Journal of Neurochemistry , 2007, 103 , 2471–2481 doi:10.1111/j.1471-4159.2007.04987.x
,
à
,
,
,
,
,
* Institute of Basic Medical Sciences, National Cheng Kung University Medical College, Tainan, Taiwan
Department of Cell Biology and Anatomy, National Cheng Kung University Medical College, Tainan, Taiwan
à Institute of Behavioral Medicine, National Cheng Kung University Medical College, Tainan, Taiwan
§ Department of Physiology, National Cheng Kung University Medical College, Tainan, Taiwan
Abstract
New neurons are continuously generated in hippocampal subgranular zone throughout life, and the amount of neurogenesis is suggested to be correlated with the hippocampusdependent function. Several extrinsic stimuli are known to modulate the neurogenesis process. Among them, physical exercise has advantageous effects on neurogenesis and brain function, while inflammation shows the opposite. Herein we showed that a moderate running exercise successfully restored the peripheral lipopolysaccharide (LPS)-impaired neurogenesis in the dentate area. LPS treatment obstructed neuronal differentiation, but not proliferation. Exercise training facilitated both the proliferation of the neural stem cells and their differentiation into neurons. Interestingly, exercise replenished the LPS-reduced levels of brain-derived neurotrophic factor and its receptor, TrkB, and rescued the LPSdisturbed performance in water maze; while the LPS-elicited up-regulation of tumor necrosis factor-alpha and interleukin-
1 b remained unaltered. In conclusion, our findings suggest that running exercise effectively ameliorates the LPS-disturbed hippocampal neurogenesis and learning and memory performance. Such advantageous effects of running exercise are not due to the alteration of inflammatory response, but possibly by the restoring the LPS-lessened brain-derived neurotrophic factor signaling pathway.
Keywords: brain-derived neurotrophic factor, exercise, inflammation, learning and memory, neurogenesis.
J. Neurochem.
(2007) 103 , 2471–2481.
New neurons are generated continually in the subgranular zone (SGZ) of mammalian hippocampal dentate gyrus throughout life (Kaplan and Hinds 1977; Gross 2000). The birth of new neurons is derived from the proliferation of neural stem/progenitor cell (Gage 2002) and instructed by signaling to differentiate into neurons (Lie et al.
2005). The newly generated neurons then migrate to the granule cell layer of dentate gyrus and integrate into the hippocampal circuitry
(Lledo et al.
2006). Although it remains debated, neurogenesis in adult hippocampus has been suggested to correlate with certain aspects of brain cognitive function, including learning and memory (Kempermann et al.
2004). Irradiation has been shown to block neurogenesis and subsequently lead to deficits in learning and memory (Madsen et al.
2003). The process of adult neurogenesis in SGZ is known to be influenced by a variety of factors, such as aging (Kuhn et al.
1996), inflammation (Ekdahl et al.
2003), stress (Karten et al.
2005), enriched environment (Kempermann et al.
1997) and physical exercise (van Praag et al.
1999).
Physical exercise is perceived to be advantageous for brain health and function. Several studies have reported that exercise improves cognitive function and delays the onset of
Alzheimer’s disease (Rovio et al.
2005). In rodents, running exercise meliorates various brain injury-induced neurological impairments and facilitates functional recovery by reducing neuronal loss (Carro
(van Praag
(van Praag et al.
et al.
et al.
been shown to enhance neurogenesis, long-term potentiation
1999), synaptic plasticity (Farmer
2004), and hippocampus-dependent learning and memory
2005). Such beneficial effects are postulated, at least in part, because of the elevated expressions of neurotrophic factors, including brain-derived neurotrophic factor (BDNF) (Adlard
2 (Gomez-Pinilla
1 (Trejo et al.
et al.
2001). Running exercise has also et al.
et al.
2005), fibroblast growth factor
1997), and insulin-like growth factor
2001). Among them, BDNF, involved in
Received March 22, 2007; revised manuscript received August 11, 2007; accepted August 14 2007.
Address correspondence and reprint requests to Yu-Min Kuo,
Department of Cell Biology and Anatomy, National Cheng Kung University Medical College, 1 Ta Hsueh Road, Tainan 70101, Taiwan.
E-mail: kuoym@mail.ncku.edu.tw
Abbreviations used : BDNF, brain-derived neurotrophic factor; BrdU, bromodeoxyuridine; DCX, doublecortin; fTrkB, full-length TrkB; GFAP, glial fibrillary acidic protein; IL-1 b , interleukin-1 b ; LPS, lipopolysaccharide; MWM, Morris water maze; SGZ, subgranular zone; TGFb , transforming growth factor-beta; TNFa , tumor necrosis factor-alpha.
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481 2471

2472 C.-W. Wu et al.
neuronal survival and differentiation (Sairanen et al.
2005), has emerged as a major regulator of synaptic plasticity (Xu et al.
2000).
The progenitor cells of dentate gyrus are sensitive to brain insults, such as hypoxia/ischemia (Jin et al.
2001), trauma
(Rice et al.
2003), and epilepsy (Parent et al.
1997). In addition to the direct lesions in CNS, peripheral inflammation has been demonstrated to disturb neurogenesis (Ekdahl et al.
2003) and cognitive function (Arai et al.
2001). Intraperitoneal administration of lipopolysaccharide (LPS), frequently used to induce systemic inflammation, not only stimulates microglia activation, but also enhances pro-inflammatory cytokines secretion in the CNS (Godbout et al.
2005;
Ke et al.
2006). Such an inflammatory cascade may be transduced from periphery to CNS via toll-like receptors or tumor necrosis factor-alpha (TNFa ) receptor pathways
(Chakravarty and Herkenham 2005). Activated microglia and several pro-inflammatory cytokines have been shown to disrupt the normal proliferation and differentiation of neural stem/progenitor cells in the hippocampus (Cacci et al.
2005).
Furthermore, hippocampus-dependent functions such as contextual fear and spatial learning and memory were impaired by the peripheral administration of LPS (Pugh et al.
1998; Arai et al.
2001; Sparkman et al.
2005).
Although exercise enhances neurogenesis and cognitive behavior, the effects of exercise on chronic inflammationinhibited neurogenesis and learning and memory remain uncertain. To answer this question, we first developed a chronic inflammation mouse model by repetitive injection of LPS systemically for a period of 3 weeks. Half of the LPS-injected mice received chronic running exercise to investigate if running exercise could mitigate the LPSinduced neuronal deficits, including hippocampal neurogenesis and learning and memory capability. As BDNF is known to modulate neurogenesis and learning and memory, the levels of BDNF and its receptor, TrkB, were also monitored.
Materials and methods
Animals
Male C57BL/6J mice obtained from Laboratory Animal Center,
National Cheng Kung University were used for all experiments.
Experimental protocols were performed according to National
Institutes of Health guidelines for animal research ( Guide for the
Care and Use of Laboratory Animal ) and approved by the National
Cheng Kung University Institutional Animal Care and Use
Committee. Mice were housed under conditions of controlled temperature (23 ± 1 C) and humidity (55 ± 5%), 12 h light/dark cycle (light cycle begins at 06:00 hours), and unrestricted access to food and water.
Treadmill running exercise
At the age of 8 weeks old, animals were subjected to 1-week familiarization to reduce handling and environment-related stimuli.
Mice were allowed to run on the motor-driven leveled treadmill
(Model T408E; Diagnostic & Research Instruments Co., Taoyuan,
Taiwan) at a speed of 9 m/min for 10 min each day for 5 days. Mice were then randomly divided into exercise and control groups. The exercise training began at the age of 9 weeks old and lasted for
5 weeks (Fig. 1). The running speed and time were set at 10 m/min,
20 min for the first day with an increment of 10 min per day until reaching 60 min/day to fulfill the intensity criteria of approximately
70% of animals’ maximal oxygen consumption (Schefer and Talan
1996). Mice of the sedentary control group were placed on the same treadmill equipment without running training for the matched period.
Repetitive LPS treatment
Animals in either sedentary or exercise group were further divided into two subgroups: the LPS-treated (LPS) and saline vehicle (Sal) groups. The LPS-treated group received intraperitoneal injections of
LPS (055 : B5; 1 mg/kg, Sigma, St Louis, MO, USA) on days 13,
20, 27, and 34 after the beginning of exercise training, while the vehicle group received saline injections (Fig. 1).
Determination of citrate synthase activity in soleus muscles
The citrate synthase activity in soleus muscles was measured using a modified method reported earlier (Srere 1969). In short, soleus muscle samples were homogenized thoroughly in five volumes of ice-cold 0.1 mol/L of Tris–HCl buffer, pH 8.3, containing 0.1%
Triton X-100, centrifuged at 14 000 g for 15 min at 4 C, and the protein concentration of the supernatant was adjusted to 1.5
l g/ l L.
Citrate synthase activity in the supernatant was measured by mixing with acetyl CoA, 5,5 ¢ -dithiobis(2-nitrobenzoic acid) and oxaloacetate as described (Srere 1969). The enzyme activity of citrate synthase was determined spectrophotometrically at 412 nm and expressed as l mole of substrate utilized per minute per milligram of protein.
Brain processing
Two days after the last LPS or saline injection, mice were deeply anesthetized by sodium pentobarbital (150 mg/kg; Sigma) and perfused with phosphate-buffered saline. Brains were removed and post-fixed in 4% paraformaldehyde for 36 h at 4 C followed by a cryoprotection with 30% sucrose solution. Brains were sliced with a freezing microtome at 30 l m. Samples were collected in cryoprotectant (30% ethylene glycol, 20% glycerol, 50 mmol/L sodium phosphate buffer, pH 7.4) and stored at
)
20 C. For biochemical analyses (RT-PCR, western blotting, and ELISA), fresh brains were removed, dissected and quickly submerged in liquid nitrogen for
10 min and then stored at
)
70 C.
RT-PCR
The RT-PCR was employed to semi-quantify the gene expression levels of interleukin-1 b (IL-1 b ), TNFa , and transforming growth factor-beta (TGFb ). Total RNA was isolated from hippocampal tissue using the TRIZOL reagent (Life Technologies, Rockville,
MD, USA) and the cDNA was synthesized by extension of random primers with MMLV reverse transcriptase (Promega, Madison, WI,
USA) in a mixture containing 2 l g of total RNA according to the manufacturer’s protocol. PCR products were separated by agarose gel electrophoresis and visualized by ethidium bromide staining.
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

Suppressive effects of peripheral LPS on hippocampal neurogenesis 2473
Fig. 1 Timeline of experimental procedure. Mice at 8 weeks of age were subjected to a 5-day 9 m/min, 10 min/day treadmill familiarization treatment. At the age of 9 weeks old, mice in the exercise group began receiving a 10 m/min exercise training started from 20 min/day at the first day and gradually increased to 60 min/day at the fifth day.
Treadmill exercise was maintained at the same duration and strength until the fifth week, when the running speed was elevated to 11 m/min.
Preliminary experiments using a pooled cDNA sample showed that
40 (IL-1
TGFb b ), 35 (TNFa
Immunohistochemistry
) and 28 cycles (TGF-
3-phosphate dehydrogenase and b b sequences and predicted sizes of PCR products.
) gave the optimal conditions (middle of log phase) for the quantification of interested gene expressions. The PCR relative intensity of IL-1 b , TNFa , and were normalized by the relative intensity of glyceraldehyde-
-actin. Table 1 listed the primer
The paraformaldehyde fixed brain section was stained by rabbit antiionized calcium-binding adapter molecule-1 (1 : 1000; Wako,
Osaka, Japan) for microglia, rabbit anti-glial fibrillary acidic protein
(GFAP) antibody (1 : 1500; Dako, Glostrup, Denmark) for astrocyte, mouse anti-bromodeoxyuridine (BrdU) antibody (1 : 250;
Amersham, Buckinghamshire, UK) for newly proliferated cell, goat anti-doublecortin (DCX) (1 : 500; Santa Cruz Biotechnology, Santa
Table 1 Sequences of oligonucleotide primer and predicted sizes of
PCR products
Gene Nucleotide sequence a
PCR product
(bp)
IL-1 b
TNF-
TGFa b
GAPDH b -actin
F: ATGGCAACTGTTCCTGAACTCAAC
R: AGGACAGGTATAGATTCTTTCCTTT
F: GGCAGGTCTACTTTGGAGTCATTGC
R: ACATTCGAGGCTCCAGTGAATTC
F: CAAGTGTGGAGCAACATGTG
R: CACAGCAGTTCTTCTCTGTG
F: GTTTGTGATGGGTGTGAACC
R: CTCTTGCTCAGTGTCCTTGC
F: GGAAATCGTGCGTGAC
R: GCTCGTTGCCAATAGTG
540
308
399
662
143 a
F, forward primer; R, reverse primer.
IL-1 b , interleukin-1 b ; TNFa , tumor necrosis factor-alpha; TGFb , transforming growth factor-beta.
Meanwhile, during the fifth week, all mice received a daily intraperitoneal bromodeoxyuridine (BrdU) (50 mg/kg/day) injection. Half of the mice received lipopolysaccharide (LPS) (1 mg/kg) injections on the sixth day of weeks 2, 3, 4, and 5. For cytokine analyses, mice were killed 6 h after the last LPS or saline injection. For other analyses, mice were killed 2 days after the last injection.
Cruz, CA, USA) for immature neurons. Brain specimens were incubated with appropriate peroxidase-conjugated secondary antibody (Vector, Burlingame, CA, USA) and an avidin–biotin peroxidase (Vector) using 3,3 ¢ -diaminobenzidine as the substrate.
For immunofluorescence double labeling, free-floating tissues were immunostained with primary antibody and incubated with the Alexa
Flour 488 anti-goat (1 : 1000; Molecular Probes, Eugene, OR,
USA) and Texas Red-conjugated anti-mouse (1 : 1000; Vector) secondary antibodies for 2 h at 25 ± 1 C. Coverslips were mounted in 2.6% DABCO (Sigma) in 90% glycerol/10% phosphate-buffered saline and imaged with a Nikon confocal fluorescent microscope.
Proliferated cell labeling
To label dividing cell, BrdU (Sigma) was injected (50 mg/kg/day, i.p.) to mice in the last 5 days of exercise training (Fig. 1).
Paraformaldehyde-fixed sections (30 l m) were pretreated in 2 N
HCl at 37 C for 30 min to denature the DNA. The sections were then incubated in 100 mmol/L sodium borate, pH 8.5, for 5 min to neutralize residual acid. BrdU positive cells were labeled by immunohistochemical method as aforementioned.
Stereology
A modified unbiased stereology protocol was used to quantify labeling cells (West et al.
1991). The entire hippocampal dentate area was cut into an average of 93 coronal sections with a thickness of 30 l m. The numbers of BrdU/DCX-, BrdU-, and DCX-positive cells were counted in every sixth section (15 of 93 sections). Positive cells were counted through 40X objective under a Nikon microscope. The total number of labeled cells per section was determined and divided by the slide selection ratio (i.e. 15/93) to obtain the total number of labeled cells per dentate gyrus. The average cell count numbers for BrdU/DCX-, BrdU-, and DCX-positive cells of the sedentary control group were 3996 for BrdU/DCX-, 11450 for
BrdU-, and 33806 for DCX-positive cells, respectively.
Immunoblotting assay
Immunoblotting was used to determine interested protein expressions in hippocampus. Supernatant samples from each group,
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

2474 C.-W. Wu et al.
containing equivalent total protein concentration, were mixed with sample buffer (Invitrogen, Carlsbad, CA, USA), heated to 70 C for
10 min in the presence of dithiothreitol, and separated on a 4–12%
Nu-PAGE gel (Invitrogen). The electrophoretically separated proteins were transferred onto polyvinylidene difluoride membranes
(Bio-Rad, Hercules, CA, USA), blocked with 5% non-fat milk in
20 mmol/L Tris buffer, pH 7.5, containing 0.5 mol/L NaCl, and
0.5% Tween-20. The membrane blots were probed with respective primary antibodies against GFAP (1 : 10 000; Dako) or TrkB
(1 : 5000; Santa Cruz Biotechnology). The later antibody (H-181: sc-8316; Santa Cruz Biotechnology) is capable of detecting both full-length (145 kDa) and truncated (95 kDa) forms of TrkB.
Control for protein loading was performed by staining membranes with a monoclonal antib -actin antibody (1 : 10 000; Chemicon,
Temecula, CA, USA). Membranes were then incubated with appropriate secondary antibodies (1 : 10 000), followed by chemiluminescence detection (PerkinElmer, Boston, MA, USA), and the band densities were analyzed with an image analysis system
(BioChemi imaging system; UVP, Upland, CA, USA).
ELISA for BDNF quantification
A commercial sandwich ELISA kit (Promega) was used to quantify the levels of BDNF in the brain homogenates. Hippocampal tissue was homogenized in a Dounce homogenizer (1 mm clearance), centrifuged at 15 000 g for 15 min, and the supernatant was collected. The protein concentration of the supernatant was determined using the MicroBCA kit (Pierce, Rockford, IL, USA) and adjusted to 0.5 mg/mL before applied to the microtiter plates.
The plate was read in an ELISA-spectrophotometer reader with the absorbance wavelength of 405 nm. Standard curves were obtained from values generated from known concentrations of BDNF provided by the kits.
Morris water maze
The Morris water maze (MWM) was performed in a custom-made circular pool with a diameter of 110 cm and a wall height of 60 cm, which was filled with clear tap water at a temperature of 25 ± 2 C and depth of 32 cm. The circular escape platform made of transparent Plexiglas (diameter 10 cm) was submerged 0.5 cm below the surface of the water. During all trials of spatial navigation, the location of the hidden platform was kept constant.
Animals were given a two-session training (07 00–10 00 and
19 00–22 00 hours) per day for 2 days. Each session consisted of four swim trials (120 s per trial) with different quadrant starting positions for each trial. The 2-day training was followed by a probe test 1 h after the last training session. During the probe test, animals were placed in the pool in the southwest position, the longest distance from the previous platform position (northeast), and the mice were allowed to swim for 60 s without platform present. The whole process was recorded by a charge coupled device camera and the escape latency (i.e. time to reach the platform, in seconds), path length and swim speed (cm/s) were analyzed by EthoVision video tracking system (Noldus Information Technology, Wageningen,
Netherlands).
Statistical analysis
A total of 56 mice was randomly allocated to each of the four treatment combinations ( n = 14 in each group) formed by the two
(a)
(b)
Fig. 2 Treadmill exercise counteracted the peripheral lipopolysaccharide (LPS)-inhibited adult hippocampal neurogenesis. (a) Confocal micrographs demonstrated the double labeling of bromodeoxyuridine
(BrdU) (red) and immature neuronal marker doublecortin (DCX)
(green) in the hippocampal dentate area. Scale bar, 30 l m. (b) Hippocampal neurogenesis is presented as the numbers of BrdU/DCX double positive cells in the dentate region and the sedentary control as
100% (see Materials and methods). Two-way
ANOVA revealed that there was a significant effect of running exercise ( F = 17.3, d.f. 1/24, p < 0.001) and LPS ( F = 16.6, d.f. 1/24, p < 0.001) on BrdU/DCX double positive cell count but no interaction between these two factors
( F = 1.2, d.f. 1/24, p = 0.28). Sed-Sal: sedentary animals treated with saline; Sed-LPS: sedentary animals receive repetitive LPS injections;
Ex-Sal: mice receive treadmill running exercise and saline injections;
Ex-LPS: mice receive treadmill running exercise and LPS injections.
factors, running exercise and repeated LPS treatment, unless specified otherwise. Half of the animals (seven in each group) were assigned to MWM test and the other half for biochemical and immunological analyses. Data are presented as mean ± standard error. Two-tailed Student’s t -test was applied when variable means were compared between the control and exercise groups. To determine whether running exercise prevented LPS-induced effects
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

(a)
Suppressive effects of peripheral LPS on hippocampal neurogenesis 2475
(a)
(b)
(b)
Fig. 3 Treadmill exercise increased the mitotic cell populations in the hippocampal dentate region. (a) Immunostaining of bromodeoxyuridine (BrdU)-labeled cells (black) which were counter-stained with neutral red. (b) Hippocampal total mitotic cell count is presented as the numbers of BrdU-positive cells in the dentate area and the sedentary control as 100% (see Materials and methods). Running exercise
( F = 10.3, d.f. 1/24, p < 0.005) but not lipopolysaccharide (LPS)
( F = 1.5, d.f. 1/24, p = 0.23) was a significant factor in number of mitotic cell measures with no exercise · LPS interaction ( F = 1.4, d.f.
1/24, p = 0.25). Group abbreviations: same as in Fig 2.
Fig. 4 Treadmill exercise restored the peripheral lipopolysaccharide
(LPS)-reduced neuronal progenitor cells in the dentate gyrus. (a) Immunostaining of immature neuron with neuronal progenitor markerdoublecortin (DCX). (b) Hippocampal neuronal progenitor cell count is presented as the numbers of DCX-positive cells in the dentate area and the sedentary control as 100% (see Materials and methods).
There was a significant effect of running exercise ( F = 161.6, d.f. 1/24, p < 0.0001) and LPS ( F = 12.4, d.f. 1/24, p = 0.002) on the number of neuronal progenitor cells. A significant interaction between running exercise and LPS ( F = 4.3, d.f. 1/24, p = 0.048) was revealed by twoway
ANOVA
. Group abbreviations: same as in Fig 2.
on neurogenesis, inflammation, gliosis, memory performance in water maze, and BDNF signaling, two-way
ANOVA s were used to analyze the two main effects and possible interaction. Newman–
Keuls post hoc tests were performed if significant ( p < 0.05) main effects or interactions were found. The MWM training results were analyzed by a mixed-model
ANOVA with training session as withinsubject factor and the two main effects as between subject factor.
One-way
ANOVA was used to analyze the time effect on BDNF expressions, followed by post hoc Newman–Keuls multiple comparison if appropriate ( p < 0.05).
Results
Citrate synthase activity was elevated after running exercise
An elevation of citrate synthase activity is commonly used to confirm the exercise training effect. The enzyme activity of citrate synthase in soleus muscle was significantly increased in the 5-week treadmill exercise group (sedentary control:
1.73 ± 0.25; exercise: 1.99 ± 0.40
l mole/min/mg protein; p < 0.05), indicating the effectiveness of the exercise training.
Exercise restored peripheral LPS-inhibited hippocampal neurogenesis
Hippocampal neurogenesis is presented as the numbers of
BrdU (mitotic cell marker) and DCX (neuronal progenitor marker) double positive cell counts in the dentate region
(Fig. 2a). Repetitive peritoneal LPS treatment significantly decreased the BrdU/DCX double positive cell numbers;
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

2476 C.-W. Wu et al.
(a)
(b)
Fig. 5 Treadmill exercise did not alter the peripheral lipopolysaccharide (LPS)-stimulated hippocampal cytokine expressions. (a) Representative examples of interleukin-1 b (IL-1 b ), tumor necrosis factor-alpha (TNFa ), transforming growth factor-beta (TGFb ), and
GAPDH RT-PCR results of the hippocampal specimens. (b) Relative expression levels of TNFa mRNA. LPS ( F = 13.5, d.f. 1/16, p < 0.005) but not running exercise ( F = 0.2, d.f. 1/16, p > 0.5) was a significant factor in the stimulation of TNFa mRNA expression with no exercise · LPS interaction ( F = 0.1, d.f. 1/16, p > 0.5). (c) Relative expression levels of IL-1 b mRNA. A significant LPS effect ( F = 34.5, d.f. 1/16, p < 0.0001) on the stimulation of IL-1 b mRNA expression was noticed. Running exercise ( F = 0.3, d.f. 1/16, p > 0.5) did not alter the expression of IL-1 b mRNA. (d) Relative expression levels of TGFb mRNA. Neither LPS ( F = 0.1, d.f. 1/16, p > 0.5) nor running exercise
( F = 0.1, d.f. 1/16, p > 0.5) was a significant factor in the stimulation of
TGFb mRNA expression.
n = 4 in each treatment group. Group abbreviations: same as in Fig. 2.
(c)
(d) while 5 weeks of treadmill running exercise effectively promoted neurogenesis (Fig. 2b). Furthermore, the LPSreduced neurogenesis was replenished by treadmill exercise
(Fig. 2b), although the interaction between running exercise and LPS effects did not reach significant levels
(Fig. 2b).
In adult brain, multipotent stem cells give rise to neural progenitors which differentiate into either neuronal or glial progenitors (Gage 2000). Both multipotent stem cells and neural progenitors possess self-renewal capability. To characterize the effects of LPS and running exercise on stem/ neural progenitor cell proliferation and differentiation, the mitotic (BrdU positive) and neuronal progenitor (DCX positive) cell numbers in the dentate area in these animals were analyzed (Fig. 3a and 4a). Our results revealed that LPS treatment did not alter the total mitotic (BrdU positive) cell number in the dentate area, whereas running exercise enhanced the proliferation rate (Fig. 3b). Furthermore, repetitive LPS treatment decreased the DCX positive cell count (Fig. 4b), suggesting that inflammation disturbed the neuronal progenitor differentiation pathway. Running exercise, on the contrary, dramatically enhanced the neuronal progenitor (DCX positive) differentiation process, regardless of LPS treatment (Fig. 4b).
Exercise did not reduce peripheral LPS-induced inflammation in the hippocampus
We then evaluated if exercise modulated the systemic LPSelicited CNS inflammation by measuring the cytokine expression levels in hippocampal specimens. Mice received
LPS injections exhibited higher levels of TNFa and IL-1 b than those of the saline control group, while the mRNA level of the anti-inflammatory cytokine TGFb was unaltered
(Fig. 5). Further, a slight but statistically insignificant elevation of IL-1 b and TNFa levels in hippocampus was evident after 5 weeks of running exercise (Fig. 5b and c).
However, the LPS-stimulated up-regulation of TNFa and
IL-1 b in the hippocampus was not influenced by running exercise (Fig. 5).
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

(a)
Suppressive effects of peripheral LPS on hippocampal neurogenesis 2477
(c)
(b) (d)
Fig. 6 Treadmill exercise did not change lipopolysaccharide (LPS)induced glial responses in dentate gyrus. (a) The immunohistochemical stain for astrocyte with anti-glial fibrillary acidic protein GFAP antibody. (b) Relative expression levels of GFAP protein. LPS
( F = 5.4, d.f. 1/24, p < 0.05) but not running exercise ( F = 0.6, d.f.
1/24, p = 0.43) showed a significant effect on enhancing the expression of GFAP with no LPS · exercise interaction ( F = 0.4, d.f. 1/24, p > 0.5). (c) The immunohistochemical stain for microglia using anti-
Iba 1 antibody. (d) Hippocampal microglia cell count is presented as the numbers of Iba 1-positive cells in the dentate area and the sedentary control as 100%. LPS ( F = 23.1, d.f. 1/24, p < 0.001) but not running exercise ( F = 2.1, d.f. 1/24, p = 0.15) was a significant factor in increasing microglia cell number in dentate gyrus with no
LPS · exercise interaction ( F = 1.0, d.f. 1/24, p = 0.33). Group abbreviations: same as in Fig 2.
In terms of glia cells, repetitive peripheral LPS injection induced astrocyte and microglia activation in the hippocampal formation. The GFAP-labeled astrocyte number
(Fig. 6a) and the expression of GFAP protein (Fig. 6b) were enhanced by the LPS treatment. Exercise slightly enhanced the expression of GFAP; however, such change was not significant (Fig. 6b). Exercise did not alter the LPS-induced hippocampal gliosis (Fig. 6b). Repetitive LPS injections also led to microglia activation (Fig. 6c). The number of ionized calcium-binding adapter molecule-1 positive cells in the dentate gyrus was increased by the peripheral LPS treatment (Fig. 6d). Running exercise did not show significant change in microglia morphology or density (Fig. 6d).
The LPS-elicited microglia activation and augmented population were unaffected by the exercise (Fig. 6d). Taken together, these results indicated that repetitive peripheral
LPS injections effectively elicited inflammatory responses in the hippocampal formation. Five weeks of running exercise did not alter the peripheral LPS-stimulated CNS inflammatory responses.
Exercise restored the peripheral LPS-hampered learning and memory
The effect of peripheral LPS-induced CNS inflammation on hippocampal-dependent spatial learning and memory was tested using MWM. Our results showed that the LPS-treated mice, both sedentary and exercise groups, performed slightly worse than the saline group in the four training sessions
(Fig. 7a). In probe tests, repetitive LPS-treated group spent less time than the saline control group in the target quadrant
(Fig. 7b). In contrast, the motor activity as indicated by the swimming speeds in these two groups was similar
(Fig. 7c).These results indicated that LPS-induced inflammation impaired spatial learning and memory ability. Mice that received 5 weeks of running exercise restored the peripheral
LPS-hampered learning and memory (Fig. 7a and b).
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

2478 C.-W. Wu et al.
Exercise up-regulated BDNF and TrkB expression
Numerous evidence indicate that BDNF and its related signaling pathways are involved in neuronal survival, synaptic plasticity and hippocampus-dependent learning and memory (Lowenstein and Arsenault 1996; Xu et al.
2000; Mizuno et al.
2003; Sairanen et al.
2005). Previously, we have shown that compulsive exercise transiently enhance the expression levels of BDNF mRNA and protein in hippocampus of the rat (Huang et al.
2006). To examine the effect of treadmill exercise on the expression profile of hippocampal BDNF, mice that received 5 weeks of exercise were killed at different time points and their hippocampi were subjected to BDNF quantification. Our results showed that running exercise increased the hippocampal BDNF levels which peaked at about 1 h after the exercise (Fig 8a).
Two days after the treadmill running, the expressions of
BDNF were comparable between sedentary control and exercise groups (Fig. 8b). Repetitive peripheral LPS injections extensively reduced the expression of BDNF in the hippocampus (Fig. 8b). Such decline was completely prevented by the running exercise (Fig. 8b). Furthermore, a slight decrease in the BDNF receptor, full-length TrkB
(fTrkB), was noticed in the LPS-treated group (Fig. 8c).
Running exercise augmented the expression level of fTrkB, even in the presence of peripheral LPS treatment (Fig. 8c).
The expression levels of truncated TrkB, a dominant negative inhibitor of BDNF signaling, were similar among the four groups regardless of the exercise training or LPS challenge
(Fig. 8d).
Discussion
Our results show that compulsive running exercise restores peripheral repetitive inflammation-dampened hippocampal neurogenesis and spatial learning and memory ability. Such beneficial effects of running exercise are not because of modulating the LPS-elicited inflammatory responses. LPS treatment inhibits the neuronal differentiation pathway, but not the proliferation of multipotent and neural stem cells. On the contrary, exercise promotes both the proliferation and differentiation of the neural stem cells toward neuronal progenitors. Such advantageous effects of running exercise against LPS-induced injuries may be mediated by the upregulation of BDNF signaling pathway.
Peripheral administration of LPS is known to induce systemic inflammatory responses, including the elevated expression of cytokines and chemokines (Erridge et al.
2002). Subsequent examination of the LPS-treated animals revealed a transmission of inflammatory responses from the periphery to CNS. Several potential pathways have been put forward for such transmission. LPS has been shown to bind to Toll-like receptor 4 on endothelial cells, which in turn triggers a cascade of signaling pathway leading to the activation of nuclear factor-kappa B and several cytokine
Fig. 7 Treadmill exercise restored the peripheral lipopolysaccharide
(LPS)-dampened performances in Morris water maze. (a) Latency of training sessions. LPS-treated mice (sedentary: Sed-LPS; exercise:
Ex-LPS) took longer time to find the platform than the saline control groups (sedentary: Sed-Sal; exercise: Ex-Sal) (Mixed model
ANOVA
:
F = 2.5, d.f. 3/24, p = 0.08). (b) Probe test in water maze. LPS showed a significant reduction on staying in the target quadrant
( F = 5.3, d.f. 1/28, p < 0.05). Note that the LPS-dampened memory performance was partially recovered by treadmill exercise. (c) Swimming speeds were comparable among four groups ( p > 0.5). Group abbreviations: same as in Fig. 2.
genes (Rivest 2003). Furthermore, a recent finding suggested the important role of TNF a /TNF a receptors in the transferring of inflammation from the periphery to the brain (Qin
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

Suppressive effects of peripheral LPS on hippocampal neurogenesis 2479
Fig. 8 Effects of lipopolysaccharide (LPS) and treadmill exercise on hippocampal brain-derived neurotrophic factor (BDNF) and TrkB expression. (a) BDNF protein expression patterns after 5-week treadmill exercise. The level of BDNF at 1 h after running was significant higher than the other time points ( F = 3.9, d.f. 4/25, p < 0.05).
n = 5 for each time point. (b) Effects of LPS and exercise on BDNF expressions. Peripheral LPS administration ( F = 6.6, d.f. 1/24, p < 0.05) but not running exercise ( F = 3.9, d.f. 1/24, p = 0.06) was a significant factor in the alteration of hippocampal BDNF levels.
A significant LPS · running exercise interaction ( F = 4.4, d.f. 1/24, p < 0.05) was also observed. (c) Effects of LPS and exercise on the expression of full-length TrkB. Running exercise ( F = 28.3, d.f. 1/24, p < 0.001) but not LPS ( F = 0.7, d.f. 1/24, p = 0.40) was a significant factor in the levels of full-length TrkB with no exercise · LPS interaction ( F = 0.1, d.f. 1/24, p > 0.5). (d) Effects of LPS and exercise on the expression of truncated TrkB. Neither LPS ( F = 0.1, d.f. 1/24, p > 0.5) nor running exercise ( F = 1.0, d.f. 1/24, p = 0.31) was a factor in the expression levels of truncated TrkB.
et al.
2007). In this study, we adopted the peripheral LPSinduced CNS inflammation paradigm and expanded to multiple LPS injections to study the effects of chronic inflammation in the periphery on hippocampal neurogenesis and learning and memory ability. Our results showed that repetitive peripheral LPS treatments induced CNS inflammation, including glia cell activation and up-regulation of pro-inflammatory cytokines, in agreement with previous findings (Ekdahl et al.
2003; Monje et al.
2003). Such treatments perturbed hippocampal neurogenesis and performance in the MWM task, confirming earlier studies (Pugh et al.
1998; Arai et al.
2001; Sparkman et al.
2005). In LPStreated mice, their poor performance in water maze was not because of the LPS-elicited fever or immobility, as the swimming task was conducted 2 days after the last LPS injection and the swimming speeds were comparable among the four groups. Significantly, reductions of hippocampal
BDNF and fTrkB expression levels were evident in the repetitive LPS-treated animals. These results suggested that chronic inflammation in the periphery could impede normal brain functions by reducing the levels of neurotrophic factors in CNS.
Adult hippocampal neurogenesis is known to be modulated by several pathological and physiological events.
However, the underlying mechanism remains unclear. Several inflammation-induced cytokines have been shown to influence the process of adult neurogenesis (Battista et al.
2006; Kaneko et al.
2006; Wachs et al.
2006). For instance, transgenically directed production of IL-6 by astroglia decreases neurogenesis in the hippocampal SGZ of young adult mice (Vallieres et al.
2002; Monje et al.
2003). In addition, IL-6 reduces neuronal differentiation rather than the proliferation or death of neural progenitor or immature neurons (Monje et al.
2003). Furthermore, interferona suppresses neurogenesis by IL-1 production in adult rat dentate gyrus (Kaneko et al.
2006). TGFb specifically
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

2480 C.-W. Wu et al.
arrests neural stem and progenitor cells in the G0/1 phase of the cell cycle, but it does not affect the self-renewal capacity and the differentiation fate of these cells (Wachs et al.
2006).
In this study, we showed that repetitive peripheral administration of LPS-elevated CNS TNFa and IL-1 b expression and decreased the numbers of neuronal progenitor (DCX positive) and BrdU/DCX double positive cells in adult hippocampus. Several possibilities can attribute to the LPSinduced reduction of DCX-positive cells. For example, peripheral LPS-induced CNS inflammation inhibits the differentiation of neural progenitor to DCX-positive neuron.
It is also possible that LPS itself and LPS-elicited inflammatory responses alter the expression of DCX and/or the lifespan of the DCX-positive neuron. Furthermore, while the number of neuronal progenitor (DCX positive) was reduced, the LPS treatment did not alter the total BrdU-positive cell number. As the GFAP-positive cell were augmented by LPS, these results indicate that the peripheral LPS-induced CNS inflammation favored the glial lineage rather than the neuronal lineage differentiation pathway.
Among the non-pharmacological interventions, physical exercise is recognized to have many beneficial effects on brain health and function, such as lessening trauma-induced neurological impairments(Carro et al.
2001), increasing neurogenesis, and enhancing long-term potentiation and learning and memory (van Praag et al.
1999), just to name a few . Therefore, we hypothesized that physical exercise could meliorate the peripheral LPS-induced CNS injuries. To better control the exercise intensity and duration, we chose compulsive treadmill running instead of voluntary wheel running for better regulations of the duration and strength of exercise. Our results revealed that treadmill running exercise enhanced the neurogenesis and increased the expression of
BDNF and its receptor, fTrkB, in hippocampus. Importantly, running exercise successfully restored the LPS-dampened neurogenesis and learning and memory ability. Furthermore, the chronic inflammation-reduced hippocampal BDNF and fTrkB expression levels were replenished by the running exercise, suggesting that LPS-elicited CNS damages could be restored by running exercise. Taken together, running exercise not only stimulates brain cells releasing more trophic factors and neurogenesis to maintain healthier brain function, but also protects against brain insults or reverses the injury consequences.
Numerous studies have indicated the intimate association of BDNF in the regulation of survival and differentiation of neural/neuronal progenitors (Lowenstein and Arsenault
1996; Sairanen et al.
2005). BDNF signaling pathway, including the expression level of TrkB, has been shown to modulate cell survival (Sairanen et al.
2005). In this study, the hippocampal protein levels of BDNF were reduced by the peripheral LPS treatment and increased by running exercise. The LPS-stimulated IL-1 b may be involved in the synthesis of BDNF. Lapchak et al.
(1993) have showed that intraperitoneal administration of IL-1 b reduces hippocampal
BDNF mRNA expression in rats. Our results indicated that running exercise replenished the LPS-lowered BDNF but did not alter the IL-1 b expression level. These findings suggest that exercise regulated BDNF expression pathway is independent of the LPS–IL-1 b mediated mechanism.
Nonetheless, the LPS-dampened BDNF and TrkB expressions provide an explanation for the perturbed differentiation of neuronal progenitor in these mice. Thus the findings that running exercise attenuated the LPS-disturbed neuronal differentiation was likely because of the restored BDNF level and enhanced TrkB expression by exercise. However, the exact mechanism by which exercise up-regulates the
BDNF pathway in the brain remains to be clarified.
Acknowledgements
This work was supported by National Science council (95-2320-B-
006-044-MY3) of Taiwan.
References
Adlard P. A., Perreau V. M. and Cotman C. W. (2005) The exerciseinduced expression of BDNF within the hippocampus varies across life-span.
Neurobiol. Aging 26 , 511–520.
Arai K., Matsuki N., Ikegaya Y. and Nishiyama N. (2001) Deterioration of spatial learning performances in lipopolysaccharide-treated mice.
Jpn. J. Pharmacol.
87 , 195–201.
Battista D., Ferrari C. C., Gage F. H. and Pitossi F. J. (2006) Neurogenic niche modulation by activated microglia: transforming growth factor beta increases neurogenesis in the adult dentate gyrus.
Eur. J.
Neurosci.
23 , 83–93.
Cacci E., Claasen J. H. and Kokaia Z. (2005) Microglia-derived tumor necrosis factor-alpha exaggerates death of newborn hippocampal progenitor cells in vitro.
J. Neurosci. Res.
80 , 789–797.
Carro E., Trejo J. L., Busiguina S. and Torres-Aleman I. (2001) Circulating insulin-like growth factor I mediates the protective effects of physical exercise against brain insults of different etiology and anatomy.
J. Neurosci.
21 , 5678–5684.
Chakravarty S. and Herkenham M. (2005) Toll-like receptor 4 on nonhematopoietic cells sustains CNS inflammation during endotoxemia, independent of systemic cytokines.
J. Neurosci.
25 ,
1788–1796.
Ekdahl C. T., Claasen J. H., Bonde S., Kokaia Z. and Lindvall O. (2003)
Inflammation is detrimental for neurogenesis in adult brain.
Proc.
Natl Acad. Sci. USA 100 , 13632–13637.
Erridge C., Bennett-Guerrero E. and Poxton I. R. (2002) Structure and function of lipopolysaccharides.
Microbes Infect.
4 , 837–851.
Farmer J., Zhao X., van Praag H., Wodtke K., Gage F. H. and Christie B.
R. (2004) Effects of voluntary exercise on synaptic plasticity and gene expression in the dentate gyrus of adult male Sprague–
Dawley rats in vivo.
Neuroscience 124 , 71–79.
Gage F. H. (2000) Mammalian neural stem cells.
Science 287 ,
1433–1438.
Gage F. H. (2002) Neurogenesis in the adult brain.
J. Neurosci.
22 ,
612–613.
Godbout J. P., Chen J., Abraham J., Richwine A. F., Berg B. M., Kelley
K. W. and Johnson R. W. (2005) Exaggerated neuroinflammation and sickness behavior in aged mice following activation of the peripheral innate immune system.
FASEB J.
19 , 1329–1331.
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481

Suppressive effects of peripheral LPS on hippocampal neurogenesis 2481
Gomez-Pinilla F., Dao L. and So V. (1997) Physical exercise induces
FGF-2 and its mRNA in the hippocampus.
Brain Res.
764 , 1–8.
Gross C. G. (2000) Neurogenesis in the adult brain: death of a dogma.
Nat. Rev. Neurosci.
1 , 67–73.
Huang A. M., Jen C. J., Chen H. F., Yu L., Kuo Y. M. and Chen H. I.
(2006) Compulsive exercise acutely upregulates rat hippocampal brain-derived neurotrophic factor.
J. Neural. Transm.
113 ,
803–811.
Jin K., Minami M., Lan J. Q., Mao X. O., Batteur S., Simon R. P. and
Greenberg D. A. (2001) Neurogenesis in dentate subgranular zone and rostral subventricular zone after focal cerebral ischemia in the rat.
Proc. Natl Acad. Sci. USA 98 , 4710–4715.
Kaneko N., Kudo K., Mabuchi T., Takemoto K., Fujimaki K., Wati H.,
Iguchi H., Tezuka H. and Kanba S. (2006) Suppression of Cell
Proliferation by Interferon-Alpha through Interleukin-1 Production in Adult Rat Dentate Gyrus.
Neuropsychopharmacology 31 , 2619–
2626.
Kaplan M. S. and Hinds J. W. (1977) Neurogenesis in the adult rat: electron microscopic analysis of light radioautographs.
Science
197 , 1092–1094.
Karten Y. J., Olariu A. and Cameron H. A. (2005) Stress in early life inhibits neurogenesis in adulthood.
Trends Neurosci.
28 , 171–172.
Ke Z. J., Bowen W. M. and Gibson G. E. (2006) Peripheral inflammatory mechanisms modulate microglial activation in response to mild impairment of oxidative metabolism.
Neurochem. Int.
49 ,
548–556.
Kempermann G., Kuhn H. G. and Gage F. H. (1997) More hippocampal neurons in adult mice living in an enriched environment.
Nature
386 , 493–495.
Kempermann G., Wiskott L. and Gage F. H. (2004) Functional significance of adult neurogenesis.
Curr. Opin. Neurobiol.
14 , 186–191.
Kuhn H. G., Dickinson-Anson H. and Gage F. H. (1996) Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation.
J. Neurosci.
16 , 2027–2033.
Lapchak P. A., Araujo D. M. and Hefti F. (1993) Systemic interleukin-1 beta decreases brain-derived neurotrophic factor messenger RNA expression in the rat hippocampal formation.
Neuroscience 53 ,
297–301.
Lie D. C., Colamarino S. A., Song H. J.
et al.
(2005) Wnt signalling regulates adult hippocampal neurogenesis.
Nature 437 ,
1370–1375.
Lledo P. M., Alonso M. and Grubb M. S. (2006) Adult neurogenesis and functional plasticity in neuronal circuits.
Nat. Rev. Neurosci.
7 ,
179–193.
Lowenstein D. H. and Arsenault L. (1996) The effects of growth factors on the survival and differentiation of cultured dentate gyrus neurons.
J. Neurosci.
16 , 1759–1769.
Madsen T. M., Kristjansen P. E., Bolwig T. G. and Wortwein G. (2003)
Arrested neuronal proliferation and impaired hippocampal function following fractionated brain irradiation in the adult rat.
Neuroscience 119 , 635–642.
Mizuno M., Yamada K., He J., Nakajima A. and Nabeshima T. (2003)
Involvement of BDNF receptor TrkB in spatial memory formation.
Learn. Mem.
10 , 108–115.
Monje M. L., Toda H. and Palmer T. D. (2003) Inflammatory blockade restores adult hippocampal neurogenesis.
Science 302 , 1760–1765.
Parent J. M., Yu T. W., Leibowitz R. T., Geschwind D. H., Sloviter R. S.
and Lowenstein D. H. (1997) Dentate granule cell neurogenesis is increased by seizures and contributes to aberrant network reorganization in the adult rat hippocampus.
J. Neurosci.
17 , 3727–3738.
van Praag H., Christie B. R., Sejnowski T. J. and Gage F. H. (1999)
Running enhances neurogenesis, learning, and long-term potentiation in mice.
Proc. Natl Acad. Sci. USA 96 , 13427–13431.
van Praag H., Shubert T., Zhao C. and Gage F. H. (2005) Exercise enhances learning and hippocampal neurogenesis in aged mice.
J. Neurosci.
25 , 8680–8685.
Pugh C. R., Kumagawa K., Fleshner M., Watkins L. R., Maier S. F. and
Rudy J. W. (1998) Selective effects of peripheral lipopolysaccharide administration on contextual and auditory-cue fear conditioning.
Brain Behav. Immun.
12 , 212–229.
Qin L., Wu X., Block M. L., Liu Y., Breese G. R., Hong J. S., Knapp D.
J. and Crews F. T. (2007) Systemic LPS causes chronic neuroinflammation and progressive neurodegeneration.
Glia 55 , 453–462.
Rice A. C., Khaldi A., Harvey H. B., Salman N. J., White F., Fillmore H.
and Bullock M. R. (2003) Proliferation and neuronal differentiation of mitotically active cells following traumatic brain injury.
Exp.
Neurol.
183 , 406–417.
Rivest S. (2003) Molecular insights on the cerebral innate immune system.
Brain Behav. Immun.
17 , 13–19.
Rovio S., Kareholt I., Helkala E. L., Viitanen M., Winblad B., Tuomilehto J., Soininen H., Nissinen A. and Kivipelto M. (2005)
Leisure-time physical activity at midlife and the risk of dementia and Alzheimer’s disease.
Lancet Neurol.
4 , 705–711.
Sairanen M., Lucas G., Ernfors P., Castren M. and Castren E. (2005) Brainderived neurotrophic factor and antidepressant drugs have different but coordinated effects on neuronal turnover, proliferation, and survival in the adult dentate gyrus.
J. Neurosci.
25 , 1089–1094.
Schefer V. and Talan M. I. (1996) Oxygen consumption in adult and
AGED C57BL/6J mice during acute treadmill exercise of different intensity.
Exp. Gerontol.
31 , 387–392.
Sparkman N. L., Kohman R. A., Garcia A. K. and Boehm G. W. (2005)
Peripheral lipopolysaccharide administration impairs two-way active avoidance conditioning in C57BL/6J mice.
Physiol. Behav.
85 , 278–288.
Srere P. A. (1969) Citrate synthase.
Methods Enzymol.
13 , 3–5.
Trejo J. L., Carro E. and Torres-Aleman I. (2001) Circulating insulin-like growth factor I mediates exercise-induced increases in the number of new neurons in the adult hippocampus.
J. Neurosci.
21 , 1628–
1634.
Vallieres L., Campbell I. L., Gage F. H. and Sawchenko P. E. (2002)
Reduced hippocampal neurogenesis in adult transgenic mice with chronic astrocytic production of interleukin-6.
J. Neurosci.
22 ,
486–492.
Wachs F. P., Winner B., Couillard-Despres S., Schiller T., Aigner R.,
Winkler J., Bogdahn U. and Aigner L. (2006) Transforming growth factor-beta1 is a negative modulator of adult neurogenesis.
J. Neuropathol. Exp. Neurol.
65 , 358–370.
West M. J., Slomianka L. and Gundersen H. J. (1991) Unbiased stereological estimation of the total number of neurons in thesubdivisions of the rat hippocampus using the optical fractionator.
Anat.
Rec.
231 , 482–497.
Xu B., Gottschalk W., Chow A., Wilson R. I., Schnell E., Zang K., Wang
D., Nicoll R. A., Lu B. and Reichardt L. F. (2000) The role of brain-derived neurotrophic factor receptors in the mature hippocampus: modulation of long-term potentiation through a presynaptic mechanism involving TrkB.
J. Neurosci.
20 , 6888–6897.
2007 The Authors
Journal Compilation 2007 International Society for Neurochemistry, J. Neurochem.
(2007) 103 , 2471–2481