Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
INDEX
Primary Anti-Tuberculous Drugs Resistance of Pulmonary Tuberculosis in
Southwestern Saudi Arabia
Ahmed M. Asaad and Jobran M. Alqahtani
Serological and Molecular Diagnosis of Human Brucellosis in Najran,
Southwestern Saudi Arabia
Ahmed M. Asaad and Jobran M. Alqahtani
EXPRESSION OF CD69 ON PLATELETS OF PATIENTS WITH Systemic
Lupus Erythematosus AND Cardiovascular Disease
Sabah I. Abd Elreheem, Nivin Ghoraba*, Lamyaa Ismaiel Ahmad
The Role of Ica Operon and Biofilm Formation in Coagulase Negative
Staphylococcal Infection
Ashwak M.F. Abu Taleb, Mervat S. Mohamed, Randa S. Abdel-Latif and Manar
Gouda
Detection of Gram Negative Bacilli and Endotoxin in Water and Dialysate of
Haemodialysis Unit in a University Hospital
Ensaf A Azzazy; Nana A-E Mohammed; Mervat S. Mohammed and Rehab M. E.
Tash
Evaluation of QuantiFERON -TB Gold in Diagnosis of Tuberculous Pericardial
Effusion
Mohamed E. Mohamed, Hanan E. Mohamed and Azza M Abd Elaziz
House Dust Mites as a Risk Factor in Chest Allergic Patients in Gharbia
Governorate, Egypt
Sanaa N. Antonios, Dalia S. Ashour, Mohamed G. Elkholy, Mohamed E. Hanterra &
Dalia A. Elmehy
Comparative Study between Bactec Magit 960 and Fast Plaque - Response™
For Susceptibility Pattern to Rifampicin in Sputum Specimens of Tuberculous
Patients
Azza M,Abdulaziz, Dalia El-Hossary and Hani Asfour
Methicillin Resistant Staphylococcus Aureus Infection and Its Biofilm in
Diabetic Foot Ulcers
Hanan E Mohamed and Ayman H Al-Gadaa
Plasma Transforming Growth Factor β1 level in Asthmatic Children
Mervat S. Mohamed, Khalid M Salah, Dina M Shokry, Ahmed A Halaby
Direct Ag Detection in Stool versus Conventional Culture for Diagnosis of
Campylobacter as a Causative Agent in Pediatric Gastroenteritis
Abeer A Abo Elazem MD, Sherin M Emam MD
Identification of Il-13 1923 C/T as Risk Locus for Asthma in Children
Eman M El-Behady and Rabab M El-Behady
Phenotypic analysis of Candida Species Associated with Vulvovaginal Candidiasis
Mai M. Helmy
I
Pages
1-6
7-12
13-20
21-32
22-42
43-50
51-62
63-72
73-82
83-92
93-100
101-108
109-116
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Primary Anti-Tuberculous Drugs Resistance of Pulmonary
Tuberculosis in Southwestern Saudi Arabia
Ahmed M. Asaad and Jobran M. Alqahtani
Microbiology Department and Dean of College of Medicine*, Najran University, Saudi Arabia
ABSTRACT
The emergence of drug-resistant tuberculosis (TB) is an increasing problem which adversely affects
patient care and public health. This work aims to determine the rates and patterns anti-TB drug
resistance in Najran, Southwestern Saudi Arabia. The study included 80 smear-positive new pulmonary
TB patients. Sputum samples were cultured on Lowenstein-Jenseen and Middle-Brook 7H10 media. M.
tuberculosis susceptibility testing was done by the conventional agar proportion method for isoniazide
(INH), rifampicin (RIF), streptomycin (SPM) and ethambutol (EMB). Out of the 68 M. tuberculosis
isolates, 42 (61.8%) were sensitive to all 4 drugs and 26 (38.2%) were resistant to one or more drugs.
Highest resistance was found to INH (33.8%), followed by RIF (23.5%), SPM (13.2%) and EMB (2.9%).
Eight (11.8%) isolates were resistant to one drug, 14 (20.6%) were resistant to 2 drugs, 3 (4.4%) were
resistant to 3 drugs and one (1.5%) was resistant to 4 drugs. Multi-drug resistant (MDR) isolates were
found in 14 (20.6%) cases. In conclusion, the primary resistance rate to four first-line anti-tuberculous
drugs and MDR-TB rate are worryingly high, representing an alarming situation in Najran. Further
studies are necessary for continuous surveillance of M. tuberculosis resistance patterns.
unknown, except for a few studies confined to
large centers(7-12). Unfortunately, there are no
previous
reports
on
M.
tuberculosis
susceptibility from Najran, southwestern Saudi
Arabia.
Prompt detection of anti-TB drug resistance
is essential for controlling the development and
spread of MDR-TB as it facilitates the
appropriate and timely delivery of anti-TB
therapy, reduces overall cost of treatment,
minimizes the risk of further resistance
development and limits the spread of drugresistant M. tuberculosis(13).
This work aims to determine the rates and
patterns anti-TB drug resistance in Najran,
Southwestern Saudi Arabia. It is our intention
that these data could then be used locally, in
conjunction with related studies from other
regions of the Kingdom and worldwide to
reflect the extent of the problem in the
community.
INTRODUCTION
Tuberculosis (TB) has a long and
continuing history of causing worldwide
morbidity and mortality. The World Health
Organization estimated the global burden of
tuberculosis disease in 2009 as 9.4 million
incident patients, 14 million prevalent cases and
2.38 million deaths(1).
The
emergence
of
Mycobacterium
tuberculosis strains resistant to anti-tuberculosis
drugs is a difficult problem to solve and is one
of the greatest threats to public health
worldwide. The emergence of multidrugresistant TB (MDR-TB), defined as resistance to
at least isoniazid (INH) and rifampin (RIF), the
2 principal first-line anti-TB drugs, poses an
important threat to TB control as MDR-TB
reduces response to standard short-course
chemotherapy with first-line anti-TB drugs,
leads to higher mortality and treatment failure
rates, and increases periods of transmissibility
of the disease(2-3). The underlying causes of
MDR-TB have been suggested to be incorrect
treatment, poor compliance and erratic drug
ingestion, poor drug absorption or frequent or
prolonged shortages of anti-TB drugs due to
financial constraints in some developing
countries(4-5). Among TB patients notified in
2009, an estimated 250000 had multi-drug
resistant TB (MDR-TB), while they were
440000 cases in 2008(6). The prevalence of
single-drug resistant TB (SDR-TB) or MDR-TB
in the Kingdom of Saudi Arabia is largely
MATERIALS & METHODS
A total of 80 smear-positive new
pulmonary TB patients from Chest and King
Khalid Hospitals in Najran were included in this
study between March, 2009 and August, 2011.
New TB cases were defined as patients with TB
who have never been treated with antituberculous drugs or have received them for less
than 1 month(1).
Three consecutive sputum samples were
collected from each patient and sent to the
1
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
were 0.2, 1.0, 2.0 and 5.0 µg/ml for INH, RIF,
SPM and EMB respectively. M. tuberculosis
isolate was considered drug-resistant if the
number of colonies on drug-containing media is
1% or more of the colonies on drug-free
media(14).
Microbiology Department, College of Medicine,
Najran University for further processing.
Each specimen was processed by N-AcetylL-Cystein sodium hydroxide (NALC-NaOH)
method and cultivated on Lowenstein-Jenseen;
L-J (BioMerieux, France) and Middle-Brook
7H10 (Difco Laboratories, USA) media as
described by Kent and Kubica(14). Cultures were
incubated at 37ºC for up to 2 months. Suspected
colonies were identified by Kinyoun-stained
smears, niacin accumulation, using niacin TB
test strips (Difco Laboratories), nitrate
reduction, using nitrate test strips (Difco
Laboratories) and heat stable catalase tests(14).
All M. tuberculosis isolates were subjected
to susceptibility testing for INH, RIF,
streptomycin (SPM) and ethambutol (EMB) by
the conventional proportion method on
antibiotic-free and antibiotic-incorportated
Middle-Brook 7H10 agar plates containing
OADC (oleic acid-albumin-dextrose-catalase)
enrichment. The critical drug concentrations
RESULTS
In this study, culture for M. tuberculosis
was positive in 68 of the 80 cases, while
contamination was in 4 cases, non-tuberculous
mycobacteria in 3 cases and no growth of
mycobacteria in 5 cases. Out of the 68 M.
tuberculosis isolates, 42 (61.8%) were sensitive
to all 4 drugs and 26 (38.2%) were resistant to
one or more drugs. Highest resistance was
found to INH (33.8%), followed by RIF
(23.5%), SPM (13.2%) and EMB; 2.9% (table
1).
Table (1): Susceptibility patterns of the 68 M. tuberculosis isolates to 4 anti-tuberculosis drugs
Name of drugs
Sensitive isolates No. (%)
Resistant isolates No. (%)
Isoniazide
45 (66.2)
23 (33.8)
Rifampicin
52 (76.5)
16 (23.5)
Streptomycin
59 (86.8)
9 (13.2)
Ethambutol
66 (97.1)
2 (2.9)
Sensitive to all drugs
42 (61.8)
Resistant to all drugs
26 (38.2)
The resistance patterns of M. tuberculosis
isolates are presented in table (2). Eight (11.8%)
isolates were resistant to one drug, 14 (20.6%)
were resistant to 2 drugs, 3 (4.4%) were
resistant to 3 drugs and one (1.5%) was resistant
to 4 drugs. MDR was found in 14 (20.6%)
cases.
Table (2): Resistance patterns of drug-resistant M. tuberculosis isolates to 4 anti-tuberculosis drugs
Number of drugs
Name of drugs
Resistant isolates No. (%)
Total No. (%)
One drug
INH
4 (5.9)
8 (11.8)
RIF
2 (2.9)
SPM
1 (1.5)
EMB
1 (1.5)
Two drugs
INH+RIF
10 (14.7)
14 (20.6)
INH+SPM
4 (5.9)
Three drugs
INH+RIF+SPM
3 (4.4)
3 (4.4)
Four drugs
INH+RIF+SPM+EMB
1 (1.5)
1 (1.5)
MDR
14 (20.6)
al.(15) in Jazan in the south west of the country.
The investigators attributed this to the fact that
Jazan is very close to Yemen, which has been
reported to have one of the highest rates of
active TB among Arab countries, and the
workers moving across the border might be the
cause for their high resistance rate.
DISCUSSION
In this study, the overall drug resistance
rate of 38.2% is higher than that reported in
previous Saudi studies with values ranging from
8.7% to 30%(7-12). Higher resistance rate of
43.7% was reported in the study of Schiott et
2
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
26.5%) with primary resistance to more than on
drug, including 20.6% of patients with
resistance to two drugs, 4.4% of patients to 3
drugs and 1.5% of patients to 4 drugs. Previous
report from Saudi Arabia(20) showed that 3.7%
of all patients had resistance to at least three
drugs, 3.6% had resistance to at least two drugs
and 6.8% had resistance to one drug only.
Resistances against two or more drugs are
difficult to treat and often result in treatment
failure.
The problem of MDR-TB in any
community is of considerable public health
concern, not only because of its mortality and
low therapeutic response but also because of the
implications for a speedy and energetic contact
tracing and management of exposed contacts(5).
The rate of MDR-TB in this study (20.6%) was
comparable to that (20.9%) reported in a
previous study(15) in the southwestern region of
the country. Other Saudi studies showed MDRTB rates ranging from 2.7% to 19.4%(7-12). In
the GPADRS study(16), the median prevalence
of MDR-TB in new TB cases was 1.6%,
ranging from 0% in 8 countries with low TB
prevalence to 19.4% in Moldova and 22.3% in
Azerbijan. In this report, the MDR-TB rates
were 2% in Oman, 13% in Jordan and 15% in
Yemen.
Anti-tuberculous drug resistance in never
treated cases (primary resistance) is considered
a good epidemiological indicator of long term
surveillance of the quality of treatment
performed by the TB program. Therefore, a high
level of primary resistance indicates poor
performance of the TB program by allowing
transmission of resistant TB in the
community(21). The Saudi Ministry of Health
has established the National Tuberculosis
Control Committee to put forward the DOTS
program that is applicable to the Kingdom since
1999. However, Saudi Arabia’s success rate
(65%) is comparatively below the WHO target
of 85% with drug resistance, non-compliance
and over the counter access to anti-TB treatment
being contributing factors(22).
This study had some limitations. First, the
small number of cases and lack of demographic
data restricted our ability to describe
characteristics of patient sub-strata. Second, the
study did not include previously treated TB
cases to determine the secondary resistance
rates at the same time. Finally, the study
included only pulmonary M. tuberculosis
isolates.
Geographically, Najran is also very close to
Yemen, and this resistance rate is a highly
alarming situation. According to the Global
Project on Anti-tuberculous Drug Resistance
Surveillance (GPADRS) in 83 countries during
2002 to 2007(16), the median prevalence of
primary resistance to any drug was 11.1% with
values ranging from 0% in Iceland to 56.3% in
Azerbijan. In this report, data from Arab
countries showed primary resistance rates of
10% in Oman, 35% in Jordan and 49% in
Yemen.
The rate of resistance to anti-tuberculous
agents is an important parameter for control
measures and success of treatment programs. In
this study, resistance to INH as a single drug
was the most common (5.9%). Reports from
different regions in Saudi Arabia showed INHresistance of 4.4% to 19.4% in Riyadh(7-8),
10.3% to 28.7% in Jeddah(9-10), 9.5% to 17% in
Dammam(11-12), 6.5% in Taif(17) and 40.8% in
Jazan(15). In the GPADRS report(16), the
prevalence of INH-resistance ranged from 0%
in Iceland to 42.4% in Uzbekistan, while it was
4.7% in Oman, 9% in Jordan and 3.9% in
Yemen. INH-resistance is important, because it
is a potent bactericidal drug, and is an important
component of short course anti-TB regimen.
According to the Centers for Disease Control
and Prevention (CDC), when INH-resistance
rates are >4%, quadruple empiric therapy with
INH, RIF, pyrazinamide (PZA) and EMB or
SPM is indicated(18). In the light of our findings
and as per CDC guidelines, the initial treatment
of pulmonary TB with the 4-drugs regimen
should be maintained as INH-resistance is
higher than the cut off value of 4%.
Rifampicin is a potent bactericidal and
sterilizing drug which acts on dormant and
persister bacilli on short exposure and RIFresistance may lead to the failure of directly
observed treatment short-course (DOTS)
program(19). RIF-resistance in this study (2.9%)
is lower than that reported in other Saudi
studies, accounting for 3.7% to 9.7% in
Riyadh(7-8), 5.1% to 23.4% in Jeddah(9-10), 2.9%
to 17% in Dammam(11-12), 15.3% in Taif(17) and
20.4% in Jazan(15). In the GPADRS study(16), the
prevalence of RIF-resistance ranged from 0.5%
in Iceland to 22.7% in Azerbijan, whereas it was
1.3%, 2.9% and 11.7% in Oman, Yemen and
Jordan respectively.
In this study the SPM- and EMB-resistance
rates were lower than the resistance rates
reported in other Saudi studies(7-12).
Besides the high overall drug-resistance
rate, another important observation in this study
was a significant number of patients (18;
3
Egyptian Journal of Medical Microbiology, January 2012
CONCLUSION
10.
The results of this study showed that the
primary resistance rate to four first-line antituberculous drugs and MDR-TB rate are
worryingly high, representing an alarming
situation in Najran. Further studies are
necessary for continuous surveillance of
resistance pattern of M. tuberculosis to further
delineate the risk factors and to formulate the
plans for preventing the dissemination of
resistant isolates, in particular MDR-isolates to
the general population.
Acknowledgment
This work was supported by a grant from
the Deanship of Scientific Research, Najran
University (NU12/09).
11.
12.
13.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
WHO (2010): Global report on
surveillance
and
response.
WHO/HTM/TB/2010-3, WHO, Geneva,
Switzerland.
Drobniewski FA, Yates MD (1997):
Editorial:
Multiple
drug
resistant
tuberculosis. J Clin Pathol; 50: 89-92.
WHO, Crofton J, Chaulet P, Maher D
(1996): Guidelines on the management of
drug-resistant tuberculosis. WHO TB; 210:
1-40.
Pablos-Mendez A, Raviglione MC,
Laszlo A, Binkin N, Rieder HL, Bustreo
F et al. (1998): Global surveillance for
anti-tuberculosis-drug resistance, 19941997. New Engl J Med; 338: 1641-1649.
Heym B, Honore N, Truffot-Pernot C,
Banerjee A, Schurra C, Jacobs WR et al.
(1994):
Implications
of
multi-drug
resistance for the future of short-course
chemotherapy of tuberculosis: a molecular
study. Lancet; 344: 293-298.
WHO (2008): Anti-tuberculous drug
resistance in the world: report 4.
WHO/HTM/TB/2008-394, WHO, Geneva,
Switzerland.
Al-Orainey IO (1986): Resistance to
standard antituberculous drugs in Saudi
Arabia. Saudi Med. J; 7: 363-368.
Al-Orainey IO, Saeed ES, El-Kassimi FA
and Al-Shareef N (1989): Resistance to
antituberculous drugs in Riyadh, Saudi
Arabia. Tubercle; 70: 207-210.
Zaman R (1991): Tuberculosis in Saudi
Arabia: initial and secondary drug
resistance among indigenous and non-
14.
15.
16.
17.
18.
19.
20.
4
Vol. 21, No. 1
indigenous populations. Tubercle; 72: 5155.
Khan MY, Kinsara AJ, Osoba AO, Wali
S, Samman Y, Memish Z (2001):
Increasing resistance of M. tuberculosis to
anti-TB drugs in Saudi Arabia. Int J
Antimicrob Agents; 17: 415-418.
Al-Jama AA, Borgio FG, Al-Qatari KM
(1999): Patterns of resistance to antituberculous drugs in Eastern Province,
Saudi Arabia. Saudi Med J; 20: 927-930.
Al-Rubaish AM, Madania AA, AlMuhanna FA (2001): Drug resistance
pulmonary tuberculosis in the Eastern
Province of Saudi Arabia. Saudi Med J; 22:
776-779.
Mukherjee J, Rich M, Socci A, Joseph
JK, Viru FA, Shin SS et al (2004):
Programs and principles in treatment of
multi-drug resistant tuberculosis. Lancet;
363: 474-481.
Kent PT and Kubica GP (1985): Public
Health mycobacteriology: a guide for the
level III laboratory. Centers for Disease
Control and Prevention, USA.
Schiott CR, Engbaek HC, Vergmann B,
Al Motez M, Kassim I (1985): Incidence
of drug resistance among isolates of M.
tuberculosis recovered in the Gizan area,
Saudi Arabia. Saudi Med J; 6: 375-378.
Wright A, Zignol M, Van Deun A,
Falzon D, Gerdes K, Feldman K et al
(2009): Epidemiology of anti-tuberculosis
drug resistance 2002-2007: an update of the
Global Project on Anti-tuberculosis drug
resistance surveillance. Lancet; 373: 18611873.
Jarallah JS, Elias AK, Al Hajjaj MS,
Bujhari MS, Al Shareef AH, Al
Shammari SA (1992): High rate of
rifampicin resistance of M. tuberculosis in
the Taif region of Saudi Arabia. Tuber
Lung Dis; 73: 113-115.
American Thoracic Society Ad Hoc
Committee of the Scientific Assembly on
Microbiology (1995): Tuberculosis and
Pulmonary Infections: treatment of
tuberculosis and tuberculosis infection in
adults and children. Clin Infect Dis; 21: 927.
Centers for Disease Control and
Prevention (1993): Initial therapy for
tuberculosis in the era of multi-drug
resistance: recommendations of the
advisory council for the elimination of
tuberculosis. MMWR; 42 (RR-7): 1.
Singla R, Al-Sharif N, Al-Sayegh M,
Osman M and Shaikh MA (2003):
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫‪Prevalence of resistance to anti-tuberculosis‬‬
‫‪drugs in Riyadh and a review of previous‬‬
‫‪reports. Ann. Saudi Med; 23: 143-147.‬‬
‫‪21. Al-Marri MR (2001): Pattern of‬‬
‫‪mycobacterial resistance to four anti‬‬‫‪tuberculosis‬‬
‫‪drugs‬‬
‫‪in‬‬
‫‪pulmonary‬‬
‫‪tuberculosis patients in the State of Qatar‬‬
‫‪after the implementation of DOTS and a‬‬
‫‪limited expatriate screening program. Int J‬‬
‫‪Tuberc Lung Dis; 5: 1116-1121.‬‬
‫‪22. Al-Hajoj SA (2010): Tuberculosis in Saudi‬‬
‫‪Arabia: can we change the way we deal‬‬
‫‪with disease. J Infect Pub Health; 3: 17-24.‬‬
‫اﻟﻤﻠﺨﺺ اﻟﻌﺮﺑﻰ‬
‫د‪/‬أﺣﻤﺪ ﻣﺮاد أﺳﻌﺪ ‪ ،‬و د‪/‬ﺟﺒﺮان ﻣﺮﻋﻰ اﻟﻘﺤﻄﺎﻧﻰ*‬
‫ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻰ ‪ ،‬ﻋﻤﻴﺪ آﻠﻴﺔ اﻟﻄﺐ* – ﺟﺎﻣﻌﺔ ﻧﺠﺮان – اﻟﻤﻤﻠﻜﺔ اﻟﻌﺮﺑﻴﺔ اﻟﺴﻌﻮدﻳﺔ‬
‫إن ﻇﻬﻮر اﻟﺴﻞ اﻟﻤﻘﺎوم ﻟﻸدوﻳﺔ هﻮ اﻟﻤﺸﻜﻠﺔ اﻟﻤﺘﺰاﻳﺪة اﻟﺘﻰ ﺗﺆﺛﺮ ﺳﻠﺒﺎ ﻋﻠ ﻰ رﻋﺎﻳ ﺔ اﻟﻤﺮﺿ ﻰ واﻟ ﺼﺤﺔ اﻟﻌﺎﻣ ﺔ‪ .‬ﻳﻬ ﺪف ه ﺬا‬
‫اﻟﻌﻤﻞ إﻟﻰ ﺗﺤﺪﻳﺪ ﻣﻌﺪﻻت وأﻧﻤﺎط ﻣﻘﺎوﻣﺔ اﻷدوﻳﺔ اﻟﻤ ﻀﺎدة ﻟﻠ ﺴﻞ ﻓ ﻰ ﻧﺠ ﺮان ‪ ،‬ﺟﻨ ﻮب ﻏ ﺮب اﻟﻤﻤﻠﻜ ﺔ اﻟﻌﺮﺑﻴ ﺔ اﻟ ﺴﻌﻮدﻳﺔ‪ .‬ﺷ ﻤﻠﺖ‬
‫اﻟﺪراﺳﺔ ‪ ٨٠‬ﻣﺮﻳﺾ ﺑﺎﻟﺴﻞ وﺗﻢ زرع ﻋﻴﻨﺎت اﻟﺒﺼﺎق وﺗﻢ ﻋﻤﻞ إﺧﺘﺒﺎر ﺣﺴﺎﺳﻴﺔ ﻣﻌﺰوﻻت اﻟﻤﺘﻔﻄﺮة اﻟﺘﺪرﻧﻴﺔ ﻟﻜﻞ ﻣ ﻦ أﻳﺰوﻧﻴﺎزﻳ ﺪ‬
‫‪ ،‬رﻳﻔﺎﻣﺒﻴﺴﻴﻦ ‪ ،‬ﺳﺘﺮﺑﺘﻮﻣﻴﺴﻴﻦ و إﻳﺜﺎﻣﺒﻴﺘﻮل‪ .‬أﺳﻔﺮت ﻧﺘﺎﺋﺞ اﻟﺒﺤ ﺚ ﻋﻠ ﻰ وﺟ ﻮد ‪ ٢٦‬ﻣﻌﺰوﻟ ﺔ ﻣﻘﺎوﻣ ﺔ ﻷدوﻳ ﺔ اﻟ ﺴﻞ و ‪ ٤٢‬ﻣﻌﺰوﻟ ﺔ‬
‫ﺣ ﺴﺎﺳﺔ ﻟﻜ ﻞ اﻷدوﻳ ﺔ‪ .‬آﺎﻧ ﺖ أﻋﻠ ﻰ ﻣﻘﺎوﻣ ﺔ ﻟ ﺪواء اﻷﻳﺰوﻧﻴﺎزﻳ ﺪ )‪ (%٣٣.٨‬ﻳﻠﻴ ﻪ اﻟﺮﻳﻔﺎﻣﺒﻴ ﺴﻴﻦ )‪ (%٢٣.٥‬وﺳﺘﺮﺑﺘﻮﻣﻴ ﺴﻴﻦ‬
‫)‪ (%١٣.٢‬وإﻳﺜﺎﻣﺒﻴﺘﻮل )‪ .(%٢.٩‬ﺗﻢ ﻓﺼﻞ ‪ ١٤‬ﻣﻌﺰوﻟﺔ ﻣﻘﺎوﻣﺔ ﻟﻠﻌﻘﺎﻗﻴﺮ اﻟﻤﺘﻌﺪدة‪ .‬ﻣﻦ هﺬا اﻟﺒﺤﺚ ﺗ ﻢ إﺳ ﺘﻨﺘﺎج إن ﻣﻌ ﺪل اﻟﻤﻘﺎوﻣ ﺔ‬
‫اﻷوﻟﻴﺔ إﻟﻰ أرﺑﻌﺔ ﻋﻘﺎﻗﻴﺮ ﻣﻦ اﻟﺨﻂ اﻷول ﺿﺪ اﻟﺴﻞ وﻣﻌﺪل اﻟﺴﻞ اﻟﻤﻘﺎوم ﻟﻸدوﻳ ﺔ ﻣﺮﺗﻔﻌ ﺔ ﺑ ﺸﻜﻞ ﻳ ﺪﻋﻮ إﻟ ﻰ اﻟﻘﻠ ﻖ وه ﻮ ﻣ ﺎ ﻳﻤﺜ ﻞ‬
‫ﺣﺎﻟﺔ ﻣﺜﻴﺮة ﻟﻠﻘﻠﻖ ﻓﻰ ﻧﺠﺮان‪ .‬وﻧﻮﺻﻰ ﺑﻤﺰﻳﺪ ﻣﻦ اﻟﺪراﺳﺎت اﻟﻼزﻣﺔ ﻟﻤﺮاﻗﺒﺔ ﻣﺴﺘﻤﺮة ﻷﻧﻤﺎط ﻣﻘﺎوﻣﺔ اﻟﺴﻞ‪.‬‬
‫‪5‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Serological and Molecular Diagnosis of Human Brucellosis in Najran,
Southwestern Saudi Arabia
Ahmed M. Asaad and Jobran M. Alqahtani*
Microbiology Department and Dean of College of Medicine*, Najran University, Saudi Arabia
ABSTRACT
This work aims to investigate the prevalence of human brucellosis in Najran, southwestern Saudi Arabia
and to assess the performance of ELISA and PCR as diagnostic tools of brucellosis in comparison to the
conventional methods. The study included 340 patients with clinical characteristics of brucellosis. Blood
samples from cases were subjected to culture, standard tube agglutination test (SAT), ELISA for IgM and
IgG, and brucella PCR. The diagnosis of brucellosis was confirmed in 54 (15.9%) of 340 provisionally
diagnosed patients. Blood culture identified only 14 (25.9%) cases. SAT was positive in 50 (92.6%) cases,
and ELISA IgM and IgG were found positive in 46 (85.2%) and 52 (96.3%) cases, whereas PCR was
positive in 38 (70.4%) cases. The sensitivities of ELISA IgM and IgG were 85.2% and 96.3% respectively
and the specificity was 100% for each. For PCR, the sensitivity and specificity were 70.4% and 100%
respectively. In conclusion, ELISA IgM and IgG tests seem to be valuable tools for definitive diagnosis of
brucellosis in endemic areas. The PCR can be particularly important in patients with clinical picture and
negative serological results, allowing early and rapid confirmation of the disease.
through the isolation of Brucella spp. from
blood cultures or the detection of specific
antibodies through the use of serological tests.
However, the established methods for
laboratory diagnosis are often unreliable in
several respects.
Culture is a time-consuming procedure. In
addition, failure to detect the pathogen is a
frequent occurrence and Brucella spp. are class
III pathogen posing considerable risk to
laboratory personnel(7). Common serological
tests are the Rose Bengal plate agglutination test
(RBPT), standard tube agglutination test (SAT),
Coombs test and ELISA. Conventional
serological methods have important limitations.
Their sensitivity is poor in the early stage of the
disease, and their specificity is reduced in areas
where the disease is highly endemic and in the
frequent relapses of the disease(8). The
development of specific PCR assays is a recent
advance in diagnosis of human brucellosis, but
information concerning the use of this
diagnostic tool is scarce.
This work aims to investigate the
prevalence of human brucellosis in Najran,
southwestern Saudi Arabia and to assess the
performance of ELISA and PCR as diagnostic
tools of brucellosis in comparison to the
conventional methods.
INTRODUCTION
Brucellosis is a systemic disease caused by
bacteria of the genus Brucella that affects
humans and numerous animal species.
Transmission to humans occurs by ingestion of
raw or unpasteurized milk and other dairy
products, by direct contact with infected animal
tissues, or by accidental ingestion, inhalation, or
injection of the Brucella culture(1).
According
to
the
World
Health
Organization, half a million of new human cases
are reported each year, but these numbers
greatly underestimate the true incidence of
human disease(2). Although the incidence of the
disease has decreased markedly in industrialized
countries, it remains a major public health
problem in many developing countries. In Saudi
Arabia, Brucellosis is hyper-endemic with an
incidence of 5.4 per 1,000 per year. Its
prevalence has been variable in different regions
of the country with reported values of 8.8 to
38%(3). According to Memish et al.(4), more
than 8,000 cases are reported per year to public
health authorities.
In humans, brucellosis behaves as a
systemic infection with a very heterogeneous
clinical
spectrum(5).
The
infection
is
characterized by protean manifestations and
prolonged recurrent febrile episodes. The
features of acute disease are varied and may be
insidious, whereas the features of chronic
disease, which may persist or recur for years,
are often vague(6). The disease, therefore, cannot
be diagnosed on clinical grounds alone, and
microbiological confirmation is required
MATERIALS AND METHODS
From April 2010 to September 2011, a total
of 340 patients attending the Infectious Diseases
Clinic of King Khalid Hospital in Najran and
presenting with clinical characteristics of
7
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Serum samples from patients and controls
were extracted for the isolation of Brucella
DNA using E.Z.N.A commercial kit (Omega
Bioteck, USA), according to the manufacturer's
instructions.
The PCR amplification mixture consisted
of pure Taq ready-to-go PCR bead (Amersham
Bioscience, UK), 10 pmol/µL of each primer
and 50 pg of Brucella DNA extract in a total
volume of 50 µl. The amplification was
performed in a thermal cycler (Cyclogene
Techne, UK). The reaction mixtures were
heated to 90°C for 5 minutes, followed by 40
amplification cycles, each consisting of 60
seconds at 90°C, 30 seconds at 60°C and 60
seconds at 72°C. A final extension cycle of
72°C for 7 minutes was included. The amplified
products were electrophoresed in 1.5% agarose
gel. The gels were stained with ethidium
bromide and visualized under ultraviolet transilluminator (Cole-Parmer, USA). The presence
of a clear-cut band of 223 bp was considered as
a positive result.
Statistical methods
Data were entered and analyzed using
SPSS 10 for windows statistical package (SPSS
Inc, USA). Sensitivity, specificity, and positive
and negative predictive values were calculated.
brucellosis were included in this study.
According to the duration of symptoms, the
patients were classified into 3 groups: acute
group with presentation for < 2 months (N =
180), sub-acute group with the symptoms for 2
to 12 months (N = 110) and chronic group with
symptoms for > one year (N = 50). One hundred
healthy personnel who were blood donors at the
hospital’s blood bank were enrolled as controls.
Eight ml blood (5 ml for culture and serology
and 3 ml mixed with EDTA for PCR assay)
were taken from all patients and controls. The
diagnosis of brucellosis was established
according to one of the following criteria: (i) the
isolation of Brucella spp. in blood culture or (ii)
the presence of compatible clinical picture
together with positivity for one or both of SAT
and ELISA(8).
Bacteriological and serological techniques
Blood cultures were processed with
biphasic blood culture medium (Biomerieux,
France), incubated at 37 C in an atmosphere of
5% to 10% carbon dioxide for 30 days and subcultured weekly. Suspected colonies were
identified
according
to
the
standard
techniques(9).
For serology, All sera from patients and
controls were tested by SAT and ELISA for
IgM and IgG against Brucella species. In the
SAT, equal volumes of serial dilutions of the
serum (from 1:10 to 1:1280) and B. abortus and
B. melitensis antigens (Omega Diagnostic Ltd,
UK) were mixed in test tubes and incubated at
37 C for 24 hours. Known negative and
positive control sera were used. A titer of
≥1/160 was considered positive(8). ELISA
testing for IgM and IgG against Brucella spp.
was performed using commercial reagents
(Genzyme Virotech, Germany). The absorbance
values found were converted into Virotech units
(VE) using the following formula according to
the manufacturer’s instructions: patient sample
(mean) absorbance X 10/mean absorbance value
of cut off controls (>11 VE was considered
positive). Borderline results were re-tested and
confirmed either positive or negative.
Brucella PCR
The detection of a target sequence of 223
bp within the gene coding for the production of
a 31-kDa membrane protein specific to the
genus Brucella was performed by PCR, using
specific primers (Quiagen, USA) as previously
reported(10). The sequences of these primers
were:
forward
5'TGGCTCGGTTGCCAATATCAA-3'
and
reverse 5'- CGCGCTTGCCTTTCAGGTCTG3'(11).
RESULTS
We studied a total of 340 patients having
presumptive diagnosis of brucellosis. The
patients were between 19 and 82 years of age,
with the mean age of the patients being 32.18
years with a standard deviation of ± 11.73 years.
Two hundred and sixty (76.5%) patients were
males and 80 (23.5%) were females; the male to
female ratio was 3.3:1. There was no seasonal
variation in the cases studied. The noticeable
symptoms were with patients having fever, joint
pain, low backache, headache, and vomiting.
Consumption of raw milk (205 patients) and
direct contact with domestic animals (138
patients) were recognized as major risk factors
for transmission of brucellosis in our study.
In this work, the diagnosis of brucellosis
was confirmed in 54 (15.9%) of the 340
patients. Blood culture identified 14 (25.9%)
cases. SAT was positive in 50 (92.6%) cases,
and ELISA IgM and IgG were positive in 46
(85.2%) and 52 (96.3%) cases, whereas PCR
was positive in 38 (70.4%) cases. The
distribution of laboratory tests results among the
brucellosis groups is listed in table (1). Control
samples were all negative by culture, SAT and
PCR.
8
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (1): Distribution of laboratory tests results according to the type of brucellosis
Laboratory test
Brucellosis groups
Acute
Subacute
Chronic
No. =180 (%)
No. =110 (%)
No. =50 (%)
Culture
13 (7.2)
1 (0.9)
0 (0)
SAT
28 (15.6)
6 (5.5)
16 (32)
ELISA IgM
32(17.8)
4 (3.6)
10 (20)
ELISA IgG
28 (15.6)
6 (5.5)
18 (36)
PCR
32 (17.8)
4 (3.6)
2 (4)
Twenty one patients with SAT titer of
1/160 and 18 patients with SAT titer of 1/320
yielded positive results by ELISA IgM and IgG.
ELISA IgM and IgG were positive in 4 patients
where SAT titer was 1/80. PCR test was
positive in 38 cases where SAT titers were
Total
No. =340 (%)
14 (4.1)
50 (14.7)
46 (13.1)
52 (15.3)
38 (11.2)
1/160 (in 11 cases), 1/320 (17 cases), 1/640 (6
cases) and 1/1280 (4 cases) as presented in table
(2). The sensitivity, specificity, and positive and
negative predictive values of ELISA-IgM,
ELISA-IgG and PCR are presented in table (3).
Table (2): Distribution of ELISA and PCR results according to SAT titers
ELISA IgM
ELISA IgG
SAT titer No of cases
Positive
Negative Positive
Negative
1/40
96
0
96
0
96
1/80
194
4
190
4
190
1/160
18
18
0
18
0
1/320
21
21
0
21
0
1/640
7
3
4
7
0
1/1280
4
0
4
2
2
Table (3): Diagnostic yield of ELISA IgM, ELISA IgG and PCR
Laboratory test Sensitivity
Specificity
Positive predictive value
ELISA IgM
85.2%
100%
100%
ELISA IgG
96.3%
100%
100%
PCR
70.4%
100%
100%
PCR
Positive
0
0
11
17
6
4
Negative
96
194
7
4
1
0
Negative predictive value
97.3%
99.3%
94.7%
locations where there are uncontrolled
movements of animals may have a high
prevalence rate, especially in villages where
Bedouins live in close contact with animals.
However, in another recent study in Najran
region(16), the prevalence was 7.3% among 540
healthy subjects. In that study, ELISA IgG was
used as the only diagnostic technique and the
authors might underestimate the true prevalence
of the disease. It had been reported that none of
the serological techniques used in the diagnosis
of brucellosis are 100% sensitive and
specific(17,18). Data from Middle East countries
reported seroprevalence rates ranging from 8%
in Jordan(19) to 12% in Kuwait(20).
Despite the important advances made in the
diagnostics of human brucellosis following the
introduction of automated blood culture
techniques, diagnosis of this disease is still
based mostly on serological and molecular
DISCUSSION
Brucellosis is an important public problem
in many developing countries, including the
Mediterranean countries and the Arabian
Peninsula. The overall prevalence of human
brucellosis in this study was 15.9%. In an earlier
report, the seroprevalence rate was 19% in the
Southern region(12). In another large-scale study
investigating the seroprevalence of brucellosis
on 24000 subjects in different Saudi regions(13),
the highest prevalence of brucellosis was in
Northern and Southern regions accounting for
20% and 18.3% respectively, while it was
14.6%, 14% and 11.6% in Central, Eastern and
Western regions respectively. Many previous
Saudi studies(14,15) showed that the area of
residence (northern or southern regions) has a
significant effect on seroprevalence. Border
9
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
of patients with chronic brucellosis. One of the
main characteristics of the PCR assay that
enhances its value, as the results of the present
study confirm, is its ability to establish the
diagnosis of acute brucellosis.
Although the PCR specificity in this work
was 100%, its sensitivity was 70.4%. In
previous studies, PCR sensitivities varied from
66% to 94%(25-28). This can be related to lack of
uniformity and standardization among studies in
PCR protocols such as optimal clinical
specimen, sample volume, extraction method,
primers and target sequences, storage conditions
of samples or experimental setup(25,26).
methods. Among the newer serologic tests,
ELISA appears to be the most sensitive(5,6). In
this work, overall concordant results between
ELISA IgM and IgG titers, and SAT titers were
found among 88.5% of patients within the three
groups. Six patients yielded discrepant results: 4
acute brucellosis patients with negative SAT
titers were positive by ELISA for IgM and IgG
and 2 chronic brucellosis patients tested positive
only in ELISA IgG. This serological picture is
very similar to that reported elsewhere in the
world(17,21,22). Mantur et al(17) reported positive
ELISA IgM and IgG in 16 of 28 acute
brucellosis patients with negative SAT results
and positive ELISA IgG in 21 of 29 chronic
brucellosis patients with negative ELISA IgM
and SAT titers. Irmak et al(21) found that 9% of
26 acute brucellosis patients tested positive in
the IgM assay and negative in the IgG assay,
56% tested positive in both tests, 26% tested
positive only in the IgG assay, and 9% tested
negative in both tests. It is known that IgM may
be detected after the first week following the
entry of the organism. The peak level is reached
4 weeks later(22). IgG has a delayed appearance,
although it is found mixed with IgM 4 weeks
after the initial antigenic stimulus; the IgM level
always exceed the IgG level in the acute stage
of the disease. Our findings agree with the
principle that the IgM test is more indicative of
acute infection, while IgG is more useful for the
diagnosis of the sub-acute and chronic infection.
Different studies showed different results
for ELISA sensitivity and specificity. The
sensitivity and specificity of ELISA in this work
are in agreement with that reported in other
studies(23,24). Araj et al(23) reported sensitivities
of 100% and 91% for ELISA IgM and IgG
respectively and specificity of 100% for both.
Mantur et al.(17) reported ELISA sensitivity of
71.3% and specificity of 100%. Memish et al.(24)
found that sensitivity and specificity of ELISA
IgM were 79.1% and 100%, whereas they were
45.6% and 97.1% for ELISA IgG. Combining
ELISA IgM and IgG positivity in their study
increased the sensitivity to 94.1% and the
specificity to 97.1%.
The PCR based assays are promising
alternatives for the diagnosis of brucellosis. In
this work, PCR correctly diagnosed the 32 acute
brucellosis patients. In accordance, Mitka et
al(25) found that rate of PCR positive results in
200 acute brucellosis patients was 99%, while it
was 91.2% (31 0f 36 patients) in the study of
Surucuoglo et al(26). On the other hand, our PCR
test results were only positive in 11.1% of
patients with chronic disease. This lower rate
might be due to low organism load in the blood
CONCLUSION
The results of this study showed that
ELISA is a valuable test in the diagnosis of
brucellosis in endemic areas. Its ability to
measure 2 specific antibodies makes this an
effective diagnostic tool of brucellosis. This is
especially important, since it may be possible to
use this test to confirm the clinical stage of the
disease. The PCR test results can be particularly
important in patients with clinical signs and
symptoms, and negative serological results,
allowing early and rapid confirmation of the
disease.
Acknowledgment
This work was supported by a grant
from the Deanship of Scientific Research,
Najran University (NU05/10).
REFERENCES
1.
2.
3.
4.
5.
6.
10
Ariza J. (1996): Brucellosis: an update.
Curr Opin Infect Dis; 9: 126-131.
World Health Organization (1997): Fact
sheet N173, July 1997. World Health
Organization, Geneva, Switzerland.
Al abdely HM, Halim MA and Amin TM
(1996): Breast abscess caused by Brucella
melitensis. J Infect; 33: 219-220.
Memish ZA and Mah MW (2001):
Brucellosis in laboratory workers at a Saudi
Arabian Hospital. Am. J. Infect. Control;
29: 48–52.
Cutler SJ, Whatmore AM and
Commander NJ (2005): Brucellosis – new
aspects of an old disease. J. Appl.
Microbiol; 98: 1270 – 1281.
Young EJ (1995): Brucellosis: current
epidemiology, diagnosis and management.
Curr. Trop. Infect. Dis; 15: 115 – 128.
Egyptian Journal of Medical Microbiology, January 2012
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Vol. 21, No. 1
19. Abu Shaqra QM (2000): Epidemiological
aspects of brucellosis in Jordan. Eur J
Epidemiol; 16: 581 – 584.
20. Lulu AR, Arja GF, Khateeb MY, Yusuf
AR, Ferech FF (1998): Human brucellosis
in Kuwait. Q J Med; 66:39 - 44.
21. Irmak H, Buzgan T, Evirgen O, Akdeniz
H, Demiroz P, Abdoel T et al (2004): Use
of the brucella IgM and IgG flow assays in
the serodiagnosis of human brucellosis in
an area endemic for brucellosis. Am J Trop
Med Hyg; 70: 688 – 694.
22. Osoba AO, Balkhy H, Memish Z, Khan
MY, Al-Thagafi A, Al Shareef B, et al
(2001): Diagnostic value of Brucella
ELISA IgG and IgM in bacteremic and
non-bacteremic patients with brucellosis. J
Chemother; 13:54–59.
23. Araj GF, Kattar MM, Fattouh LG,
Bajakian KO and Kobeissi SA (2005):
Evaluation of the PANBIO brucella IgG
and IgM ELISA for diagnosis of human
brucellosis. Clin Diagn Lab Immunol; 12:
1334 – 1335.
24. Memish ZA, Almuneef A, Mah MW,
Qassem LA and Osoba AO (2002):
Comparison of the brucella standard
agglutination test with the ELISA IgG and
IgM in patients with brucella bactreremia.
Diagn Microbiol Infect Dis; 44: 129 – 132.
25. Mitka S, Anetakis C, Souliou E, Diza E
and Kansouzidou A (2007): Evaluation of
different PCR asaays for early detection of
acute and relapsing brucellosis in humans
in comparison with conventional methods. J
Clin Microbiol; 45: 1211 – 1218.
26. Surucuoglu S, El S, Ural S, Gazi H,
Kurutepe S, Taskiran P et al (2009):
Evaluation of real time PCR method for
rapid diagnosis of brucellosis with different
clinical manifestations. Pol J Microbiol; 58:
15 – 19.
27. El Kholy AA, Gomaa HE, El Anany MG
and El Rasheed EA (2009): Diagnosis of
human brucellosis in Egypt by polymerase
chain reaction. East Med Health J; 15: 1068
– 1074.
28. Elfaki MG, Al Hokail AA, Nakeeb SM
and Al Rabiah FA (2005): Evaluation of
culture, tube agglutination and PCR
methods for the diagnosis of brucellosis in
humans. Med Sci Monit; 11: MT69 – 74.
Navarro E, Casao MA and Solera J
(2004): Diagnosis of human brucellosis
using PCR. Expert Rev Mol Diagn; 4: 115
– 125.
Ariza J, Pellicer T, Pallares R, Foz A and
Gudiol F (1992): Specific antibody profile
in human brucellosis. Clin Infect Dis; 14:
131 – 140.
Moyer N and Holcomb PA (1995):
Brucella. In: Murray PR, Baron EJ, Pfaller
MA, Tenover FC and Yolken RH, editors.
Manual
of
clinical
microbiology,
Washington, D.C.; p.: 382 – 386.
Queipo-Ortuno MI, Morata P, Ocon P,
Manchado P, Colmenero J (1997): Rapid
diagnosis of human brucellosis by
peripheral-blood PCR assay. J Clin
Microbiol; 35: 2927 – 2930.
Bailey GG, Krahn JB, Drasar BS, Stoker
NG (1992): Detection of Brucella
melitensis and Brucella abortus by DNA
amplification. J Trop Med Hyg; 95: 271 –
275.
Al-Ballaa SR (1995): Epidemiology of
human brucellosis in Southern Saudi
Arabia. J Trop Med Hyg; 98:185-9.
Al Sekait MA (1999): Seroepidemiological
survey of brucellosis antibodies in Saudi
Arabia. Ann Saudi Med; 19: 219 – 222.
Fallatah FM, Oduloju AJ, Al-Dusari SN
and Fakunle YM (2005): Human
brucellosis in Northern Saudi Arabia. Saudi
Med J; 26: 1562 – 1566.
Malik GM (1997): A clinical study of
Brucellosis in the Asir Region of Southern
Saudi Arabia. Am J Trop Med Hyg; 56:
375 - 377.
Elsheikh AA, Masoud EE, Mostafa MF
and
Elkhawanky
MM
(2011):
Seroprevalence of 2 zoonotic diseases in
Southwestern Saudi Arabia: Rift Valley
fever and Brucellosis. Saudi Med J; 32: 740
– 741.
Mantur B, Parande A, Amarnath S, Patil
G et al (2010): ELISA versus conventional
methods of diagnosing endemic brucellosis.
Am J Trop Med Hyg; 83: 314 – 318.
Pabuccuoglu O, Ecemis T, El S, Coskun
A, Akacali S and Sanlidag T (2011):
Evaluation of serological tests for diagnosis
of brucellosis. Jpn J Infect Dis; 64: 272 –
276.
11
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫اﻟﺘﺸﺨﻴﺺ اﻟﻤﻨﺎﻋﻰ واﻟﺠﺰﻳﺌﻰ ﻟﻤﺮض اﻟﺤﻤﻰ اﻟﻤﺎﻟﻄﻴﺔ اﻟﺒﺸﺮﻳﺔ ﻓﻰ ﻣﻨﻄﻘﺔ ﻧﺠﺮان ‪ ،‬ﺟﻨﻮب ﻏﺮب‬
‫اﻟﻤﻤﻠﻜﺔ اﻟﻌﺮﺑﻴﺔ اﻟﺴﻌﻮدﻳﺔ‬
‫د‪/‬أﺣﻤﺪ ﻣﺮاد أﺳﻌﺪ ‪ ،‬و د‪/‬ﺟﺒﺮان ﻣﺮﻋﻰ اﻟﻘﺤﻄﺎﻧﻰ*‬
‫ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻰ ‪ ،‬ﻋﻤﻴﺪ آﻠﻴﺔ اﻟﻄﺐ* – ﺟﺎﻣﻌﺔ ﻧﺠﺮان – اﻟﻤﻤﻠﻜﺔ اﻟﻌﺮﺑﻴﺔ اﻟﺴﻌﻮدﻳﺔ‬
‫ﻳﻬﺪف هﺬا اﻟﺒﺤﺚ إﻟﻰ ﺗﺤﺪﻳﺪ ﻣﻌﺪل إﻧﺘ ﺸﺎر اﻟﺤﻤ ﻰ اﻟﻤﺎﻟﻄﻴ ﺔ اﻟﺒ ﺸﺮﻳﺔ ﻓ ﻰ ﻣﻨﻄﻘ ﺔ ﻧﺠ ﺮان ‪ ،‬ﺟﻨ ﻮب ﻏ ﺮب اﻟﻤﻤﻠﻜ ﺔ اﻟﻌﺮﺑﻴ ﺔ اﻟ ﺴﻌﻮدﻳﺔ ‪،‬‬
‫وﺗﻘﻴﻴﻢ أداء إﺧﺘﺒﺎر اﻹﻟﻴﺰا وﺗﻔﺎﻋﻞ ﺳﻠﺴﺔ إﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة ﻓﻰ ﺗﺸﺨﻴﺺ اﻟﺤﻤﻰ اﻟﻤﺎﻟﻄﻴﺔ ﻣﻘﺎرﻧﺔ ﺑﺎﻟﻄﺮق اﻟﺘﻘﻠﻴﺪﻳﺔ‪.‬‬
‫إﺷﺘﻤﻞ اﻟﺒﺤﺚ ﻋﻠﻰ ‪ ٣٤٠‬ﻣ ﺮﻳﺾ ﻟﺪﻳ ﻪ اﻟﺨ ﺼﺎﺋﺺ اﻟ ﺴﺮﻳﺮﻳﺔ ﻟﻠﺤﻤ ﻰ اﻟﻤﺎﻟﻄﻴ ﺔ‪ .‬ﺗ ﻢ ﺗﺠﻤﻴ ﻊ ﻋﻴﻨ ﺎت اﻟ ﺪم ﻣ ﻦ آ ﻞ اﻟﻤﺮﺿ ﻰ‬
‫ﻹﺟ ﺮاء إﺧﺘﺒ ﺎر اﻹﻟﻴ ﺰا وﺗﻔﺎﻋ ﻞ ﺳﻠ ﺴﺔ إﻧ ﺰﻳﻢ اﻟﺒﻠﻤ ﺮة‪ .‬ﺗ ﻢ اﻟﺘ ﺸﺨﻴﺺ اﻟﻤﻌﻤﻠ ﻰ ﻓ ﻰ ‪ (%١٥.٩) ٥٤‬ﻣ ﺮﻳﺾ‪ .‬آ ﺎن إﺧﺘﺒ ﺎر اﻹﻟﻴ ﺰا‬
‫ﻟﻸﺟﺴﺎم اﻟﻤﻀﺎدة إم وﺟﻰ إﻳﺠﺎﺑﻴﺎ ﻓﻰ ‪ ٤٦‬و‪ ٥٢‬ﻣﺮﻳﺾ ﺑﻴﻨﻤﺎ ﺗﻔﺎﻋﻞ ﺳﻠﺴﻠﺔ إﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة إﻳﺠﺎﺑﻴﺎ ﻓﻰ ‪ ٣٨‬ﻣ ﺮﻳﺾ‪ .‬آﺎﻧ ﺖ ﺣ ﺴﺎﺳﻴﺔ‬
‫إﺧﺘﺒﺎر اﻹﻟﻴﺰا ﻟﻸﺟﺴﺎم اﻟﻤﻀﺎدة إم وﺟ ﻰ ‪ %٨٥.٢‬و ‪ %٩٦.٣‬وآﺎﻧ ﺖ ﺧ ﺼﻮﺻﻴﺔ اﻹﺧﺘﺒ ﺎر ‪ .%١٠٠‬أﻣ ﺎ ﺣ ﺴﺎﺳﻴﺔ وﺧ ﺼﻮﺻﻴﺔ‬
‫ﺗﻔﺎﻋﻞ ﺳﻠﺴﺔ إﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة هﻰ ‪ %٧٠.٤‬و ‪ %١٠٠‬ﻋﻠﻰ اﻟﺘﻮاﻟﻰ‪.‬‬
‫ﻣﻦ هﺬا اﻟﺒﺤﺚ ﺗﻢ إﺳﺘﻨﺘﺎج أن إﺧﺘﺒﺎر اﻷﻟﻴﺰا أداة ذات ﻗﻴﻤﺔ ﻓﻰ اﻟﺘﺸﺨﻴﺺ اﻟﻨﻬﺎﺋﻰ ﻟﻠﺤﻤﻰ اﻟﻤﺎﻟﻄﻴﺔ ﻓﻰ اﻟﻤﻨﺎﻃﻖ اﻟﻤﺴﺘﻮﻃﻨﺔ‪.‬‬
‫إﺧﺘﺒ ﺎر ﺗﻔﺎﻋ ﻞ ﺳﻠ ﺴﻠﺔ إﻧ ﺰﻳﻢ اﻟﺒﻠﻤ ﺮة ﻳﻌﺘﺒ ﺮ ه ﺎم ﻓ ﻰ اﻟﺘ ﺸﺨﻴﺺ اﻟﻤﺒﻜ ﺮ واﻟ ﺴﺮﻳﻊ ﻓ ﻰ اﻟﻤﺮﺿ ﻰ اﻟﻤ ﺸﻜﻮك ﻓ ﻰ إﺻ ﺎﺑﺘﻬﺎ ﺑ ﺎﻟﻤﺮض‬
‫وﻳﺼﺎﺣﺒﻬﺎ ﻧﺘﺎﺋﺞ ﺳﻠﺒﻴﺔ ﺑﻄﺮق اﻟﺘﺸﺨﻴﺺ اﻟﺘﻘﻠﻴﺪﻳﺔ‪.‬‬
‫‪12‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
EXPRESSION OF CD69 ON PLATELETS OF PATIENTS WITH
Systemic Lupus Erythematosus AND Cardiovascular Disease
Sabah I. Abd Elreheem*, Nivin Ghoraba*, Lamyaa Ismaiel Ahmad**
Departments of Clinical Pathology* and Internal Medicine**
Al Azhar University, Faculty of Medicine for Girls
ABSTRACT
Introduction:-Systemic lupus erythematosus is an autoimmune disease characterized by inflammation of
many different systems. Epidemiological studies showed an increase of cardio and cerebrovascular
events in patients suffering from systemic autoimmune diseases, and autoptic investigations pointed out
that an accelerated atherosclerotic process is largely responsible for such manifestations. Both
symptomatic as MI (myocardial infarction) and asymptomatic as atherosclerotic (carotid plaque)
diseases are more prevalent in SLE patients than in the general population. There were positive
correlations between CD69 (one of type I IFN-regulated genes in platelets) level and cardio vascular
complications in these patients. Objective:-To determine the level of CD69 andC3 in patients with
systemic lupus erthematosus and to find the relationship between CD69 andC3 levels and cardio vascular
complications in these patients. METHODS:-Twenty systemic lupus erthromatosis patients were
included in this study were selected from internal medicine in and out-patient clinics of Al-Zahraa
university hospital, ten patients suffering of SLE with no cardio vascular disease (Group1) and ten
patients suffering of SLE with cardio vascular disease (Group 2), Ten healthy individuals of matched age
and sex were selected as control group. All systemic lupus patients were subjected to full history taking,
clinical examination, ECG, complete blood picture, liver function, renal function, ANA, dDNA, serum
complement 3, and CD69 on platelets were done. RESULTS:-The expression ofCD69 on platelets was
significantly higher in patient of SLE with cardiovascular complication group than control
group(p0.0071),and there was a significant increases in the serum level of C3 of SLE with cardiovascular
complication group than in patient of SLE without cardiovascular complication group (p=0.000005).
Also we found that the serum level of C3 lower in patient of SLA group with and without cardiovascular
complication than control group (p=0.009) (0.00009). Conclusion:-These finding suggest that Platelets
with CD69 expression seem to more activated and may contribute to development of vascular
complication in patients of SLE so CD69 expression on platelets may serve as predictive marker of CVD
complication in patients with SLE.
observations support a possible role of
autoimmunity in the genesis of atherosclerosis
that may have clinical or subclinical features(3).
Both preclinical (carotid plaque) and
clinical (myocardial infarction) atherosclerotic
diseases are more prevalent in SLE patients than
in
the
general
population.
Clinically
atherothrombotic events, such as myocardial
infarction (MI), have been recognized as risk
factors for mortality, there may be a bimodal
distribution of mortality risk factors in lupus, an
early peak in mortality is caused by disease
activity and severity itself, as well as infections,
while a late peak is related to coronary artery
disease (CAD), CAD is described with a
prevalence ranging from 6 to 10%, and, in SLE
patients, the risk of developing any CAD is 4–8
times higher than in control. In young women
with SLE, the risk of MI is increased 50-fold. In
various cohort studies, MI was the cause of
death in 3–30% of SLE patients(4).
INTRODUCTION
Systemic lupus erythematosus (SLE) is an
autoimmune
disease
characterized
by
inflammation in many different organ systems
such as skin, joints, kidney, nervous system,
serosal membranes and blood elements. B-cell
abnormalities, autoantibodies, complement
activation and an ongoing type I interferon
(IFN) production are all of importance in the
pathogenesis of SLE(1,2).
Type I interferon (IFN) gene signature in
patients with SLE, and the IFN-regulated
proteins PRKRA, IFITM1 and CD69 were
found to be up-regulated in platelets from SLE
patient(1)
Epidemiological studies showed an increase
of cardio and cerebrovascular events in patients
suffering from systemic autoimmune diseases,
and autoptic investigations pointed out that an
accelerated atherosclerotic process is largely
responsible for such manifestations. These
13
Egyptian Journal of Medical Microbiology, January 2012
The excess risk of cardiovascular disease
(CVD) associated with inflammatory rheumatic
diseases has long been recognized. Patients with
established rheumatoid arthritis (RA) or
systemic lupus erythematosus (SLE) have
higher mortality compared with the general
population. Over 50% of premature deaths in
RA are attributable to CVD. Excess mortality in
SLE follows a bimodal pattern, with the early
peak predominantly a consequence of active
lupus or its complications, and the later peak
largely attributable to atherosclerosis. Patients
with RA or SLE are also at increased risk of
nonfatal ischemic heart disease. The
management and outcome of myocardial
infarction and congestive heart failure in
patients with RA or SLE differs from that in the
general population(5).
Immune dysregulation characteristic of
lupus appears to play the dominant role in
atherogenesis. While both SLE-specific and
non-specific mechanisms have been proposed to
play a prominent role in the induction of
premature vascular damage in this disease(6).
platelet activation have possible role in
pathogenesis of CVD, SLE increased platelet
expression of p-seletin and phosphatidylserin
(PS) has been demonstrated, furthermore,
platelet-monocyte complexes which could
accelerate the production of tissue factor are
found in SLE(7). markers of sustained platelet
activation such as extracellular phosphorxlation
of plasma proteins fibrinogen and C3 has been
found in SLE patients and may be associated
with venous thsombosis(8) .
CD69 is asignal transducing disulfide
linked homo-dimer functronally expressed on
platelets , CD3 bright thymocytes and actived
lymphocytes, CD69 involved in lymphocyte
proliferation and functions as asignal
transmitting receptor in lymplocytes natural
killer (NK) cells and platetets(9).
Upregulation of CD69 expression by IFN
has been described in neutrophils and
megacaryocytes.(10)
CD69 is a marker of activation of
inflammatory cells and it is suspected to
participated in pathology of vasculitis and
possibly in platelet aggregation (11).
Complement 3, often simply called C3, is
a protein of the immune system. It plays a
central role in the complement system and
contributes to innate immunity. In humans it is
encoded
on chromosome
19 by
a gene called C3(12).
C3 plays a central role in the activation
of complement system. Its activation is required
for both classical and alternative complement
Vol. 21, No. 1
activation pathways. People with C3 deficiency
are susceptible to bacterial infection
One form of C3-convertase, also known as
C4b2a, is formed by a heterodimer of activated
forms of C4 and C2. It catalyzes
the proteolytic cleavage of C3 into C3a andC3b,
generated during activation through the classical
pathway as well as the mannan-binding lectin
pathway.
C3a
is
an anaphylotoxin
abindinglectin
pathway.
C3a
is
an anaphylotoxin and the precusor of some
cytokines such as ASP, and C3b serves as
an opsonizing agent.(13)
Observation
of
low
complement
concentrations and also of activation of the
complement system are characteristic findings
in active SLE and have led to the practice of
using measurement of complement for the
diagnosis, classification and monitoring of
disease course in SLE.
In the 1982 set of ACR criteria for SLE,
complement components were not included.
However, low levels of CH50, C3 and C4 were
tested when the criteria were developed. The
sensitivities and specificities for the tested
components were 70 and 70%, respectively, for
CH50, 64 and 91% for C3 and 64 and 65% for
C4. In further analysis by recursive partitioning
on the same data set, the combined sensitivity
and specificity for CH50, C3 and C4 were 74
and 88%. In a more recent study, low levels of
C1q were found to have a high specificity
(96%) but the sensitivity was low (20%)(14).
Aim of the work:
To determine the level of C3 and CD69 in
patients with systemic lupus erthematosus and
to find the relationship between C3 and CD69
levels and cardio vascular complication in these
patients.
PATIENTS & METHODS
The present study was conducted on 30
subjects : twenty patients with SLE (all patients
were diagnosed according to criteria of
American collage for Rheumatology method
classification criteria for SLE), and Ten healthy
individuals of matched age and sex were
selected as control group. The patients were
selected from internal medicine department in
and out-patient clinics of Al-Zahraa university
hospital from January 2011-july 2011 after
informed consent. The patients group were
classified into two group;
Group 1: ten patients suffering of SLE with no
cardio vascular disease one of them was male
and 9 were females, their age ranged from 17 to
14
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
4. ANA and DNA detect by indirect
immunoflouriscing technique, kits supplied
from
(ORGENTEC,CAT
NO870LOT870131)
Statistical analysis
Data was analyzed by Microsoft Office 2003
(excel) and Statistical Package for Social
Science (SPSS) version 16.
Parametric data was expressed as mean ± SD,
and non parametric data was expressed as
number and percentage of the total.
The mean and standard deviation (SD) were
calculated as follows:
33years, patients in this group proved to have no
cardiovascular disease
Group 2: ten patients suffering of SLE with
cardio vascular disease 2 of them were males
and 8 were females, their age ranged between
26 and 40 years, patients in this group proved to
have cardiovascular disease
All groups were subjected to
Full history taking, and full clinical
examination, ECG, and Eechocardiography
were done.
The following investigation were done to
patients and control blood sample were
obtained in tubes, one part was put in EDTA
tube for complete blood count & CD69 on
platelets and the other part was put in plain tube
for serum separation by centrifugation, part of
the serum were used for estimation of ANA, and
DNA and the other were used for estimation of
serum complement 3, liver function, renal
function tests. also urine analysis were done.
1. CBC was done using automated cell
counter (sismix ……..)
2. CD69 detected by flow cytometry model
Beckman coulter machine. Kits supplied by
(Beckman) (catalog V B.P177-13276
Maseillecedex France). Fifty ului of diluted
blood by phosphate buffer saline (PBs) was
added to 5ul of the mono clonal antibody
(antihuman CD69 FITC (conjugated). The
tubes vortexed and then incubated in the
dark at room temperature for 15 min-1.5ml
(NH4CL buffered with KHCO3 at PH7.2
)was added and then vortexed, the sample
was then ready for flow cytometer
processing.
3. C3 detection was done by radial immune
diffusion
plats
(Biocientifia
S.A
CAT.NO,NDO8-12) in this type of assay,
the procedure consists in an immuno
precipitation in agarose between antigen
and it's homologous antibody .it's
performed by incorporating anti body
uniformly throught layer of agarose gel and
then indtroducing the antigen into wells
duly pouched in the gell antigen diffuses
radially out of the wells into surrounding
gel antibody mixture, and the visible ring of
precipitation forms where the antigen and
antibody reacted. Quantitative relationship
dose exist between ring diameter and
antigen concentration, while the precipitate
is expanding. The ratio between ring
diameter and antigen concentration shows
linear ratio. The diffusion plate is evaluated
by using a reference table, end point
method. The normal value of C3 was 84
to193mg/dl.
∑ (Xi)
n
2
∑ (X - Xi)
SD =
n -1
Where, Σ: Sum.
(Xi): each value in the series.
n: number of values in the series.
Comparing the mean ± SD of 2 groups was
done using the paired t test
Mean (X) =
X-Y
SDp 1/nX + 1/nY
Where, t (df): value at the degrees of freedom.
df: degrees of freedom.
X: mean of sample X.
Y: mean of sample Y.
nX: number of sample X.
nY: number of sample Y.
SDp: pooled SD (SD of both samples).
t (df) =
Determining the extent that a single observed
series of proportions differs from a theoretical
or expected distribution was done using the Chi
square test
[Oi - Ei) - 1/2]2
X 2 c(df) =
Ei
Where, X2 (df): value at the degrees of freedom.
df: degrees of freedom.
Oi: Observed frequency.
Ei: expected frequency.
P value < 0.05 is considered significant
P value < 0.01 is considered highly sig P value
> 0.05 is considered non-significant(15)
RESULTS
The clinical and demographic data of patients
groups
15
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (1): Clinical and demographic data of patients groups
Parameter
Group I
Group II
AGE
17-33 years
26-40years
SEX
one male and 9 females
2 males and 8 females
6 patients
3 patients
Malar rash
3
patients
one patients
Oral ulcers
5 patients
4 patients
Photosensitivity
6 patients
5 patients
Arthritis
2 patients
One patients
Serositis
4 patients
3 patients
Renal disease
-ve
One patient
Neurological disease
-ve
4 patients with DVT
Venous disease
-ve
2 patients with PVD
Arterial disease
-ve
6 patients
MI
-ve
4 patients
IHD
+ve in all patients
+ve in all patients
ANA
+ve in all patients
+ve in all patients
Anti DNA
CBC
Aneamia8 patients
Aneamia6 patients and 3 patients thrompocytopenia
Table (2): Comparison between patients (group 1&2) and control regard CD69
CD69
Control
Group 1
Group 2
Mean
30.15
39.40
51.10
SD
14.86
17.49
16.03
Min
8.3
10
20
Max
46
64
70
T value
-1.274263046
-3.030542007
P value
0.218776745
0.007197701
The expression ofCD69 on platelets was significantly higher in group 2 than control group
(p0.0071)(table-2),and no significant difference in its level in group 1 (p=o.21) (table-2) when compared
to control group.
Table (3): Comparison between patients (group 1&2) regard CD69
CD69
Group 1
Mean
39.40
SD
17.49
Min
10
Max
64
T value
P value
Group 2
51.10
16.03
20
70
-1.55926
0.136343
CD 69
60
51.1
50
39.4
40
30.15
30
20
10
0
Control
SLE without CVD
SLE with CVD
Fig. (1): Comparison between patients and control regard CD69
16
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Also we found that the serum level of C3was lower in group 1 and in group 2 than control group
(p=0.00009) (p=0.0099) (table -2), and was higher in group 2 than group1 (p=0.00005)(table-3).
Table (4): Comparison between patients and control regard C3
C3
Control
SLE without CVD
Mean
116.50
77.30
SD
18.95
5.44
Min
98
66
Max
153
84
T value
6.287242
P value
0.000091
Table(5): Comparison between patients (group 1&2) regard C3
C3
SLE without CVD
Mean
77.30
SD
5.44
Min
66
Max
84
T value
P value
SLE with CVD
96.90
6.19
89
109
3.1088057
0.0099466
SLE with CVD
96.90
6.19
89
109
-7.52241
0.000005
C3
140
120
116.5
96.9
100
77.3
80
60
40
20
0
Control
SLE without CVD
SLE with CVD
Fig (2): Comparison between patients and control regard C3:
Fig. (3): CD expression on platelet from control one
17
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Fig. (4): CD69 expression on platelet from SLE one
Fig. (5): CD69expression on platelet from SLE patient with cardiovascular disease.
erythematosus (SLE). Overall SLE patients
have a 5-6-fold increased risk of CHD and this
excess risk is especially pronounced in younger
women where the excess risk may be >50-fold.
risk factors alone do not completely explain the
excess risk observed(18).
The underlying mechanisms of increased
risk of VD in SLE are unclear and the role of
platelets not examined in this study we present
strong association between CD69 in platelet and
cardiovascular disease.
CD 69 is a marker of activation of
inflammatory cells .it is suspected in pathology
of vascutitis and possibly in platelet
aggregation(11).
In the present study we found that CD 69
expression on platelets were markedly higher in
SLE patients with cardiovascular disease than
DISCUSSION
SLE is a chronic multi system autoimmune
disease with abroad rang of clinical
manifestation including photosensitive skin
rashes discoid lesions arthritis arthraligia
nephritis cardiac and pulmonary disease and
CNS disorder. The pathogenesis is attributed to
circulating antinuclear antigens and dysfunction
of T and B lymphocyte and dendrities cells(16).
Patients with systemic erythematosis have a
markedly
increased
risk
to
develop
cardiovascular
disease
and
traditional
cardiovascular risk factor fail to account for this
increased risk(17)
Premature coronary heart disease (CHD)
has emerged as a major cause of morbidity and
mortality in patients with systemic lupus
18
Egyptian Journal of Medical Microbiology, January 2012
in healthy control and also we found that CD 69
expression are significantly higher in patients
with SLE patients with cardiovascular disease
than SLE patients without cardiovascular
disease .
Consistent with that idea Christian et al.(16)
shows that CD 69 was found to be upregulated
in platelets from SLE patients especially in
patients with previous episodes of M I, and this
also agree with Healy(10) shows that CD 69 was
the most significant probe set showing increased
expression in myocardial infraction of allowed
by MRP-14 protein, CD 69 is a constitutively
expression protein on platelets and the platelets
CD 69 m RNA level has been identified as a
strong discriminator of acute st-segment
elevation MI.
Although the role of C3 in atherogenesis
remain unclear there is evidence that in the
general population C3 levels correlate with
waist circumference and postprandial lipemia
suggesting a possible mechanism related to
more traditional risk factors(19)
Among our results C3 was significant
decreased in SLE patients with and without
myocardial infarction when compared to control
group .in agreement with our finding Yang et
al. (20) reported lower C3 and C4 levels are
traditionally associated with lupus pathogenesis
and lupus activation .and also agree with Bao et
al.(21) suggested that low concentrations of
complement components due to increased
catabolism are found in majority of patients
with active and severe SLE.
In this study also we found that C3 levels
was
increased in SLE patients with
cardiovascular disease than SLE without
cardiovascular disease and this agree with
Manger et al.(22) whom suggest that elevated
C3 levels were predictive of coronary artery
calcification and were more commonly found to
be associated with symptomatic coronary heart
disease in women with SLE and also agree with
Trina et al.(23) whom assume that higher serum
C3 levels and immuno suppressant use at base
line were related to progression of carotid
intimedia thickness and plague in women with
systemic lapus .
These finding suggest that Platelets with
CD69 expression seem to more activated and
may contribute to development of vascular
complication in patients of SLE so CD69
expression on platelets may serve as
predictive marker of CVD complication in
patients with SLE.
Vol. 21, No. 1
REFERNCES
1.
Bengtsson, T, ruedsson L, (2000):
Activation of type I interferon system in
systemic lupus erythematosus correlates
with disease activity but not with
antiretroviral antibodies. Lupus ,9(9):664671
2. Crow MK, Kirou KA (2004): Interferonalpha in systemic lupus erythematosus.
CurrOpinRheumatol;16(5):541-547.
3. Doria A, SarLzi-Puttini P, et al (2005):
Cardiovascular involvement in systemic
lupus erythemathosus. Lupus; 14:683-6.
4. Doria A, Shoenfeld Y, Pauletto P. (2004):
Premature coronary disease in systemic
lupus. N Eng J Med;350:15 2
5. Deborah
P.
M.
Symmons&SherineE.andGabriel(2011)Epi
demiology of CVD in rheumatic disease,
with a focus on RA and SLE Nature
Reviews Rheumatology7, 399-408 .
6. Kaplan MJ (2009): Premature vascular
damage in systemic lupus erythematosus.
Autoimmunity;42(7):580-85 .
7. Joseph JE, Harrison P, Mackie IJ, et al
(2001): Increased circulating plateletleucocyte complexes and platelet activation
in patients with antiphospholipid syndrome,
systemic
lupus
erythematosus
and
rheumatoid
arthritis.
Br
J
Haematol;115(2):451-459.
8. Ekdahl KN, Bengtsson AA, Andersson J,
et al(2004): Thrombtic disease in systemic
lupus erythematosus is associated with a
maintained systemic platelet activation. Br
J Haematol ;125(1):74-78.
9. Vanek O, Nalezkova M, Kavan D, et al
(2008): Soluble recompinant CD69
receptores optimized to have an exceptional
physical and chemical stability display
prolonged circulation and remain intact in
blood of mice.FEBS J.275:5589-5606.
10. Healy AM, Pickard MD, Pradhan AD et
al. (2006): Platelet expression profiling
and clinical validation of myeloid-related
protein-14 as a novel determinant of
cardiovascular events. Circulation 113 (19):
2278-2284.
11. Suzuki Kazou (2006): Interaction Of
neutrophil and platelets mediated by CD69
molecules in onset process of vasculitis
Japanese journal of thrombosis and
hemostasis. vol 17 : no.2 page 223-229
12. Matsuyama
W,
Nakagawa
M,
Takashima H, Muranaga F, Sano Y,
Osame M (December 2001). "Molecular
analysis of hereditary deficiency of the
19
Egyptian Journal of Medical Microbiology, January 2012
13.
14.
15.
16.
17.
third component of complement (C3) in
two sisters". Intern. Med. 40 (12): 1254–8.
Sahu A, Lambris JD (April 2001).
"Structure and biology of complement
protein C3, a connecting link between
innate and acquired immunity". Immunol.
Rev. 180: 35–38doi:10.1034/j.1600-2001.
G. Sturfelt and L. Truedsson (October
2005) 1mplement and its breakdown
products in Rheumatology ,44(10): 12271232.
Sokal, Robert R., and F. James (1995):
The Principles and Practice of Statistics in
Biological Research. 2nd ed. New York: W.
H. Freeman, 1995.
Christian Lood1, Stefan Amisten,
Birgitta Gullstrand et al (2010): Platelet
transcriptional
profile
and
protein
expression in patients with systemic lupus
erythematosus: up-regulation of the type I
interferon system is strongly associated
with vascular disease .Blood September
16,vol 116 no.11,1951-1957
Rheumatology (Oxford). (2005): Not
only...but also': factors that contribute to
accelerated atherosclerosis and premature
18.
19.
20.
21.
22.
23.
Vol. 21, No. 1
coronary heart disease in systemic lupus
erythematosus. Dec;44(12):1492-502.
Rubin LA, Urowitz MB, and Gladman
1985. Mortality in systemic lupus
erythematosus: the bimodal pattern
revisited. Q J Med ;55(216):87-98.
Kathleen M – Mckinnon – Laurrence.S –
Magder–Michelle (2006) predictor of
carotid atherosclerosis inSLE – the Journal
of rheumatology :33:2458:63
Yang L, Taog J, Tang X (2011) journal of
european academy of dermatology and
venerology 6,95-101
Bao L, Quigg R J (2007): Complement in
lupus nephritis: the good , the bad , and
unknown .semin nephrol ; 27:69-80.
Manger K, Bozzoli C, Forster C. et al
(2003). Factors associated with coronary
artery calcification in young female patients
with SLE -ANN RHEUM DIS:62:846-50
Trina T , Kim S , Rachel P et al (2008).
Progression of carotid intima – media
thickness and plaque in women with
systemic lupus erythematosus. Arthritis &
rheummarism .vol 58,no.3 march, pp835-8.
‫ ﻓﻲ ﻣﺮﺿﻲ اﻟﺬﺋﺒﻪ اﻟﺤﻤﺮاء ﻣﻊ أﻣﺮاض اﻟﻸوﻋﻴﻪ اﻟﺪﻣﻮﻳﻪ واﻟﻘﻠﺐ‬٦٩ ‫ﺗﻤﺜﻴﻞ ﺳﻰ دى‬
**‫ ﻧﻴﻔﻴﻦ ﻣﺤﻤﺪ أﺣﻤﺪ* ﻟﻤﻴﺎء إﺳﻤﺎﻋﻴﻞ اﺣﻤﺪ‬-‫ﺻﺒﺎح إﺑﺮاهﻴﻢ ﻋﺒﺪ اﻟﺮﺣﻴﻢ‬
.‫اﻗﺴﺎم اﻟﺘﺤﺎﻟﻴﻞ اﻟﻄﺒﻴﻪ*اﻻﻣﺮاض اﻟﺒﺎﻃﻨﻴﻪ **آﻠﻴﻪ ﻃﺐ اﻟﺒﻨﺎت ﺟﺎﻣﻌﺔ اﻻزهﺮ‬
‫ ﻋﻠﻲ اﻟﺼﻔﺎﺋﺢ اﻟﺪﻣﻮﻳﻪ ﻓﻲ اﻟﻤﺮﺿﻰ اﻟﺬﻳﻦ ﻳﻌ ﺎﻧﻮن ﻣ ﻦ ﻣ ﺮض اﻟﺬﺋﺒ ﻪ‬٦٩ ‫وﺳﻰ دى‬٣‫أﺟﺮى هﺬا اﻟﺒﺤﺚ ﻟﻘﻴﺎس اﻟﻜﻮﻣﺒﻠﻴﻤﻨﺖ‬
-: ‫اﻟﺤﻤﺮاء وﺗﻢ ﺗﻘﺴﻴﻢ اﻟﻤﺮﺿﻲ اﻟﻲ ﻣﺠﻤﻮﻋﺘﻴﻦ‬
(‫ﻣﺠﻤﻮﻋﻪ اﻟﻤﺮﺿﻰ اﻟﺬﻳﻦ ﻳﻌﺎﻧﻮن ﻣﻦ ﻣﺮض اﻟﺰﺋﺒﻪ اﻟﺤﻤﺮاء )وآﺎن ﻋﺪدهﻢ ﻋﺸﺮﻩ ﻣﺮﺿﻲ‬-١
‫ ﻣﺠﻤﻮﻋﻪ اﻟﻤﺮﺿﻰ اﻟﺬﻳﻦ ﻳﻌﺎﻧﻮن ﻣﻦ ﻣﺮض اﻟﺰﺋﺒﻪ اﻟﺤﻤﺮاء ﻣﻊ ﻣﻊ أﻣﺮاض اﻟﻸوﻋﻴﻪ اﻟﺪﻣﻮﻳﻪ واﻟﻘﻠﺐ )وآﺎن ﻋﺪدهﻢ‬-٢
(‫ﻋﺸﺮﻩ ﻣﺮﺿﻲ‬
‫آﻤ ﺎ ﺗ ﻢ ﻓﺤ ﺺ ﻋ ﺸﺮﻩ اﺷ ﺨﺎص اﺻ ﺤﺎء آﻤﺠﻤﻮﻋ ﻪ ﺿ ﺎﺑﻄﻪ وﻗ ﺪ ﺗ ﻢ ﻓﺤ ﺼﻬﻢ ﻓﺤ ﺼﺎ اآﻠﻴﻨﻴﻜﻴ ﺎ ﺷ ﺎﻣﻼ وﺗ ﻢ ﻗﻴ ﺎس ﻣ ﺴﺘﻮي‬
. ‫ ﻋﻠﻲ اﻟﺼﻔﺎﺋﺢ اﻟﺪﻣﻮﻳﻪ‬٣٣‫ وﺳﻲ د ي‬٣‫اﻟﻜﻮﻣﺒﻠﻴﻤﻨﺖ‬
‫ آﺎن ﻣﺮﺗﻔﻌﺎ إﺣ ﺼﺎﺋﻴﺎ ﻓ ﻰ ﻣﺮﺿ ﻲ اﻟﺬﺋﺒ ﻪ اﻟﺤﻤ ﺮاء وﻳﻌ ﺎﻧﻮن ﻣ ﻦ ﻣ ﻀﺎﻋﻔﺎت اﻷوﻋﻴ ﻪ‬٦٩‫وﻗﺪ اوﺿﺤﺖ اﻟﻨﺘﺎﺋﺞ ان ﺳﻲ دي‬
٣‫ﻟﺪﻣﻮﻳﻪ واﻟﻘﻠﺐ ﺑﺎﻟﻤﻘﺎرﻧﻪ ﺑﺎﻻﺻﺤﺎء وﻋﻦ اﻟﻤﺮﺿﻲ اﻟﺬﻳﻦ ﻳﻌﺎﻧﻮن ﻣ ﻦ اﻟﺬﺋﺒ ﻪ اﻟﺤﻤ ﺮاء ﻓﻘ ﻂ آﻤ ﺎ وﺟ ﺪ ان ﻣ ﺴﺘﻮي اﻟﻜﻮﻣﺒﻴﻠﻴﻤﻨ ﺖ‬
‫آﺎن ﻣﻨﺨﻔﻀﺎ إﺣﺼﺎﺋﻴﺎ ﻓﻲ ﻣﺮﺿﻲ اﻟﺬﺋﺒﻪ اﻟﺤﻤﺮاء ﺑﺎﻟﻤﻘﺎرﻧﻪ ﺑﺎﻻﺻﺤﺎء وﻟﻜﻨﻬﺎ آﺎﻧﺖ ﻣﺮﺗﻔﻌﻪ ﻓﻲ ﻣﺮﺿﻲ اﻟﺬﺋﺒ ﻪ اﻟﺤﻤ ﺮاء اﻟ ﺬﻳﻦ‬
.‫ﻳﻌﺎﻧﻮن ﻣﻦ ﻣﻀﺎﻋﻔﺎت اﻷوﻋﻴﻪ ﻟﺪﻣﻮﻳﻪ واﻟﻘﻠﺐ ﻋﻦ ﻣﺮﺿﻲ اﻟﺬﺋﺒﻪ اﻟﺤﻤﺮاء ﻓﻘﻂ‬
‫ ﻣ ﻦ اﻟﻤﻤﻜ ﻦ ان ﻳﻜ ﻮن ﻣ ﻦ دﻻﺋ ﻞ ﻣ ﻦ ﻣ ﻀﺎﻋﻔﺎت اﻷوﻋﻴ ﻪ ا ﻟﺪﻣﻮﻳ ﻪ واﻟﻘﻠ ﺐ ﻓ ﻲ‬٦٩‫وﻣﻦ هﺬ اﻟﺒﺤﺚ ﻧﺴﺘﺨﻠﺺ ان ﺳ ﻲ دي‬
.‫ﻣﺮﺿﻲ اﻟﺬﺋﺒﻪ اﻟﺤﻤﺮاء‬
20
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
The Role of Ica Operon and Biofilm Formation in Coagulase
Negative Staphylococcal Infection
Ashwak M.F. Abu Taleb, Mervat S. Mohamed,
Randa S. Abdel-Latif and Manar Gouda
Microbiology & Immunology Department, Faculty of Medicine, Zagazig University
ABSTRACT
Coagulase negative staphylococci are normal skin commensals and are frequently isolated from clinical
specimens. CoNS are a major cause of sepsis in the neonatal intensive care unit. The virulence of these
bacteria is mainly due to their ability to form biofilms on indwelling medical devices. One important
element in this process is the ica operon (intercellular adhesion operon), a gene cluster encoding the
production of polysaccharide intercellular adhesion (PIA), which mediates the intercellular adherence of
bacteria and the accumulation of multilayer biofilm . This work aimed to evaluate that pathogenic CoNS
isolates are more likely to be positive for the ica operon and to produce biofilm than isolates isolated
randomly from healthy individuals. Also to compare between antibiotic sensitivity of biofilm producing
CoNS isolates and non-biofilm producing CoNS isolates. Finally to detect source of infection in neonatal
intensive care unit using biotyping, antibiogram and plasmid profile as epidemiological markers. This
study was conducted from April 2010 to April 2011, at Medical Microbiology and Immunology
Department, Faculty of Medicine Zagazig University. The study included 40 neonates admitted to NICU,
with picture of bacteremia with the mean age 17.43± 7.2 days. From them 40 blood samples were taken
from peripheral sites and 40 skin swabs were taken from axilla for culture on blood culture bottles and
blood agar respectively. 40 age matched healthy neonates as control group and 25 health care workers
from NICU to detect source of infection were enrolled in the study. The biofilm production was examined
using congo red agar and the presence of genes icaA, icaD were determined by PCR. Biotyping,
antibiogram and plasmid profiles were used as epidemiological markers to detect source of infection in
NICU. The isolated CoNS were (32.5% , 37.5%, 20% and 24 from blood samples, skin swabs, control
and health care workers respectively and the most common isolated organism was S. epidermidis
followed by S. haemolyticus then S. hominis. Also the results of qualitative detection of biofilm formation
were 69.2%, 33.3% and 33.3% from the studied specimens respectively but all control were non-biofilm
forming. The icaA and icaD genes were 76.9% , 40% and 33.3% from studied specimens respectively but
both genes were not found in any control isolates. We conclude that the isolates of CONS infections are
more likely to be positive for ica operon and health care workers play a role in dissemination of CONS
infection in hospital.
associated with a significant increase in
morbidity, mortality, duration of hospital stay
and overall cost of treatment 3.
Sepsis due to CoNS is common in the
NICU. The incidence of CoNS sepsis varies
between 1.3 and 19.9% depending on birth
weight and gestational age. Most of these
infections respond well to vancomycin, the first
drug of choice. A minority of neonates develops
a persistent staphylococcal bacteremia, which
does not respond to vancomycin. For these
neonates rifampin may be a safe and effective
additive treatment to vancomycin4.
The virulence of these bacteria is mainly
due to their ability to form biofilms on
indwelling medical devices. Biofilm related
infections often fail to respond to antibiotic
chemotherapy guided by conventional antibiotic
susceptibility tests 5.
The mechanism by which CoNS attach to
prosthetic material and elaborate biofilm is
INTRODUCTION
Coagulase negative staphylococci (CoNS)
are normal inhabitants of human skin and
mucous membranes. They have long been
dismissed as culture contaminants. Later on
CoNS are recognized as etiologic agents of wide
variety of infections. CoNS play a role in
bacteremia, central nervous system shunt
infection, endocarditis, urinary tract infection,
surgical site infection, endophthalmitis, foreign
body infection and many other infections.
Patients with CoNS infections are usually
immunocompromised, with indwelling or
implanted foreign bodies 1.
CoNS are a major cause of sepsis in the
neonatal intensive care unit (NICU) especially
late onset sepsis in preterm infants 2.
Approximately 17% of very low birth
weight (<1500gm) neonates develops an
episode of CoNS bacteremia and this event is
21
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
females, with mean age 17.43± 7.2 days
and age range 1-30 days) with picture of
suspected bacteremia (as suspected
clinically by NICU doctor). 40 blood
samples were taken from peripheral sites
and 40 skin swabs were taken from axilla.
2. Control included 40 healthy neonates who
had no features of sepsis chosen randomly
(24 males and 16 females, with mean age
16.8± 7.6 days and age range 1-30 days).
From them 40 skin swabs were taken from
axilla.
3. Health care workers included 25 health
care workers from NICU (19 females and 6
males, with mean age 28.5±6 years and age
range from 20 to 35 years). They were 5
doctors, 15 nurses and 5 workers (skin
swab were taken to detect source of
infection).
Methods:
Blood samples were cultured on blood
culture bottles, and skin samples were plated on
blood agar and incubated at 37°C for 24 h 2.
1- Identification of CoNS (according to
Barid11).
Species identification was performed by using
the API Staph 2.
2- Antibiotic susceptibility testing: as
recommended by ( NCCLS ) was performed by
using disk diffusion method: using antibiotic
discs (Penicillin (P) 10 units. Ampicillin (AMP)
10 µg. Amoxicillin-clavulanate (AMC) 20
µg+10 µg. Methicillin (ME) 5 µg. Cephradine
(CE) 30 µg. Vancomycin (VA) 30 µg.
Gentamycin (CN) 10 µg. Tetracycline (TE) 30
µg. Chloramphenicol (C) 30 µg. Erythromycin
(E) 15 µg. Ciprofloxacin (CIP) 5 µg. Rifampin
(RA) 5µg ).
3- Detection of biofilm production:
Qualitative detection was done by using congo
red agar (CRA). The medium was composed of
brain heart infusion broth (Oxoid) (37 gm/l),
sucrose (Sigma) (5 gm/l), agar number 1(Oxoid)
(10 gm/l) and congo red dye (Sigma) (0.8 gm/l).
Black colonies with a dry crystalline
consistency indicated biofilm production while
red colonies indicate no biofilm production12,13.
4 - Detection of the icaA and icaD operon:
DNA extraction:
- Chromosomal DNA was extracted from
isolated colonies by using QIAamp® DNA Mini
kit (Qiagen GmbH, Hilden, Germany).
DNA amplification:
PCR-GOLD Master-Mix Beads (Bioron, The
ENZYME Company, Germany).Each bead
contains all of the necessary reagents, except
primer and templet for performing a 20 ul PCR
amplification reaction.
being increasingly understood. This is a
complex and multistep process 6.
One important element in this process is the
ica operon (intercellular adhesion operon), a
gene cluster encoding the production of
polysaccharide intercellular adhesion (PIA),
which mediates the intercellular adherence of
bacteria and the accumulation of multilayer
biofilm 7.
The operon is composed of five genes,
icaA, icaD, icaB, icaC and icaR. IcaA and icaD
were chosen to be tested in this study due to
their importance in the operon, as they code for
proteins (icaA,D) that together represents a
novel enzyme combination that is responsible
for the production of PIA 8.
CoNS have become the leading cause of
infections due to its biofilm formation.
Numerous studies have shown that coagulase
negative staphylococci biofilm formation is a
two step process, in which bacteria first adhere
to the surface (initial attachment phase), and
subsequently form cell to cell aggregates and a
multilayered
architecture
(accumulative
phase).In the accumulative phase the PIA,
encoded by the ica ADBC locus is the major
component mediating intercellular adhesion 9.
Multiresistant staphylococci frequently
cause nosocomial infections. Also many
staphylococcal
antibiotic
resistance
determinants are plasmid encoded. The wide
variety of plasmids present in staphylococci has
made the use of plasmid profiles convenient for
studying outbreaks caused by these bacteria 10.
The aim of this study was to evaluate that
pathogenic CoNS isolates are more likely to be
positive for the ica operon and to produce
biofilm than isolates isolated randomly from
healthy individuals. Also to compare between
antibiotic sensitivity of biofilm producing CoNS
isolates and non-biofilm producing CoNS
isolates. To detect source of infection in
neonatal intensive care unit using biotyping,
antibiogram
and
plasmid
profile
as
epidemiological markers.
SUBJECTS, MATERIAL &
METHODS
This work was carried out in the
Microbiology & Immunology Department and
neonatal intensive care unit (NICU), Faculty of
medicine, Zagazig University in the period from
April 2010 to April 2011.
Subjects:
1. Patients included 40 neonates admitted to
NICU, Pediatric Department, Zagazig
University Hospitals (22 males and 18
22
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
skin swabs, eight CoNS isolates (20%) were
isolated from 40 control and 6 CoNS isolates
(24%) were isolated from 25 health care
workers, 5 isolates were isolated from nurses
and only 1 isolate from workers.
Table (2) shows that S. epidermidis was the
most commonly isolated organism. There was
no statistically significant difference between
patients, control and health care workers as
regarding species.
Table (3) shows that there was statistically
significant difference between patients, control
and health care workers as regarding their
ability to produce biofilm, presence icaA gene
and icaD gene.
There was complete agreement between the
results obtained from detection of both icaA and
icaD genes. All positive icaA were also positive
for icaD and all negative icaA were also
negative for icaD.
Table (4) shows that there was very good
agreement between two tests regarding Kappa
factor.
All isolates were 100% sensitive to
vancomycin and rifampicin. The resistance to
different antibiotics is higher in biofilm forming
isolates than in non-biofilm forming isolates.
There was statistically significant difference
between them. Table (5) 34 CoNS isolated from
patients and HCW has been classified into 14
groups.
Table (6) shows that the isolated CoNS
strains from patients and HCW (34 isolates)
were found to have 9 different plasmid profiles;
it was found that 21 strains (61.8%) harbored
plasmid of different sizes. The molecular weight
of plasmids ranged from 1.3 to 14 MDa and the
number of plasmids ranged from 1 to 4. Plasmid
profiles of the isolated CoNS showed that 13
strains were plasmidless, 10 strains had a single
plasmid, 5 strains had 2 plasmids, 5 strains had
3 plasmids, while 1 strain had 4 plasmids.
Health care workers play a role in
dissemination of CoNS infections in NICU.
Only two CoNS isolates which were isolated
from hands of nurses were proved to be the
source in 3 cases of neonatal septicemia. These
2 nurse strains were multidrug resistance,
contain plasmids, biofilm producer and contain
ica genes. One strain was S. epidermidis, the
other was S. haemolyticus.
Also there were 2 strains which were
biofilm non producer but ica gene positive, one
was isolated from blood and the other strain was
isolated from skin, both were plasmidless and
non multidrug resistance.
Primers (Qiagen): for PCR amplification
For detection of icaA,
Forward primer sequence is:
5'-TCTCTTGCAGGAGCAATCAA -3
Reverse primer sequence is:
5'-TCAGGCACTAACATCCAGCA-3
For detection of icaD,
Forward primer sequence is:
5'-ATGGTCAAGCCCAGACAGAG-3
Reverse primer sequence is:
5'-CGTGTTTTCAACATTTAATGCAA-3
Primers were designed to give a predicted
product size of 188- bp for icaA gene and 198bp for caD gene13 (Bioron, The ENZYME
Company, Germany). 4 µl (25 pmol) of each
primer, 2 µl of template DNA and sterile
distilled water to a total volume of 20 µl. The
amplification was performed in a DNA thermal
cycler (DNA thermal cycle – Elmer, Cetus,
Norwalk, CT, USA), for 30 cycles,
Denaturation at 94°C for 1min, annealing at 60
°C for 1min for icaA and at 59°C for 1 min for
icaD, extension at 72°C for 2.5 min, then final
extension at 72°C for 10 min 2.
Detection of the amplified product were
detected by gel electrophoresis in parallel with a
molecular weight marker.
5– plasmid DNA analysis : Plasmid was
extracted from the clinical isolates by using
QIAprep® Spin Miniprep kit (Qiagen GmbH,
Hilden, Germany). The QIAprep miniprep
procedure is based on alkaline lysis of bacterial
cells followed by adsorption of DNA onto silica
in the presence of high salt. The unique silica
membrane used in QIAprep Miniprep Kits
completely replaces glass for plasmid
minipreps. The QIAprep Miniprep procedure
was analyzed using agarose gel electrophoresis.
Ten µl of the plasmid DNA preparation were
removed to a clean microcentrifuge tube and 5
µl of the loading buffer was added to the
microcentrifuge tube. The samples were loaded
to 0.8% agarose gel and molecular weight
marker (1000-20000) was run in parallel. The
gel was visualized by UV transilluminator at
320 nm wavelength and photographed.
RESULTS
Table (1) Shows that neonate group
included patients (40 neonates with picture of
suspected bacteremia from them 40 blood
samples and 40 skin swabs were taken), control
(40 healthy neonates from them 40 skin swabs
were taken) and health care workers (25 health
care workers from NICU). 13 CoNS isolates
(32.5%) were isolated from 40 blood samples,
15 CoNS isolates (37.5%) were isolated from 40
23
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (1): Demographic data of the studied groups and Numbers, percentages of CoNS isolates
from different groups.
CoNS isolates
Neonate group
No. of Clinical
No.
of Gender Age (Range )
persons specimens
specimens M F
No.
%
Patients
40
Blood samples
40
22 18 1-30 days
13
32.5
Skin swabs
40
22 18 1-30 days
15
37.5
Control
40
Skin swabs
40
24 16 1-30 days
8
20.0
Health care workers
25
Skin swabs
25
6
19 20-35 years
6
24.0
Table (2): Species identification by API Staph of CoNS isolated from neonate group.
Control
Health care worker
Patient isolates
isolates ( 8 ) isolates ( 6 )
Specimens
No.
%
No.
%
Blood (13 ) Skin ( 15 )
N0.
%
No.
%
S. epidermidis
7
53.8 10
66.7
6
75.0
3
50.0
S. haemolyticus
4
30.8 4
26.7
1
12.5
2
33.3
S. hominis
1
7.7
1
6.6
1
12.5
1
16.7
S. xylosus
1
7.7
0
0.0
0
0.0
0
0.0
Table (3): PCR for icaA , icaD and Biofilm formation of CoNS isolates.
Patient isolates
Control
Health care worker
Neonatal group
isolates ( 8 )
isolates ( 6 )
Blood ( 13 )
Skin ( 15 )
Biofilm
Positive strains
9 (69.2%)
5 (33.3%)
0 (0.0%)
2 (33.3%)
Negative strains
4 (30.8%)
10 (66.7%) 8 (100%)
4 (66.7%)
icaA
Positive strains
10 (76.9% )
6 ( 40.0%)
0 (0.0%)
2 (33.3%)
Negative strains
3 (23.1% )
9 ( 60.0%)
8 (100%)
4 ( 66.7%)
icaD
Positive strains
10 (76.9%)
6 ( 40.0%)
0 ( 0.0%)
2 ( 33.3%)
Negative strains
3 (23.1%)
9 ( 60.0%)
8 (100%)
4 ( 66.7%)
X2
P
1.44
1.0
-----
0.69
0.78
-----
X2
P
10.5
0.01
12.43
0.00
12.43
0.00
Table (4): Relation between slime production and presence of ica genes by PCR among 40 patients.
PCR
Total &
Kappa P
percentage
Positive
Negative
14
0
14 (50%)
Biofilm Positive
0.85
0.00
2
12
14 (50%)
Negative
16 (57.1%)
12 (42.9%)
28
Total & percentage
24
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (5): Antibiogram of CoNS isolated from patients and HCW .
Group
A
B
C
D
E
F
G
H
I
J
K
L
M
N
No. of
isolates
(34 )
Resistant pattern ( 12 discs )
P,AMP,AMC,ME,CE,CN,TE,C,E,CIP
P,AMP,AMC,ME,CE,CN,TE,E,CIP
P,AMP,AMC,ME,CE,CN,TE,C,E
P,AMP,AMC,ME,CE,CN,C,CIP
P,AMP,AMC,ME,CE,CN,C,E
P,AMP,AMC,ME,CE,TE,C,E
P,AMP,AMC,ME,CN,C,CIP
P,AMP,AMC,CE,CN,TE,E
P,AMP,AMC,CN,TE,E
P,AMP,AMC,CE,E,CIP
P,AMP,AMC,E
P,AMP,CN,E
P,AMP,AMC
---------
8
8
5
1
1
1
1
1
1
1
1
1
2
2
Sources
Health care
Patient isolates
worker
Blood
Skin
isolates isolates isolates ( 6 )
4
3
1
2
4
2
4
0
1
0
1
0
0
1
0
0
1
0
0
1
0
1
0
0
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
0
1
1
Table (6): Plasmid profile of CoNS isolated from patients and HCW.
Pattern
Number
I
II
III
IV
V
VI
VII
VIII
IX
M.W of detected plasmid in
kpb
plasmidless
2.465 kpb (1.6 MDa)
2.589 kpb (1.7 MDa)
10.000 kpb (6.6 MDa)
2.787 kpb (1.8 MDa)
15.874 kpb (10.5 MDa)
2.405 kpb (1.6 MDa)
21.14 kpb (14 MDa)
1.948 kpb (1.3 MDa)
3.224 kpb (2.1 MDa)
9.147 kpb (6.1 MDa)
2.265 kpb (1.5 MDa)
8.305 kpb (5.5 MDa)
21.14 kpb (14 MDa)
1.948 kpb (1.3 MDa)
2.265 kpb (1.5 MDa)
7.248 kpb (4.8 MDa)
21.14 kpb (14 MDa)
21.14 kpb (14 MDa)
No. of
isolates
( 34 )
13
2
2
3
2
Sources
Patient isolates
Blood isolates Skin isolates
( 13 )
( 15 )
3
8
0
1
2
0
1
2
1
1
Health care
worker
isolates ( 6 )
2
1
0
0
0
3
1
1
1
2
1
1
0
3
2
0
1
1
1
0
0
3
1
1
1
25
Egyptian Journal of Medical Microbiology, January 2012
Fig. (1): PCR detection of icaA gene
Lane 1, 8 DNA molecular weight markers
Lane 7 negative control
Lane 3, 4 negative strains
Lane 2, 5, 6 positive strains (188-bp)
Vol. 21, No. 1
Fig. (2 ): PCR detection of icaD gene
Lane 1, 8 DNA molecular weight markers
Lane 7 negative control
Lane 3, 4 negative strains
Lane 2, 5, 6 positive strains (198-bp)
Fig. (3): Plasmid profile of some of the studied CoNS isolates.
Lane 1 shows molecular weight marker
Lane 2 shows 1 plasmid (10.000 bp)
Lane 3 shows 2 plasmids (2787, 15874 bp)
Lane 4, 6, 7 show plasmidless strains
Lane 5 shows 1 plasmid (2589 bp)
Lane 8 shows 3 plasmids (2265, 8305, 21140 bp)
by which it can cause severe and irreducible
infections 15.
Slime production is under genetic control
and is mediated by the ica operon, a
polysaccharide intercellular adhesion (PIA) is
synthesized, this supports cell to cell bacterial
contact by means of a multilayered biofilm 16.
Biofilm impair the penetration of antibiotics,
normal immune responses and increase
difficulty of eradicating biofilm infections 17.
Our results show that out of 40 patients,13
CoNS isolates (32.5%) were isolated from 40
blood samples, 15 CoNS isolates (37.5%) were
DISCUSSION
Coagulase negative staphylococci are
normal inhabitants of human skin and mucous
membranes. They have long been dismissed as
culture contaminants, but now CoNS are a
major cause of nosocomial and health care
related infections. CoNS are the major cause of
sepsis in NICU 14.
The pathogenic potential of this commensal
organism is not clearly known and may be due
to ability to adhere to biomaterial and
production of extracellular slime, a mechanism
26
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
commensal
flora by hospital strains.
Widerstrom et al 23 stated that colonization of
patients with CoNS precedes infection with
these organisms.
The difference in these results may be
explained by the difference in locality and
environmental conditions, taking in mind the
fact that the ability of biofilm production
although controlled by a chromosomal gene,
this gene can be transferred from one strain to
another by conjugation and so can be more
predominant or less predominant in different
localities 24.
None of the isolates of control group
(commensals) included in our study shows the
ability to produce biofilm. These results are the
same results obtained by Arciola et al 13 and de
silva et al 2 . This can be explained by the fact
that biofilm production is a virulent factor and
the control isolates which is comprised from
commensal strains are not virulent 24.
In our study for the genetic basis of biofilm
production the ica operon was chosen. This
choice depends on the fact that, although the
genetic basis of biofilm formation in CoNS is
multifactorial, synthesis of a polysaccharide
adhesion by ica ADBC-encoded enzymes is the
best understood mechanism of CoNS biofilm
development 25.
Our results show that 10 isolates (76.9%)
out of 13 CoNS isolated from blood samples
and 6 isolates (40%) out of 15 CoNS isolated
from skin samples contain icaA gene. The gene
was not found in any of the control isolates.
Among 6 CoNS isolated from health care
workers, only 2 isolates (33.3%) contain icaA
gene.
In another study, PCR method used for
detection of ica operon was very sensitive
among CoNS species isolated from blood of
infected neonates and from the skin of infected
and healthy ones. They reported that 40% of
CoNS strains were positive for ica operon 2.
Our PCR results had shown that both icaA
and icaD gene are either present in certain strain
or absent, and no single strain had shown the
presence of one gene. Our results regarding this
point agree with results of Arciola et al 13 and de
silva et al2.
These results confirm the fact that both
genes are part of one operon and so, either the
entire operon is present or absent 24.
In this study, both the icaA and icaD genes
are present in all biofilm producing strains; this
indicates that the presence of both genes is
essential for biofilm production. This result is
supported by the results of a study done by
Mack et al26, who had inactivate each gene
isolated from 40 skin swabs samples, eight
CoNS isolates (20%) were isolated from 40
control and 6 CoNS isolates (24%) were
isolated from 25 health care workers.
These results agree with the results of de
silva et al 2 who found that CoNS are a major
cause of sepsis in NICU. Also these results go
well with results of Dobbins 18 who found that
37% of infections were caused by CoNS.
This study shows that S. epidermidis was
the predominant CoNS among blood samples,
skin swabs of patients, control and health care
workers
(53.8%,
66.7%,
75%,
50%
respectively), followed by S. haemolyticus then
S. hominis and S. xylosus.
These results agree with results of Koura et
al 19 who reported that S. epidermidis was the
predominant CoNS (79.0%), S. haemolyticus
(4.6%), S. hominis (2.3%) and S. xylosus
(2.3%).
We aimed to evaluate that ica operon and
biofilm production are associated with CoNS
diseases. The biofilm production was examined
using qualitative congo red agar (CRA), and the
presence of genes icaA, icaD was determined by
PCR.
Congo red agar method has significant
clinical applicability; it can be used in routine
diagnostic bacteriology laboratory. Because of
its rapidity, the results of the test could be
provided along with the final culture and
sensitivity report on the second post inoculation
day thus, ascribing the isolate as having a
pathogenic potential and not as a mere
commensal 19.
Our results show that out of 13 CoNS
isolated from blood samples , 9 isolates (69.2%)
were able to form biofilm as detected by CRA,
while out of 15 CoNS isolated from skin swabs ,
5 isolates (33.3%) were biofilm forming.
These results are matched with the results
obtained by Arciola et al 13 who found that the
percentage of biofilm formation among CoNS
was 49%, and Muller et al 20 found that 46% of
CoNS are biofilm producer by CRA. Ziebuhr et
al 21 had reported higher incidence, they found
that 87% of CoNS isolates are biofilm forming
while de silva et al 2 reported that only 25% of
the tested CoNS were biofilm positive by CRA.
Nayak et al 22 found that 57% of CoNS strains
were slime forming on CRA.
We found that CoNS isolated from skin
swabs from neonate with neonatal septicemia
are more than CoNS isolated from healthy
neonate and also 33.3% of them have the ability
to form biofilm however non of control isolates
have the ability to form biofilm, this suggested
that neonate in NICU replace their own
27
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
However these results are different from the
results obtained by Arciola et al 13 who found
that biofilm negative staphylococci lake these
two genes and thus had suggested that the
phenotypic change may be caused by a deletion
of the ica operon rather than an insertion event
which inactivates the ica genes.
Nofal et al 24 stated that, CRA and PCR are
both valid tests in the detection of biofilm
formation. The choice should depend on the
health condition of the patient and the
availability of different reagents, also an
economic background must be put in mind.
PCR is a rapid tool of diagnosis especially if we
consider that a large proportion of patients are
critically ill and rapid diagnosis is required. On
the other hand for cases which can tolerate
delay in diagnosis and also for research work it
is more important to differentiate between
virulent and avirulent strain by CRA.
In our study show that CoNS isolates from
blood samples were resistant to penicillin
(100%),
ampicillin
(100%),
amoxicillin/clavulonic acid (100%), methicillin
(76.7%), cephradin (92.3%), gentamycin
(84.6%), tetracyclin (84.6%), chloramphenicol
(61.5%),
erythromycin
(92.3%)
and
ciprofloxacin (53.8%) whereas all isolates were
sensitive to vancomycin and rifampicin.
This finding is close to results of Koura et
al 19 who found that most isolates of CoNS were
resistant to penicillin (95%), ampicillin (85%),
gentamyvin
(80%),
cefotaxime
(80%),
tetracyclin (75%), amoxicillic (75%) and
oxacillin (74%) whereas resistance to
vancomycin and teicoplanin was found in only
two strains (5%).
Our results coincided with others who
found that most strains were resistant to
penicillin and tetracycline and 5.1% of CoNS
were resistant to vancomycin 30 and others
showed that 100% of CoNS were sensitive to
vancomycin 31.
The difference in susceptibility tests would
be due to difference in the study duration,
population and hospital care patterns of the
antimicrobial prescription.
We observed that resistance to different
antibiotics is higher in biofilm forming isolates
than in non-biofilm forming isolates. This is in
agreement with Koura et al 19 who found that
slime positive isolates were multidrug resistance
as compared to slime negative isolates.
Also Koksal et al 32 reported that
methicillin resistance was significantly higher in
slime positive isolates (81%) than in slime
negative isolates (57%).
separately by insertion of different transposone
and both insertions had lead to complete
inactivation of PIA synthesis.
Gerke et al 16 found that inactivation of
icaD lead to the loss of cell aggregation and PIA
production indicating that icaD plays an
essential role in intercellular adhesion and PIA
production in vivo. Møretrø et al 27 had shown
the importance of icaA gene for the production
of PIA.
Ica locus is a virulence marker for clinically
significant CoNS isolates. Its presence in a high
percentage of clinical isolates and its association
with the strains ability to produce slime strongly
suggests a role of icaA and icaD in the
pathogenic mechanism of CoNS infections. The
genotype characterization by PCR represents a
highly sensitive method for the detection of ica
locus 19.
Our results indicate that 50% of CoNS
isolated from patients were positive for slime
production where 57.1% were positive for icaA,
icaD genes. There was a positive correlation
between slime production by CRA plate and the
presence of ica genes by PCR.
PCR can detect ica operon in strains that
appear to be non-biofilm producers with CRA.
We found 2 strains which are biofilm non
producer but ica gene positive, one was isolated
from blood, the other strain was isolated from
skin, both were plasmidless and non multidrug
resistance.
These results agree with the result of
Handke et al 28 who had reported the presence
of biofilm negative staphylococci that contain
the ica operon. The presence of ica operon
among the biofilm negative strains had been
extensively explained by many authors. Some
authors consider point mutation in the icaA gene
of biofilm negative strains as an important
explanation and this also was suggested by de
silva et al 2.
Another explanation had been made by
Møretrø et al 27 and Ziebuhr et al 21 who found
that 1.332 bp sequence element, known as IS
256, causes inactivation of icaA gene and leads
to biofilm negative phenotype forming.
Also Mack et al 29 had genetically
engineered 9 biofilm negative strains that
contain ica operon, this had resulted from
transposon insertion in different chromosomal
loci, four loci within the ica operon and five loci
outside the operon.
Handke et al 28 stated that the finding of the
prevalence of the ica locus among biofilm
negative strains might be explained by low level
of expression of the ica locus in those strains
due to strict gene regulatory mechanism.
28
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
be lost during storage40. Moreover genetic
unrelated strains may harbor the same
plasmid41. Additionally fragile plasmid or
plasmids found in low copy number are difficult
to extract 35.
Our finding may indicate that health care
workers play a role in dissemination of CoNS
infections in the hospital. Only 2 CoNS isolates
which were isolated from hands of nurses were
proved to be the source in 3 cases of neonatal
septicemia. These 2 nurse strains were
multidrug resistance, contain plasmids, biofilm
producer and contain ica genes. One strain was
S. epidermidis, the other was S. haemolyticus.
These results suggesting horizontal
transmission of epidemic strain from one patient
to another through hospital staff. Hira et al.42
stated that hospital personnel can be responsible
for spreading multiresistant CoNS isolates. In
conclusion isolates of CoNS infections are more
likely to be positive for ica operon and to
produce biofilm than isolates separated
randomly from healthy individual. Both CRA
and PCR are valid tests for detection of biofilm
formation. Plasmid profile has a role in
epidemiological typing of CoNS isolates. Health
care workers play a role in dissemination of
CoNS infections in the hospital. Presence of
biofilm enhances resistance to different
antibiotics. We recommended that infection
control program to prevent spread of infections
through hands of HCW. Increase concentration
of antibiotics (if possible) to be effective against
biofilm producing bacteria.
This can be explained by the fact that
biofilm is the most important virulence factor of
CoNS because it enables attachment and
persistence of bacteria and enhances bacterial
resistance to antibiotics and host defense
mechanisms 33.
In this study antibiogram have been used
for phenotyping of CoNS isolates. According to
antibiogram the neonatal cases and HCW
isolates (34 isolates) have been classified into
14 groups indicating that antibiogram could be a
relatively sensitive marker.
A lot of workers have also successfully
used antibiogram for typing their nosocomial
isolates34. This was contraindicated by other
workers who reported limited usefulness and
low discriminatory power of antibiotyping in
comparing different isolates in epidemiologic
studies 35.
Antibiogram might be non reproducible in
many instances due to the probable exchange of
R factor among isolates 36.
To overcome limitation of phenotypic
analysis, genotypic methods have been used for
strain typing of CoNS. Plasmid profile has been
used widely in this field as it is simple rapid
molecular technique.
Plasmid profile analysis was done among
neonate cases and HCW in NICU. In our study
it was found that 21 isolates (61.8%) out of 34
isolates harbored plasmids of different sizes.
The molecular weight of plasmids ranged from
1.3 to 14 MDa and the number of plasmids
ranged from 1 to 4.
In our study, the detected plasmid sizes
were 1.3, 1.5, 1.6, 1.7, 1.8, 2.1, 4.8, 5.5, 6.1, 6.6,
10.5, 14 MDa. Plasmid profiles of the isolated
CoNS showed that 13 strains (38.2%) were
plasmidless, 10 strains had a single plasmid, 5
strains had 2 plasmid, 5 strains had 3 plasmids,
while 1 strain had 4 plasmids. The isolated
CoNS strains were found to have 9 different
plasmid profiles. Thus, possession of a different
class of plasmids by the isolate might reflect
different degree of virulence and differing
pathogenicity 37.
Plasmid profiles were first used to
distinguish different strains of CoNS by Parisi
and Hecht 38 who were able to demonstrate the
existence of a common strain of S. epidermidis
causing infection among infants in a neonatal
unit. These findings suggested that the infective
strain was being passed from infant to infant.
Abo El-Ela and Al-Essa 39 suggested that
plasmid subtyping method is discriminative and
sensitive. Other workers found plasmid analysis
was of no value in epidemiologic studies
because of instability of plasmids, which might
REFERENCES
1.
2.
3.
29
Piette A and Verschraegen G (2009):
Role of coagulase negative staphylococci in
human disease. Veterinary Microbiol;
134(1-2): 45-54.
de Silva GDI, Kantzanou M, Justice A,
Massey RC, Wilkinson AR, Day NPJ and
Peacock SJ (2002): The ica operon and
biofilm production in coagulase negative
staphylococci associated with carriage and
disease in a neonatal intensive care unit. J
Clin Microbio; 40(2): 382-388.
Stoll BJ, Gordon T, Korones SB,
Shankaran S, Tyson JE, Bauer CR,
Fanaroff AA, Lemons JA, Donovan EF,
Oh W, Stevenson DK, Ehrenkranz RA,
Papile LA, Verter J and Wright LL
(1996): Late onset sepsis in very low birth
weight neonates: a report from the National
Institute of Child Health and Human
Development Neonatal Research Network.
J Pediatr; 129(1): 63–71.
Egyptian Journal of Medical Microbiology, January 2012
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Vol. 21, No. 1
15. Greenwood WT, Cooper B, Hails J,
Jones K, Kwaku F, Shaw S, Kibbler C,
Sbulman R and Wilson PR (2004):
Linezolid versus teicoplanin in the
treatment of gram positive infections in the
critically ill: A randomized; double-blind,
multicentre
study.
J
Antimicrob
Chemother; 53(2): 345-349.
16. Gerke C, Kraft A, Süssmuth R,
Schweitzer O and Götz F (1998):
Characterization
of
the
Nacetylglucosaminyltransferase
activity
involved in the biosynthesis of the
Staphylococcus epidermidis polysaccharide
intercellular adhesion. J Biol Chem;
273(29): 18586-18593.
17. Vuong C and Otto M (2002):
"Staphylococcus epidermidis infections"
Microbes and Infection; 4(4): 481-489.
18. Dobbins BM, Kiel P, Kindon A,
McMahon MJ and Wilcox MH (2002):
DNA fingerprinting analysis of coagulase
negative staphylococci implicated in
catheter related bloodstream infections. J
Clinic Patho; 55: 824-828.
19. Koura BA, Badwy W, Zaghloul MH and
El Mashad N (2007): Plasmid pattern
analysis in slime producing coagulase
negative staphylococci in acute bacterial
conjunctivitis, keratitis, chronic blepharitis
and corneal ulcer. E J Med Microbiol; 16
(2): 338-349.
20. Muller E, Takeda S, Shiro H, Goldmann
D and Pier GB (1993): Occurrence of
capsular polysaccharide/adhesion among
clinical isolates of coagulase negative
staphylococci. J Infect Dis; 168: 12111218.
21. Ziebuhr W, Heilmann C, Gtöz F, Meyer
P, Wilmas K, Straube E and Hacker J
(1997): Detection of the intercellular
adhesion gene cluster (ica) and phase
variation in Staphylococcus epidermidis
blood culture strains and mucosal isolates.
Infect Immun; 65(3): 890-896.
22. Nayak N, Satpathy G, Vajpayee RB and
Pandey RM (2001): A simple alternative
method for rapid detection of slime
produced by Staphylococcus epidermidis
isolates in bacterial keratitis. Indian J Med
Res; 114: 169-172.
23. Widerstrom M, Monsen T, Karlsson C
and Wiström J (2006): Molecular
epidemiology of methicillin resistant
coagulase negative staphylococci in a
Swedish county hospital: evidence of intra
and interhospital clonal spread. J Hosp
Infect; 64(2): 177–183.
24. Nofal FA, Selim ES, El Behedy EM and
El Shabrawy RM (2005): Biofilm
Margreth N, van der Lugt, Sylke JS and
Frans JW (2010): Use of rifampin in
persistent
coagulase
negative
staphylococcal bacteremia in neonates,
BMC Pediatrics; 10(1): 84-91.
Yue Q, Andrew JD, Taghrid SI, Suzanne
MG and Margaret AD (2010): Antibiotic
susceptibility of coagulase negative
staphylococci isolated from very low birth
weight babies: comprehensive comparisons
of bacteria at different stages of biofilm
formation. Annals of Clinical Microbiology
and Antimicrobials; 9: 16-28.
Mack D (1999): Molecular mechanisms of
Staphylococcus
epidermidis
biofilm
formation. J Hosp Infect; 43: 113–125.
Heilmann C, Schweitzer O, Gerke C,
Vanittanakom N, Mack D and Götz F
(1996): Molecular basis of intercellular
adhesion in the biofilm forming
Staphylococcus
epidermidis.
Mol
Microbiol; 20(5): 1083–1091.
Götz F (2002): Staphylococcus and
biofilms. Mol Microbiol; 43(6): 1367–
1378.
Zhiqiang Q, Xiaomei Y, Lei Y, Juan J,
Yuanzhu O, Soeren M and Di Q (2007):
Formation and properties of in vitro
biofilms of ica negative Staphylococcus
epidermidis clinical isolates. J Med
Microbiol; 56: 83–93.
Leonard WM (1988): Use of plasmid
profile in epidemiological surveillance of
disease outbreaks and in tracing the
transmission of antibiotic resistance. Clin
Microbiol Rev; 1 (2): 228-243.
Baird D (1996): Staphylococcus: Cluster
forming gram positive cocci. In: Mackie &
McCarteny
Practical
Medical
Microbiology. Collewe, J.G.; Marmion,
B.P.; Fraser, A.G.; and Simmons, A. eds.
Ch. 11. Churchill Livingstone, New York,
pp. 245-274.
-Mathur T, Singhal S, Khan S,
Upadhyay DJ, Fatma T and Rattan A
(2006): Detection of biofilm formation
among
the
clinical
isolates
of
staphylococci: An evaluation of three
different screening methods. Indian J Med
Microbiol; 24 (1): 25-29.
-Arciola CR, Baldassarri L and
Montanaro L (2001): Presence of icaA
and icaD genes and slime production in a
collection of staphylococcal strains from
catheter associated infections. J Clin
Microbiol; 39(6): 2151-2156.
-Piette A and Verschraegen G (2009):
Role of coagulase negative staphylococci in
human disease. Veterinary Microbiol;
134(1-2): 45-54.
30
Egyptian Journal of Medical Microbiology, January 2012
25.
26.
27.
28.
29.
30.
31.
32.
33.
formation and the presence of intercellular
adhesion locus (ica) among staphylococcal
from catheter associated infections. New E
J of Med; 33(6): 297-305.
Fitzpatrick F, Humphreys H and O'Gara
JP (2005): Evidence for icaADBCIndependent
biofilm
development
mechanism
in
methicillin
resistant
Staphylococcus aureus Clinical. J Clin
Microbio; 43(4): 1973-1976.
Mack D, Sabottke A, Dobinsky S, Rohde
H, Horstkotte MA and Knobloch JK
(2002):
Differential
expression
of
methicillin resistance by different biofilm
negative
Staphylococcus
epidermidis
transposon mutant classes. Antimicrob
Agents Chemother; 46(1): 178-183.
Møretrø T, AL, Sidhu MS, Rudi K and
Langsrud S (Hermansen L, Holck 2003):
Biofilm formation and the presence of the
intercellular adhesion locus ica among
staphylococci from food and food
processing environments. Appl Environ
Microbiol; 69(9): 5648-5655.
Handke LD, Conlon KM, Slater SR,
Elbaruni S, Fitzpatrick F, Humphreys H,
Giles WP, Rupp ME, Fey PD and
O'Gara JP (2004): Genotypic and
phenotypic analysis of biofilm phenotypic
variation in multiple Staphylococcus
epidermidis isolates. J Med Microbio;
53:367-374.
Mack D, Rohde H, Dobinsky S,
Riedewald J, Nedelmann M, Knobloch J,
Elsner HA and Feucht HH (2000):
Identification of three essential regulatory
gene loci governing expression of
Staphylococcus epidermidis polysaccharide
intercellular adhesin and biofilm formation.
Infect Immun; 68(7): 3799-3807.
Yasar N, Sengul D, Atahan A and
Handan K (2005): Investigation of
staphylococcus to glycopeptides in a
Turkish University Hospital. Clin Infect
Dis; 5:31.
Villari P, Sarnataro C and Iacuzio
(2000): Molecular epidemiology of
Staphylococcus epidermidis in a neonatal
intensive care unit over a 3 year period. J
Clin Microbial; 38 (5) 1740-1746.
Koksal F, Yasar H and Samasti M
(2007): Antibiotic resistance patterns of
coagulase negative staphylococcus strains
isolated from blood cultures of septicemic
patients in Turkey. Microbiol Res; 16: 3134.
Sadovskaya I, Vinogradov E, Flahaut S,
Kogan G and Jabbouri S (2005):
Extracellular
carbohydrate
containing
polymers of a model biofilm-producing
34.
35.
36.
37.
38.
39.
40.
41.
42.
31
Vol. 21, No. 1
strain, Staphylococcus epidermidis RP62A.
Infect and Immuni; 73(5): 3007-3017.
Awad AS, Shaheeh MA and Fathy MM
(2004): Colonization rates and typing of
Staphylococcus aureus isolated from the
nose and the eczematous skin of patients
with atopic dermatitis and their correlation
with the severity of exzema. E J Med
Microbiol; 13(2): 313-323.
Eisn D, Russell E, Tymms M, Roper E,
Grauson M and Turnidge J (1995):
Random amplified polymorphic DNA and
plasmid analysis used in investigation of an
outbreak of multiresistant Klebsiella
pneumonia. J Clin Microbiol; 33(3):713717.
El Sweify MA, Khalifa K, Brenner DJ,
Emad K, Mohammed FA and Heiba AA
(1994):
Subtyping
of
nosocomial
Pseudomonas
aeurginosa
isolates;
phenotypic and genotypic markers. E J Med
Microbiol; (3):500-505.
Archer GL, Karchmer AW, Vishniavsky
N and Johnston JL (1984): Plasmid
pattern analysis for differentiation of
infecting
from
non-infecting
Staphylococcus epidermidis. J Infect Dis;
149: 913-920.
Parisi JT and Hecht DW (1980): Plasmid
profiles in epidemiologic studies of
infections by Staphylococcus epidermidis. J
Infect Dis; 141: 637-643.
Abou El-Ela M and Al-Essa S (2004):
Molecular epidemiological study of
Enterobacter clocae isolates from a
neonatal intensive care unit. E J Med
Microbiol; 13(4): 753-762.
Dubois V, Aprin C, Ander C, Coulge L
and Quentin C (2005): Prolonged
outbreak of infection due to TEM
21producing strains of Pseudomonas
aeurginosa and Enterobacteria in a nursing
home. J Clin Microbiol; 43(8): 4129-4138.
Gori A, Esplimase F, Delpano A,
Nonhoff C, Nicolas M and Struelens M
(1996): Comparison of pulsed field gel
electrophoresis and randomly amplified
DNA polymorphism analysis for typing
extended spectrum B-lactamase producing
Klebsiella pneumonia. J Clin Microbiol; 34
(10): 2448-2453.
Hira V, Sluijter M, Esteväo S, HorstKreft D, Ott A, de Groot R, Hermans
PW and Kornelisse RF (2007): Clinical
and molecular epidemiologic characteristics
of coagulase negative staphylococcal
bloodstream infections in intensive care
neonates. Pediatr Infect Dis J; 26(7): 607–
612.
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫دور اﻟﻤﻮﻗﻊ اﻟﺠﻴﻨﻰ ) إآﺎ ( وﺗﻜﻮﻳﻦ اﻟﻐﺸﺎء اﻟﺤﻴﻮى ﻓﻰ اﻟﻌﺪوى ﺑﺎﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ‬
‫أﺷﻮاق ﻣﺤﻤﺪ ﻓﺆاد اﺑﻮ ﻃﺎﻟﺐ – ﻣﺮﻓﺖ ﺳﻠﻴﻤﺎن ﻣﺤﻤﺪ – رﻧﺪا ﺻﺪﻳﻖ ﻋﺒﺪ اﻟﻠﻄﻴﻒ – ﻣﻨﺎر ﺟﻮدﻩ‬
‫ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻴﺎ اﻟﻄﺒﻴﺔ واﻟﻤﻨﺎﻋﺔ – آﻠﻴﺔ اﻟﻄﺐ ‪ -‬ﺟﺎﻣﻌﺔاﻟﺰﻗﺎزﻳﻖ‬
‫ﺗﻌﺘﺒﺮ اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ اﻟﺴﺒﺐ اﻟﺮﺋﻴﺴﻰ ﻟﻠﺘﺴﻤﻢ اﻟﺪﻣﻮي اﻟﻮﻟﻴﺪي ﻓﻰ وﺣﺪة اﻟﻌﻨﺎﻳﺔ اﻟﻤﺮآﺰة ﻟﻼﻃﻔﺎل‪.‬‬
‫اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ ﺗﺴﺒﺐ اﻟﻌﺪوى ﻧﺘﻴﺠ ﺔ ﺗﻜ ﻮﻳﻦ اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮى اﻟ ﺬى ﻳ ﺴﺎﻋﺪهﺎ ﻋﻠ ﻰ اﻹﻟﺘ ﺼﺎق ﺑ ﺄى ﺟ ﺴﻢ ﺻ ﻨﺎﻋﻲ‬
‫وآﺬﻟﻚ ﻣﻘﺎوﻣﺔ اﻟﺠﻬﺎز اﻟﻤﻨﺎﻋﻲ واﻟﻤﻀﺎدات اﻟﺤﻴﻮﻳﺔ اﻟﻤﺨﺘﻠﻔﺔ‪.‬‬
‫اﻟﻬﺪف ﻣﻦ اﻟﺒﺤﺚ‪:‬‬
‫إﺛﺒﺎت أن اﻟﻤﻌﺰوﻻت اﻟﻤﺄﺧﻮذة ﻣﻦ أﻣﺮاض اﻟﻌﺪوى ﺑﺎﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳ ﺎﻟﺒﺔ اﻟ ﺘﺠﻠﻂ ﻟﻬ ﺎ اﻟﻘ ﺪرة ﻋﻠ ﻰ ﺗﻜ ﻮﻳﻦ اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮي وﺑﻬ ﺎ اﻟﻤﻮﻗ ﻊ‬‫اﻟﺠﻴﻨﻰ )إآﺎ( أآﺜﺮ ﻣﻦ اﻟﻤﻌﺰوﻻت اﻟﻤﺄﺧﻮذة ﻋﺸﻮاﺋﻴﺎ ﻣﻦ اﻷﺻﺤﺎء‪.‬‬
‫اﻟﻤﻘﺎرﻧﺔ ﺑﻴﻦ ﺣﺴﺎﺳﻴﺔ اﻟﻤﻴﻜﺮوﺑﺎت اﻟﻤﻜﻮﻧﺔ ﻟﻠﻐﺸﺎء اﻟﺤﻴﻮي ﻟﻠﻤﻀﺎدات اﻟﺤﻴﻮﻳﺔ واﻟﻤﻴﻜﺮوﺑﺎت اﻟﻐﻴﺮ ﻣﻜﻮﻧﺔ ﻟﻠﻐﺸﺎء اﻟﺤﻴﻮى‪.‬‬‫ﻓﺼﻞ اﻟﺒﻼزﻣﻴﺪات ﻣﻦ اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ ﻹﺳﺘﺨﺪاﻣﻬﺎ ﻓﻰ ﺗﺤﺪﻳ ﺪ ﻣ ﺼﺎدر اﻟﻌ ﺪوى ﻓ ﻲ وﺣ ﺪة اﻟﻌﻨﺎﻳ ﺔ اﻟﻤﺮآ ﺰة ﻟﻸﻃﻔ ﺎل ﺣ ﺪﻳﺜﻲ‬‫اﻟﻮﻻدة‪.‬‬
‫ﻣﻮاد وﻃﺮق اﻟﺒﺤﺚ‪:‬‬
‫ﺗﻢ اﺧﺬاﻟﻌﻴﻨﺎت ﻣﻦ ﺣﺎﻵت اﻟﺘﺴﻤﻢ اﻟﺪﻣﻮي اﻟﻮﻟﻴﺪي ‪:‬‬
‫اﻟﻌﻴﻨﺎت اﻟﻤﺮﺿﻴﺔ‪ ٤٠:‬ﺣﺎﻟﻪ ﺗﺴﻤﻢ وﻟﻴﺪى ﺑﻮﺣﺪة اﻟﻌﻨﺎﻳﺔ اﻟﻤﺮآﺰة ﻟﻼﻃﻔﺎل ﺑﻤﺴﺘﺸﻔﻰ اﻟﺰﻗﺎزﻳﻖ اﻟﺠﺎﻣﻌﻲ )‪ ٤٠‬ﻋﻴﻨﺔ دم ﻣ ﻦ اﻻوردﻩ اﻟﻄﺮﻓﻴ ﺔ‬
‫و ‪ ٤٠‬ﻣﺴﺤﻪ ﻣﻦ اﻟﺠﻠﺪ ﻣﻦ ﺗﺤﺖ اﻹﺑﻂ(‪.‬‬
‫اﻟﻌﻴﻨﺎت اﻟﻀﺎﺑﻄﺔ‪٤٠ :‬ﻃﻔﻞ ﻣﻦ اﻷﻃﻔﺎل ﺣﺪﻳﺜﻰ اﻟﻮﻻدة اﻻﺻﺤﺎء ﻳﺘﻢ أﺧﺬهﺎ ﻋﺸﻮاﺋﻴﺎ )‪ ٤٠‬ﻣﺴﺤﻪ ﻣﻦ اﻟﺠﻠﺪ ﻣﻦ ﺗﺤﺖ اﻹﺑﻂ(‪.‬‬
‫‪25‬ﺷﺨﺺ ﻣﻦ ﻣﻘﺪﻣﻰ اﻟﺮﻋﺎﻳﺔ اﻟﺼﺤﻴﺔ ﺑﻮﺣﺪة اﻟﻌﻨﺎﻳﺔ اﻟﻤﺮآﺰة ﻟﻼﻃﻔﺎل ﺑﻤﺴﺘﺸﻔﻰ اﻟﺰﻗﺎزﻳﻖ اﻟﺠﺎﻣﻌﻲ‪.‬‬
‫ﺗﻢ ﻧﻘﻞ اﻟﻌﻴﻨﺎت إﻟﻰ ﻣﻌﺎﻣﻞ ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻰ واﻟﻤﻨﺎﻋﺔ ﺑﻜﻠﻴﺔ اﻟﻄﺐ اﻟﺒﺸﺮى ﺑﺠﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ ﺣﻴﺚ ﺗﻢ اﻟﺘﻌﺎﻣﻞ ﻣﻌﻬﺎ آﻤﺎ ﻳﻠﻰ‪:‬‬
‫زرع ﻋﻴﻨﺎت اﻟﺪم ﻋﻠﻰ اﻷﺟﺎر اﻟﻤﻐﺬى ﻓﻰ زﺟﺎﺟﺎت زراﻋﺔ اﻟﺪم و زرع ﻣﺴﺤﺎت اﻟﺠﻠﺪ ﻋﻠﻲ اﻵﺟﺎر اﻟﻤﻐﺬي وذﻟﻚ ﻟﻔﺼﻞ اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳ ﺔ‬‫ﺛﻢ اﻟﺘﻌﺮف ﻋﻠﻰ اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ وﺗﺤﺪﻳﺪ ﻧﻮﻋﻬﺎ واﻟﺘﺎآﺪ ﻣﻨﻪ ﻋﻦ ﻃﺮﻳﻖ‪API Staph.‬‬
‫ﺗﻢ إﺧﺘﺒﺎر ﺣﺴﺎﺳﻴﺔ اﻟﻤﻴﻜﺮوب ﻟﻠﻤﻀﺎدات اﻟﺤﻴﻮﻳﺔ اﻟﻤﺨﺘﻠﻔﺔ‪.‬‬‫ﺗﺤﺪﻳ ﺪ ﻗ ﺪرة اﻟﺒﻜﺘﺮﻳ ﺎ اﻟﻌﻨﻘﻮدﻳ ﺔ ﺳ ﺎﻟﺒﺔ اﻟ ﺘﺠﻠﻂ ﻋﻠ ﻰ ﺗﻜ ﻮﻳﻦ اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮي ﺑﺎﺳ ﺘﺨﺪام اﻷﺟ ﺎر اﻟﻤ ﻀﺎف إﻟﻴ ﻪ ﺻ ﺒﻐﺔ اﻟﻜﻮﻧﺠ ﻮ اﻟﺤﻤ ﺮاء‪،‬‬‫اﻟﻤﻌﺰوﻻت اﻟﻤﻮﺟﺒﺔ ﺗﻈﻬﺮ ﺑﺎﻟﻠﻮن اﻷﺳﻮد واﻟﻤﻌﺰوﻻت اﻟﺴﺎﻟﺒﺔ ﺗﻈﻬﺮ ﺑﺎﻟﻠﻮن اﻷﺣﻤﺮ‪.‬‬
‫إﺳﺘﺨﺮاج اﻟﺤﺎﻣﺾ اﻟﻨﻮوى ﻣﻦ اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ وﺗﺤﺪﻳﺪ وﺟﻮد اﻟﻤﻮﻗﻊ اﻟﺠﻴﻨﻰ )إآﺎ( ﺑﺈﺳﺘﺨﺪام ﺗﻔﺎﻋﻞ إﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ‪.‬‬‫ﻓﺼﻞ اﻟﺒﻼزﻣﻴﺪات ﻣﻦ اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻌﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ وذﻟﻚ ﻟﺘﺘﺒﻊ ﻣﺼﺎدر اﻟﻌﺪوى‪.‬‬‫ﻧﺘﺎﺋﺞ اﻟﺒﺤﺚ‬
‫ﺗﻢ ﻓﺼﻞ ‪ ١٣‬ﺣﺎﻟﺔ ﻣﻦ اﻟﺒﻜﺘﺮﻳﺎ اﻟﻌﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ )‪ ( ٪٣٢.٥‬ﻣﻦ ‪٤٠‬ﻋﻴﻨﻪ دم ﻣﻦ اﻻﻃﻔﺎل اﻟﺬﻳﻦ ﻳﻌﺎﻧﻮن ﻣﻦ اﻟﺘﺴﻤﻢ اﻟﺪﻣﻮي اﻟﻮﻟﻴﺪى ﺑﻴﻨﻤ ﺎ‬
‫ﺗﻢ ﻓﺼﻞ ‪ ١٥‬ﺣﺎﻟﺔ )‪ ( ٪٣٧.٥‬ﻣﻦ ‪ ٤٠‬ﻣﺴﺤﻪ ﻣﻦ اﻟﺠﻠﺪ و آﺬﻟﻚ ﺗ ﻢ ﻓ ﺼﻞ ‪ ٨‬ﺣ ﺎﻻت )‪ ( ٪٢٠‬ﻣ ﻦ ‪ ٤٠‬ﻋﻴﻨ ﻪ ﺿ ﺎﺑﻄﺔ و‪ ٦‬ﺣ ﺎﻻت )‪ ( ٪٢٤‬ﻣ ﻦ‬
‫‪ ٢٥‬ﺷﺨﺺ ﻣﻦ ﻣﻘﺪﻣﻰ اﻟﺮﻋﺎﻳﺔ اﻟﺼﺤﻴﺔ ﻓﻲ وﺣﺪة اﻟﻌﻨﺎﻳﺔ اﻟﻤﺮآﺰة ﻟﻸﻃﻔﺎل ﺑﻄﺐ اﻟﺰﻗﺎزﻳﻖ‪.‬‬
‫آﺎﻧﺖ اﺳﺘﺎف إﺑﻰ درﻣﻴﺪس أآﺜﺮ اﻷﻧﻮاع اﻟﺘﻲ ﺗﻢ ﻓﺼﻠﻬﺎ ﻣﻦ اﻟﻤﺠﻤﻮﻋﺘﻴﻦ‪.‬‬‫ﺑﺄﺳﺘﺨﺪام اﻷﺟﺎر اﻟﻤﻀﺎرف إﻟﻴﻪ ﺻﻐﺒﺔ اﻟﻜﻮﻧﺠﻮ اﻟﺤﻤﺮاء )ﻣﺠﻤﻮﻋﻪ اﻟﺘﺴﻤﻢ اﻟ ﺪﻣﻮي اﻟﻮﻟﻴ ﺪي( وﺟ ﺪ أن ‪ ٩‬ﺣ ﺎﻻت )‪( ٪٦٩.٢‬ﻣ ﻦ ‪ ١٣‬ﻋﺰﻟ ﺔ‬‫ﺑﻜﺘﺮﻳﺎ ﻋﻨﻘﻮدﻳﺔ ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ ﻣﻦ ﻋﻴﻨﺎت اﻟﺪم ﻟﻬﺎ اﻟﻘﺪرة ﻋﻠ ﻰ ﺗﻜ ﻮﻳﻦ اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮي و ‪ ٥‬ﺣ ﺎﻻت )‪ ( ٪٣٣.٣‬ﻣ ﻦ ‪ ١٥‬ﻋﺰﻟ ﺔ ﺑﻜﺘﺮﻳ ﺎ ﻋﻨﻘﻮدﻳ ﺔ‬
‫ﺳﺎﻟﺒﺔ اﻟﺘﺠﻠﻂ ﻣﻦ ﻣﺴﺤﺎت اﻟﺠﻠﺪ ﻟﻬﺎ اﻟﻘﺪرة ﻋﻠﻰ ﺗﻜﻮﻳﻦ اﻟﻐﺸﺎء اﻟﺤﻴﻮي ﺑﻴﻨﻤﺎ ﻟﻢ ﺗﺒﺪ أى ﺣﺎﻟﺔ ﻣﻦ اﻟﺤﺎﻻت اﻟﻀﺎﺑﻄﺔ ﻗﺪرﺗﻬﺎ ﻋﻠ ﻰ ﺗﻜ ﻮﻳﻦ اﻟﻐ ﺸﺎء‬
‫اﻟﺤﻴﻮى‪ .‬آﺬﻟﻚ ﺗﻢ ﻓﺼﻞ ﺣﺎﻟﺘﻴﻦ )‪ ( ٪٣٣.٣‬ﻣﻦ ‪ ٦‬ﻋﺰﻻت ﻣﻦ ﻣﻘﺪﻣﻲ اﻟﺮﻋﺎﻳﺔ اﻟﺼﺤﻴﺔ ﻟﻬﺎ اﻟﻘﺪرة ﻋﻠﻰ ﺗﻜﻮﻳﻦ اﻟﻐﺸﺎء اﻟﺤﻴﻮي‪.‬‬
‫ﺑﻌﺪ اﻟﺒﺤﺚ ﻋﻦ ﺟﻴﻨﺎت "‪ "ica‬ﺗﺒﻴﻦ وﺟﻮد اﻟﺠﻴﻨﺎت ﻓﻰ ﺟﻤﻴﻊ اﻟﺤﺎﻻت اﻟﺘﻰ ﻟﻬﺎ اﻟﻘﺪرة ﻋﻠ ﻰ ﺗﻜ ﻮﻳﻦ اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮى واﻳ ﻀﺎ ﺗﺒ ﻴﻦ وﺟ ﻮدﻩ ﻓ ﻰ‬‫ﺑﻌﺾ اﻟﺤﺎﻻت اﻟﺘﻰ ﻻ ﺗﺴﺘﻄﻴﻊ ﺗﻜﻮﻳﻦ اﻟﻐﺸﺎء اﻟﺤﻴﻮى وﻟﻢ ﻳﺘﻮاﺟﺪ ﺟﻴﻨﺎت "‪"ica‬ﻓﻰ اى ﺑﻜﺘﺮﻳﺎ ﻣﻦ اﻟﻌﻴﻨﺎت اﻟﻀﺎﺑﻄﺔ‪.‬‬
‫آﺎﻧ ﺖ ﻣﻌﻈ ﻢ اﻟﻌﻴﻨ ﺎت ﻣﻘﺎوﻣ ﺔ ﻟﻌﻘ ﺎر اﻟﺒﻨ ﺴﻠﻴﻦ وﺣ ﺴﺎﺳﺔ ﻟﻌﻘ ﺎر ﻓﺎﻧﻜﻮﻣﻴ ﺴﻴﻦ‪ ،‬رﻳﻔﺎﻣﺒ ﺴﻴﻦ‪ .‬و آﺎﻧ ﺖ ﻣﻘﺎوﻣ ﺔ اﻟﻌ ﺰﻻت اﻟﻤﻜﻮﻧ ﺔ ﻟﻠﻐ ﺸﺎء اﻟﺤﻴ ﻮي‬
‫ﻟﻠﻤﻀﺎدات اﻟﺤﻴﻮﻳﺔ اﻟﻤﺨﺘﻠﻔﺔ أآﺜﺮ ﻣﻦ ﻣﻘﺎوﻣﺔ اﻟﻌﺰﻻت اﻟﻐﻴﺮ ﻣﻜﻮﻧﺔ اﻟﻐﺸﺎء اﻟﺤﻴﻮى‪.‬‬
‫ﻋﻠﻰ ﺣﺴﺐ ﺣﺴﺎﺳﻴﻪ اﻟﻤﻴﻜﺮوب ﻟﻠﻤﻀﺎدات اﻟﺤﻴﻮﻳﺔ اﻟﻤﺨﺘﻠﻔﺔ ﺗﻢ ﺗﻘﺴﻤﻬﻢ اﻟﻰ ‪ ١٤‬ﻣﺠﻤﻮﻋﺔ‪.‬‬‫ﻳﻮﺟﺪ ﺑﻪ ‪ ٩‬ﻣﺠﻤﻮﻋﺎت ﻣﻦ اﻟﺒﻼزﻣﻴﺪات اﻟﻤﺨﺘﻠﻔﺔ و‪ ١٣‬ﺳﻼﻟﺔ ﺑﺪون ﺑﻼزﻣﻴﺪات‪.‬‬‫ﻧﺘﺎﺋﺞ هﺬا اﻟﺒﺤﺚ أوﺿﺤﺖ أن ﻣﻘﺪﻣﻲ اﻟﺮﻋﺎﻳﺔ اﻟﺼﺤﻴﺔ ﻟﻬﻢ دور ﻓﻲ ﻧﺸﺮ اﻟﻌﺪوي داﺧﻞ وﺣﺪة اﻟﻌﻨﺎﻳﺔ اﻟﻤﺮآﺰة ﻟﻸﻃﻔﺎل‪ .‬ﺣﻴ ﺚ وﺟ ﺪ ﺳ ﻼﻟﺘﻴﻦ‬‫ﺗﻢ ﻋﺰﻟﻬﻢ ﻣﻦ أﻳﺪي اﻟﻤﻤﺮﺿ ﺎت آﺎﻧ ﺖ ه ﻲ ﻣ ﺼﺪر اﻟﻌ ﺪوى ﻟﺜﻼﺛ ﻪ ﺣ ﺎﻻت ﻣ ﻦ اﻟﺘ ﺴﻤﻢ اﻟ ﺪﻣﻮي‪ .‬آ ﻼ ﻣ ﻦ اﻟ ﺴﻼﻟﺘﻴﻦ آﺎﻧ ﺖ ﻣﻘﺎوﻣ ﻪ ﻟﻜﺜﻴ ﺮ ﻣ ﻦ‬
‫اﻟﻤﻀﺎدات اﻟﺤﻴﻮﻳﺔ و ﺗﺤﺘﻮي ﻋﻠﻲ ﺑﻼزﻣﻴﺪات و آﺬﻟﻚ آﺎﻧﺖ ﻣﻜﻮﻧﺔ ﻟﻠﻐﺸﺎء اﻟﺤﻴﻮى و ﺑﻬﺎ اﻟﻤﻮﻗﻊ اﻟﺠﻴﻨﻲ إآﺎ ‪.‬‬
‫وﻣﻦ هﺬااﻟﺒﺤﺚ ﻳﺘﻢ اﺳﺘﻨﺘﺎج اﻵﺗﻰ‪:‬‬‫إن اﻟﻌﺰﻻت اﻟﻤﺮﺿﻴﺔ ﻟﻬﺎ اﻟﻘﺪرة ﻋﻠﻰ ﺗﻜﻮﻳﻦ اﻟﻐﺸﺎء اﻟﺤﻴﻮى وﺑﻬﺎ اﻟﻤﻮﻗﻊ اﻟﺠﻴﻨﻰ ) إآﺎ(‬
‫آﻼ ﻣﻦ اﻻﺟﺎر اﻟﻤﻀﺎف اﻟﻴﺔ ﺻﺒﻐﺔ اﻟﻜﻮﻧﺠﻮ اﻟﺤﻤﺮاء واﻟﺒﺤﺚ ﻋﻦ ﺟﻴﻨﺎت )إآﺎ( هﻲ ﻃﺮق ﺻﺤﻴﺤﺔ ﻟﺘﺤﺪﻳﺪ ﻗﺪرة اﻟﺒﻜﺘﺮﻳﺎ ﻋﻠﻰ ﺗﻜﻮﻳﻦ اﻟﻐ ﺸﺎء‬
‫اﻟﺤﻴﻮى‪.‬‬
‫اﻟﺒﻼزﻣﻴﺪات ﻟﻬﺎ دور ﻓﻰ ﺗﺘﺒﻊ ﻣﺼﺎدر اﻟﻌﺪوى‪.‬‬
‫ﻣﻘﺪﻣﻰ اﻟﺮﻋﺎﻳﺔ اﻟﺼﺤﻴﺔ ﻟﻬﻢ دور ﻓﻰ ﻧﺸﺮ اﻟﻌﺪوى‪.‬‬
‫وﺟﻮد اﻟﻐﺸﺎء اﻟﺤﻴﻮى ﻳﺴﺎﻋﺪ اﻟﺒﻜﺘﺮﻳﺎ ﻋﻠﻰ ﻣﻘﺎوﻣﺔ اﻟﻤﻀﺎدات اﻟﺤﻴﻮﻳﺔ اﻟﻤﺨﺘﻠﻔﺔ‪.‬‬
‫‪32‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Detection of Gram Negative Bacilli and Endotoxin in Water and
Dialysate of Haemodialysis Unit in a University Hospital
Ensaf A Azzazy; Nana A-E Mohammed; Mervat S. Mohammed and
Rehab M. E. Tash
Microbiology and Immunology Department -Faculty of Medicine- Zagazig University
ABSTRACT
This study aimed to detect Gram negative bacilli by different microbiological methods and to detect the
endotoxin by The Limulus Amebocyte Lysate (LAL) assay in water and dialysate of haemodialysis unit in
Zagazig University Hospitals. Two hundred eighty one water samples, 50 concentrate and 100 dialyste
samples were collected. All tested samples were cultured on four media using membrane filtration
technique , M- Endo at 37 °C for 24 hours (selective for total coliform ), M- FC medium at 45 °C for 48
hours ( selective for faecal coliform ), Reasoner’s 2 agar (R2A) at 22 °C for 7 days ( for isolation of
heterotrophs) and Cetermide medium at 37 °C for 24 hours ( selective for Pseudomonas
auroginosa).Forty samples were tested for endotoxin by gel clot method LAL assay along with bacterial
count on R2A medium. Fifty dilaysate samples were tested for free short segments of DNA .The same
samples were directly tested by PCR for the presence of Gram negative bacilli 16S t RNA universal gene.
No water samples showed coliform or faecal coliform growth while concentrate and dialysate samples
showed 12% &10 % coliform growth and 6% & 5% faecal coliform growth respectively. 9.7 % of all
tested samples showed growth of Pseudomonas aurginosa. On R2A 28.9% of all tested samples showed
growth. Forty percent of treated water, 60% of treated water after distribution and 70 % dialyste samples
had endotoxin level > 0.25 EU/ml. 82% of dialysate samples showed short DNA fragment with molecular
weight below 100 bp.62% of samples showed positive results for the presence 16S t RNA gene with bands
that lie in the area between 123-246 bp .The quality of water and fluids used in the heamodialysis unit
under study necessitates revision of to elevate the quality of haemodialysis service with better outcome for
patients.
Key words: Haemodialysis -Water quality -Dialysate -Gram-negative bacteria- Bacterial countEndotoxin
Abbreviations: LAL: Limulus amebocyte lysate
So rigorous control of water quality in
hemodialysis services is extremely important in
order to guarantee a better quality of life of the
patients submitted to this treatment. The lack of
adequate water monitoring has caused the death
of various patients in the past before
establishment of the water and dialysate
standards(1).
Quality standards of European Dialysis and
Transplant
Association
(EDTA)
for
heterotrophic bacterial count define the
microbiological quality of water for dialysis and
dialysate as not more than 102 microorganisms
and 0.25 EU of endotoxin/ml(4).
Objective:
The aim of this work was detection of
Gram negative bacilli by (conventional
methods, API and PCR) in addition to detection
of the endotoxin by The Limulus Amebocyte
Lysate (LAL) assay in water and dialysate of
Haemodialysis Unit in Zagazig University
Hospitals.
INTRODUCTION
Hemodialysis is an important alternative
treatment for patients with chronic renal failure,
increasing the quality of life of these individuals
and becoming for some the hope of life in view
of the irreversibility of the disease and during
the waiting period for a renal transplant(1).
Exposure to bacteria and endotoxins of
patients submitted to dialytic treatment is
clearly associated with short-term complications
causing organic alterations such as fever,
shivering, discomfort, myalgia, nausea,
yawning, and coagulation of the dialyzer, but
also leads to long-term consequences such as
migraine and amyloidosis, in addition to
contributing to subdialysis(2).
During hemodialysis, patient’s blood has a
contact with dialysate through a semipermeable
membrane. Bacterial endotoxins can pass
through the membrane pores into the patient’s
blood
and
cause
a
silent
chronic
microinflammation(3).
33
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
to obtain separate colonies for further
identification then subcultered on MacConkeys
agar to differentiate lactose fermenters to be
further identified by API 20E and lactose
nonfermenters to be identified by API 20
NE(BioMe´rieux, France)(11). Heterotrophic
bacterial count was calculated as CFU/ml
according to AlTomi(7).
Regarding the endotoxin detection. Forty
samples were tested for endotoxin along with
bacterial count, this included: ten samples from
treated water, ten samples from water after
distribution system and 20 dialysate samples.
The Limulus amoebocyte lysate (Pyrotell,
Associates of Cape Cod -USA) gel clot method
was used. It is an aqueous extract of blood cells
(amebocytes) from the horse shoe crab Limulus
Polyphemus. The LAL single test vial of
Pyrotell contain 0.2 ml lyophilized LAL , 1.5
v/v of 25 % of human serum albumin as
stabilizer, 3% NaCl and other appropriate ions.
No preservatives, buffer or other ingredients
have been added. Manufacturer instructions
were followed. Depyrogenation of the glass
bottles used for water and dialysate collection
was carried out in hot air oven for 30 minutes at
250 ºC .The same precautions in sampling,
transport and storage were applied as before.
For single test vial with sensitivity of 0.25
EU/ml, 200 µL of sample was added and
incubated at 37° C for 60 minutes. Positive and
negative controls were included. A positive test
is indicated if the clot remains solid after the
inversion of the test tube 180º.
The presence of short DNA fragments was
tested in fifty dialysate samples by extraction of
DNA by Sep-Pak C18 column and the
molecular weight is determined by gel
electrophoresis. The same samples were directly
tested by PCR for the presence of Gram
negative bacteria 16S tRNA universal gene.
All data were coded, filtered and checked to
SPSS (Statistical Package for Social Science)
version 19
MATERIAL & METHODS
This study was conducted in the Medical
Microbiology & Immunology department,
Faculty of Medicine, Zagazig University, during
the period from July 2008- June 2011. Samples
were collected from Haemodialysis Unit –
Nephrology department, Zagazig University
Hospitals.
For bacteriological examination, 281 water,
50 concentrate and 100 dialysate samples were
collected, water samples included 72 samples
from municipal feed water, 72 water after pretreatment stage and before reverse osmosis, 72
treated water samples and 65 water samples
from dialysis room after distribution system and
before entering dialysis machines. Aseptic
technique was applied and sterile gloves were
worn during sampling(5). Volume of 400 ml of
the tested samples was collected after free flow
of 5-10 liters has been discarded. The sample
was collected aseptically in to prepared sterile
glass bottle (sodium thiosulphate with final
concentration of 10 percent was added to
municipal water samples only). Samples were
transported in ice box with no delay to the lab, if
there will be delay the glass containers were
stored at 4-8 °C in a refrigerator and analysis of
the samples were performed within 24 hours(6).
Membrane filtration technique was
employed for the tested samples(7). A volume of
100 ml of each sample was filtered through
membrane filters with pores 0.45 µm in
diameter. The membranes were then placed face
up on M-Endo medium, selective for total
coliform (HiMedia Laboratories-India, at 37°C,
for 24 h), on M-FC agar selective for faecal
coliform (HiMedia Laboratories-India, at 45ºC,
for 24 h), on Cetrimide agar selective for
Pseudomonas
auroginosa.
(HiMedia
Laboratories- India, at 37°C, for 48 h) and R2A
for
isolation
of
heterotrophic
water
contaminants (HiMedia Laboratories- India, at
22°C, for 7 days). The plates were examined for
colonies morphology and Gram stain was done.
Typical colonies grown on M-Endo medium
(green sheen) were confirmed to be coliform
and were identified to species level by API 20E
(BioMe´rieux,France). Atypical colonies on MEndo media were subcultured on MacConkeys
agar and further identification was done
according to the growth pattern(8).
Blue
colonies grown on M-FC medium were
confirmed to be faecal coliform(9) and were
identified to species level by API 20E. Colonies
grown on Cetermide medium were considered
as Pseudomonas aurginosa(10). Colonies grown
on R2A medium were subcultured on R2A agar
RESULTS
No growth was detected from water
samples on M-Endo or M-FC medium .Table
(1) shows the distribution of growth of the
tested samples on different media. The growth
of Pseudomonas aurginosa on cetermide
medium was detected in 9.7% (42/431) of all
tested samples with the bicarbonate concentrate
samples showing the highest prevalence of P.
aurginosa.
Quality standards of European Dialysis and
Transplant
Association
(EDTA)
for
34
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
The second quality parameter tested in our
study was endotoxin level using LAL gel clot
method. The EDTA standard 0.25 EU/ml was
used, above this value the tested fluid is not
acceptable to be used in haemodialysis. Four
samples (40%) of treated water samples and 6
samples (60%) out of treated water after
distribution system had endotoxin level > 0.25
EU/ml. Dialyste samples had the highest level
of endotoxin contamination among the tested
samples where 70 % had endotoxin level > 0.25
EU/ml. Table (5) shows endotoxin level and
bacterial count in tested samples.
Statistically significant relationship (P
value =0.01) was found between the endotoxin
level and heterotrophic bacterial count of the
tested samples .Table (6)
Regarding the detection of free short DNA
fragments in Dialysate samples, 82% samples
showed short DNA fragment with molecular
weight below 100 bp Fig (1) .Table (7) shows
the presence of DNA fragments in inlet and
outlet dialysate samples indicating the ability of
those fragments to transfer the dialyzer
membrane .
Sixty two percent of samples (31/50)
showed positive results for the presence of
Gram negative universal gene (16S tRNA) with
bands that lie in the area between 123-246 bp.
Fig (2)
heterotrophic bacterial count level in water and
dialysate was used as bench mark to which the
quality of tested samples was compared. The
non acceptable samples (>100 CFU/ml) were
4.2%, 20% and 49% in tested treated water
samples, treated water samples after distribution
system and dialysate samples respectively. The
bacterial count on R2A of water and dialysate
samples are shown in Table (2).
Out of 130 samples with positive growth
on R2A medium 170 isolates were detected.
Table (3) shows the type of isolates on R2A
medium
Table (4) shows the distribution of isolated
Gram negative lactose fermenter bacilli from
different samples those types were isolated on
M-Endo, M-FC and R2A media.
Gram negative bacilli represent the major
bacterial isolates on R2A (53.5%). Out of those
Gram negative bacilli 94.5% were non lactose
fermenter of which ten different bacterial
species were isolated from tested samples on
R2A medium and identified by API 20 NE ; The
isolates were (in order of frequency of isolation)
Burkholderia
cepacia,
Pseudomonas
fluorescens,
Pseudomonas
stutzeri
Stenotrophomonas maltophilia, Acintobacter
bumaii , Pseudomonas putida ,Chryseomonas
luteola, Chryseobacterium meningosepticum,
Agrobacterium
radiobacter,
Acintobacter
haemolyticus.
Table (1) the distribution of growth of the tested samples on different media
Feed
Water
Treated
Water after Acetate
Bicarbonate
Media
water
before
water
distribution concentrate concentrate
n=72
RO n=72 n=72
n=65
n=20
n=30
No %
No %
No %
No
%
No
%
No
%
M-endo
0
0
0
0
0
0
0
0
1
5
5
16.7
M-FC
0
0
0
0
0
0
0
0
1
5
2
6.7
R2A
7
9.7
15 20.8 7
9.7
16
24.6
3
15
17
56.7
Cetermide 2
2.8
5
6.9
4
5.6
9
13.8
2
10
5
16.7
Total
9
12.5 20 27.8 11 15.3 25
38.5
7
35
29
96.7
Table (2): Bacterial count of water samples and dialysate on R2A
Treated water
Water after
Bacterial count CFU/mL
n=72
distribution n=65
N0
%
N0
%
<50
1
1.4
1
1.5
50 -100
3
4.2
2
3.1
101-200
2
2.8
10
15.4
>200
1
1.4
3
4.6
35
Dialysate
n=100
No
10
5
65
15
95
%
10
5
65
15
95
Dialysate samples
n=100
N0
%
9
9
7
7
34
34
15
15
Total
16
8
130
42
196
Egyptian Journal of Medical Microbiology, January 2012
Table (3): Type of isolates on R2A
Type of isolates
Gram positive cocci
Gram positive bacilli
Gram negative bacilli
Lactose fermenter
Non lactose fermenter
Vol. 21, No. 1
No
26
53
91
5
86
%
15.3
31.2
53.5
5.5
94.5
Table (4): The distribution of isolated Gram negative lactose fermenter bacilli from different
samples
Water after
distribution
Other water
samples
Acetate
concentrate
Bicarbonate
concentrate
Dialysate
Total
E.coli
Klebsialla pnemoniae
Klebsialla oxytocca
Serratia marcesans
Citrobacter freundii
Enterobacter cloacae
1
-
-
1
-
2
1
1
2
5
3
2
1
2
8
4
2
1
2
4
Table (5) Endotoxin level and bacterial count in tested samples
Water
Treated
after
water
distributio
Endotoxin level &bacterial count (n=10)
n (n=10)
No %
No %
>0.25 EU/ml
3
30
6
60
&>100 CFU/ml
>0.25 EU/ml
1
10
0
0
& <100 CFU/ml
<0.25EU/ml
4
40
2
20
& <100CFU/ml
< 0.25EU/ml &
2
20
2
20
> 100CFU/ml
Dialysate
(n=20)
χ2
P
4.11
0.66
Nonsignificant
No
%
11
55
3
15
4
20
2
10
Table (6) Relation between endotoxin level and bacterial count in all tested samples.
>0.25 EU/ml
CFU/ml
<0.25EU/ml
χ2
P
No
%
No
%
<100
4
16.7
10
62.5
6.96
0.01
Significant
>100
20
83.3
6
37.5
Table (7) Short DNA segments found in the dialysate samples
Present short DNA Absent short DNA
Samples
segments
segment
No
%
No
%
Inlet dialysat( n=25)
19
76
6
24
Outlet dialysate (n=25)
22
88
3
12
36
P
0.23
Non significant
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
This Result differs from Arvanitidou et al. who
found E.coli in 12% of tap water samples,
12.3% total coliform and 8.6% E coli in treated
water. This difference can be attributed to the
local hygienic level of drinking water in each
locality.(12)
On the other hand our results came in line
with Lima et al.(1) they found no total coliform
in tested samples and in accordance with Borges
et al., whose samples showed no growth of
neither coliform nor faecal coliform(13).
The positive growth percentage on R2A of
different stages of water treatment system, first
tap water then water after pre-treatment stage
(i.e. before reverse osmosis), treated water and
water after distribution system were 9.7%,
20.8%, 9.7% and 24.6% respectively, this
pattern reflects the importance of each step of
the treatment process the percent 9.7% in tap
water which is lowest of the tested samples may
be explained by the presence of the bacteria in
stressed non cultural state due to the presence of
residual chlorine in the municipal feed water
and by the removal of chlorine by pretreatment
stage the percent rise to 20.8% then the percent
fell again to 9.7% which emphasize the
importance of last stages of treatment of water
before it is distributed to dialysis units , so the
good monitoring of bacterial filters and UV
lamp in this final treatment stage is vital for the
quality of the water(14). Pisani et al., found that
microorganisms identified in pre- and posttreatment samples were heterotrophic bacteria,
with the percentage being higher percentage in
post-treatment samples, a finding similar to
those reported in the present study(15).
When the water samples were evaluated for
the count of hetertrophic bacteria on R2A , not
all samples were compliant with EDTA
standards, 4.2% of the treated water samples
had count more than 100 CFU/ml. Pontoriero et
al. in Italy found that 15 % of tested samples
had bacterial count >100 CFU/ml.(16)
The type of culture medium and the
conditions of incubation have considerable
influence on the results and could be a possible
factor for variation between different studies(17).
The treated water takes a journey in the
distribution system till reaching the dialysis
machines this was found to compromise the
quality of treated water where 20 % of samples
were found to EDTA standards
The discrepancy in the quality of treated
water when sampled at the treatment station
(non acceptable samples=4.2%) and those
sampled at dialysis room (non acceptable
samples=20%) give an idea about the efficacy
of disinfection and the possibility of presence of
Fig (1): Gel electrophoresis showing free short
DNA fragments with molecular weight ranged
between 25-75 bp. Left lane (M): molecular
marker -Right lane (C): negative control
Fig (2): Gel electrophoresis of PCR product
showing the universal gene of Gram negative
bacilli (16 S tRNA) bands are between 123- 246
bp. Left lane (M): molecular marker -Right
lane (C): negative control
DISCUSSION
The microbiological quality of treated water
is a very important issue in hemodialysis units.
Therefore, hemodialysis units must have
stringent quality programmes including regular
water monitoring for microbiological analysis(1).
Not only that but also, the quality of the
dialysate play an important role in the
modulation of dialysis-related complications(3).
Our study was carried out to check the quality
of water and fluids used in haemodialysis unit in
Zagazig university hospital.
No water samples showed growth of
coliform nor E.coli so the water used in dialysis
units are acceptable regarding this parameter.
37
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
accordance with Santos et al.(2) who reported
about 90% of the bacteria found were Gramnegative. Bugno et al.(20) investigated the
occurrence of non-fermenting Gram-negative
bacteria which were detected in 49.5% of
treated water samples and in 29.6% of
dialysates.
Regarding the type of gram negative lactose
non fermenter bacilli isolated from tested
samples in this study, eleven bacterial species
were identified, Pseudomonas aeruginosa was
most prevalent isolate followed by Burkholderia
cepacia, this in accordance with Santos et al.
who found a clear predominance of the genus
Pseudomonas, which was able to multiply
rapidly even in sterile water, reaching high
concentrations (>100,000 CFU/mL) in less than
48 h.(2)
P. aeruginosa is being related more and
more to virulence factors, multiple resistance to
a large number of antimicrobial agents, ready
acquisition of new resistance factors and its
capacity to survive in water for long periods,
even without nutrients. For these reasons, this
species is being studied closely with a view to
establishing new means to eliminate it from
dialysis water(21).
Regarding the endotoxin level in tested
water samples , 40% of treated water samples
and 60% of treated water after distribution
system had endotoxin level > 0.25 EU/ml The
higher percentage of non acceptable samples in
water after distribution system than that found
in treated water samples can be explained by the
release of endotoxin from biofilm contaminating
the distribution system this release occurs not
only by growing bacteria in the tubing system
but also from dead bacteria due to effect of
disinfectants which kill and detach the bacteria
from the tubing system so increases the level of
endotoxins.(22)
Our results were higher than that found by
Lima et al.(1) in their study where they found
33% of post treatment water samples had
endotoxins higher than the regulating standards.
The presence of endotoxins alerting to the need
for a more rigorous monitoring and control of
all steps of the process of hemodialysis water
treatment.
Dialysate samples had the highest level of
endotoxin contamination among the tested
samples where 70% had endotoxin level > 0.25
EU/ml. Lamas et al., found poor compliance
with endotoxin criteria over a period of one year
at two HD units in Spain. A range of endotoxin
was 1.83–2.645 and 0.05–60.87 EU/mL in
dialysate from units A and B, respectively(23).
biofilm in the tubing system. if samples were
only taken from treatment station this will give
false impression of the quality of the water,
moreover this raise the attention during regular
checking of quality of water to include both
types of samples in the routine work.
The bacteriological quality of the
concentrate samples showed growth of coliform
and E.coli in 12% (6/50) & 6% (3/50) of
samples on M-Endo and M-FC respectively
that may be explained by contamination of the
concentrate by improper handling of the
concentrate and the probe. 40 %(20/50)showed
growth on R2A medium 14% (7/50) showed
growth on cetermide medium that can indicate
the contamination of the concentrate by
environmental heterotrophic bacteria as the
canisters were not tightly closed during dialysis
sessions also the improper way of preparing the
fluid with non of aseptic techniques applied to
the process may contribute to this
contamination.
Dialyste samples showed growth of total
coliform (10%), faecal coliform (5%), this may
be explained by favourable bacterial growth
conditions inside dialysis machines. The source
of those bacteria is mostly from the concentrate
samples as the water samples examined in this
study were negative for E.coli and total
coliform. In addition, these results, suggest that
the dialysis machine is the main source of
contamination. Tubing within the dialysis
machine may be the site of biofilm
development,
resulting
in
high
level
contamination of dialysate. Even if dialysis
machines are disinfected daily, biofilm
contamination may not be completely
eradicated(18). The hetertrophic bacterial count
on R2A was not acceptable in 49% of tested
dialysate samples. This is different from that
reported by Masakane et al. where the
noncompliant samples of tested dialysate
samples in a study carried out in Japan was
3.1%(19). In some guidelines there is no
standards for dialysate and they consider the
quality of water as indicator of the dialysate
quality based on the fact that dialysate is 9599% composed of water, however the result of
the present study indicate that testing dialyaste
for microbial contamination is essential and
when water meet the quality standard this won’t
necessarily guarantee the quality of dialyste
keeping in mind that dialyate is the critical fluid
that come in contact with patient blood.
The type of bacteria isolated in this study is
mainly Gram negative bacilli which represent
53.5% of isolates on R2A medium , 94.5% of
which were non lactose fermenter This was in
38
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
area between 123-246 bp. Schindler et al. using
PCR technique found Gram negative bacteria
16S tRNA gene in 10% (2 out of 20) of tested
dialysate samples(25).
Conclusion
This study showed that water and other
fluids (concentrate and dialysate) used in
haemodialysis unit-Nephrology Department at
Zagazig University Hospital meet the standards
regulations in some aspects especially total and
faecal coliform in water samples. However,
other aspects (endotoxin and DNA fragments)
necessitate revision of the production, handling
and disinfection procedures carried out in the
unit to elevate the quality of haemodialysis
service with better outcome for patients.
El-Koraie et al. investigated
the
bacteriological quality of dialysis fluid in 2
haemodialysis units in Alexandria, Egypt .The
LAL assay showed that the level of endotoxin
exceeded 0.25 EU/mL in all tested samples(17).
In another study carried out at Lithuanian
hemodialysis centers, the water and dialysate
were of insufficient quality (>0.25 EU/ml) in
14% and in 8% respectively(3).
On the other side in a study conducted in
Brazil, endotoxin analysis revealed that the
quantity present in the all tested water samples
and dialysate conform to the levels permitted by
brazilin national standards (less than 0.25
EU/ml).(13)
The high percentage dialysate and water
samples with endotoxin level more than the
accepted standards in our study and studies of
other authors may be explained by the added
effect of contaminated water used plus the
concentrate bacterial contamination load and
also the dialysis machine hygiene level keeping
in mind that the most abundant bacteria isolated
from those fluid were Gram negative bacilli.
The dialysate quality is currently tested by
LAL and counting bacterial colonies (CFU/ml)
not because these are the best methods but for
convenience(24). In our study the presence of
short DNA fragment in dialysate samples was
tested after filtration of dialysate through 0.45
µm membrane filter to get rid of any bacteria
remnants and then DNA was extracted and
subjected to gel electrophoresis to visualize the
presence of DNA fragments and their molecular
weight, 41 of 50 (82%) samples showed short
DNA fragment with molecular weight below
100 bp .
In a study done by Schindler et al. short
DNA frgamnets were detected in 18 of 20
(90%) dialysate samples investigated(25).
When comparing the bacterial DNA
contamination at inlet dialyaste and outlet
dialysate, all samples that showed positive DNA
at the inlet dialysate samples were also positive
as well at outlet dialysate samples which means
that DNA fragments can pass dialyser
membrane and carry the risk of chronic immune
system stimulation to the dialysis patient and
contribute to the pathological changes in them.
Five samples were positive at outlet
dialysate samples and negative when testing
their inlet dialysate this could originate from the
patient own blood (bacteraemia or septicaemia).
The same dialysate samples that were tested
for short DNA fragment were directly tested by
PCR for the presence of Gram negative bacteria
16S t RNA universal gene. 31 samples (62%)
showed positive results with bands that lie in the
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
39
Lima JRO, Marques SG, Gonçalves AG
et al. (2005): Microbiological analyses of
water from hemodialysis services in São
Luís, Maranhão, Brazil. Braz. J. Microbiol.
36(2): 103-108
Santos F, Santos AG, Biernat JC et al.
(2000): Detection of endotoxin by the
Limulus Amoebocyte Lysate test (LAL) in
hemodialysis units. Rev. Virt. Med. 1.
Skarupskienė
I,
Bumblytė
AI,
Tamošaitis D. et al. (2010): The level of
endotoxins in hemodialysis water and
dialysate in Lithuanian hemodialysis
centers. Medicina (Kaunas).46(8):556-560
Nystrand R. (2008): Microbiology of
Water and Fluids for Hemodialysis. J Chin.
Med. Assoc. 71 (5):223-229.
Sobrino Pérez PE, Cuadrado GB, Romá,
CR et al. (2008): Monitoring on-line
treated water and dialysate quality.
Nefrología . 28 (5): 493-504.
Canaud B., Martin K., Morena, M.et al.
(2001): Monitoring the Microbial Purity of
the Treated Water and Dialysate. Saudi J.
Kidney Dis. Transpl. 12(3):325-326.
AlTomi, AS (2007): Manual of
Bacteriological Examination of Drinking
Water
English
edition
from
http://www.scribd.com/doc/12391705/Bact
eriological-examination-of-Drinking-Water
English-Edition [accessed 23 Nov. 2009].
Rompre A, Servais P, Baudart J et al.
(2002): Detection and enumeration of
coliforms in drinking water: current
methods and emerging approaches. J. of
Microbiol. Methods 49(1): 31–54.
Eaton AD, Clesceri LS, and Greenberg
AW (2005): Standard Methods for the
Egyptian Journal of Medical Microbiology, January 2012
10.
11.
12.
13.
14.
15.
16.
17.
Examination of Water and Wastewater,
21st Ed., APHA, Washington, D.C.
King EO, Ward MK and Raney DE.
(1954): Two simple media for the
demonstration
of
pyocyanin
aind
fluorescin. J. Lab. Clin. Med 44(2):301307.
Kulakov LA, McAlister MB, Ogden KL
et al. (2002): Analysis of Bacteria
Contaminating
Ultrapure
Water
in
Industrial
Systems.
Appl
Environ
Microbiol. 68(4): 1548–1555
Arvanitidou M, Spaia S, Katsinas C et al.
(1998): Microbiological quality of water
and dialysate in all haemodialysis centres
of Greece. Nephrol. Dial. Transplant.
13(4):949-954.
Borges C R M, Lascowski K M S, Filho
N R et al. (2007): Microbiological quality
of water and dialysate in a haemodialysis
unit in Ponta Grossa-PR, Brazil .J. of Appl
Microbiol. 103: 1791–1797.
Association for the Advancement of
Medical
Instrumentation
(2004):
Standard and Recommended Practices.
AAMI/
RD52:2004.
Dialysate
for
Haemodialysis.
Pisani B, Simões M, Prandi M A G, et al.
(2000): de bacteremia por Pseudomonas
aeruginosa na unidade de hemodiálise de
um hospital de Campinas, São Paulo,
Brasil. Rev. Inst. Adolfo Lutz. 59 (1/2): 5156.
Pontoriero G, Andrulli S, Conte F. et al.
(2002): Microbial contamination in water
and dialyaste: a prospective multicenter
study. Nephrol. Dial .Transplant. 17(1): A
152.
El-Koraie A F ,Hazzah W A, Abbass A A
et al.(2007): Bacteriological monitoring of
dialysis fluid in 2 hemodialysis units in
18.
19.
20.
21.
22.
23.
24.
25.
40
Vol. 21, No. 1
Alexandria, Egypt. Saudi Med. J.
28(8):1234-1238.
Oie S, Kamiyaa A, Yonedab I et al.
(2003): Microbial contamination of
dialysate
and
its
prevention
in
haemodialysis units J. of Hospital
Infection. 54(2): 115–119.
Masakane I, Tsubakihara Y, Akib T, et
al., (2008): Bacteriological qualities of
dialysis fluid in Japan as of 31 December
2006. The Japanese Society for Dialysis
Therapy. 12(6):457-63
Bugno A, Almodovar A A B, Pereira T C
et al. (2007): Detection of non-fermenting
Gram-negative bacteria in treated water for
dialysis procedure purpose. [Portuguese].
Global Health Revista do Instituto Adolfo
Lutz. 66(2): 172-175.
Montanari L B, Sartori FG, Cardoso, M
JO, et al. (2009): Microbiological
contamination of a hemodialysis center
water distribution system. Rev. Inst. Med.
trop. S. Paulo. 51(1): 37-43.
Morin P. (2000): Identification of the
bacteriologicalcontamination of a water
treatment line used for haemodialysis and
its disinfection. J. Hosp. Infect. 45(3):218224.
Lamas JM, Alonso M, Sastre F, et al.
(2007): Dialysate bacteriological quality in
a health district. Nefrologia. 27(2):191-195.
Schindler R (2009): Clinical effect of
purification of dialysis fluids, evidence and
experience. Blood Purification. 27 (S1):
20-22
Schindler R, Beck W, Deppisch R, et al.
(2004): Short bacterial DNA fragments
Detection in dialysis fluid and induction of
cytokines. J. Am .Soc. Nephrol .15(S1):
3207–3214.
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫اﻟﻜﺸﻒ ﻋﻦ اﻟﻌﺼﻴﺎت ﺳﺎﻟﺒﺔ اﻟﺠﺮام واﻟﺬﻳﻔﺎن اﻟﺪاﺧﻠﻲ ﻓﻲ اﻟﻤﺎء وﻣﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ ﻓﻲ‬
‫وﺣﺪة اﻟﺘﺼﻔﻴﺔ اﻟﺪﻣﻮﻳﺔ ﺑﻤﺴﺘﺸﻔﻰ ﺟﺎﻣﻌﻲ‬
‫اﺻﺒﺢ اﻟﺘﻠﻮث اﻟﻤﻴﻜﺮوﺑﻲ ﻟﻤﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ اﻟﻤﺴﺘﺨﺪم ﻓﻲ ﻋﻤﻠﻴﺔ اﻟﺘﺼﻔﻴﺔ اﻟﺪﻣﻮﻳﺔ ﻟﻤﺮﺿﻰ اﻟﻔﺸﻞ اﻟﻜﻠﻮي ﻣﻦ اﻟﻤﺸﺎآﻞ اﻟﺠﺪﻳﺮة‬
‫ﺑﺎﻻهﺘﻤﺎم ﻧﻈﺮا ﻻرﺗﻔﺎع ﻧﺴﺒﺔ ﺗﻠﻮث هﺬا اﻟﺴﺎﺋﻞ ﺑﺎﻟﺒﻜﺘﻴﺮﻳﺎ وﺧﺼﻮﺻﺎ اﻟﻌﺼﻴﺎت ﺳﺎﻟﺒﺔ اﻟﺠﺮام ﺑﺎﻻﺿﺎﻓﻪ اﻟﻰ اﻟﺬﻳﻔﺎن اﻟﺪاﺧﻠﻰ ﻟﻬﺬﻩ‬
‫اﻟﺒﻜﺘﻴﺮﻳﺎ وآﻼهﻤﺎ ﻳﺘﺴﺒﺐ ﻓﻲ اﻟﻜﺜﻴﺮ ﻣﻦ اﻟﻤﺸﺎآﻞ اﻟﺼﺤﻴﻪ ﻟﻬﺆﻻء اﻟﻤﺮﺿﻰ‪ .‬ﻳﻬﺪف هﺬا اﻟﺒﺤﺚ اﻟﻰ اﻟﻜﺸﻒ ﻋﻦ وﺟﻮد اﻟﻌﺼﻴﺎت‬
‫ﺳﺎﻟﺒﺔ اﻟﺠﺮام ﺑﺎﻟﻄﺮق اﻟﻤﺨﺘﻠﻔﻪ ‪ ،‬ﻗﻴﺎس ﻣﺴﺘﻮى اﻟﺬﻳﻔﺎن اﻟﺪاﺧﻠﻰ و اﻟﻜﺸﻒ ﻋﻦ اﻻﺟﺰاء اﻟﺼﻐﻴﺮة ﻣﻦ اﻟﺤﺎﻣﺾ اﻟﻨﻮوي ﻟﻠﺒﻜﺘﻴﺮﻳﺎ‬
‫اﻟﻤﻮﺟﻮدة ﻓﻲ ﺻﻮرة ﻃﻠﻴﻘﺔ ﻓﻲ آﻞ ﻣﻦ اﻟﻤﺎء وﻣﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ اﻟﻤﺴﺘﺨﺪم ﻓﻲ وﺣﺪة اﻟﺘﺼﻔﻴﺔ اﻟﺪﻣﻮﻳﺔ ﺑﻤﺴﺘﺸﻔﻴﺎت ﺟﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ‬
‫ﻟﻠﻮﺻﻮل اﻟﻰ ﻣﺴﺘﻮى اﻟﺘﻄﻬﻴﺮ اﻟﻤﻄﻠﻮب‪.‬ﺗﻢ ﺟﻤﻊ ‪٢٨١‬ﻋﻴﻨﺔ ﻣﻦ اﻟﻤﻴﺎﻩ ‪٥٠ ،‬ﻋﻴﻨﺔ ﻣﻦ اﻟﺴﻮاﺋﻞ اﻟﻤﺮآﺰة اﻟﻤﺴﺘﺨﺪﻣﺔ ﻟﺘﺤﻀﻴﺮ ﻣﺤﻠﻮل‬
‫اﻟﺘﺮﺷﻴﺢ و ‪ ١٠٠‬ﻋﻴﻨﺔ ﻣﻦ ﻣﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ ﻣﻊ ﺗﻄﺒﻴﻖ ﺟﻤﻴﻊ اﻻﺣﺘﻴﺎﻃﺎت ﺧﻼل أﺧﺬ اﻟﻌﻴﻨﺎت واﻟﻨﻘﻞ ﻟﻠﺤﺼﻮل ﻋﻠﻰ ﻧﺘﺎﺋﺞ دﻗﻴﻘﺔ‪.‬ﺗﻢ‬
‫زرع آﻞ ﻋﻴﻨﺔ ﻋﻠﻰ ارﺑﻊ اﻧﻮاع ﻣﻦ اﻟﻤﺴﺘﻨﺒﺘﺎت ﺑﺎﺳﺘﺨﺪام ﻃﺮﻳﻘﺔ اﻟﻔﻠﺘﺮة ‪،‬ﻋﻠﻰ ‪ M-endo‬ﻓﻲ درﺟﺔ ‪ °٣٧‬ﻟﻤﺪة ‪ ٢٤‬ﺳﺎﻋﺔ‪M- ،‬‬
‫‪ FC‬ﻓﻲ درﺟﺔ ‪°٤٥‬ﻟﻤﺪة ‪ ٤٨‬ﺳﺎﻋﺔ‪ R2A ،‬ﻓﻲ ‪° ٢٢‬ﻟﻤﺪة ‪ ٧‬أﻳﺎم و ‪ cetermide‬ﻓﻲ درﺟﺔ ‪° ٣٧‬ﻟﻤﺪة ‪ ٢٤‬ﺳﺎﻋﺔ ‪ .‬ﺗﻢ اﺧﺘﻴﺎر‬
‫اﻟﻤﺴﺘﻨﺒﺖ ‪ R2A‬ﻻﺟﺮاء اﻟﻌﺪ اﻟﺒﻜﺘﻴﺮي‪ .‬ﻟﻠﺘﻌﺮف ﻋﻠﻰ اﻟﻤﺤﺘﻮى اﻟﺒﻜﺘﻴﺮي ﻣﻦ اﻟﻌﺼﻴﺎت ﺳﺎﻟﺒﺔ اﻟﺠﺮام ﺗﻢ اﺳﺘﺨﺪام ‪ API 20N‬و‬
‫‪ . API 20NE‬آﻤﺎ ﺗﻢ ﻗﻴﺎس ﻣﺴﺘﻮى اﻟﺬﻳﻔﺎن اﻟﺪاﺧﻠﻲ ﻓﻲ‪٤٠‬ﻋﻴﻨﺔ )‪ ١٠‬ﻋﻴﻨﺎت ﻣﻦ اﻟﻤﺎء اﻟﻤﻌﺎﻟﺞ ﻓﻲ ﻣﺤﻄﺔ اﻟﻤﻌﺎﻟﺠﺔ و ‪١٠‬ﻋﻴﻨﺎت‬
‫ﻣﻦ اﻟﻤﺎء اﻟﻤﺴﺘﺨﺪم ﻓﻲ ﻏﺮف اﻟﺘﺼﻔﻴﺔ اﻟﺪﻣﻮﻳﺔ و‪ ٢٠‬ﻋﻴﻨﺔ ﻣﻦ اﻟﻤﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ و ذﻟﻚ ﺑﻄﺮﻳﻘﺔ ‪ .Gel clot -LAL test‬ﻟﻠﻜﺸﻒ‬
‫ﻋﻦ وﺟﻮد اﻻﺟﺰاء اﻟﺼﻐﻴﺮة اﻟﺤﺮة ﻣﻦ اﻟﺤﻤﺾ اﻟﻨﻮوي ﻓﻲ ‪ ٥٠‬ﻋﻴﻨﺔ ﻣﻦ ﻣﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ ﺗﻢ اﺳﺘﺨﺪام ‪Sep pack C18‬‬
‫‪ column‬ﻻﺳﺘﺨﻼص اﻟﺤﻤﺾ اﻟﻨﻮوي ﻣﻦ اﻟﻌﻴﻨﺎت و ﻟﻠﻜﺸﻒ ﻋﻦ وﺟﻮد اﻟﺠﻴﻦ ‪ 16S t RNA‬ﻟﻠﺒﻜﺘﺮﻳﺎ ﺳﺎﻟﺒﺔ اﻟﺠﺮام ﻓﻲ ﻧﻔﺲ‬
‫اﻟﻌﻴﻨﺎت ﺗﻢ اﺳﺘﺨﺪام ﺗﻔﺎﻋﻞ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ‪ .‬ﻟﻢ ﺗﻈﻬﺮ ﻋﻴﻨﺎت اﻟﻤﻴﺎﻩ اﻟﻤﺨﺘﺒﺮة اي ﻣﻦ ﻣﻌﺰوﻻت اﻟﺒﻜﺘﻴﺮﻳﺎ اﻟﻘﻮﻟﻮﻧﻴﺔ اﻟﻜﻠﻴﺔ او اي‬
‫ﻣﻦ ﻣﻌﺰوﻻت اﻟﺒﻜﺘﻴﺮﻳﺎ اﻟﻘﻮﻟﻮﻧﻴﺔ اﻟﺒﺮازﻳﺔ ﻓﻲ ﺣﻴﻦ أن ﻓﺤﺺ اﻟﻌﻴﻨﺎت اﻟﻤﺤﺎﻟﻴﻞ اﻟﻤﺮآﺰة و ﻣﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ أﻇﻬﺮت ﻧﻤﻮ اﻟﺒﻜﺘﺮﻳﺎ‬
‫اﻟﻘﻮﻟﻮﻧﻴﺔ اﻟﻜﻠﻴﺔ ﻓﻲ ‪ ٪١٠ ، ٪١٢‬و ﻧﻤﻮ اﻟﺒﻜﺘﻴﺮﻳﺎ اﻟﻘﻮﻟﻮﻧﻴﺔ اﻟﺒﺮازﻳﺔ ﻓﻲ ‪ ٪٥ ، ٪٦‬ﻋﻠﻰ اﻟﺘﻮاﻟﻲ‪ .‬ﺗﻢ ﻋﺰل ﻣﻴﻜﺮوب اﻟﺰاﺋﻔﺔ‬
‫اﻟﺰﻧﺠﺎرﻳﺔ ﻓﻲ ‪ ٪٩¸٧‬ﻣﻦ آﻞ اﻟﻌﻴﻨﺎت اﻟﺘﻲ ﺗﻢ ﻓﺤﺼﻬﺎ ‪ .‬اﻣﺎ ﺑﺎﻟﻨﺴﺒﺔ ﻻﺳﺘﺨﺪام ﻣﺴﺘﻨﺒﺖ ‪ R2A‬ﻟﻌﺰل اﻟﺒﻜﺘﻴﺮﻳﺎ اﻟﻐﻴﺮ ذاﺗﻴﺔ اﻟﺘﻐﺬﻳﺔ ﻣﻦ‬
‫اﻟﺴﻮاﺋﻞ اﻟﻤﺴﺘﺨﺪﻣﺔ ﻓﻲ وﺣﺪة اﻟﺘﺮﺷﻴﺢ اﻟﺪﻣﻮي ﻓﻘﺪ وﺟﺪ ان ‪ ٤٠ ،٪ ١٦.١‬و ‪ ٪٦٥‬ﻣﻦ ﻋﻴﻨﺎت اﻟﻤﺎء ‪ ،‬ﻋﻴﻨﺎت اﻟﻤﺤﺎﻟﻴﻞ اﻟﻤﺮآﺰة و‬
‫ﺳﺎﺋﻞ اﻟﺘﺮﺷﻴﺢ اﻟﻤﺨﺘﺒﺮة ﻗﺪ اﻇﻬﺮت ﻧﻤﻮ ﺑﻜﺘﻴﺮي ﻋﻠﻰ هﺬا اﻟﻮﺳﻂ اﻟﻐﺬاﺋﻲ ‪ .‬وﻗﺪ وﺟﺪ ان ‪ ٪ ٤٠‬ﻣﻦ ﻋﻴﻨﺎت اﻟﻤﺎء اﻟﻤﻌﺎﻟﺞ و ‪٪٦٠‬‬
‫ﻣﻦ ﻋﻴﻨﺎت اﻟﻤﺎء اﻟﻤﻌﺎﻟﺞ ﺑﻌﺪ اﻟﺘﻮزﻳﻊ و‪ ٪٧٠‬ﻣﻦ ﻋﻴﻨﺎت ﻣﺤﻠﻮل اﻟﺘﺮﺷﻴﺢ ﺗﺤﺘﻮي ﻋﻠﻰ ذﻳﻔﺎن داﺧﻠﻲ < ‪ ٠¸٢٥‬وﺣﺪة ﻗﻴﺎس ‪/‬ﻣﻞ‪ .‬و‬
‫ﻗﺪ وﺟﺪ ان ‪ ٪٨٢‬ﻣﻦ اﻟﻌﻴﻨﺎت ﺗﺤﺘﻮى ﻋﻠﻰ ﺟﺰﻳﺌﺎت اﻟﺤﺎﻣﺾ اﻟﻨﻮوى ذات اﻟﻮزن اﻟﺠﺰﻳﺌﻲ اﻗﻞ ﻣﻦ ‪ ١٠٠‬ﻗﺎﻋﺪة ﻧﻴﺘﺮوﺟﻴﻨﻴﺔ ‪ .‬ﺗﻢ‬
‫اﺳﺘﺨﺪام ﺗﻔﺎﻋﻞ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ ﻟﻠﻜﺸﻒ ﻋﻦ وﺟﻮد اﻟﺠﻴﻦ اﻟﻤﻤﻴﺰ ﻟﻠﺒﻜﺘﻴﺮﻳﺎ اﻟﺴﺎﻟﺒﺔ اﻟﺠﺮام )‪ ( 16S t RNA‬و ﻗﺪ وﺟﺪ ان ‪٪ ٦٠‬‬
‫ﻣﻦ اﻟﻌﻴﻨﺎت ﺗﺤﺘﻮي ﻋﻠﻰ هﺬا اﻟﺠﻴﻦ ‪.‬‬
‫‪41‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Evaluation of QuantiFERON -TB Gold in Diagnosis of
Tuberculous Pericardial Effusion
Mohamed E. Mohamed, Hanan E. Mohamed* and Azza M Abd Elaziz**
Cardiothoracic Surgery, Clinical Pathology* Departments, Faculty of Medicine,
Zagazig University and Microbiology**, National Liver Institute, Menofeyia University
ABSTRACT
Background: Prompt treatment of tuberculous pericarditis can save lives, but definite diagnosis requires
detection and isolation of the tubercle bacilli from pericardial fluid and/or biopsy which is often delayed
and difficult. Objectives: To evaluate the diagnostic role of QuantiFERON -TB Gold test (QFT-G) as a
rapid non invasive immunological assay in diagnosis of tuberculous pericarditis with pericardial effusion
in comparison to Adenosine deaminase enzyme (ADA) activity and Polymerase chain reaction (PCR)
either individually or in combination. Subjects and methods: 27 patients suffering of pericarditis
accompanied with pericardial effusions highly suspicious to be tuberculous (clinically and
radiographically) were subjected to pericardial fluid aspiration and biopsy, Ziehl-Neelsen stain, culture
and histopathological examination(biopsy) for tuberculosis were done for each sample. Pericardial fluid
was submitted to Polymerase chain reaction and measurement of adenosine deaminase activity and
finally QuantiFERON -TB Gold test in blood was done. Results: Out of 27 probable tuberculous
pericarditis patients with pericardial effusion, 19 were definite positive cases. Considering the value of
40 U/L ADA activity , 16/19 cases were positive so the sensitivity was 84.2% which was the same as the
results of QuantiFERON -TB Gold test while there were 10 PCR positive cases, so PCR sensitivity was
52.6%. There were 2 positive ADA and one QuantiFERON -TB Gold positive results among the 8 culture
negative cases, while none was detected by PCR , so its specificity was100% while (QFT-G) specificity
was 87.5% and ADA 75%. The sensitivity, specificity, PPV and NPV of combined QFT-G test and PCR
results were 89.5%, 87.5%, 94.4% and 77.8% respectively. While the sensitivity, specificity, PPV and
NPV combined QFT-G with ADA results were 84.2%, 75%, 88.9% and 66.7% respectively. Conclusion:
QuantiFERON -TB Gold test have good sensitivity and specificity for diagnosis of tuberculous
pericardial effusion. The best combined sensitivity and specificity in the current study were reported
between PCR and QuantiFERON test results but it is not much greater than that of QuantiFERON test
alone. So, QuantiFERON -TB Gold test can be used as an adjunct rapid immunological non invasive test
for diagnosis of tuberculous pericardial effusion. However negative QuantiFERON -TB Gold assay does
not exclude the disease because of the low NPV of this assay.
an acute pericarditis, which is uncommon, or as
cardiac tamponade(6), which is frequent, the
diagnosis is more likely to be delayed or missed.
The delay from hospital admission to diagnosis
was 5.2 weeks in a report from Spain(7) and in
another from the USA the diagnosis was first
made only at necropsy in 17% of patients(8). The
probability of obtaining a definitive diagnosis is
greatest when pericardial fluid and a pericardial
biopsy specimen are examined early in the
effusive stage(7,9). Considering the mortality
from tuberculous pericarditis (17% to 40%)(10)
and survival time without treatment is
approximately four months even when the
patients receive treatment ,the mortality rate
ranges from 3 up to 40% (11), rapid and accurate
diagnosis (which is often difficult) and
treatment are crucial to reduce mortality and
morbidity from this pericardial disease(12,13).
Ziehl-Neelsen (ZN) stained smears of
pericardial fluid have poor sensitivity for
INTRODUCTION
Tuberculosis (TB) is a major health
problem in South Africa, with an annual
incidence rate of 350 per 100,000 population(1).
In Egypt, tuberculosis is the second most
important health problem after Bilharzasis(2).
Approximately 1 to 2% of these cases are
complicated by tuberculous pericarditis (TP) (3).
Tubercle bacilli reach the pericardium from
the adjacent tracheobronchial lymph nodes
either directly or via lymphatic channels. Less
commonly seedling of the pericardium occurs
with milliary tuberculosis and rarely
mycobacteria spread directly from pleura or
adjacent rib(4). Tuberculous pericarditis is a rare
cause of pericardial effusion in developed
countries, while it is the cause of up to 70% of
cases in developing countries(5) .Tuberculous
pericardial effusion usually presents as a slowly
progressive febrile illness. When it presents as
43
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
QuantiFERON- TB Gold test was done in
blood.
1. ADA activity (U/L) was determined in
every pericardial fluid specimen according
to the method described by GIUSTI(26). The
cut-off value for ADA activity that
considered adequate to presume the
diagnosis of tuberculous pericardial
effusion was 40 U/L (22,27).
2. Polymerase Chain Reaction using COBAS
AMPLICOR (Roche Diagnostics) for every
sample. The test was done in four steps:
specimen preparation; Polymerase Chain
Reaction nucleic acid amplification of
target DNA using biotinylated primers;
hybridization of amplified products to
oligonucleotide probes specific to the target
and detection of the probe- bound amplified
products by color formation.
3. QuantiFERON -TB Gold test. Cellestis
QuantiFERON-TB Gold test (Cellestis Ltd,
Carnegie, Victoria ,Australia).
ƒ Five ml blood was collected from each
subject in heparinized tube , incubation
with stimulation antigens as soon as
possible (within 12 hours) after
collection must be done.
ƒ One ml aliquots of heparinized whole
blood from each sample was dispensed
into 4 wells of 24 well tissue culture
plate.
ƒ The TB- specific antigens, nil and
mitogen controls were thoroughly
mixed, then the dropper bottle was
hold vertically and added 3 drops of
ESAT- 6 TB specific antigen, CFP-10
TB specific antigen, mitogen control
and nil control to the appropriate wells
containing blood and the plates were
incubated for 16-24h at 37°C.
ƒ 200-300 µl of plasma was removed
carefully from above the sedimented
red cells using a variable micropipette
and was transferred into separate tubes.
Plasma tubes can be stored for up to 3
months at - 20 C.
ƒ Fifty ul of freshly prepared conjugate
were pipetted to microwells of ELISA
plate then fifty µl of plasma samples
were pipetted to appropriate wells
containing conjugate and fifty µl of
each of the standards were pipetted to
appropriate wells containing conjugate.
ƒ Microwell strips were covered and
incubated for 2 hours at room
temperature (18-25°C) on a microplate
shaker then microwell strips were
detecting Mycobacterium tuberculosis, while
culture is both slow and insensitive(13-15).
Pericardial biopsy is invasive, requires technical
skills and is often not diagnostic(7,13,16).
Clinicians thus have to rely heavily on the
clinical features of pericardial tuberculosis to
initiate therapy(17-19).
Due to this difficulty of establishing the
diagnosis of tuberculous pericarditis using
clinical, radiological, cytological or even
microbiologic evaluation, attempts to correlate
tuberculous pericarditis diagnosis with other
markers have been pursued(20).Adenosine
deaminase enzyme (ADA) activity in
tuberculous pericarditis(21,22) and Polymerase
chain reaction (PCR) for diagnosis of TB in
pericardial
fluid
and
tissue
were
documented(12,23).
The recently developed interferon-y (IFNy) release assay (IGRA) measures TB-specific T
cells responding to Mycobacterium tuberculosis
derived antigens, including early secreted
antigenic target 6 (ESAT-6) and culture filtrate
protein 10 (CFP-10)(24). Among these tests, the
QuantiFERON -TB Gold (QFT-G) is approved
and recommended for diagnosing latent and
active TB(25). This study was done to evaluate
the diagnostic role of QuantiFERON- TB Gold
test as a rapid non invasive immunological
assay for diagnosis of tuberculous pericarditis
with pericardial effusion in comparison to ADA
activity and PCR either individually or in
combination.
SUBJECTS & METHODS
Twenty-seven patients suffering of
pericarditis accompanied with pericardial
effusions clinically and radiographically (ages,
23 to 62 years; 17 males and 10 females) were
included in this study. They were admitted to
Zagazig University hospitals from April 2008 to
January 2010. Informed written consent was
obtained from the patients. Pericardial fluid and
biopsy specimens were obtained from patients
by
pericardiocentesis
subxiphoid
pericardiostomy as described by Cegielski et
al(17). For definite diagnosis(12,23), each sample
was submitted for :
1. Ziehl-Neelsen staining .
2. culture and identification of Mycobacterium
tuberculosis using Bactec 460TB(Becton
Dickinson).
3. Histopathological examination of the
pericardial biopsy.
Pericardial fluid was further submitted to
measurement of ADA activity, PCR and finally
44
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
was evaluated by calculating Sensitivity,
specificity, positive predictive value(PPV), and
negative predictive value (NPV).
washed at least 4 times with wash
buffer.
ƒ One hundred µl of enzyme substrate
solution was pipetted to all wells and
mixed well using a microplate shaker
then the microwell strips were covered
and incubated at room temperature for
about 30 minutes on a microplate
shaker set at 100 rpm.
ƒ Fifty µl enzyme stopping solution was
pipetted to all wells.
ƒ Color intensity was measured at 450
nm and 620 nm as a reference wave
length within 5 minutes.
ƒ The IFN-y concentration (IU/ ml) for
each of the test plasma samples were
determined by using the standard curve
to read off the IFN-y concentration.
The manufacturer's cutoff for a positive
test, indicating likely M. tuberculosis
infection, is ≥0.35 IU/ml of IFN-y for
the TB-specific antigen stimulated
plasma sample above the amount of
IFN-y in the negative control sample.
Statistical analysis
Analysis of the collected data was done
using SPSS version 10.0 . Data were expressed
as number and percentage for quantitative and
qualitative variables. The usefulness of
determining ADA activity, PCR and
QuantiFERON -TB Gold test as a diagnostic
tool for tuberculous pericarditis with effusion
RESULTS
Among Twenty-seven patients with
pericarditis and pericardial effusions. Only 19
were confirmed to have definite tuberculous
pericarditis .Among these patients there were16
positive cases by measuring (40 U/L )ADA
activity and also , 16 cases showed positive
QuantiFERON -TB Gold results , so the
sensitivity for both tests was 84.2%. While there
were 10 PCR positive cases, PCR sensitivity
was of 52.6%. There were 2 positive ADA and
one QuantiFERON -TB Gold positive results
among the 8 culture negative cases, while no
positive case was detected by PCR .Its
specificity was100% while (QFT-G) specificity
was 87.5% and ADA 75% (table 1).
The sensitivity, specificity, PPV and NPV
of ADA and PCR tests in combination with
QFT-G were assessed. QFT-G test results when
combined with PCR results, the sensitivity,
specificity, PPV and NPV were 89.5%,
87.5%,94.4% and 77.8% respectively(table 2).
When QFT-G results was combined to ADA
results the sensitivity ,specificity ,PPV and NPV
were 84.2%,75%,88.9% and 66.7% respectively
(table 3).
Table (1): Diagnostic performance of different methods individually in diagnosis of tuberculous
pericarditis.
Presumed cases=27
PPV
NPV
Definite +ve Definite -ve sensitivity specificity
(no:19)
(no:8)
+ve
16
2
84.2%
75%
88.9%
66.7%
ADA activity
-ve
3
6
+ve
10
0
52.6%
100%
100%
47%
PCR
-ve
9
8
+ve
16
1
84.2%
87.5%
94.1%
70%
QFT-G
-ve
3
7
Table (2): Diagnostic performance of PCR in combination with QFT-G for diagnosis of tuberculous
pericarditis.
Presumed cases=27
specificity
PPV
NPV
Definite +ve
Definite -ve
sensitivity
(no:19)
(no:8)
17
1
QFT-G+ PCR +ve
89.5%
87.5%
94.4% 77.8%
-ve
2
7
45
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (3): Diagnostic performance of ADA in combination with QFT-G for diagnosis of tuberculous
pericarditis.
Presumed cases=27
PPV
NPV
Definite +ve Definite -ve sensitivity specificity
(no:19)
(no:8)
16
2
QFT-G+ADA +ve
84.2%
75%
88.9%
66.7%
-ve
3
6
acid amplification(21). In this study, PCR for M.
tuberculosis was performed in pericardial fluid
samples for all patients . Positive PCR results
were obtained for ten ‘definite’ tuberculous
effusions and was negative for nine of them.
This resulted in sensitivity, specificity, PPV and
NPV of 52.6%, 100%, 100% and 47%,
respectively. Reuter et al (23) reported that The
use of PCR for the detection of M. tuberculosis
provides a test with high specificity for the
diagnosis of pericardial TB; however,
sensitivity was low at 32%. This surprisingly
poor sensitivity has also been reported in
different pericardial effusion studies with
specificities
between
96–100%,(12,22).
Explanations for the poor sensitivity of PCR in
tuberculous exudates include the presence of
inhibitors such as fibrin and hemoglobin, as
well as low numbers of tubercle bacilli or their
DNA in the specimens(31,32).
In the current study the QuantiFERON -TB
Gold test results were positive in 16 cases out of
19 definite positive cases by ZN and/or culture
and/or histopathological examination, while there
were one QuantiFERON positive result among
the definite negative cases ,so its sensitivity was
84.2% and the specificity was 87.5%.These
results were in agreement with that of Raven et
al(33) and Nishimura et al (34)who reported that
QuantiFERON test sensitivity were 80% and 85%
respectively and the specificity were 87% and
91.2% respectively. Also nearby results were
reported by Lee et al (35) as sensitivity of the test
was 78% and specificity was 79%. But in another
study of Kim et al (36) ,lower sensitivity and
specificity (70.1% and 64.3% respectively) of
QuantiFERON test were reported and were
attributed to the difference in radiographic extent
of the disease and its location. Also
immunological state and other biological factors
may interfere and lead to different results(34).
In the present study, three definite positive
cases were negative by QuantiFERON, these
cases were diagnosed clinically as severe
pericarditis with huge pericardial effusion that
may be associated with weak T-cell response,
which was also suggested by previous
studies(33,34).
DISCUSSION
Effective
treatment
of
tuberclous
pericarditis requires a rapid and accurate
diagnosis, but this is often difficult(13). Acid fast
bacilli stains of pericardial effusion sediment
are usually negative and culture sensitivity is
not greater than 50%(12). The diagnostic
sensitivity for TB by pericardial biopsy ranges
from 10% to 64%(13,28). Due to the difficulty of
establishing the diagnosis of tuberculous
pericarditis
using
clinical,
radiological,
cytological or even microbiologic evaluation,
attempts to correlate tuberculous pericarditis
diagnosis with other markers have been
pursued(20). Reuter et al. (23) mentioned that
where the diagnostic infrastructure and
resources are available, suspected cases of
tuberculous pericarditis may be diagnosed using
polymerase chain reaction (PCR) analysis,
adenosine deaminase
(ADA) activity and
pericardial interferon gamma (IFN- y) levels.
The analysis of ADA activity is one of the
most studied possibilities and highlighted as an
accurate measurement method for values greater
than 40 U/L(22,27).
The ADA activity sensitivity for
tuberculous pericarditis detection in our study
was 84.2% which was similar to that found in
other studies(22,29). A meta-analysis evaluating
ADA activity levels in tuberculous pericarditis
revealed a mean sensitivity of 88%(30).
Therefore, measuring ADA activity in
pericardial effusion is, indeed, useful as a
screening
investigation
for
tuberculous
pericarditis.
The same conclusion cannot be reached
when analyzing the specificity value (75%) that
we verified and was not helping in the exclusion
of the diagnosis when patients present with
normal values of ADA activity. This specificity
value was in agreement with results reported in
several studies(21,23).
The difficulty to establish the etiologic
diagnosis of tuberculous pericarditis fosters the
search of a reliable, quick and affordable
diagnostic test for this illness. Several studies
have demonstrated the importance of the nucleic
46
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
4.
Ortbals DW, Avioli LV. Tuberculous
pericarditis. Arch Intern Med 1979;
139:231–4.
Fouda R, Hussam A, Ramy E, et al.
Tuberculous pericarditis associated with
hoarseness of voice due to left recurrent
laryngeal nerve paralysis. BMJ Case
Reports
2011;
doi:10.1136/bcr.06.2011.4409
Jain S, Sharma N, Varma S, et al. Profile
of cardiac tamponade in the medical
emergency ward of a North Indian hospital.
Can J Cardiol1999;15:671–5.
Sagrista-Sauleda J, Permanyer-Miralda
G, Soler-Soler J. Tuberculous pericarditis:
ten year experience with a prospective
protocol for diagnosis and treatment. J Am
Coll Cardiol 1988;2:724–8.
Rooney JJ, Crocco JA, Lyons HA.
Tuberculous pericarditis. Ann Intern Med
1970;72:73–8.
Barr JF. The use of pericardial biopsy in
establishing etiologic diagnosis in acute
pericarditis. Arch Intern Med 1955; 96:
693–696
Sayed F, Mayosi B. A modern approach to
tuberculous pericarditis. Progress in
cardiovascular diseases. 2007;50:218–36.
Yang CC, Lee MH, Liu JW, et al.
Diagnosis of tuberculous pericarditis and
treatment without corticosteroid in a tertiary
teacher hospital in Taiwan: a-14 years
experience. J. Microbiol. Immunol. Infect.
2005; 38: 47-52,.
Cegielski JP, Blythe HD, Uma PP, et al.
Comparison of PCR, Culture, and
Histopathology
for
Diagnosis
of
Tuberculous Pericarditis. JCM 1997;35:
3254–3257.
Koh KK, Kim EJ, Cho CH, et al.
Adenosine
deaminase
and
carcinoembryonic antigen in pericardial
effusion diagnosis, especially in suspected
tuberculous pericarditis. Circulation 1994;
89:2728–35.
Strang JIG. Tuberculous pericarditis in
Transkei. Clinical Cardiol 1984; 7:667–70.
Cherian G. Diagnosis of tuberculous
aetiology in pericardial effusions. Postgrad
Med J 2004; 80:262–6.
Fowler NO. Tuberculous pericarditis.
JAMA 1991; 266:99–103.
Cegielski JP, Lwakatare JL, Dukes CS,
et al. Tuberculous pericarditis in Tanzanian
patients with and without HIV infection.
Tuber Lung Dis 1994; 75:429–34.
Pozniak AL, Weinberg J, Mahari M, et
al. Tuberculous pericardial effusion
Considering the good diagnostic performance
of QuantiFERON-TB Gold test among the studied
tests and in order to reach maximum diagnosis of
tuberculous pericardial effusion, the current study
evaluated whether combination of ADA or PCR
results to QuantiFERON test results could lead to
better diagnostic performance than that of each
test alone.
The best combined sensitivity and specificity
in our study was reported between PCR and
QuantiFERON results (89.5% and 87.5%
respectively) but it is not much greater than that
of QuantiFERON test alone, while combined
sensitivity and specificity of ADA and
QuantiFERON test results were (84.2% and 75%
respectively) and did not add more.
Pericardiocentesis is not always feasible,
and non-invasive tests that are indicative of
tuberculous aetiology of pericardial effusion are
thus highly desirable. Major advantage of
QuantiFERON test include non-invasiveness,
availability, cost-effectiveness and rapidity.
However, none of the immune based tests can
replace conventional tests such as ZN stain for
acid fast bacilli, culture and histopathological
examination for the diagnosis of tuberculous
pericardial effusion especially in immunecompromised patients.
Further studies are recommended on larger
group of patients to fully ascertain the role of
QuantiFERON assay in diagnosis of tuberculous
pericardial effusion and for longer duration of
follow up especially after treatment.
In conclusion QuantiFERON -TB Gold test
have good sensitivity and specificity and can be
used as an adjunct rapid immunological non
invasive test in diagnosis of tuberculous
pericardial
effusion.
However
negative
QuantiFERON -TB Gold assay does not
exclude the disease because of the low NPV of
this assay.
5.
6.
7.
8.
9.
10.
11.
12.
13.
REFERENCES
1.
2.
3.
Colvin M, Abdool SS. HIV infection
among patients with tuberculosis in
KwaZulu-Natal, South Africa [letter]. Int J
Tuberc Lung Dis 1998; 2:172
Zaher H. Tuberculosis situation in Egypt.
The 5Th International conference of
Microbiology, AIDS and emerging
Infectious diseases, Cairo, Egypt. 1996.
Larrieu AJ, Tyers GFO, Williams EH, et
al. Recent experience with tuberculous
pericarditis. Ann Thorac Surg 1980; 29:464
–468
14.
15.
16.
17.
18.
47
Egyptian Journal of Medical Microbiology, January 2012
19.
20.
21.
22.
23.
24.
25.
26.
27.
associated with HIV infection: a sign of
disseminated disease. Tuber Lung Dis
1994; 75:297–300.
Maher D, Harries AD. Tuberculous
pericardial effusion: a prospective clinical
study in a low-resource setting-Blantyre,
Malawi. Int J Tuberc Lung Dis 1997;
1:358–64.
Blake J, Berman P. The use of adenosine
deaminase assays in the diagnosis of
tuberculosis. S Afr med J 1982;62: 19-21.
Tuon FF, da Silva VI, Duboc de Almeida
J M, et al. The usefulness of adenosine
deaminase in the diagnosis of tuberculous
pericarditis. Rev Inst Med trop S Paulo
2007;49(3):165-170
Lee JH, Lee CW, Lee S, et al. Comparison
of polymerase chain reaction with
adenosine deaminase activity in pericardial
fluid for the diagnosis of tuberculous
pericarditis. Am J Med 2002;113: 519-521.
Reuter H, Burgess L, Van Vuuren W, et
al. Diagnosing tuberculous pericarditis. Q J
Med 2006; 99:827–839
Dong Il Won, Jung Ran P. Flow
Cytometric Measurements of TB-Specific T
Cells Comparing with QuantiFERON-TB
Gold .Cytometry Part B .Clinical
Cytometry 2010;78B:71–80 .
Mazurek GH, Jereb J, Lobue P, et al.
Guidelines for using the Quantiferon-TB
Gold test for detecting Mycobacteruim
tuberculosis infection, United States.
Morbid Mortal Wkly Rep ; 54 (RR-15),4955.
Giusti G. Adenosine deaminase. In:
Bergmeyer HU, ed. Methods of enzymatic
analysis. 2nd ed. New York: Acedemic
Press, 1974: 1092-9.
Reuter H, Burgess LJ, Carstens ME et
al. Adenosine deaminase activity - more
28.
29.
30.
31.
32.
33.
34.
35.
36.
48
Vol. 21, No. 1
than a diagnostic tool in tuberculous
pericarditis. Cardiovasc J S Afr 2005;16:
143-147.
Schepers GWH. Tuberculous pericarditis.
Am J Cardiol. 1962; 9: 248–276
Martinez-Vazquez JM, Ribera E, Ocana
I, et al. Adenosine deaminase activity in
tuberculous pericarditis. Thorax 1986;41:
888-889.
Tuon FF. Video-assisted thoracoscopy and
tuberculous pericarditis. Ann thorac Surg
2006;81: 2338.
Kox LF, Rhienthong AM, Miranda N, et
al. A more reliable PCR for detection of
Mycobacterium tuberculosis in clinical
samples. J Clin Microbiol 1994; 32:672–8.
Ferrer J. Pleural tuberculosis. Eur Respir J
1997; 10:942–7.
Raven P, Munk ME, Andersen AB, et al.
Prospective Evaluation of a Whole-Blood
Test Using Mycobacterium tuberculosisSpecific Antigens ESAT-6 and CFP-10 for
Diagnosis of Active Tuberculosis. Clin
Diag Lab Immunol 2005;12(4):491-496.
Nishimura T, Hasegawa N, Mori M, et
al. Accuracy of an interferon-gamma
release assay to detect active pulmonary
and extra-pulmonary tuberculosis. Int J
Tuberc Lung Dis 2008;12(3):269-74.
Lee HM, Cho SG, Kang HK, et al. The
Usefulness of Whole-blood Interferongamma Release Assay for the Diagnosis of
Extra-pulmonary Tuberculosis. Tuberc
Respir Dis 2009 Oct;67(4):331-337.
Kim YY, Lee J, Lee YJ, et al. Sensitivity
of Whole-Blood Interferon-Gamma Release
Assay According to the Severity and the
Location of Disease in Patients with Active
Tuberculosis. Tuberc Respir Dis 2011
Feb;70(2):125-131.
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫ﺗﻘﻴﻴﻢ اﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ ﺟﻮﻟﺪ ﻓﻰ ﺗﺸﺨﻴﺺ ارﺗﺸﺎح اﻟﺘﺎﻣﻮر اﻟﺪرﻧﻰ‬
‫ﺧﻠﻔﻴ ﺔ‪ :‬اﻟﻌ ﻼج اﻟﻔ ﻮري ﻻﻟﺘﻬ ﺎب اﻟﺘ ﺎﻣﻮر اﻟ ﺪرﻧﻰ ﻳ ﺆدى ﻹﻧﻘ ﺎذ أرواح اﻟﻌﺪﻳ ﺪ ﻣ ﻦ اﻟﻤﺮﺿ ﻰ‪ ،‬وﻟﻜ ﻦ اﻟﺘ ﺸﺨﻴﺺ اﻟﻮاﺿ ﺢ واﻷآﻴ ﺪ‬
‫ﻳﺘﻄﻠﺐ اﻟﻜﺸﻒ ﻋﻦ اﻟﻌﺼﻴﺎت اﻟﺴﻠﻴﺔ وﻋﺰﻟﻬﺎ ﻣﻦ اﻟﺴﺎﺋﻞ اﻟﺘﺎﻣﻮري و ‪ /‬أو اﻟﺨﺰﻋﺔ اﻟﺘﻲ ﻏﺎﻟﺒﺎ ﻣﺎﻳﻜﻮن ﻣﻦ اﻟﺼﻌﻮﺑﺔ ﺑﻤﻜﺎن و ﻳﺄﺧ ﺬ‬
‫اﻟﻜﺜﻴﺮ ﻣﻦ اﻟﻮﻗﺖ‪.‬‬
‫اﻷهﺪاف‪:‬اﻟﻬﺪف ﻣﻦ هﺬا اﻟﺒﺤﺚ هﻮﺗﻘﻴﻴﻢ اﻟﺪور اﻟﺘﺸﺨﻴﺼﻰ ﻻﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗ ﻰ ﺑ ﻰ ﺟﻮﻟ ﺪ )‪ (QFT-G‬ﻓ ﻰ ﺗ ﺸﺨﻴﺺ ارﺗ ﺸﺎح‬
‫اﻟﺘﺎﻣﻮر اﻟﺪرﻧﻰ اﻟﻤﺼﺎﺣﺐ ﻟﻼﻟﺘﻬﺎب اﻟﺘﺎﻣﻮرى آﻄﺮﻳﻘﻪ ﺳﺮﻳﻌﻪ و ﻣﻨﺎﻋﻴﺔ ﻣﻘﺎرﻧﺔ ﺑﻨﺸﺎط اﻧﺰﻳﻢ اﻷدﻳﻨﻮﺳﺎﻳﻦ ﻧﺎزع اﻷﻣ ﻴﻦ )‪(ADA‬‬
‫وﺗﻔﺎﻋﻞ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ )‪ (PCR‬إﻣﺎ ﻣﻨﻔﺮدة أو ﻣﺠﺘﻤﻌﺔ‪.‬‬
‫اﻷﺷﺨﺎص و اﻟﻄﺮق‪ :‬ﺗﻢ اﻟﻘﻴﺎم ﺑﻬﺬا اﻟﺒﺤﺚ ﻋﻠﻰ ‪ ٢٧‬ﻣﺮﻳﻀﺎ ﻳﻌﺎﻧﻮن ﻣﻦ اﻟﺘﻬ ﺎب اﻟﺘ ﺎﻣﻮر ﺗﺮاﻓ ﻖ ﻣ ﻊ اﻻرﺗ ﺸﺎح اﻟﺘ ﺎﻣﻮرى اﻟﻤﺘﻮﻗ ﻊ‬
‫ﻟﺪرﺟﺔ ﻋﺎﻟﻴﺔ أن ﻳﻜﻮن اﻟ ﺪرﻧﻰ )ﺳ ﺮﻳﺮﻳﺎ وﺑﺎﻷﺷ ﻌﺔ اﻟ ﺴﻴﻨﻴﺔ(‪ .‬ﺗ ﻢ ﻋﻤ ﻞ ﺑ ﺬل اﻟ ﺴﺎﺋﻞ اﻟﺘ ﺎﻣﻮري واﻟﺨﺰﻋﺔ‪،‬وﺻ ﺒﻐﺖ ﺟﻤﻴ ﻊ اﻟﻌﻴﻨ ﺎت‬
‫ﺑﺼﺒﻐﺔ اﻟﺰﻳﻞ ﻧﻠﺴﻦ‪ ،‬وﻋﻤﻞ ﻣﺰرﻋﺔ ﻟﻠ ﺪرن‪ ،‬وﻓﺤ ﺺ اﻷﻧ ﺴﺠﺔ )ﺧﺰﻋ ﺔ( ﻟﻤ ﺮض اﻟ ﺪرن ‪.‬آﻤ ﺎ ﺗ ﻢ ﻗﻴ ﺎس ﻧ ﺸﺎط اﻧ ﺰﻳﻢ اﻷدﻳﻨﻮﺳ ﺎﻳﻦ‬
‫ﻧﺎزع اﻷﻣﻴﻦ وﻋﻤﻞ ﺗﻔﺎﻋﻞ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ ﻟﻠﺴﺎﺋﻞ اﻟﺘﺎﻣﻮري وأﺧﻴﺮا اﺟﺮاء اﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ ﺟﻮﻟﺪ ﻓﻲ اﻟﺪم‪.‬‬
‫اﻟﻨﺘﺎﺋﺞ‪ :‬ﻣﻦ أﺻﻞ ‪ ٢٧‬ﺣﺎﻟﺔ ﻣﺤﺘﻤﻠﺔ ﻟﻤﺮﺿﻰ اﻟﺘﻬﺎب اﻟﺘﺎﻣﻮر اﻟﺪرﻧﻰ ﻣﻊ ارﺗ ﺸﺎح اﻟﺘ ﺎﻣﻮر‪ ،‬آ ﺎن هﻨ ﺎك ‪ ١٩‬ﺣﺎﻟ ﺔ اﻳﺠﺎﺑﻴ ﺔ أآﻴ ﺪﻩ ‪.‬‬
‫ﺑﺎﻋﺘﺒﺎر اﻟﻘﻴﻤﺔ اﻟﻘﺎﻃﻌﻪ ﻟﻨ ﺸﺎط اﻧ ﺰﻳﻢ اﻷدﻳﻨﻮﺳ ﺎﻳﻦ ﻧ ﺎزع اﻷﻣ ﻴﻦ ه ﻰ ‪ ٤٠‬وﺣ ﺪﻩ ‪/‬ﻟﺘ ﺮ‪ ١٩/١٦ ،‬ﺣﺎﻟ ﺔ آﺎﻧ ﺖ اﻳﺠﺎﺑﻴ ﺔ وﺑﺎﻟﺘ ﺎﻟﻲ ﻓ ﺈن‬
‫ﺣﺴﺎﺳﻴﺘﺔ ﻻآﺘﺸﺎف اﻟﺪرن آﺎﻧﺖ ‪ ٪ ٨٤.٢‬وآﺎﻧﺖ ﻧﻔﺲ اﻟﺤ ﺴﺎﺳﻴﺔ ﻻﺧﺘﺒ ﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗ ﻰ ﺑ ﻰ ﺟﻮﻟ ﺪ ﻓ ﻲ اﻟ ﺪم ﺑﻴﻨﻤ ﺎ ﻇﻬ ﺮت ‪١٠‬‬
‫ﺣﺎﻻت اﻳﺠﺎﺑﻴﺔ ﻓﻘﻂ ﻣﻊ ﺗﻔﺎﻋﻞ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ ﻟﺬﻟﻚ آﺎﻧ ﺖ ﺣ ﺴﺎﺳﻴﺘﻪ ﻓ ﻰ ﺗ ﺸﺨﻴﺺ اﻟ ﺪرن ‪ . ٪٥٢.٦‬أﻳ ﻀﺎ آﺎﻧ ﺖ هﻨ ﺎك ﺣ ﺎﻟﺘﻴﻦ‬
‫اﻳﺠﺎﺑﻴﺘﻴﻦ ﺑﻘﻴﺎس ﻧﺸﺎط اﻧﺰﻳﻢ اﻷدﻳﻨﻮﺳﺎﻳﻦ ﻧﺎزع اﻷﻣﻴﻦ وﺣﺎﻟﺔ واﺣﺪة ﺑﺎﺳﺘﺨﺪام اﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ ﺟﻮﻟﺪ ﻓﻰ اﻟﺪم ﺑﻴﻦ ﺛﻤﺎﻧﻴﺔ‬
‫ﺣﺎﻻت ﺳﻠﺒﻴﺔ اﻟﻤﺰرﻋﻪ ﻓﻲ ﺣﻴﻦ ﻟﻢ ﻳﺘﻢ اﻟﻜﺸﻒ ﻋﻦ أي ﻣﻨﻬﺎ ﺑﺎﺳﺘﺨﺪام ﺗﻔﺎﻋﻞ اﻟﺒﻠﻤ ﺮة اﻟﻤﺘﺴﻠ ﺴﻞ ﻟ ﺬﻟﻚ آﺎﻧ ﺖ ﻧﻮﻋﻴﺘ ﻪ ‪ ٪ ١٠٠‬ﺑﻴﻨﻤ ﺎ‬
‫آﺎﻧﺖ ﻧﻮﻋﻴﺔ اﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ ﺟﻮﻟﺪ ‪ ٪٨٧.٥‬وﻧﻮﻋﻴﺔ ﻗﻴﺎس ﻧﺸﺎط اﻧﺰﻳﻢ اﻷدﻳﻨﻮﺳﺎﻳﻦ ﻧﺎزع اﻷﻣﻴﻦ ‪. ٪٧٥‬‬
‫آﺎﻧﺖ اﻟﺤﺴﺎﺳﻴﺔ ‪ ،‬اﻟﻨﻮﻋﻴﺔ ‪ ،‬اﻟﻘﻴﻤﺔ اﻟﺘﻨﺒﺆﻳﺔ اﻹﻳﺠﺎﺑﻴﺔ و اﻟﻘﻴﻤﺔ اﻟﺘﻨﺒﺆﻳﺔ اﻟﺴﺎﻟﺒﺔ ﻻﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ ﺟﻮﻟﺪ ﻓﻲ اﻟﺪم ﻣﻊ ﺗﻔﺎﻋﻞ‬
‫اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠ ﺴﻞ ﻣﺠﺘﻤﻌ ﻴﻦ آ ﺎﻵﺗﻰ ‪ ٪٩٤.٤، ٪٨٧.٥ ،٪٨٩.٥ :‬و‪ ٪٧٧.٨‬ﻋﻠ ﻰ اﻟﺘ ﻮاﻟﻲ وآﺎﻧ ﺖ اﻟﺤ ﺴﺎﺳﻴﺔ ‪ ،‬اﻟﻨﻮﻋﻴ ﺔ ‪ ،‬اﻟﻘﻴﻤ ﺔ‬
‫اﻟﺘﻨﺒﺆﻳﺔ اﻹﻳﺠﺎﺑﻴﺔ و اﻟﻘﻴﻤﺔ اﻟﺘﻨﺒﺆﻳﺔ اﻟﺴﺎﻟﺒﺔ ﻻﺧﺘﺒ ﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗ ﻰ ﺑ ﻰ ﺟﻮﻟ ﺪ ﻓ ﻲ اﻟ ﺪم ﻣ ﻊ ﻗﻴ ﺎس ﻧ ﺸﺎط اﻧ ﺰﻳﻢ اﻷدﻳﻨﻮﺳ ﺎﻳﻦ ﻧ ﺎزع‬
‫اﻷﻣﻴﻦ هﻰ ‪ ٪٨٨.٩ ،٪٧٥ ،٪٨٤.٢‬و‪ ٪٦٦.٧‬ﻋﻠﻰ اﻟﺘﻮاﻟﻰ‪.‬‬
‫اﻟﺨﻼﺻﺔ‪ :‬اﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ ﺟﻮﻟﺪ ﻓﻲ اﻟﺪم ﻟﻪ ﺣﺴﺎﺳﻴﺔ وﻧﻮﻋﻴﺔ ﺟﻴﺪة ﻓ ﻰ ﺗ ﺸﺨﻴﺺ ارﺗ ﺸﺎح اﻟﺘ ﺎﻣﻮر اﻟ ﺪرﻧﻰ اﻟﻤ ﺼﺎﺣﺐ‬
‫ﻟﻼﻟﺘﻬﺎب اﻟﺘﺎﻣﻮرى‪ .‬أن أﻓﻀﻞ ﺣﺴﺎﺳﻴﺔ وﻧﻮﻋﻴﺔ ﻣﺠﺘﻤﻌﺔ ﻓﻲ اﻟﺪراﺳﺔ اﻟﺤﺎﻟﻴﺔ آﺎﻧﺖ ﺑﻴﻦ اﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ ﺟﻮﻟﺪ ﻓ ﻲ اﻟ ﺪم‬
‫ﻣﻊ ﺗﻔﺎﻋﻞ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ ﻓﻰ اﻟﺴﺎﺋﻞ اﻟﺘﺎﻣﻮرى وﻟﻜﻨﻬﺎ ﻟﻴﺴﺖ أآﺒﺮ ﻣﻦ ذﻟﻚ ﺑﻜﺜﻴﺮ ﻣﻊ اﺳﺘﺨﺪام اﺧﺘﺒﺎر اﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗﻰ ﺑﻰ‬
‫ﺟﻮﻟﺪ ﻓﻲ اﻟﺪم ﻣﻨﻔﺮدا‪ .‬ﻟﺬﻟﻚ‪ ،‬ﻳﻤﻜﻦ اﺳ ﺘﺨﺪام اﺧﺘﺒ ﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗ ﻰ ﺑ ﻰ ﺟﻮﻟ ﺪ آﺎﺧﺘﺒﺎرﻣ ﺴﺎﻋﺪ ﺳ ﺮﻳﻊ وﻣﻨ ﺎﻋﻰ ﻏﻴ ﺮ اﺟﺘﻴ ﺎﺣﻰ ﻓ ﻰ‬
‫ﺗﺸﺨﻴﺺ ارﺗﺸﺎح اﻟﺘﺎﻣﻮر اﻟﺪرﻧﻰ اﻟﻤﺼﺎﺣﺐ ﻟﻼﻟﺘﻬﺎب اﻟﺘﺎﻣﻮرى‪.‬وﻣﻊ ذﻟﻚ ﻓ ﺎن ﺳ ﻠﺒﻴﺔاﺧﺘﺒﺎرآﻮاﻧﺘﻴﻔﻴﺮون ﺗ ﻰ ﺑ ﻰ ﺟﻮﻟ ﺪ ﻻﺗ ﺴﺘﺒﻌﺪ‬
‫وﺟﻮد اﻟﻤﺮض وذﻟﻚ ﻻﻧﺨﻔﺎض اﻟﻘﻴﻤﺔ اﻟﺘﻨﺒﺆﻳﺔ اﻟﺴﺎﻟﺒﺔ ﻟﻪ‪.‬‬
‫‪49‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
House Dust Mites as a Risk Factor in Chest Allergic Patients in
Gharbia Governorate, Egypt
Sanaa N. Antonios a, Dalia S. Ashour a,*, Mohamed G. Elkholy b,
Mohamed E. Hanterra b& Dalia A. Elmehy a
a
Department of Medical Parasitology, Faculty of Medicine, Tanta University, Tanta,
Egypt; bDepartment of Chest, Faculty of Medicine, Tanta University, Tanta, Egypt
ABSTRACT
Background: During the past few decades, house dust mites have attracted worldwide interest because of
their importance in causing allergic disorders. Aim of the study: This study investigated the relation
between different mite species and allergic conditions in atopic patients. Methodology: Acarological
examination of their house dust, skin prick testing using Dermatophagoides pteronyssinus and
Dermatophagoides farinae allergens and measuring the level of specific IgE to both allergens in serum
samples. Results: Acarological examination revealed 81 positive samples with D. pteronyssinus in 34
samples, D. farinae in 25 samples, mixed D. pteronyssinus and D. farinae in 10 samples, Blomia
tropicalis in 3 samples and 9 samples were un-identified. A total 729 mites were isolated and identified
with higher percent in mattresses then furniture followed by floors. Spring and autumn yielded the highest
number of positive sample. Skin prick test and specific IgE to both D. pteronyssinus and D. farinae
allergens were positive in 95% of patients with varying sensitivity. Conclusions: The existence of mite
fauna is dominated by D. pteronyssinus and D. farinae with strong influence of season in Gharbia
Governorate. Sensitization in patients with atopic asthma is mainly due to house dust mites evidenced by
correlated results of SPT and specific IgE in serum samples.
Keywords: Dermatophagoides pteronyssinus, Dermatophagoides farinae, atopic asthma, skin prick test,
specific IgE, Gharbia Governorate.
in heated houses and primarily live in
mattresses, pillows, carpets and old books, as
they prefer warm moist places to multiply and
produce protein substances in their feces10.
Exposure to allergens derived from house dust
mite (HDM) feces is a postulated risk factor for
allergic sensitization, asthma development and
morbidity 11.
In vivo skin testing or detection of in vitro
allergen-specific responses can be helpful to test
whether a patient with a relevant clinical history
is allergic to a specific allergen. After
intradermal injection of allergen in the skin of a
sensitive subject, a type-I reaction develops
rapidly, peaks after 10–20 min and subsides
within a few hours. After several hours, a late
diffuse edematous response may appear at the
allergen injection site 12.
In view of these data, this work was
designed to study mites that are important in
human diseases among allergic patients in
Gharbia Governorate, Egypt.
INTRODUCTION
The prevalence of allergic diseases such as
asthma, nasal rhinitis, nasal polyps, atopic
dermatitis
and
idiopathic
eosinophilic
syndromes has increased dramatically in recent
decades 1. Asthma is a significant and growing
public health problem 2. It is a common disease
affecting about 300 million people worldwide
and this is projected to rise to 400 million by
2025 with an estimated 250.000 deaths globally
each year are due to asthma 3&4.
Several studies have suggested a correlation
between allergen exposure and the prevalence
of allergic diseases 5. Recent progress in allergy
has promoted extensive studies on identification
of sensitization to indoor allergens6. Common
indoor allergens include those produced by
house dust mites, cockroaches, animals (cats,
dogs, and rodents) and molds. Therefore,
sensitization to one or more of the common
indoor allergens has been consistently
associated with asthma and allergy among
children and adults 7.
Worldwide, house dust mites have been
recognized as one of the most important sources
of house dust allergens responsible for bronchial
asthma, rhinitis and atopic dermatitis in
susceptible persons 8&9. Mites grow enormously
SUBJECTS & METHODS
This prospective study was conducted in
Medical Parasitology and Chest department,
Tanta University from August 2010 to July
2011. All patients gave informed consent for the
51
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
polymer matrix, which in turn is labelled with a
ligand. The bead is coated with anti-ligand. The
liquid phase consists of alkaline phosphatase
conjugated to monoclonal murine anti-human
IgE antibody in a human /nonhuman serum
buffer matrix18. In the first cycle, the patient
sample and the ligand-labelled specific allergen
are incubated together with the coated bead for
30 minutes. During this time, specific IgE in the
sample binds to the ligand labelled allergen,
which in turn binds to the anti-ligand on the
bead. Unbound sample is then removed by
centrifugal washes. In the second cycle, the
enzyme conjugated monoclonal murine antihuman IgE antibody is added to the original
reaction tube for additional 30 minutes
incubation .The enzyme conjugated monoclonal
murine anti-human IgE antibody binds to
immobilized IgE. The unbound enzyme
conjugate is removed by centrifugal washes.
Finally, the chemiluminescent substrate is added
to the reaction tube. The signal is generated in
proportion to the bound enzyme and reading
occurs according to degree of color intensity19.
Quantitative values are presented by kilo unit/
liter (KU/L) 20.
Acarological examination of patient house
dust
Dust collection
Three dust samples from bed mattresses,
floors and upholstery furniture were collected in
each season using a standard vacuum cleaner
during the study period giving a total of 240
samples. One square meter of each place is
vacuumed for one minute. The collected dust is
divided to samples, each weight 1 gram and
kept separately in different plastic bags, labelled
properly and stored at 4 °C to avoid mite
proliferation 21.
Isolation, extraction and identification of
mites from dust samples
Each sample was sieved separately by a
mechanical sieve and mites recovered by
suspension extraction method which allows
examination of the entire sample with high
extraction efficiency 22&23. It involves placing
each dust sample in a Petri dish then adding
ethanol, sodium chloride solution or better lactic
acid because of its high viscosity that makes
particles move around less. Samples were
examined under a stereo binocular microscope
and mites were removed by a fine needle and
counted. All mites extracted from the dust
samples should be washed with distilled water
and mounted on microscopic slide for
identification under a compound light
microscope24. Identification of mite species was
done according to the identification keys25.
study. The study protocol and the informed
consent form were approved by Faculty of
Medicine, Tanta University, Research Ethics
Committee, Quality Assurance Unit.
Subjects
Twenty patients with known history of
allergic conditions such as allergic rhinitis and
asthma were obtained according to the
following exclusion criteria: no children under
six years of age, no old patients above 60 years,
no pregnant or lactating women and no chronic
chest disease patients e.g. patients with severe
asthma, other concomitant chest disease, and
abnormal chest x- ray. Each patient was
subjected to the following: 1- Thorough clinical
history as regards allergic conditions and
physical examination. 2- Immunological
evaluation of patients by skin prick test and
specific IgE to HDM. 3- Acarological
examination of samples from their house dust.
Allergy skin prick test (SPT)
SPT identifies which substance triggers an
allergic reaction in the form of wheal formation
due to the release of histamine 13. The inner
forearm is coded with a skin marker pen
corresponding to the number of allergens being
tested. Marks should be at least 2 cm apart then
a drop from each of crude extracts of D. farina
and D. pteronyssinus allergen solutions
(Stallergen, France) are placed beside the mark.
A small prick through the drop is made to the
skin using a sterile lancet. Excess allergen
solution is dabbed off with a tissue. As a
positive control, histamine (concentration
0.01mg/mL) was injected, and the negative
control was dilution buffer 6&14.
Reactions were read after 15-20 minutes
(early response). The skin became itchy with a
wheal in the centre. The wheal has a white
raised edge that surrounds the swollen red
central area of skin reaction. The area of the
skin response in mm2 was measured. The earlyphase response was considered positive when its
size was at least half the size of the histamine
response (positive control). The negative control
should show no response. The grading scale
using the size of the wheal is most accurate 15.
Assessment of specific IgE to HDM in serum
samples
Venous blood samples were taken (before
skin prick testing) and serum was separated 16.
Estimation of specific IgE is done by 3g
AllergyTM Specific IgE universal kit (Siemens
Healthcare Diagnostics Inc., USA) for use on
IMMULITE 2000 SYSTEMS which is a solid
phase chemiluminescent immunoassay that
exploits liquid phase kinetics in a bead format17.
The allergens are covalently bound to a soluble
52
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
A) Clinical history evaluation and physical
examination
Most of the patients had different risk
factors that affect the severity of asthma e.g. old
furniture, old beds with cotton beddings,
crowded homes with low socio-economic level,
home dampness, smoking and positive family
history. All of the twenty patients were
suffering from frequent standardized asthma
symptoms as dyspnea, diurnal wheezing, cough
and worsening of symptoms after exercise,
inhaling smoke, dust or fumes and exposure to
cold air.
B) Skin prick test (SPT)
The
wheal
size,
indurations
and
interpretation of SPT are shown in Fig. 1. There
was no statistically significant difference
between the results of SPT using D.
pteronyssinus or D. farinae allergens. Only 5%
of cases gave negative results for SPT to both
D. pteronyssinus and D. farinae allergens while
95% of cases were sensitive to D. pteronyssinus
and D. farinae allergens with varying degrees of
sensitivity.
Scanning Electron microscopy of HDM
For better identification of the fine features
of the morphology, HDM specimens were fixed
for two hours in phosphate- buffered (PH 7.2)
and 3% gluteraldehyde, then processed
according to Heywood 26 then examined in Joel
3500 SEM at an acceleration voltage of 15 K.V.
Statistical analysis
Quantitative values of the measured
parameters were expressed as mean± standard
deviation (S.D.) using the software package by
SPSS version 17 software. The difference was
considered statistically significant when P
<0.05.
RESULTS
The studied group included twenty patients
randomly selected with different ages ranging
from 20- 49 years. The study included 15 (75%)
females and 5 (15%) males with statistically
significant difference between males and
females. All patients had known history of
allergic conditions such as allergic rhinitis and
bronchial asthma.
Fig. 1: Interpretation of SPT: (A) negative SPT (wheal size <4 mm); (B) mildly sensitive SPT (wheal size
5 -10 mm); (C) moderately sensitive SPT (wheal size 10-15 mm); (D) very sensitive SPT (wheal size >15
mm).
It has been found that there was a very high
correlation and concordance (100%) between
levels of specific IgE and SPT results in the
diagnosis of cases shown to be allergic to both
D. farinae and D. pteronyssinus. Both tests have
a 100% sensitivity and specificity, a positive
predictive value of 100% and a negative
predictive value of 100% for both D. farinae
and D. pteronyssinus.
C) Specific IgE determination
The levels of specific IgE to D. farinae and
D. pteronyssinus were shown in table 1. There
was no statistically significant difference
between the levels of specific IgE to both D.
pteronyssinus and D. farinae allergens. Only
5% of cases showed undetectable level of
specific IgE to both D. pteronyssinus and D.
farinae and 95% of cases showed different
levels of specific IgE.
53
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table 1: Levels of specific IgE to D. farinae and D. pteronyssinus
Specific IgE
D. farinae
D. pteronyssinus
Allergy
Level of allergen specific
concentration
classes
IgE
No
%
No
%
(KU /L)
0
<0.35
Absent or undetectable
1
5
1
5
I
0.35-0.7
Low
3
15
3
15
II
0.7-3.5
Moderate
5
25
7
35
III
3.5-17.5
High
9
45
8
40
IV
17.5-50
Very High
1
5
0
0
V
50.0-100
Very High
1
5
1
5
VI
>100
Very High
0
0
0
0
Total
20
100
20
100
X2
1.392
Chi square
P-value
0.925
identified by the cuticle anterior of epigynium
was striated transversely and dorsal cuticle with
transverse striations between setae and by the
presence of a copulatory bursa, while D. farinae
male was identified by dorsal cuticle with
transverse striations between setae and by the
presence of a penis and anal suckers (Fig. 2). D.
pteronyssinus female was identified by that the
cuticle anterior of epigynium and dorsal cuticle
that were striated longitudinally and by the
presence of a copulatory bursa while D.
pteronyssinus male was identified by the dorsal
cuticle with longitudinal striations, penis and
anal suckers (Fig. 3). Blomia tropicalis was
identified by long, densely pectinate dorsal
setae, crista metopica absent (Fig. 4).
D) Acarological examination of patients’
house dust
A total 240 dust samples were examined
throughout the study period. Mites were
detected in 81 samples (33.75%) of the
examined samples whereas 159 samples
(66.25%) of the examined samples were
negative. A total of 729 mites were isolated
from dust samples is Three different species of
mites were detected; D. pteronyssinus was 351
mites (48.2%), D. farinae were 270 mites
(37%), Blomia tropicalis were 8 mites (1.1%)
and unidentified species were 100 mites
(13.7%).
The different species of mites were
examined by light (LM) and electron
microscope (EM). D. farinae female was
Fig. 2: D. farinae ♂ (left) showing transverse striations, penis (p) and anal suckers (an) (LM ×40) and D.
farinae ♀ (right) showing cuticle anterior of epigynium (e) is striated transversely (arrow) with
copulatory bursa (c) (EM ×200).
54
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Fig 3: (A) D. pteronyssinus ♀ showing longitudinal striations, epigynium and copulatory tube (c) ; (B)
D. pteronyssinus ♂showing longitudinal striations, penis (p) and anal suckers (an) (LM ×40); (C&D) D.
pteronyssinus ♀ showing cuticle anterior of epigynium (e) is striated longitudinally (arrow), with
copulatory tube (c) and setae (s) (EM ×500).
There was a statistically significant
difference in the distribution of house dust mites
between mattresses and floors. However, no
statistically significant difference was observed
in the distribution of house dust mites between
(mattresses and furniture) and (furniture and
floors). Prevalence of D. pteronyssinus in
mattress was 19.8% and 11.1% in upholstery
furniture and in floors while prevalence of D.
farinae in mattress and furniture was 14.8 %
and 12.4 %, respectively while floors showed
3.7%. Blomia tropicalis was present in mattress
in a percent of 2.5%, 1.2% in furniture and not
found in the floors as demonstrated in table 2.
Fig. 4: Blomia tropicalis ♀ with long, densely
pectinate dorsal setae, crista metopica absent
(LM ×40).
Table 2: Mites found in dust samples examined from mattresses, upholstery furniture and floor
Pvalue
Mite species in positive samples
Source
No. of
examined
samples
No. +ve
samples
%
Mattresses
80
39
48.2
Furniture
80
26
32.1
Floors
80
16
19.8
Total
240
81
100
D.
pteronyssinus
No
%
19.
16
8
11.
9
1
11.
9
1
41.
34
9
Mixed
D. farinae
Blomia
tropicalis
No
%
No
%
No
%
12
14.8
4
4.9
2
2.5
10
12.4
3
3.7
1
1.2
3
3.7
3
3.7
0
0
25
30.9
10
12.4
3
3.7
Unidentified
No.
%
5
6.2
3
3.7
1
1.2
9
11.1
P1 comparison between total number of positive samples of mite species in mattresses and furniture.
P2 comparison between total number of positive samples of mite species in furniture and floors.
P3 comparison between total number of positive samples of mite species in mattresses and floors.
55
P1
0.136
P2
0.164
P3
0.003
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
exposures among men. Also, Abramson et al. 32;
Dowdee and Osseque 33 stated that in children,
male: female ratios may be as high as 4:1 and
this ratio inverts after puberty. They attributed
that to having smaller airway diameters relative
to lung volume among boys (dysanapsis) and
more allergen sensitivities.
The results of the present study regarding
the effect of risk factors on the severity of
asthma showed that old furniture, old beds with
cotton beddings, crowded homes with low
socio-economic level, smoking and home
dampness are major risk factors in most of
patients. Biddulph et al.34 declared that the
major habitats of HDM are beds, carpets and
soft furnishings and their population size
depends mainly on the availablability of food,
relative humidity and the temperature which
represent good ecological and biological
conditions for HDM35. Positive family history
for allergic diseases is another major risk factor.
This coincides with Horwood et al.36 who stated
that family history may include both genetic and
environmental components due to exposure of
all family members to the same environment as
regard temperature and humidity.
As regards immunological evaluation of
patients using skin prick test (SPT) in the
present work it was found that 95% of cases
were sensitive to both D. pteronyssinus and D.
farinae allergens. Our results were in agreement
with Bousquet et al.6 who demonstrated that
sensitization to D. pteronyssimus and D. farinae
were usually the most prevalent among the
studied indoor allergens. Variable percentages
of positive skin reactions to HDM among
asthmatics from country to another and even
from locality to another in the same country
were recorded. For example, Bjornsson et al.37
reported a percentage of 7.9% positivity among
asthmatics in the population of a central
Swedish locality. Whereas Saha et al.38 reported
82% positivity in Calcutta, India and PrietoUrsúa et al.39 demonstrated the highest
percentage of positivity (96%) among asthmatic
children in Mexico City. The variable
percentages of positivity of the skin test could
be referred to differences of ecological
conditions such as the climate, humidity and the
environmental factors that affect the levels of
mite infestations in homes in addition to genetic
predisposition40. Skin prick testing provide a
confirmatory evidence for a diagnosis made on
the patient's history and clinical condition and
can be used to guide the management of atopic
patient e.g. desensitization to a certain allergen,
removal of a family pet and avoidance of certain
foods 33.
Regarding the distribution of mites in the
four seasons of the year at Gharbia governorate,
there was a difference between four seasons as
spring yielded the highest number of positive
samples representing (38.3 %) followed by
autumn (35.8 %) and then come winter and
summer with the lowest mite density
representing 16.1% and 9.9%, respectively.
DISCUSSION
House dust mites (HDM) have been
confirmed as a major trigger for acute asthmatic
attacks in sensitive individuals. About 1-2 % of
the world population (65-130 million people are
allergic to house dust mites27. In Egypt, it is
well established that HDM are of great medical
importance in causing allergic manifestations in
human being21. In the last decade, determination
of IgE antibodies by laboratory tests and the
appropriate challenge procedures have been
improved to be useful either to identify atopic
individuals or as outcome predictor in wheezy
chest. However, since Aalberse 28 had evaluated
skin reaction to mite extracts to be of great
clinical significance, this procedure is still
widely used up till now. The objective of our
study was to evaluate the role of HDM exposure
in asthmatic patients in all cities of Gharbia
governorate and the acarological analysis of
their house dust samples.
According to our results, the percent of
male to female asthmatic patients was 1:3 that
indicate that prevalence of bronchial asthma is
more in females than males with obvious sex
bias. These results have been supported by
many epidemiological studies29&30. They
suggested that women are at increased risk of
developing asthma and also suffer from more
severe disease than men. These gender
differences appear to be the product of
biological sex differences as well as sociocultural and environmental differences.
Other factors could be genetic factors as
COX-2 gene homozygosity is associated with
female sex. COX pathways, are essential
mediators of inflammation in bronchial
asthma16. Also, Somani 19 found that total IgE
levels have been shown to be heritable, with
estimates of heritability ranging from 50- 80%
more in females due to presence of two possible
alleles at a given X-linked locus in females but
only one in males.
On the other hand, Krishman et al.31
reported that men typically having higher
incidence of asthma than women, especially at
young ages which have been attributed to higher
prevalence of smoking or occupational
56
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
leading directly to both the early and late phase
reactions 46.
According to our results, acarological
examination of patients’ house dust showed that
the most remarkable finding of the mite fauna
found in Gharbia governorate is the dominance
of both Dermatophagoides species: D.
pteronyssinus and D. farinae, with no
significant differences between the percentages
of both species. Regarding storage mites, the
most frequent non-pyroglyphid mite species in
Gharbia governorate was Blomia tropicalis
which was found in low percentage. These
finding were in agreement with Cho et al.47 who
stated that pyroglyphid mites usually make up
60-90% of the house dust acarofauna in
temperate climate regions throughout the world.
Most often they are found in habitats intimately
associated with man, such as beds, couches,
sofas, other upholstered furniture, clothing,
floors and carpets 48.
van Bronswijk et al.49 and Arlian et al.50
postulated that there are decisive factors
influencing HDM occurrence and abundance.
Average annual temperature was the main
outdoor factor that correlated with higher mite
concentrations while the indoor main predictor
was the presence of obvious signs of humidity
in the home. Therefore, house insulation tends
to increase indoor humidity and may lead to
higher house dust mite densities 51. It should be
stressed that the domination of D. farinae and
D. pteronyssinus in dwellings appears to be the
characteristic tendency at many localities in
Gharbia governorate.
A scarce number of Blomia tropicalis was
found in dust collected during the course of the
present work. The presence of low percentage
of Blomia tropicalis is not surprising because
this species has a tropical and subtropical
distribution. So , it is clear that these cities are
not a suitable site for living, reproduction and
building up of mite populations and mites are
not a permanent inhabitors of the governorate
but it come as occasional invaders on the bodies
and cloths of patients and hence their house
dust. Also, this mite species prefer climate with
less seasonal variation in rainfall and
temperature 52.
The total HDM load in a room, as estimated
in the present study, could be relevant to amount
of inhalable allergen, as it sets an upper limit for
the possible amounts of inhalable dust
originating from the vaccumed objects53.
Concerning the number of HDM collected from
house dust of all cities of Gharbia governorate,
it was found that total 729 mites were isolated
from positive samples (33.75%). The same
Concerning the immunological evaluation
by measuring specific IgE in serum samples, it
was found that 95% of cases are sensitive to
both D. pteronyssinus and D. farinae allergens.
Variable levels of positive specific IgE to HDM
among asthmatics from locality to another were
recorded. Alshishtawy et al.41 reported that D.
pteronyssinus and D. farinae allergens represent
the highest value of allergens that induce asthma
inn Tanta, Egypt. However, potential cross
reactivity may be present between mite
allergens because allergenic determinants are
shared with other mites belonging to the
Pyroglyphidae family and are highly crossreactive
with
other
Dermatophagoides
species28&42. There seems to be a limited crossreactivity with Storage (non-pyroglyphid)
mites18. Detection of specific IgE offers reliable
results in agreement with skin tests with very
high correlation and concordance17. So, some
researchers recommend the measurement of
allergen specific IgE antibodies in serum as a
similar diagnostic value to that of skin tests but
it has higher reproducibility and is not
influenced by ongoing symptoms or treatment
e.g. antihistamines or anti-inflammatory
therapy. It is also the test of choice for
individuals who have widespread eczema,
which precludes skin prick testing 19.
The severity of asthma appeared to be
associated with the number of positive skin tests
and the magnitude of the immediate skin
reaction43 or with total and specific IgE 44. The
role of HDM allergens in induction of bronchial
asthma has been declared by NepperChristensen45 who described the immune system
response to allergen exposure as being divided
into two phases. The first is immediate
hypersensitivity or the early phase reaction that
occurs within 15 minutes of exposure to the
allergen. The second, or late phase reaction,
occurs 4- 6 hours after the disappearance of the
first phase symptoms and can last for days or
even weeks. During the early phase reaction
chemical mediators released by mast cells
including
histamine,
prostaglandins,
leukotrienes and thromboxane produce local
tissue responses characteristic of an allergic
reaction. In the respiratory tract, these include
sneezing, edema and mucus secretion, with
vasodilatation in the nose, leading to nasal
blockage and broncho-constriction in the lung
due to cellular infiltration and fibrin deposition,
leading to wheezing. These observations
suggest that IgE is instrumental in the immune
system's response to allergens by virtue of its
ability to trigger mast cell mediator release,
57
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
relative humidity are the two most important
predictors of dust mite allergen concentration in
dust samples. van Bronswijk 49 reported that the
annual periodicity of mite numbers is possibly
correlated with humidity cycle inside the house.
Arlian et al.60 had the opinion that the seasonal
fluctuation in house dust mites corresponds to
the seasonal rise in relative humidity of the air.
In conclusion, HDM species especially D.
pteronyssinus and D. farinae play a very
important role in the pathogenesis of atopic
asthma and their prevalence represents a major
risk factor for developing allergic conditions in
all cities of Gharbia governorate. So,
densensitization in atopic asthma by injection
of increasing dosage of purified mite allergens
can produce a reduction in asthma symptoms in
conjugation with reducing mite population in
the home of patients.
percentage was recorded by Gamal Eddin et
al.54 as they estimated the prevalence of HDM
in Tanta city by about (39%). They recorded the
presence of six types of house dust mites from
which are D. farinae, D. pteronyssinus, T.
putrescentiae, Cheyletus malaccensis, Blomia
kulagini and Acheles gracilis which is
considered as new record for house dust mite
fauna. Abou-Senna 55 recorded mites of storedhay (Blomia tropicalis) from houses of atopic
dermatitis patient in Gharbia Governorate.
As regard the prevalence of mites between
mattress, furniture and floors, the results
demonstrated that it was higher in mattresses
and furniture than in floors which is in
concordance with other studies as Anderson et
al. 56 who postulated that the main source of
variation in mite prevalence is the abundance of
nourishment as the moulds and human dander in
addition to different characteristics of the
furniture fitting, living habits, pollutants in
house air, social and personal factors. However,
some studies showed furniture to have the same
or higher HDM concentration than mattresses;
this may be due to the fact that residents spend
several hours setting on the upholstery furniture
in living rooms 57.
Spieksma 58 reported that the bed has the
highest allergen content in the house and this is
also logical because of the close, prolonged
contact people have with it. However, Gamal
Eddin et al. 54 discussed the factors affecting on
the attraction of mites towards beds reaching to
a conclusion that mite reaction towards human
being microhabitat is a primarily an odoriferous
response to human sweat gland secretions and
sebaceous gland secretions which permanently
contaminate the surface of mattresses, linens,
blankets and pillows.
Concerning the seasonal variation in mite
numbers, the data in the present work indicate
that, the highest population was recorded during
spring and autumn. Correlating these results
with the recorded temperatures and relative
humidities, it is observed that mite populations
were high when temperature was 25°C or below
and the relative humidity was 45% or more40.
Gamal Eddin et al.54 stated that it is the most
favorable temperature for reproduction and
breeding of both D. farinae and D.
pteronyssinus. This seasonal variation can lead
to more than 20-fold variation in allergen
concentration in the same household in a single
year 59.
Season is considered to be a compound
measure for a combination of climatic factors
that seem to affect the dust mite population. It
has been recognized that temperature and
REFERENCES
1.
2.
3.
4.
5.
6.
7.
58
Oddera S, Silvestri MA, Balbo MA,
Jovovich BO, Penna R, Crimi E, Rossi
GA. Airway eosinophilic inflammation,
epithelial
damage,
and
bronchial
hyperresponsiveness in patients with mildmoderate, stable asthma. Allergy. 1996; 51:
100-107.
Rand CS, Apter AJ. Mind the widening
gap: have improvements in asthma care
increased asthma disparities? J Allergy
Clin Immunol. 2008; 122:319-21.
Masoli M, Fabian D, Holt S, Beasley R.
The global burden of asthma: executive
summary of the GINA Dissemination
Committee Report. Allergy. 2004; 59:469478.
Zhang S, Zeng X, Wei J, Li S, He S.
Analysis of patents on anti- allergic
therapies issued in China from 1988 to
2008. Expert Opin Ther Pat.
2010;
20(6):727-737.
Sporik R, Holgate ST, Platts_Mills TA,
ogswell JJ. Exposure to house dust mite
allergen (Der p 1) and the development in
asthma in childhood. A prospective study.
N Engl J Med. 2008; 323: 502-507.
Bousquet PJ, Chinn S, Janson C,
Kogevinas M, Burney P, Jarvis D.
Geographical variation in the prevalence of
positive skin tests to environmental
aeroallergens in the European Community
Respiratory Health Survey I. Allergy.
2007; 62(3): 301-309.
Arshad SH. Does exposure to indoor
allergens contribute to the development of
Egyptian Journal of Medical Microbiology, January 2012
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
asthma and allergy? Curr Allergy Asthma
Rep. 2010; 10(1): 49-55.
Racewicz M. House Dust Mites (Acari:
Pyroglyphidae) in the cities of Gdansk and
Gdynia (Northern Poland). Ann Agric
Environ Med. 2001; 8: 33–38.
Mariana A, Santana Raj AS, Ho TM,
Tan SN, Zuhaizam H. Scanning Electron
Micrographs
of
two
species
of
Sturnophagoides
(Acari:
Astigmata:
Pyroglyphidae) mites in Malaysia. Trop
Biomed. 2008; 25(3): 217–224.
Custovic A, Simpson A, Chapman MD,
Woodcock A. Allergen avoidance in the
treatment of asthma and atopic disorders.
Thorax. 2008; 53: 63-72.
El Sherbiny GT, El-Sherbini ET, Saled
NM, Haridy FM, Morsy AT. A study on
the prevalence of house dust mites in AlArish city, North Sinai Governorate, Egypt.
J Egypt Soc Parasitol. 2010; 40(1):57-70.
Solley GO, Gleich GJ, Jordon RE,
Schroeter AL. The late phase of the
immediate wheal and flare skin reaction. Its
dependence upon IgE antibodies. J Clin
Invest. 1976; 58:408–420.
Robinson M, Smart J. Allergy testing and
referral in children. Aust Fam Physician.
2008; 37(4):210-213.
Chinoy BE, Yee SL, Bahna SL. Skin
testing versus radioallergosorbent testing
for indoor allergens. Clin Mol Allergy.
2005; 1:4-7.
Moed H, van Wijk RG, de Jongste JC,
van der Wouden JC. Skin tests, T cell
responses and self-reported symptoms in
children with allergic rhinitis and asthma
due to house dust mite allergy. Clin Exp
Allergy. 2009; 39: 222–227
Holmquist
L,
Vesterberg
O.
Immunochromatographic direct sampling
on filter testing for aeroallergens. J
Biochem Biophys Methods. 2003; 30: 183190.
El Shami AS, Alaba O. Liquid- phase. In
vitro allergen specific IgE assay with in sito
immobilization. J clin path. 1989; 74: 191201.
Ferreira F, Hawranek P, Gruber N,
Wopfner N. Allergic cross-reactivity: from
gene to the clinic. Allergy. 2004; 59: 243267.
Somani VK. A study of allergen-specific
IgE antibodies in Indian patients of atopic
dermatitis. Indian J Dermatol Venereol
Leprol. 2008; 4(2): 100-104.
Wilson DR, Merrett TG, Varga EM,
Smurthwaite L, Gould HJ, Kemp M,
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
59
Vol. 21, No. 1
Hooper J, Till SJ, Durham SR. Increases
in allergen-specific IgE in BAL after
segmental allergen challenge in atopic
asthmatics. Am J Respir Crit Care Med.
2002; 165: 22-26.
Morsy TA, Zohdi HW, Abdalla KF, ElFakahany AF, Ibrahim AA, Khalil HT.
Isolation of three species of mites from
house dust of atopic dermatitis patients in
Qualyobia Governorate, Egypt. J Egypt Soc
Parasitol. 1994; 24(2): 323-331.
Collof MJ, Ayres J, Carswell F,
Howarth PH, Merrett TG, Mitchell
EB. The control of allergens of dust
mites and domestic pets: a position paper.
Clin Exp Allergy. 1992; 22:10-28.
Morsy TA, El Said AM, Salama MMI,
Arafa MAS, Younis TA, Ragheb DA,
Abdel Rahman MM. Four species of
house dust mites from houses of patients
with allergic respiratory diseases. J Egypt
Soc Parasitol. 1995; 25:195- 206.
El Nahas HA, El-Beshbishi SN, Azab
MS, Zaalouk TKh, El-Sheikha HM,
Saleh AB, El-Shazly AM. Diagnostic
criteria for house dust mites sensitized
allergic patients. J Egypt Soc Parasitol.
2007; 37(3S): 1113-1124.
Colloff MJ, Spieksma FThM. Pictorial
keys for the identification of domestic
mites. Clin Exp Allergy. 1992; 22: 823830.
Heywood
VH.
Scanning
electron
microscopy, systematic and evolutionary
applications. Academic press, London:
1971; pp 309- 314
Colloff MJ. Distribution and abundance of
dust mites within homes. Allergy. 1998;
53(48S): 24-27.
Aalberse RC. Structural biology of
allergens. J Allergy Clin Immunol. 2000;
106: 228-238.
Thomas RA, Green RH, Brightling CE,
Birring SS, Parker D, Wardlaw AJ. The
influence of age on induced sputum
differential cell counts in normal subjects.
Chest. 2004; 126: 77-86.
El Shafey AM. Study of the prevalence of
bronchial asthma and other atopic diseases
among
school
children
in
Cairo
Metropolitan. Thesis of master degree in
Pediatrics, Faculty of Medicine, Ain Shams
University: 2006; pp 122- 130.
Krishnan JA, Diette GB, Skinner EA,
Clark BD, Steinwachs D, Wu AW. Race
and sex differences in consistency with
national asthma guidelines in managed care
Egyptian Journal of Medical Microbiology, January 2012
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
organizations. Arch Intern Med. 2001;
161:1660-1668.
Abramson SL, Turner-Henson A,
Anderson
L,
Hemstreet
MP,
Bartholomew LK, Joseph CL. Allergens
in school settings: results of environmental
assessments in 3 city school systems. J Sch
Health. 2006; 76: 246-249.
Dowdee A, Osseqe J. Assessment of
childhood allergy for the primary care
practitioner. J Am Acad Nurse Pract. 2007;
19(2): 52-63.
Biddulph P, Crowther D, Leung B,
Wilkinson T, Hart B, Oreszczyn T,
Pretlove S, Ridley I, Ucci M. Predicting
the population dynamics of the house dust
mite Dermatophagoides pteronyssinus
(Acari: Pyroglyphidae) in response to a
constant hygrothermal environment using a
model of the mite life cycle. Exp Appl
Acarol. 2007; 41:61-86.
van
Bronswijk
JEMH.
Dermatophagoides
pteronyssinus
(Trouessart) in mattress and floor dust in a
temperate climate (Acari: Pyroglyphidae). J
Med Entomol. 1973; 10: 63-70.
Horwood LJ, Fergusson DM, Shannon
FT. Social and familial factors in the
development of early childhood asthma.
Pediatrics. 1985; 75: 859–868.
Bjornsson E, Norback D, Janson C,
Widstrom J, Palmgren U, Strom G.,
Boman G. Asthmatic symptoms and indoor
levels of microorganisms and house dust
mites. Clin Exp Allergy. 1995; 25: 423431.
Saha GK, Modak A, Tandon N,
Choudhuri DK. The evaluation of skin
prick test in house dust mite allergy in
Calcutta, India. Trop Geogr Med. 1995;
47(6):278-281.
Prieto -Ursúa L, Sienra Monge JJ, del
Río Navarro BE, Mercado Ortiz VM.
Skin tests for different species of acari in
asthmatic children from Mexico City. Rev
Alerg Mex. 1995; 42(3):49- 53.
Colloff MJ. Ecology, Dust mites.
Collingwood, Victoria, Australia: CSIRO
Publishing, : 2009; pp 125- 214.
Alshishtawy MM, Abdella AM, Gelber
LE, Chapman MD. Asthma in Tanta,
Egypt: serologic analysis of total and
specific IgE antibody levels and their
relationship to parasite infection. Int Arch
Allergy Appl Immunol. 1991; 96(4):348354.
Adam E, Hansen KK, Astudillo OF,
Coulon L, Bex F, Duhant X, Jaumotte E,
43.
44.
45.
46.
47.
48.
49.
50.
51.
60
Vol. 21, No. 1
Hollenberg MD, Jacquet A. The house
dust mite allergen Der p 1 unlike Der p 3,
stimulates the expression of interleukin-8 in
human airway epithelial cells via a
proteinase-activated receptor 2-independent
mechanism. J Biol Chem. 2006; 281: 69106923.
Akerman M, Valentine-Maher S, Rao M,
Taningco G, Khan R, Tuysugoglu G,
Joks R. Allergen sensitivity and asthma
severity at an inner city asthma center. J
Asthma. 2003; 40:55–62.
Kovac K, Dodig S, Tjesic-Drinkovic D,
Raos M. Correlation between asthma
severity and serum IgE in asthmatic
children sensitized to Dermatophagoides
pteronyssinus. Arch Med Res. 2007; 38:99–
105.
Nepper-Christensen S, Backer V,
DuBuske LM, Nolte H. In Vitro
Diagnostic Evaluation of Patients with
Inhalant Allergies: summary of probability
outcomes comparing results of CLA- and
CAP-specific immunoglobulin E test
systems. Allergy Asthma Proc. 2003; 24:
253-258.
Currie GPCM, Jackson DK, Lee BJ,
Lipworth M. Determinants of airway
hyper-responsiveness in mild asthma. Ann
Allergy Asthma Immunol. 2003; 90: 560563.
Cho SH, Reponen T, Bernstein DI, Olds
R, Levin L, Liu X, Wilson K, LeMasters
G.The effect of home characteristics on
dust antigen concentrations and loads in
homes. Sci Total Environ. 2006; 371: 3143.
Clausen M, Kristjansson S, Haraldsson
A, Björkstén B. High prevalence of
allergic diseases and sensitization in a low
allergen country. Acta Paediatr. 2008; 97:
1216-1220.
Van Bronswijk JE, Bischoff E,
Schirmacher W, Kniest FM. Evaluating
mite (Acari) allergenicity of house dust by
guanine quantification. J Med Entomol.
1989; 26(1):55-9.
Arlian LG, Neal JS, Morgan MS,
Vyszenski- Moher SL, Rapp CM,
Alexander AK.
Reducing relative
humidity is a practical way to control dust
mites and their allergens in homes in
temperate climates. J Allergy Clin
Immunol. 2001; 107: 99-104.
Danielsen C, Hansen LS, Nachman G,
Herling C. The influence of temperature
and relative humidity on the development
of Lepidoglyphus destructor (Acari:
Egyptian Journal of Medical Microbiology, January 2012
52.
53.
54.
55.
Glycyphagidae) and its production of
allergens: a laboratory experiment. Exp
Appl Acarol. 2004; 32: 151-170.
Mariana A, Ho TM, Heah SK. Life
cycle, longevity and fecundity of Blomia
tropicalis in a tropical laboratory. Southeast
Asian J Trop Med Publ Health. 1996; 27:
392-395.
McGregor P, Peterson PG. Population
growth in house dust mite cultures: an
inversely density-dependent effect. Asthma
and Domestic Design III. Wellington
School of Medicine, New Zealand: 2000;
pp 27- 31.
Gamal Eddin FM, Tayel SE, Abou Senna
FM, Shehata K. Present status and ecology
of house dust mites in Egypt as approches
to environmental control of mites and
preparation of specific diagnostic antigen
before resort to any desensitizing vaccine. J
Egypt Soc Parasitol. 1982;12:253- 281.
Abou-Senna A. Mites of stored-hay from
houses of atopic dermatitis patients in Al-
56.
57.
58.
59.
60.
61
Vol. 21, No. 1
Gharbia Governorate, Egypt. J Hepat
Gastrointest Infect Dis. 1995;1: 117-125.
Anderson HR, Gupta R, Strachan DP,
Limb ES. 50 years of asthma: UK trends
from 1955 to 2004. Thorax. 2007; 62: 8590.
Simpson A, Simpson B, Custovic A, Gain
G, Craven M, Woodcock A. Household
characteristics and mite allergen levels in
Manchester, UK. Clin Exp Allergy. 2002;
32: 1413- 1419.
Spieksma FThM. Ecological distribution
of house-dust mites in Europe. Proceedings
of the 3rd International Congress of
Acarology. Academia, Prague: 1973; pp
551-556.
Platts-Mills TAE, Chapman MD. Dust
mites, immunology, allergic disease, and
environmental control. J Allergy Clin
Immunol. 1987; 80: 755-775.
Arlian LG, Morgan MS, Neal JS. Dust
mite allergens: ecology and distribution.
Curr Allergy Asthma Rep. 2002; 2: 401411.
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Comparative Study between Bactec Magit 960 and Fast Plaque Response™ For Susceptibility Pattern to Rifampicin in Sputum
Specimens of Tuberculous Patients
Azza M. Abdulaziz 1, Dalia El-Hossary2 and Hani Asfour3
1
Microbiology Department, National Liver institute, Al-Menophya University, Egypt.
Medical Microbiology and Immunology Department, Faculty of Medicine, , Zagazig University, , Egypt,
3
Department of Medical Parasitology, Faculty of Medicine , King Abdulaziz University, Jeddah, Saudi Arabia
2
ABSTRACT
Background: The emergence of drug resistant strains of Mycobacterium tuberculosis is of growing
concern. Multi-drug resistance (MDR-TB) where the strain is resistant to both rifampicin (RIF) and
isoniazid (INH), has been reported in all regions of the world. Early choice, and rapid determination of
drug resistance can allow a customized approach to treatment early in the course of the disease and can
potentially reduce morbidity, mortality and infectiousness. It would be helpful for low-resource countries
to have simple and inexpensive tests which can rapidly detect resistance to RIF .The excellent
performance of the BACTEC MGIT 960 for rapid detection of resistance to first- and second-line anti-TB
drugs can be accomplished in days rather than weeks, although still constrained by high cost equipments
and consumables. FASTPlaque-Response™ is a phage amplification-based test for detection of RIF
resistance and has been developed for direct use on sputum specimens. Aim: The present study was
undertaken to compare between BACTEC MGIT 960 method and FASTPlaque-Response™ method for
the time, specificity and sensitivity determination of RIF susceptibility in sputum of both positive (+ve)
and negative (-ve) AFB-smear of Mycobacterium tuberculosis patients. Results: In this study, a total of
60 specimens were collected and divided according to Z-N staining into two groups : group(1) which
was Z.N (+ve )comprising 47 specimens ranged from+1 to +3 positivity, and group(2) which was Z.N –(ve) comprising 13 specimens. The turnaround-time (TAT) of group(1) by BACTEC MGIT 960 ranged
from 8 to 39.2 days with Mean ± SD 13.9 ± 3.4 days for positivity and ranged from 4 to 12.96 days with
Mean ± SD( 8.02 ± 1.98) days for susceptibility pattern, while in group(2) the TAT ranged from 8.2 to
41.75 days with Mean ± SD( 15 ± 5.2) days for positivity and ranged from 4.04 to 13 days with Mean ±
SD (8. 6 ± 2.2) days for susceptibility pattern ,In contrast to BACTEC MGIT960, FASTPlaqueResponse™ susceptibility pattern was completed in just 48 hours. Susceptibility pattern of RIF by
BACTEC MGIT 960 and FASTPlaque-Response™ showed the same results in 35 out of 60 specimens
(58%) which were (26,6&3) Sensitive, resistant, and contaminant respectively, While the other 25
specimens (42%) showed discrepant results. In group (1): 34 out of the 47 specimens (72 %) showed the
same results by FASTPlaque- Response™ and BACTEC MGIT 960 , while discrepancy occurred in the
other 13 specimens ( 28 % ), in which 12 specimens were RIF sensitive by the BACTEC MGIT 960 and
showed different results by FASTPlaque- Response ™ (6,2 and 4 were resistant ,contaminant and no
growth respectively),while the 13th specimen which was resistant by BACTEC MGIT960 became
sensitive with FASTPlaque- Response™ .In group(2) the results by the two methods were the same in
only one out of 13 specimens (8 %), whereas the discrepancy was in the other 12 specimens (92 %) in
which 8 specimens were sensitive with the BACTEC MGIT 960, 7of them showed no growth and the
8th was contaminant by FASTPlaque-Response™, while 3 specimens were resistant by BACTEC MGIT
960, 2 of them were contaminant and 1 showed no growth by FASTPlaqueTB- Response™, whereas,
the 12th specimen was contaminant by BACTEC MGIT 960,but showed no growth with FASTPlaqueTBResponse™. In group(1); 4 out 47 specimens(8.5%) were contaminants and 4 specimens(8.5%)
showed no growth by FASTPlaque- Response™,while,2 specimens(4.2%) were contaminants and no
specimens showed no growth by BACTEC MGIT 960. In group(2);5 specimens out of 13 (38.5%) were
contaminants and 8 specimens (61.5%) showed no growth by FASTPlaque- Response™,while,2
specimens(15.3%) were contaminants and no specimens showed no growth by BACTEC MGIT 960.
Recommendation: Standardization of phage method to minimize the number of contaminated or
incorrect results is necessary before this diagnostic tool can be implemented widely, and improvement
needed to become highly sensitive and specific in that cases to become routinely used.
63
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Gardner and Weiser isolated the first
Mycobacteriophage in 1947 and since that time
over 250phages have been identified(9,10) The
recent upsurge of drug-resistant bacterial
infection has prompted fresh interest in the field
of phage therapy but, unfortunately, attempts to
use lytic phages therapeutically during
tuberculosis infection have so far failed to elicit
cure in experimentally infected animals(11)
Instead, the use of these Mycobacteriophages in
investigative studies of
mycobacteria has
become widespread and recently, their potential
as tools for drug susceptibility testing was
reported.(12,13,14).
FASTPlaque TB, a new rapid test for
diagnosis of TB, was launched in year 2000 by
Biotec
Laboratories
Ltd.
FASTPlaqueResponse™ is a phage amplification-based test,
and has been developed for direct use on
sputum specimens. In this technology,
Mycobacteriophages are allowed to infect the
bacteria, successful replication and production
of progeny phage being indicative of the
presence of viable mycobacteria. Rifampicin
disrupts phage replication by preventing
synthesis of bacterial mRNA and when critical
concentrations of this drug are present progeny
phage will only be observed in those strains
resistant to the drug(15).
The present study was undertaken to
compare between BACTEC MGIT 960 method
and FAST Plaque-Response™ method for the
time, specificity and sensitivity determination
of RIF resistance in sputum specimens of
both positive or negative AFB-smear of
Mycobacterium tuberculosis patients.
INTRODUCTION
The emergence of drug resistant strains of
Mycobacterium tuberculosis complex(MBTC)
is of growing concern. Multi-drug resistant
tuberculosis disease (MDR-TB), where the
strain is resistant to both
major antituberculosis
drugs
rifampicin(RIF)
and
isoniazid (INH), has been reported in all regions
of the world(1).
Early choice of appropriate treatment is an
essential determinant of favorable outcome, and
rapid determination of drug resistance can allow
a customized approach to treatment early in the
course of the disease and can potentially reduce
morbidity, mortality and infectiousness(2). So,
early detection of MDR-TB is important not
only for the patient, but also to limit the
transmission and the spread of drug resistant
disease(3,4).
Rifampicin, discovered in 1963, is the most
powerful bactericidal drug against tuberculosis,
the most potent sterilizing drug available and a
key component for treatment of tuberculosis(5).
Since RIF resistance is considered as a surrogate
marker for the identification of MDR- TB, it
would be helpful for low-resource countries to
have simple and inexpensive tests which can
rapidly detect resistance to RIF(1,6) .
The diagnosis of MDR-TB and (Extreme
drug resistant-TB) XDR-TB is hampered by the
absence of effective and affordable rapid
diagnostic techniques for drug sensitivity.
Several published studies have shown the
excellent performance of the
Mycobacteria Growth Indicator Tube
system (MGIT960, BectonDickinson, Sparks,
Md) for the rapid detection of resistance to firstand second-line anti-TB drugs. Detection of
drug resistance can be accomplished in days
rather than weeks, although still constrained by
high cost equipment and consumable(7).
Molecular methods for detection of TBdrug resistance are proving rapid and sensitive,
but the high cost of these methods and
requirement for sophisticated equipment
currently render them inappropriate for routine
use in many countries with a high burden of
disease. Hence, any test broadly acceptable to
the global TB diagnostic community needs to be
cost effective, accurate, simple and easy to
implement within the current infrastructure.
This challenge has prompted scientists to
reconsider the of Mycobacteriophages as tools
in diagnosis and drug susceptibility testing of
MBTC(8).
MATERIALS & METHODS
This study was conducted in the
Microbiology laboratory of King Abdulaziz
Hospital and Oncology Center, Jeddah, Saudi
Arabia from July 2010 till June 2011.
Patients and Clinical Specimens: In this study,
early morning sputum specimens were collected
and each of them was digested and
decontaminated by N-acetyl-l-cysteine( NALC)2 % NaOH method(BBL MycoPrep;Becton
Dickinson). And concentrated by centrifugation
at 3500 xg(RPM) for 20 min. The sediment,
after
removing
the
supernatant,
was
resuspended in about 2 ml of the phosphate
buffer (Ph 6.8) containing 0.5% Tween 80.Part
of the resultant pellet was used for detection of
MBTC isolates by the smear microscopy using
Ziehl-Nelseen (Z-N) staining . The rest of the
64
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
"Inoculation Procedure" for susceptibility test
was done. If the tube was a Day 3, Day 4 or
Day 5 positive, 1ml of the positive broth was
diluted in 4ml of sterile saline (1:5 dilution) and
the diluted suspension was used for the
inoculation procedures.
Inoculation Procedure for BACTEC MGIT
960 SIRE KIT Susceptibility Test: Five 7ml
MGIT tubes were labeled for each test isolate
and each reference control strain, one labeled as
“GC”, one as S (streptomysin), one as I (INH),
one as R (rifampicin), and the last as E (EMB).
The tubes were arranged in the correct sequence
(S-I-R-E) in the appropriate AST set carrier and
for each tube, 0.8 ml of BACTEC MGIT SIRE
Supplement was aseptically added. Then, using
a micropipette, a critical "low" concentration of
each drug was aseptically pipetted to the
appropriately labeled MGIT tube. The volumes
of added drugs were: 100 µl of 83 µg/ml SM
solution, 100 µl of 8.3µg/ml INH solution,
100µl of 83µg/ml RIF and 100 µl of 415µl
ethambutol (EMB) solution. No antibiotics
were added to the MGIT GC tube.
Growth Control tube preparation and
inoculation: 0.5 ml of the organism suspension
was aseptically pipetted into each of the four
remaining drug tubes (SM, INH, RIF, EMB),
then the tubes were tightly recapped and mixed
well. After that, the AST set was entered into
the BACTEC MGIT 960 machine using the
AST set entry feature. Zero point one ml of the
organism suspension was streaked to a blood
agar plate and MacConkey agar plate then
incubated at 35-37oC and was checked at 48
hours for bacterial growth contamination. If the
plates showed no growth, the AST testing was
allowed to proceed, if showed growth the
ongoing AST should be repeated with pure
culture.
Inoculation Procedure for BACTEC MGIT:
SM 4.0 µg/mL, INH 0.4µg/mL and EMB
7.5µg/mL Kits Susceptibility Test. If critical
concentration result susceptible, no further test
is necessary. If the strain was found resistant to
the critical concentration of SM, INH or EMB,
AST was repeated using the high concentration
where the same procedures as for the low
concentration were done.
Inoculation of BACTEC MGIT 960
Pyrazinamide Susceptibility Kit: We used the
procedure according to the manufacturer's
which resembled that of S-I-R-E except that the
PZA growth control required a dilution of 1:10
instead of 1:100. Also the PZA AST testing
occurred at a lower pH. So the PZA medium
used contained a modified Middlebroak 7H9
pellet was suspended in 15 ml of reconstituted
response medium plus and centrifuged for 20
minutes then supernatant was discarded and the
resultant pellet was suspended in 1ml of
response medium plus to produce the test
suspension.
Inoculation of BACTEC MGIT 960 Tubes:
from each digested sample 0.5 ml was
inoculated into BACTEC MGIT 960 tube as
described by the manufacturer(7)
Classification of positive isolates: Positive
isolates were discriminated by P-nitrobenzoic
acid (PNBA) susceptibility test using the
BACTEC MGIT 960 system(7) into: MBTC and
Mycobacteria Other Than Tuberculosis
(MOTT).
Niacin Test: was performed for confirmation
identification of MTBC isolates(11)
Susceptibility Test: The isolated patient strains
and five reference strains from the American
Type Culture Collection (ATCC), (ATCC
27294, susceptible to all drugs, ATCC 35820,
streptomycin (SM) resistant, ATCC 35822,
(INH) resistant, ATCC 35838, (RIF) resistant,
and ATCC 35837, ethambutol resistant) were
tested to the 4alternative anti-tuberculosis drugs,
and analyzed. AST was based on the growth of
the positive isolate in a drug-containing tube
compared to a drug-free tube (Growth ControlGC). The BACTEC MGIT 960 instrument
continually monitored tubes for increased
fluorescence. Analysis of fluorescence in the
drug-containing tube compared to the
fluorescence of the GC tube was used by the
instrument to determine susceptibility results.
The BACTEC MGIT 960 instrument
automatically interpreted these results using
predefined algorithms (which compare growth
in the drug containing tube to that in the GC
tube) and the susceptible or resistant result was
reported by the instrument(7).
Preparation from a Positive BACTEC MGIT
Tube:
Specimen preparation: all preparations
detailed below were from cultures of MBTC.
According to the manufacturer's instructions(7),
for the preparation of the test inoculum, a
positive 7ml MGIT tube was used the day after
it first became positive on the BACTEC MGIT
960 instrument (Day 1), up to and including the
fifth day (Day 5) after instrument positivity. A
tube which had been positive longer than five
days was sub cultured to a fresh 7ml MGIT tube
containing BACTEC MGIT 960 growth
supplement and tested on the BACTEC MGIT
960 instrument until became positive, and used
from one to five days following positivity. If
the tube was a Day 1 or Day 2 positive, the
65
Egyptian Journal of Medical Microbiology, January 2012
broth which supported the growth and detection
of mycobacteria at a pH of 5.9.
Reconstitution of the componants of The Fast
Plaque-Response kit: By Biotec Laboratories
Limited (Ipswich, Suffolk, UK).Response
medium plus with NOA(anti-microbials to
decrease contamination) was reconstituted and
used to reconstitute actiphage vial, sensor vial,
rifampicin vial, and control vials according to
manufacturer instructions(15).
INCUBATION OF TEST SUSPENSION
We aseptically added 0.5ml of Response
Rifampicin solution to “RIF +” reaction vessel
and 0.5ml Response Medium Plus to “RIF -”
reaction vessel.
Then, add 0.5ml of the test suspension was
added to each of the “RIF +” and “RIF -”
reaction vessels and then incubated for 18-24
hours at 37°C.
PROCESS CONTROL
A negative and positive process control
must be performed on every occasion the assay
procedure was run. The negative control should
result in 0-10 plaques and the positive control
should result in 20 plaques or greater.
Vol. 21, No. 1
ASSAY PROCEDURE
We removed the pre-incubated specimens
from the 37°C incubator and to the two
vessels(RIF-ve and RIF +ve) of each sample
and the prepared control we added 0.1ml of
actiphage with incubation at 37°C for 60
minutes. Then, we added 0.1ml of virusol
solution to each reaction vessel, then left to
stand at room temperature (20-25°C) for 5
minutes. 5 ml of Response Medium Plus was
added to each vessel. Finally, 1ml of sensor
cells was added to each vessel .We removed the
molten FASTPlaque-TB Agar from the 55°C
water bath and added 5ml to an empty sterile
Petri dish with immediate pouring the entire
contents of each reaction vessel into the dish
with replacement of the lid and mixing the
contents well, then, left at 37°c incubator
overnight (18-24 hours).
Reading
Results of the FASTPlaque-Response™
test are read as plaques (zones of clearing) on a
lawn of Sensor cell growth.
INTERPRETATION:
(Fig.,1) Rifampicin susceptibility pattern by FASTPlaque- Response™ Test
If RIF+ plate has 50 plaques or greater, the strain is RIF RESISTANT.
If RIF+ plate has less than 50 plaques, the strain is RIF SUSCEPTIBLE(15).
RESULTS
Statistical analysis
The sensitivity, specificity, for phage assay
were calculated by comparing with the AFB
smear, BACTEC MGIT 960. Sensitivity was
true-positives / (true positives + false-negatives)
x 100.Specificity was true negatives / (true
negatives + false-positives) x 100.
In this study, a total of 60 specimens were
collected and divided according to smear results
into two groups; group(1) which was Z.N +ve
comprising 47 specimens ranged from+1 to +3
positivity, and group(2) which was Z.N-ve
comprising 13 specimens.
66
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (1): Turnaround Time for Isolation and Susceptibility Testing of MBTC by BACTEC MGIT
960.
Time in days
Group
Isolation time
Sensitivity time
60
60
Overall
N
figures
8.0 -41.75
4.0 – 13.0
Range (days)
14.5 ± 4.3
8.3 ± 2.1
Mean ± SD (days)
47
47
Z-N positive N
8 – 39.2day
4 – 12.96
Range (days)
13.9 ± 3.4
8.02 ± 1.98
Mean ± SD (days)
13
13
Z-N negative N
8.2-41.75
4.04-13.0
Range (days)
15.6±5.2
8.6±2.2
Mean ± SD days)
From table (1),the turn around time (TAT)
of group(1) by BACTEC MGIT 960 ranged
from 8 to 39.2 days (mean ± SD=13.93.4 days)
for positivity and ranged from 4 to 12.96 days
(mean ± SD=8.02 ± 1.98 days) for sensitivity,
while the (TAT) of group (2) ranged from 8.2
to 41.75 days(mean ± SD=15.6 5.2 days) for
positivity and ranged from 4.04 to 13
days(mean ± SD=8.6 ± 2.2 days) for sensitivity
in contrast, the sensitivity by FASTPlaqueResponse™ was completed in just 48 hours in
both groups.
Fig.(2 ):Rifampicin susceptibility pattern by FASTPlaque- Response™ Test
plate has> 50 plaques
plate has no plaques
(RIF resistant)
(RIF susceptible)
Table(2): Susceptibility results of rifampicin by BACTEC MGIT 960& FASTPlaque- response
™Test for total isolates(Z-N stain positive &negative).
METHOD
PHAGE
Total
Total
MGIT+PHAGE MGIT ONLY
ONLY
MGIT
Phage
RESULT
26
20
1
46
27
S
6
4
6
10
12
R
3
C
No growth
TOTAL NO=60
S= sensitive, R=resistant, C=contaminant
1
-
6
12
4
60
9
12
60
specimens(58%) which were(26,6&3) Sensitive,
resistant, and contaminant, respectively. While,
the other 25 specimens (42%) showed
discrepant results.
From table (2), and figures (1 and 2),
Susceptibility tests of rifampicin by BACTEC
MGIT 960 and FASTPlaque-Response™
showed the same results in 35 out of 60
67
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (3): Susceptibility results of rifampicin by BACTEC MGIT 960& FASTPlaque- Response
™Test for Z-N stain +ve isolates(group 1).
METHOD MGIT+P
MGIT
PHAGE
Total
Total
RESULT
HAGE
ONLY
ONLY
MGIT
Phage
26
12
1
38
27
S
6
1
6
7
12
R
2
-
2
2
4
No growth
TOTAL NO=47
S= sensitive, R=resistant, C=contaminant
-
4
47
4
47
Table (3), and figures(1 and 2) highlighted,
that in group(1);34 out of the 47 specimens (72
%) showed the same results by FASTPlaqueResponse™ and BACTEC MGIT-960 , while
discrepancy occurred in the other 13 specimens
(28%), in which 12 specimens were RIF
sensitive by BACTEC MGIT 960 and showed
different results by FASTPlaque- Response™
(6,2 and 4 were resistant ,contaminant and no
growth respectively), but the 13th specimen
which was resistant by BACTEC MGIT - 960
became
sensitive
with
FASTPlaqueResponse™. Also, in group(1); 4 out 47
specimens(8.5%) were contaminant and 4
specimens (8.5%) showed no growth by
FASTPlaqueResponse™,while,2
specimens(4.2%) were contaminant and no
specimens showing no growth by BACTEC
MGIT 960.
C
Table (4): Susceptibility results of rifampicin by BACTEC MGIT 960 FASTPlaque- Response
™Test & for Z-N stain –ve isolated (group 2).
METHOD MGIT+P
MGIT
PHAGE
Total MGIT
Total
RESULT
HAGE
ONLY
ONLY
Phage
S
8
8
3
R
3
1
C
1
4
2
5
No growth
8
8
TOTAL NO=13
13
13
S= sensitive, R=resistant, C=contaminant
From table(4) and figure(1 and 2), group
(2) showed that the results by the two methods
were the same in only one out of 13
specimens (8 %) , whereas the discrepancy
was in the other 12 specimens (92 %) in
which 8 specimens were sensitive
with
BACTEC MGIT- 960, 7of them showed no
growth and the 8th was contaminant by
FASTPlaque-Response™, while 3 specimens
were resistant by BACTEC MGIT 960, 2 of
them were contaminant and 1 showed no
growth by FASTPlaque- Response™ ,whereas
,the 12th specimen was contaminant by
BACTEC MGIT 960,but showed no growth
with FASTPlaque- Response™.
Also, in group(2);5 specimens out of 13
(38.5%) were contaminant and 8 specimens
(61.5%) showed no growth by FASTPlaqueResponse™,while,2 specimens(15.3%) were
contaminant and no specimens showing no
growth by BACTEC MGIT 960.
DISCUSSION
Developing countries account for 95% of
active tuberculosis cases and deaths due to TB
worldwide(15,16,17). Most high prevalence
countries continue to use slow culture-based
methods to investigate suspected MDR-TB
cases, so new simple and rapid tests are needed
to be affordable in these settings(18).
Since RIF and INH are the most important
drugs for TB treatment, RIF resistance could be
an important marker, indicating that a patient
would not benefit from the standard antituberculosis regimen, and requires the use of
second-line drugs. Most RIF-resistant strains
worldwide are also MDR(19).
Although the period required for culture is
shortened by BACTEC MGIT 960 system, drug
susceptibility testing in a liquid medium still
requires 1 to 2 weeks from the positivity of the
culture for final determination and reporting to
the clinicians(15), so the speed (48 h) of
Mycobacteriophage tests is a substantial
68
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
sensitivity but higher specificity (as we found in
our study) compared to studies using indirect
isolates which showed higher sensitivity but
lower specificity. So, accuracy of the test varied
according to the type of inocula isolated(21).
Biotec Labs has made modifications in the
protocol for the FASTPlaque assays and
reported that, while modifications increased the
sensitivity in smear negative specimens, this
was associated with high rates of false-positive
results(22).
It was initially believed that phage-based
assays using direct patient specimens would be
feasible for implementation in low-resource
settings, in laboratories without the biosafety
infrastructure required for mycobacterial
culture, as no amplified TB isolates were being
used. However, if a laboratory does not have
technical expertise and experience in
implementing and performing routine TB
cultures, it is unlikely that it will have the
capability
to
perform
quality-assured
mycobacterial decontamination needed for the
performance of direct phage-based assays(20).
An important consideration when testing
M. tuberculosis in the laboratory is safety as
great care must be taken to avoid exposure to
infected aerosols. Indirect culture based
methods require handling of large numbers of
bacilli and stringent safety precautions are
necessary, including negative pressure rooms
and microbiological safety cabinets. Direct
testing of sputum involves much lower numbers
of bacilli reducing the risk to laboratory
personnel. However, inhalation of a very small
number of bacilli can result in infection and
tuberculosis disease .
BACTEC, E-test and phage all require
protective facilities to microbiological safety
category level III. The risk of aerosol
production and accidental exposure increases
each time viable bacteria are handled. BACTEC
test requires less manipulation of open samples
than either E-test or the Phage assay , so it
might be considered the least risky procedure.
LiPA may be considered the safest technology
due to the opportunity to sterilize samples prior
to testing, when they may be handled in a
standard laboratory without fear of infection.
In the meta-analysis done by Minion and
Pai(20), the rate of specimens that were either
contaminated or yielded indeterminate results
ranged from 0% to 36% (mean 5.8%). This was
primarily a problem for evaluations using direct
patient specimens, where the rates of
uninterruptable results ranged from 3% to 36%
(mean 21.2%). By comparison with studies
using indirect specimen inoculation did not
advantage,
allowing
better
therapeutic
management of patients through rapid detection
of MDR strains and reduction of the turnaround
time for diagnosis. Faster improved detection of
MDR-TB strains coupled to an efficient patient
management system would avoid their further
dissemination through appropriate use of
second-line drugs.(19)
There is currently only one commercial
manufacturer of phage-based tests on the
market, Biotec Laboratories Limited (Ipswich,
Suffolk,
UK),
which
produces
the
FASTPlaque™ assay. Their first generation test
for the detection of rifampicin resistance,
FASTPlaque-RIF™ or FASTPlaque-MDRi™,
was used only with indirect M. tuberculosis
isolates. This has now been replaced by
FASTPlaque-Response™ which can be used on
direct patient specimens as well as indirect
isolates(15). In-house amplification assays have
also been developed using D29 phages, and are
based on the same underlying principle(19).
In this study, the discrepancies results were
sent for confirmation in the Microbiology
laboratory of King Fahd Hospital using PCR.
(TB method commercially produced PCR
Roche Diagnostic Systems, Inc., Branchburg,
N.J.) which showed agreement with the results
of BACTEC MGIT 960 by 100% sensitivity
and100% specificity in both groups ,while
FASTPlaque- Response ™ showed 76%
sensitivity and 90% specificity in group (1) and
zero% sensitivity and 55% specificity in group
(2).
We compared our results to Minion and
Pai(20) who made a systemic review and metaanalysis of evidence regarding the diagnostic
accuracy and performance characteristics of
phage-based assays for detection of rifampicin
resistance in Mycobacterium tuberculosis
patients and reported that the evaluations of
commercial phage amplification assays yielded
more variable estimates of sensitivity (range
81–100%) and specificity (range 73–100%)
compared to evaluations of
in-house
amplification assays in which sensitivity range
was 88–100% and specificity range was 84–
100%. The variability in evaluations of the
commercial assay was predominantly a feature
of studies that did not have an author employed
by the manufacturer .Included authors employed
by the commercial manufacturer reported more
accurate results (sensitivity =96.9% and
specificity=96.7%) compared to studies without
industry-employed authors (sensitivity =92.6%
and specificity = 85.1%).
They also found that the majority of studies
that tested direct patient specimens had lower
69
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
for testing susceptibility
tuberculous drugs.
report any uninterruptable results and the mean
rate was only 2.1%. The highest rates of
uninterruptable results were seen in the
evaluations of the FASTPlaque tests. So, Biotec
Labs has developed an antibiotic supplement
(NOA) to control bacterial and fungal
overgrowth. Two studies included assessments
of the FASTPlaque-Response ™assay with
NOA supplement found that uninterruptable
results were decreased by an average of 68%,in
one study,the rate of contamination was reduced
from 16% to 5%(23) and another study,
from1.4% to 0.5%(24).
Evaluations of phage assays for M.
tuberculosis detection have also reported useful
information regarding contamination rates as
previous systematic
review which was
published in 2005(25) found that only 3 studies
reported contamination rates varying widely
from 2.5–40.4% depending on whether
antibiotic supplementation was used or
not(26,27,28).
Subsequent to this review, other studies
have been published on the use of FASTPlaque
assays for TB diagnosis specially when used to
diagnose smear-negative specimens in HIVendemic population. Bonnet et al. reported that
46.8% (95/203 specimens) of their tests were
uninterruptable due to contamination, some
amount of contamination was detected in
another 71 specimens bringing a total rate of
contamination to 81.8%(29).
From the above mentioned data, the
discrepancies between the results of different
studies which agree or disagree with the results
of our study may be due many factors as, the
difference in the isolated strains, the difference
in the method used either in-house
or
commercial phage, the type of the isolate either
direct specimen or indirect culture, the degree of
positivity of the sample as studies which
selected the samples with high positivity
showed higher results of sensitivity and
specificity, the resistant level of the isolate as
Gali et al. reported that phage methods
detecting INH resistance depend on the
resistance level of the isolate(30), the selective
criteria of choosing the patients either, firstly
diagnosed or retreatment patients, the sample
size, the concentration of rifampicin used in the
in-house phage method, the use of NOA
supplement to decrease contamination rate, the
unexpected control results and finally, the
difference in the chosen reference method in
each study. Beside all these concerns about
accuracy of phage results, it detect mono
resistance, however, BACTEC MGIT-960 used
to
many
anti-
CONCLUSION
From the all data of this study
FASTPlaque-Response ™is an inexpensive
method that relies on basic microbiological
techniques. Specialized equipment is not needed
to perform the test or to evaluate the results. It is
easy to perform in any laboratory, and can be
helpful in the laboratories that use conventional
manual culturing methods(31). The disadvantages
of FASTPlaque-Response ™ is the lower
sensitivity and specificity when used directly
from sputum samples especially with Z-N
negative one with high contamination rates, and
improvement needed to become more sensitive
and more specific in that cases to become
routinely used.
RECOMMENDATION
The true impact of implementing these
assays would depend not only on the accuracy
of drug resistance detection, but also on the cost
effectiveness, reliability and incremental benefit
of their results on patient-important outcomes.
Standardization of phage method to minimize
the number of contaminated or intermediate
results is necessary before this diagnostic tool
can be implemented widely.
REFERENCES
1.
2.
3.
4.
70
World
Health
Organisation.
WHO/CDS/TB/2004343. Geneva , WHO;
2004. Anti-tuberculosis drug resistance in
the world: Report Number 3. The
WHO/IUALTD global project on antituberculosis drug resistance surveillance.
Hopewell PC, Pai M, Maher D, Uplekar
M, Raviglione MC. International standards
for Tuberculosis care. Lancet Infect
Dis.,2006;6:710–725.
Telenti A, Imboden P, Marchesi F, et al..
Detection
of
rifampicin-resistance
mutations in Mycobacterium Tuberculosis.
Lancet, 1993;341:647–650.
McNerney R. Micro-well phage replication
assay for screening mycobacteria for
resistance to rifampicin and streptomycin .
In: Gillespie SH, editor. Antibiotic
Resistance Methods and Protocols. Vol. 48.
Towota, NY , Humana Press Inc ; 2001. pp.
21–30. (Methods in Molecular Medicine).
Walker MJ.
Egyptian Journal of Medical Microbiology, January 2012
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
World Health Organization. (2003).
Treatment of Tuberculosis. Guidelines for
National Programmes. WHO/ CDS/ TB/
2003.313.
Rossau R, Traore H, De Beenhouwer H.
et al. Evaluation of the INNO-LiPA Rif.
TB assay, a reverse hybridization assay for
the
simultaneous
detection
of
Mycobacterium Tuberculosis Complex and
its resistance to rifampin. Antimicrobial
Agents and Chemotherapy, 1997; 41: 2093–
2098.
Rüsch-Gerdes S, Pfyffer GE, Casal M, et
al. Multicenter laboratory validation of the
BACTEC MGIT 960 technique for testing
susceptibilities
of
Mycobacterium
Tuberculosis to classical second-line drugs
and newer antimicrobials. J Clin
Microbiol., 2006;44:688–692.
Eltringham LJ, Drobniewski FA,
Mangan JA, et al. Evaluation of reverse
transcription-PCR and a bacteriophagebased assay for rapid phenotypic detection
of rifampicin resistance in clinical isolates
of Mycobacterium Tuberculosis. J Clinic
Microbiol., 1999;37:3524-3527.
McNerney R, Wilson SM, Sidhu AM, et
al. Inactivation of mycobacteriophage D29
using ferrous ammonium sulphate as tool
for the detectionof viable Mycobacterium
smegmatis and M.tuberculosis. Res
Microbiol.,1998;149:487-495.
McNerney R. TB: the return of the phage.
A
reviewof
fifty
years
of
mycobacteriophage research. Int J tuberc
lung dis., 1999;3(3):179-184.
Jacob WR, Barletta R, Udani R, et al.
Rapid assessment of drug susceptibilities of
Mycobacterium Tuberculosis by means of
luciferasereporter phages. Science, 1993;
260:819-822.
Eltringham LJ, Wilson SM and
Drobniewski
FA.
Evaluation
of
bacteriophage-based assay (phage amplified
biological assay) as a rapid screen for
resistance to isoniazid, ethambutol,
streptomycin,
pyrazinamide,
and
ciprofloxacin among clinical isolates of
Mycobacterium Tuberculosis. J Clinic
Microbiol., 1999;37(11):3528-3532.
Wilson SM, Suwaidi ZA, McNerney R, et
al. Evaluation of a new rapid
bacteriophage-based method for the drug
susceptibility testing of Mycobacterium
Tuberculosis. Nature medicine, 1997;
3:465-468.
Albert H, Heydenrych A, Mole R, et al.
Evaluation of FASTPlaque TB-RIF, a
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
71
Vol. 21, No. 1
rapid, manual test for the determination of
rifampicin resistance from Mycobacterium
Tuberculosis cultures. Int J Tuberc Lung
Dis.,2001;5(10):906-911.
BIOTEC
FASTPlaque
-TB.
An
innovative breakthrough for the detection of
Tuberculosis.Technical
data
report.
BIOTEC Laboratories Ltd.UK. 2000.
Corbett EL, Watt CJ, Walker N, et al.
The growing burden of tuberculosis and
interactions with the HIV epidemic. Arch
Intern Med., 2003;163(9):1009-1021.
World Health Organisation: Global
Tuberculosis
control:
surveillance,
planning, financing. Geneva: WHO;
2009.Tuberculosis: global trends.
Traore H, Ogwang S, Mallard K, et al.
Low-cost rapid detection of rifampicin
resistant tuberculosis using bacteriophage
in Kampala, Uganda.Annals of Clinical
Microbiology and Antimicrobials, 2007,
6:1.
Chauca JA, Palomino JC and Guerra
H. Evaluation of rifampicin and isoniazid
susceptibility testing of Mycobacterium
Tuberculosis by a mycobacteriophage D29based assay .Journal of Medical
Microbiology,2007; 56: 360–364.
Minion J and Pai M. Bacteriophage
assays for rifampicin resistance detection in
Mycobacterium Tuberculosis: updated
meta-analysis Int J Tuberculosis Lung
Dis.,14(8):941–951.
Pai M, Kalantri S, Pascopella L, et al.
Bacteriophage-based assays for the rapid
detection of rifampicin resistance in
Mycobacterium Tuberculosis: a metaanalysis. J Infect., 2005; 51: 175–187.
Trollip A P, Albert H, Mole R, et al.
Performance of FASTPlaque-TB and a
modified protocol in a high HIV prevalence
community in South Africa. Int J Tuberc
Lung Dis., 2009; 13: 791–793.
Mole R, Trollip A, Abrahams C,et al.
Improved contamination control for a rapid
phage-based rifampicin resistance test for
Mycobacterium Tuberculosis. J Med
Microbiol., 2007; 56: 1334–1339.
Albert H, Trollip A P, Linley K, et al.
Development
of
an
antimicrobial
formulation for control of specimen-related
contamination in phage-based diagnostic
testing for Tuberculosis. J Appl Microbiol.,
2007; 103: 892–899.
Kalantri S, Pai M, Pascopella L,et al.
Bacteriophage-based tests for the detection
of Mycobacterium Tuberculosis in clinical
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫‪specimens: a systematic review and meta‬‬‫‪analysis. BMC Infect Dis., 2005; 5: 59.‬‬
‫‪26. Mbulo G M, Kambashi B S, Kinkese J, et‬‬
‫‪al. Comparison of two bacteriophage tests‬‬
‫‪and nucleic acid amplification for the‬‬
‫‪diagnosis of pulmonary Tuberculosis in‬‬
‫‪sub-Saharan Africa. Int J Tuberc Lung Dis.,‬‬
‫‪2004; 8: 1342–1347.‬‬
‫‪27. Muzaffar R, Batool S, Aziz F,et al.‬‬
‫‪Evaluation of the FASTPlaque-TB assay‬‬
‫‪for direct detection of Mycobacterium‬‬
‫‪Tuberculosis in sputum specimens. Int J‬‬
‫‪Tuberc Lung Dis., 2002; 6: 635–640.‬‬
‫‪28. Albay A, Kisa O, Baylan O,et al. The‬‬
‫‪evaluation of FASTPlaque-TB test for the‬‬
‫‪rapid diagnosis of Tuberculosis. Diagn‬‬
‫‪Microbiol Infect Dis., 2003; 46: 211–215.‬‬
‫‪29. Bonnet M, Gagnidze L, Varaine F, et al.‬‬
‫‪Evaluation of FASTPlaque-TB to diagnose‬‬
‫‪smear-negative Tuberculosis in a peripheral‬‬
‫‪clinic in Kenya. Int J Tuberc Lung Dis.,‬‬
‫‪2009; 13: 1112–1128.‬‬
‫‪30. Galı´ N, Domı´nguez J, Blanco S, et al.‬‬
‫‪Use of a mycobacteriophage-based assay‬‬
‫‪for rapid assessment of susceptibilities of‬‬
‫‪Mycobacterium Tuberculosis isolates to‬‬
‫‪isoniazid and influence of resistance level‬‬
‫‪on assay performance. J Clin Microbiol.,‬‬
‫‪2006; 44: 201–205.‬‬
‫‪31. Mole R and Maskell TW. Review Phage‬‬
‫‪as a diagnostic tool- the use of phage in TB‬‬
‫‪diagnosis. J Chem Tech Biotech.,‬‬
‫‪2001;76:683-688.‬‬
‫دراﺳﺔ ﻣﻘﺎرﻧﺔ ﺑﻴﻦ ﺟﻬﺎز اﻟﺒﺎآﺘﻚ ﻣﺎﺟﻴﺖ ‪ ٩٦٠‬و اﻟﻔﺎﺳﺖ ﺑﻠﻴﻚ ﺗﺤﺪﻳﺪ أﻧﻤﺎط اﻟﺘﺤﺴﺲ ﻟﻌﻘﺎر‬
‫اﻟﺮﻳﻔﺎﻣﺒﺴﻴﻦ ﻓﻲ ﻋﻴﻨﺎت اﻟﻘﺸﻊ اﻟﻤﺄﺧﻮد ﻣﻦ ﻣﺮﺿﻰ اﻟﺪرن اﻟﺮﺋﻮي‬
‫ﻋﺰة ﻣﺤﻤﺪ ﻋﺒﺪ اﻟﻌﺰﻳﺰ‪،١‬داﻟﻴﺎ اﻟﺤﺼﺮي‪،٢‬هﺎﻧﻲ ﻋﺼﻔﻮر‬
‫‪٣‬‬
‫أﻗﺴﺎم اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻰ واﻟﻤﻨﺎﻋﺔ‪ ١،٢‬واﻟﻄﻔﻴﻠﻴﺎت اﻟﻄﺒﻴﺔ‪،٣‬‬
‫ﻣﻌﻬﺪ اﻟﻜﺒﺪ اﻟﻘﻮﻣﻲ‪-‬ﺟﺎﻣﻌﺔ اﻟﻤﻨﻮﻓﻴﺔ‪-‬ج‪.‬م‪.‬ع‪،١‬آﻠﻴﺔ اﻟﻄﺐ‪-‬ﺟﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ‪-‬ج‪.‬م‪.‬ع‪,٢‬‬
‫آﻠﻴﺔ اﻟﻄﺐ‪-‬ﺟﺎﻣﻌﺔ اﻟﻤﻠﻚ ﻋﺒﺪ اﻟﻌﺰﻳﺰ‪-‬ﺟﺪة‪-‬اﻟﻤﻤﻠﻜﺔ اﻟﺴﻌﻮدﻳﺔ اﻟﻌﺮﺑﻴﺔ‪٣‬‬
‫اﻟﺨﻠﻔﻴﺔ‪ :‬ان ﻇﻬﻮرﺳﻼﺳﻼت ﺟﺪﻳﺪة ﻣﻦ ﻣﺘﻔﻄﺮات اﻟﺪرن واﻟﻤﻘﺎوﻣﺔ ﻟﻠﻌ ﻼج ﺑﻤ ﻀﺎدات اﻟ ﺪرن أﺻ ﺒﺢ ذات أهﻤﻴ ﺔ آﺒﻴ ﺮة ﻓ ﻲ أﻧﺤ ﺎء اﻟﻌ ﺎﻟﻢ آﻠ ﻪ‬
‫وﻟﺬﻟﻚ ﻓﺎن اﻟﺘﺸﺨﻴﺺ اﻟﻤﻌﻤﻠﻲ اﻟﻤﺒﻜﺮ و اﻟﺘﺤﺪﻳﺪ اﻟﺴﺮﻳﻊ ﻟﻤﻘﺎوﻣﺔ ﻣﺘﻔﻄﺮات اﻟﺪرن ﻟﻸدوﻳﺔ ﻳﺘ ﻴﺢ اﻟﻌ ﻼج اﻟ ﺴﺮﻳﻊ ﺧﺎﺻ ﺔ ﻓ ﻲ ﺑﺪاﻳ ﺔ اﻟﻤ ﺮض و‬
‫ﺑ ﺬﻟﻚ ﻳﻘﻠ ﻞ اﺣﺘﻤﺎﻟﻴ ﺎت اﻧﺘﻘ ﺎل اﻟﻌ ﺪوى وﻳﻘﻠ ﻞ ﻣ ﻦ ﻧ ﺴﺒﺔ اﻻﺻ ﺎﺑﺎت اﻟﺠﺪﻳ ﺪة وﺑﺎﻟﺘ ﺎﻟﻲ ﻳﻘﻠ ﻞ ﻣ ﻦ اﻟﺘﻜﻠﻔ ﺔ اﻟﻜﻠﻴ ﺔ ﻟﻠﻤ ﺮﻳﺾ واﻻﻗ ﻼل ﻣ ﻦ ﻧ ﺴﺐ‬
‫اﻟﻮﻓﻴﺎت‪..‬وان اﻷداء اﻟﻤﻤﻴﺰ ﻟﺠﻬ ﺎز اﻟﺒﺎآﺘ ﻚ ﻣﺎﺟﻴ ﺖ ‪ ٩٦٠‬ﻳﻔ ﻲ اﻟﻐ ﺮض ﻓ ﻲ ﺗﺤﺪﻳ ﺪ اﻧﻤ ﺎط اﻟﺤ ﺴﺎﺳﻴﺔ ﻟﻠﺨ ﻂ اﻷول و اﻟﺜ ﺎﻧﻲ ﻟﻸدوﻳ ﺔ اﻟﻤ ﻀﺎدة‬
‫ﻟﻠﺪرن ﻓﻲ ﺧﻼل أﻳﺎم ﺑﺪﻻ ﻣﻦ أﺳﺎﺑﻴﻊ ﺑﺎﺳﺘﺨﺪام اﻻوﺳﺎط اﻟﺒﻜﺘﻴﺮﻳﺔ اﻟﺼﻠﺒﺔ)وﺳﻂ ﻟﻮﻓﻨﺸﺘﻴﻦ‪-‬ﺟﻮﻧﺴﻮن( وﻟﻜﻦ ﻣﺎزال ﻳﻌﻮﻗﻪ اﻟﻜﺜﻴﺮ ﻣﻦ اﻟ ﻀﻮاﺑﻂ‬
‫واﻟﻘﻮاﻋﺪ اﻟﺘﻲ ﻳﺠﺐ اﺗﺒﺎﻋﻬﺎ ﻋﻨﺪ اﺳﺘﺨﺪاﻣﻪ ﻋ ﻼوة ﻋﻠ ﻲ اﻟﺘﻜﻠﻔ ﺔ اﻟﻌﺎﻟﻴ ﺔ ﻟﻠﺠﻬ ﺎز‪ .‬واﺻ ﺒﺤﺖ اﻟﺤﺎﺟ ﺔ ﻻﺳ ﺘﺨﺪام ﺗﻘﻨﻴ ﺎت ﺟﺪﻳ ﺪة اﺳ ﺮع وارﺧ ﺺ‬
‫وادق ﻣﻨﻬﺎ إﺳﺘﺨﺪام ﺗﻘﻨﻴﺔ اﻟﻔﺎﺳﺖ ﺑﻠﻴﻚ آﻮﻧﻬﺎ اﻗﻞ ﺗﻜﻠﻔﺔ و أآﺜﺮ ﺳﺮﻋﺔ‪ .‬و ﺳﻴﻜﻮن هﺬا ﻣﺴﺎﻋﺪا ﺧﺎﺻ ﺔ ﻓ ﻲ اﻟ ﺪول دات اﻟﻤ ﻮارد اﻟﻤﺤ ﺪودة ﻓ ﻲ‬
‫اﺟﺮاء ﻓﺤﻮﺻﺎت ﺑﺴﻴﻄﺔ و رﺧﻴﺼﺔ و ﺳﺮﻳﻌﺔ ﻟﺘﺤﺪﻳﺪ اﻟﻤﻘﺎوﻣﺔ ﻟﻌﻘﺎر اﻟﺮﻳﻔﺎﻣﺒﺴﻴﻦ‬
‫اﻟﻬﺪف‪ :‬وﻟﺬﻟﻚ ﻓﺎن هﺪف هﺬﻩ اﻟﺪراﺳﺔ اﻟﻤﻘﺎرﻧﺔ ﺑﻴﻦ ﺟﻬ ﺎز اﻟﺒﺎآﺘ ﻚ ﻣﺎﺟﻴ ﺖ ‪ ٩٦٠‬و اﻟﻔﺎﺳ ﺖ ﺑﻠﻴ ﻚ ﺑﺎﻟﻨ ﺴﺒﺔ ﻟﻠﻮﻗ ﺖ و اﻟﺤ ﺴﺎﺳﻴﺔ و اﻟﺨ ﺼﻮﺻﻴﺔ‬
‫ﻟﺘﺤﺪﻳﺪ اﻧﻤﺎط اﻟﺘﺤﺴﺲ ﻟﻌﻘﺎر اﻟﺮﻳﻔﺎﻣﺒﺴﻴﻦ ﻓﻲ اﻟﻘﺸﻊ اﻟﻤﺄﺧﻮد ﻣﻦ اﻟﻌﻴﻨﺎت اﻻﻳﺠﺎﺑﻴﺔ و اﻟﺴﻠﺒﻴﺔ ﻟﺼﺒﻐﺔ اﻟﺰﻳﻞ ﻧﻠﺴﻮن ﻟﻤﺮﺿﻰ اﻟﺪرن اﻟﺮﺋﻮي‪.‬‬
‫اﻟﻨﺘﺎﺋﺞ‪ :‬ﻓﻲ ه ﺬﻩ اﻟﺪراﺳ ﺔ ﻗ ﺴﻤﺖ اﻟﻌﻴﻨ ﺎت اﻟﻜﻠﻴ ﺔ ﻟﻠﻤﺮﺿ ﻲ ﻋﻠ ﻲ ﺣ ﺴﺐ ﻧﺘ ﺎﺋﺞ ﺻ ﺒﻐﺔ اﻟﺰﻳ ﻞ ﻧﻴﻠ ﺴﻮن اﻟ ﻲ ﻣﺠﻤ ﻮﻋﺘﻴﻦ‪.‬اﻟﻤﺠﻤﻮﻋ ﺔ اﻻوﻟ ﻲ)‪(١‬‬
‫وﺗﺸﺘﻤﻞ ﻋﻠﻲ ‪ ٤٧‬ﻋﻴﻨﺔ اﻳﺠﺎﺑﻴﺔ ﻟﺼﺒﻐﺔ اﻟﺰﻳﻞ ﻧﻴﻠﺴﻮن واﻟﻤﺠﻤﻮﻋﺔ اﻟﺜﺎﻧﻴﺔ)‪ (٢‬وﺗﺸﺘﻤﻞ ﻋﻠﻲ ‪ ١٣‬ﻋﻴﻨﺔ ﺳﻠﺒﻴﺔ ﻟﺼﺒﻐﺔ اﻟﺰﻳﻞ ﻧﻴﻠﺴﻮن‪.‬‬
‫ان اﻟﻮﻗ ﺖ اﻟﻜﻠ ﻲ ﻻآﺘﻤ ﺎل ﻓﺤ ﺺ اﻟﻌﻴﻨ ﺔ ﺑﺠﻬ ﺎز اﻟﺒﺎآﺘ ﻚ ﻣﺎﺟ ﺖ ‪ ٩٦٠‬ﻓ ﻲ اﻟﻤﺠﻤﻮﻋ ﺔ اﻻوﻟ ﻲ ﺗﺘ ﺮاوح ﺑ ﻴﻦ ‪ ٨‬اﻟ ﻲ ‪ ٣٩.٢‬ﻳﻮﻣ ﺎ‬
‫ﺑﻤﺘﻮﺳﻂ‪ ٣.٤+١٣.٩‬ﻳﻮﻣﺎ ﻟﻈﻬﻮر اﻻﻳﺠﺎﺑﻴﺔ وﺗﺘﺮاوح ﺑﻴﻦ ‪ ٤‬اﻟﻲ ‪ ١٢.٩٦‬ﻳﻮﻣﺎ ﺑﻤﺘﻮﺳﻂ‪ ١.٩٨+٨.٠٢‬ﻳﻮﻣﺎ ﻟﻈﻬﻮر اﻟﺘﺤﺴﺲ ﻟﻤ ﻀﺎدات اﻟ ﺪرن‬
‫ﺑﻴﻨﻤﺎ ﻳﺘﺮاوح اﻟﻮﻗﺖ اﻟﻜﻠﻲ ﻻآﺘﻤﺎل ﻓﺤﺺ اﻟﻌﻴﻨﺔ ﺑﺠﻬﺎز اﻟﺒﺎآﺘﻚ ﻣﺎﺟﻴﺖ ﻓﻲ اﻟﻤﺠﻤﻮﻋ ﺔ اﻟﺜﺎﻧﻴ ﺔ ﺑ ﻴﻦ ‪ ٨.٢‬اﻟ ﻲ‪ ٤١.٧٥‬ﻳﻮﻣ ﺎ ﺑﻤﺘﻮﺳ ﻂ ‪٥.٢+١٥‬‬
‫ﻳﻮﻣﺎ ﻟﻼﻳﺠﺎﺑﻴﺔ وﺑﻴﻦ ‪ ٤.٤‬اﻟ ﻲ ‪ ١٣‬ﻳﻮﻣ ﺎ ﺑﻤﺘﻮﺳ ﻂ ‪٢.٢+٨.٦‬ﻳﻮﻣ ﺎ ﻟﻠﺘﺤ ﺴﺲ ﻟﻤ ﻀﺎدات اﻟ ﺪرن‪.‬ﺑﻴﻨﻤ ﺎ اﺳ ﺘﻐﺮق وﻗ ﺖ ﻗﻴ ﺎس اﻟﺘﺤ ﺴﺲ ﻟﻤ ﻀﺎدات‬
‫اﻟﺪرن ﻳﻮﻣﻴﻦ ﻓﻘﻂ ﺑﻄﺮﻳﻘﺔ اﻟﻔﺎﺳﺖ ﺑﻠﻴﻚ‪.‬آﺬﻟﻚ اﻇﻬﺮت اﺧﺘﺒﺎرات اﻟﺘﺤ ﺴﺲ ﻧﻔ ﺲ اﻟﻨﺘ ﺎﺋﺞ ﻓ ﻲ‪ ٣٥‬ﻋﻴﻨ ﺔ )‪ (%٥٨‬ﺑﻄﺮﻳﻘ ﺔ اﻟﺒﺎآﺘ ﻚ ﻣﺎﺟﻴ ﺖ ‪٩٦٠‬‬
‫واﻟﻔﺎﺳ ﺖ ﺑﻠﻴ ﻚ ﻣﻨﻬ ﺎ ‪ ٢٦‬ﺣ ﺴﺎﺳﺔ و‪ ٦‬ﻣﻘﺎوﻣ ﺔ و‪ ٣‬ﻣﻠﻮﺛ ﺔ ﺑﻴﻨﻤ ﺎ ‪٢٥‬ﻋﻴﻨ ﺔ اﻟﺒﺎﻗﻴ ﺔ اﻇﻬ ﺮت ﻧﺘ ﺎﺋﺞ ﻣﺨﺘﻠﻔ ﺔ ﺑ ﻴﻦ اﻟﻄ ﺮﻳﻘﺘﻴﻦ‪.‬اﻣ ﺎ اﻟﻤﺠﻤﻮﻋ ﺔ اﻟﺜﺎﻧﻴ ﺔ‬
‫اﻇﻬﺮت اﻟﻄﺮﻳﻘﺘﻴﻦ ﻧﺘﺎﺋﺞ ﻣﺘﻤﺎﺛﻠﺔ ﻓﻲ ﻋﻴﻨﺔ واﺣﺪة ﻓﻘ ﻂ)‪ (%٨‬وﻧﺘ ﺎﺋﺞ ﻣﺨﺘﻠﻔ ﺔ ﻓ ﻲ ‪ ١٢‬ﻋﻴﻨ ﺔ)‪.(%٩٢‬آ ﺬﻟﻚ ﻓ ﻲ اﻟﻤﺠﻤﻮﻋ ﺔ اﻻوﻟ ﻲ آﺎﻧ ﺖ ﻧ ﺴﺒﺔ‬
‫اﻟﻌﻴﻨﺎت اﻟﻤﻠﻮﺛﺔ ‪٤‬ﻋﻴﻨﺎت )‪ (%٨٥‬وﻧﺴﺒﺔ اﻟﻌﻴﻨﺎت اﻟﺘﻲ ﻟﻢ ﻳﺤ ﺪث ﻓﻴﻬ ﺎ اي ﻧﻤ ﻮ ﺑﻜﺘﻴ ﺮى‪٤‬ﻋﻴﻨ ﺎت )‪ (%٨٥‬ﺑﻄﺮﻳﻘ ﺔ اﻟﺒﺎآﺘ ﻚ ﻣﺎﺟﻴ ﺖ ﺑﻴﻨﻤ ﺎ ﻧ ﺴﺒﺔ‬
‫اﻟﻌﻴﻨﺎت اﻟﻤﻠﻮﺛﺔ )‪ (%٤٢‬اي ‪ ٢‬ﻋﻴﻨﺔ وﻻ ﺗﻮﺟﺪ اي ﻋﻴﻨﺎت ﺑﺪون ﻧﻤﻮ ﺑﻜﺘﻴﺮى ﺑﻄﺮﻳﻘﺔ اﻟﺒﺎآﺘﻚ ﻣﺎﺟﻴﺖ ‪ ٩٦٠‬اﻣﺎ اﻟﻤﺠﻤﻮﻋ ﺔ اﻟﺜﺎﻧﻴ ﺔ آﺎﻧ ﺖ هﻨﻠ ﻚ‬
‫‪٥‬ﻋﻴﻨﺎت ﻣﻠﻮﺛﺔ )‪ (%٣٨,٥‬و‪٨‬ﻋﻴﻨﺎت )‪ (%٦١,٥‬ﻻ ﺗﺤﺘﻮى ﻋﻠﻲ اي ﻧﻤﻮ ﺑﻜﺘﻴﺮى ﺑﻄﺮﻳﻘﺔ اﻟﻔﺎﺳﺖ ﺑﻠﻴﻚ ﺑىﻨﻤﺎ ‪ ٢‬ﻋﻴﻨﺔ )‪ (%١٥,٣‬آﺎﻧﺖ ﻣﻠﻮﺛﺔ‬
‫وﻻ ﺗﻮﺟﺪ اي ﻋﻴﻨﺎت ﻻ ﺗﺤﺘﻮى ﻋﻠﻰ اي ﻧﻤﻮ ﺑﻜﺘﻴﺮى ﺑﻄﺮﻳﻘﺔ اﻟﺒﺎآﺘﻚ ﻣﺎﺟﻴﺖ ‪٩٦٠‬‬
‫اﻟﺘﻮﺻﻴﺔ‪ :‬ﺑﺎﻟﺮﻏﻢ ﻣﻦ ان اﺳﻠﻮب اﻟﻔﺎﺳ ﺖ ﺑﻠﻴ ﻚ ﻳﻔ ﻲ ﻏ ﺮض ﺳ ﺮﻋﺔ اﻟﺘ ﺸﺨﻴﺺ وﻗﻠ ﺔ اﻟﺘﻜﻠﻔ ﺔ ﻓﺎﻧ ﻪ ﻣﻄﻠ ﻮب ﺗﻌ ﺪﻳﻼت ﻓ ﻲ اﻟﺘﻘﻨﻴ ﺔ ﻟﺰﻳ ﺎدة ﻧ ﺴﺒﺔ‬
‫اﻟﺤﺴﺎﺳﻴﺔ و اﻟﺨﺼﻮﺻﻴﺔ وﺗﻘﻠﻴﻞ ﻋﺪد اﻟﻨﺘﺎﺋﺞ اﻟﻤﻠﻮﺛﺔ وﺧﺎﺻ ﺔ ﻟﻌﻴﻨ ﺎت اﻟﻤﺮﺿ ﻲ ﺳ ﺎﻟﺒﻲ ﺻ ﺒﻐﺔ زﻳ ﻞ‪-‬ﻧﻠ ﺴﻮن ﻗﺒ ﻞ ان ﻧ ﺘﻤﻜﻦ ﻣ ﻦ ﺗﻌﻤ ﻴﻢ ه ﺬة‬
‫اﻻداة اﻟﺘﺸﺨﻴﺼﻴﺔ ﻋﻠﻲ ﻧﻄﺎق واﺳﻊ‪.‬‬
‫‪72‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Methicillin Resistant Staphylococcus Aureus Infection and
Its Biofilm in Diabetic Foot Ulcers
Hanan E Mohamed and Ayman H Al-Gadaa*
Clinical Pathology and General Surgery*
Departments, Faculty of Medicine, Zagazig University
ABSTRACT
Background: Methicillin resistant staphylococcus aureus (MRSA) has emerged as a serious and
commonly occurring problem in diabetic patients with foot ulcers. Its ability to form biofilms helps the
bacterium to survive hostile environment within the host, and is considered responsible for chronic or
persistent infections. Objectives: To predict the prevalence of MRSA as well as its biofilm forming
capacity among patients with infected diabetic foot ulcers and clarify potential risk factors related to this
infection. Subjects and methods: Eighty two patients with infected diabetic foot ulcers was involved in
this study. Samples obtained from ulcers were directly plated on MacConkey , blood and mannitol salt
agar ,incubated aerobically, and anaerobic culture on GN and NS media was done, all colonies
appeared were examined macroscopically and different pathogens identified by gram stain and the
available biochemical reactions .Coagulase, catalase tests and APIStaph system for staphylococcus
aureus (S.aureus)identification were done. All S.aureus isolates were examined by polymerase chain
reaction (PCR) for MRSA mecA genedetection, then MRSA strains examined for biofilm formation via
PCR detection of icaA and D gene and quantitative tissue culture plate method (TCP). Results: A total of
103 isolates were detected from 82 infected diabetic ulcer specimens, averaging1.3 species per patient.
The most frequent isolated organism was 43(41.7%) staphylococcus aureus .Among the 43
staphylococcus aureus, 21 (48.8%) were (MRSA) and among them 11 (52.4%) were biofilm producers
.Screening of the extent of biofilm formation of the isolated MRSA by tissue culture assay (TCP) revealed
that 7/11(63.6%) were strong adherent,2(18.2%) were moderate adherent and 2(18.2%) were non/weak
adherent . Regarding the demographic and clinical characteristics of patients with MRSA and non MRSA
infected diabetic foot ulcers, the risk for MRSA isolation was significantly increase with older age, longer
duration of diabetes mellitus, larger size of the ulcer as well as presence of osteomyelitis (p≤0.05) .
Conclusion: MRSA and its biofilm were isolated frequently from infected foot ulcers of diabetic patients .
Because of the different lines of treatment between MRSA and biofilm , rapid diagnosis and treatment of
MRSA is important and screening for MRSA biofilm production in infected diabetic foot ulcers is
mandatory.
defense against pathogens and thus are more
susceptible to an ensuing foot infection(5).
Staphylococcus aureus (S.aureus)is found
to be the commonest pathogen present in
diabetic foot infections(3,6). Among persons with
diabetes, the incidence of MRSA infections is
increasing most rapidly in those with chronic
foot ulcers who have previously received
antibiotic therapy(7-9). The virulence of S.aureus
is associated with its ability to produce toxins
and extracellular factors, ability to adhere and
form biofilm on host surfaces, finally resistance
to phagocytosis(10,11). Wound surface provides
an ideal environment for bacteria, where it
attaches, Grows and remains component of an
early biofilm(12). The ability of S.aureus to form
biofilms helps the bacterium to survive hostile
environment within the host, and is considered
responsible
for
chronic
or
persistent
infections(13,14).
INTRODUCTION
The diabetic foot syndrome is clearly one of
the most important complications of diabetes(1).
People with diabetes are 25 times more likely to
have a leg amputated than those without the
condition, according to the International
Diabetes Federation(2).
Ischemia, neuropathy and infection are the
three pathological components that lead to
diabetic foot complications, and they frequently
occur together as an etiological trio(3).
Diabetes also causes structural and
functional changes within the arteriolar and
capillary systems, notably with thickening of the
basement
membrane(4).
This
thickened
membrane impairs leukocytes migration.
Because of this blunted neuro-inflammatory
response, diabetic patients lack a crucial
component of the body’s natural first line of
73
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
the criteria proposed by the international
consensus on the diabetic foot(21). Peripheral
vascular disease was diagnosed when patients
had an ankle–brachial pressure index (ABI) <
0.9, as determined with a portable Doppler
machine or when they had a history of
intermittent claudication or of re-vascularisation
procedures(22). None of the study patients had
infections at other body sites. Informed consent
from each patient was obtained.
Samples: From curettage of the diabetic
ulcer base and skin biopsies from the ulcer edge
and web swabs. Cotton swabs were moistened
with 0.9% saline(23). Curette samples were
placed in 10 ml trypticase soy broth (Himedia
lab.PVT.Ltd.India), sonicated for one minute
and vortexed for 15 seconds then 0.1 ml was
cultured .All samples were plated directly on
MacConkey agar, blood agar and mannitol salt
agar ,incubated aerobically at 37°C for 24 hours.
Also, anaerobic culture on GN and NS media
(bioMerieux , Inc) was done .
All colonies appeared on any culture were
examined macroscopically and different
microbial pathogens were identified by gram
stain, and the available biochemical reactions.
Catalase and coagulase tests was done for all
Staphylococcus strain then APIStaph system
(bioMerieux,France)
was
applied
for
identification. Staphylococcus aureus isolates
were maintained in trypticase soy broth, to
which 15% glycerol was added , at -80°C.
staphylococcus aureus strains was examined by
PCR for MRSA mecA genedetection, then
MRSA isolates examined for biofilm formation
via PCR detection of icaA/D gene
and
quantitative tissue culture plate method (TCP) .
PCR for detection of MRSA mecA and
biofilm icaA and D genes:
Three standard steps of PCR was done; DNA
extraction, amplification and detection.
DNA extraction: DNA extraction kit
(Axygen biosciences, USA). Samples were
processed according to the instructions of the
manufacturer from isolates on trypticase soy
agar plates after thawing the samples. DNA
extracted from staphylococci isolates for mecA
gene detection and from MRSA isolates for
icaA and D gene detection.
PCR amplification : Taq Master / high yield
(Jena Bioscience GmbH, Germany) was used as
ready to use mixes which contain all reagents
required for PCR except template and primers in
a premixed 5x concentrated ready to use
solution. For 50 uL PCR assay;10uL 5x Taq
Master Mix, to which 50 pmol each
primer,200ng template DNA was added and
completed up to 50uL with PCR grade water .
Biofilm formations is considered to be a
two step process in which the bacteria First
adhere to a surface mediated by a capsular
antigen, namely capsular polysaccharide/
adhesion (PS/A), followed by multiplication to
form a multilayered biofilm, which is associated
with production of polysaccharide intercellular
adhesion (PIA). The intercellular adhesion (ica)
locus consisting of the genes icaADBC encodes
the proteins mediating the synthesis of PIA and
PS/A in staphylococcal species(13,15). Among ica
genes, the icaA and icaD have been reported to
play a significant role in biofilm formation of
S.aureus and S.epidermidis(13,15,16).
Biofilm infections are difficult to treat due
to their inherent antibiotic resistance. Once
staphylococcal biofilm has formed on damaged
tissue, it is difficult to disrupt. Most
antimicrobial therapies for biofilms have largely
proven unsuccessful. The mechanism of
biofilm-associated antibiotic resistance is
uncertain and likely multifactorial. A number of
factors have been postulated, including binding
of antibiotic to the slime, poor penetration of
antibiotic into the biofilm, slow growth rate of
organisms in the biofilm, high bacterial density,
and changes in gene expression in biofilm
bacteria(1).
Vancomycin is the first-line agent for
MRSA and newer agents, such as linezolid,
daptomycin, and tigecycline, had been reserved
for patients who do not respond to or cannot
tolerate vancomycin therapy(17).
Antibiotic resistance in biofilm bacteria of
up to 1,000 times that of planktonic bacteria has
been extensively documented in experiments in
vitro(18). Thus, both systemic and topical
antibiotics alone are unable to eradicate biofilm
infections(19). Potential opportunities exist that
include prevention of bacterial attachment,
prevention of biofilm formation, disruption of
the biofilm to allow penetration of topical
antimicrobial agents, interference with quorum
sensing, and enhancement of bacteria dispersion
from biofilms to a more easily destroyed
planktonic state(20).
The aim of this study was to predict the
prevalence of MRSA and MRSA biofilm among
diabetic patients with diabetic foot ulcers and to
clarify risk factors related to this infections.
SUBJECTS & METHODS
Eighty two patients with infected diabetic
foot ulcers ( 54 males and 28 females) attending
an outpatient clinic of Zagazig University
hospitals on a weekly basis were included in
this study. Infection was diagnosed according to
74
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Biofilm production is considered; Non/weak
<0.120,
Moderately
0.120-0.240
and
High/Strong > 0.240.
Statistical analysis:
Statistical analysis was done using the
SPSS version 10.0. Data are represented as
Mean ± SD. Unpaired student t-test, fisher exact
probability test and chi-square test, were used
when appropriate. P<0.05 considered to be
statistically significant in all tests.
Amplification thermal program for MRSA
mecA andbiofilm icaA and D genes: PCR
cycling was carried out in PerkinElmer thermal
cycler 9700 as follow: an initial denaturing step
at 94°C for 5 minutes, followed by 40 cycles for
mecA and 50 cycles for icaA and D genes ,each
consists of three steps: 94°C for 30 seconds
(denaturation), 55.5°C for 30 seconds
(annealing), 72°C for 30 seconds for mecA and
1minute for icaA and D genes for (extension),
These were followed by a final extension step at
72ºC for 5 min.
Primers were supplied from (Jena Bioscience
GmbH, Germany) (table1).
The amplified products were mixed with gel
loading buffer and run on a 2% agarose gel in
Tris-borate buffer. DNA marker was used (50
bp, Promega, USA).
Detection of biofilm formation by tissue
culture plate method (TCP)(24)
Strains were subcultured in brain heart
infusion broth (Himedia lab.PVT.Ltd.India) at
37°C for 8 hours then plated on trypticase soy
agar plates. Isolates from fresh agar plates were
inoculated in trypticase soy broth with 1%
glucose and incubated for 24 hours at 37°C then
diluted (1 in 100) with fresh medium. Individual
wells of sterile, polystyrene, flat-bottom tissue
culture plates were filled with 0.2 ml aliquots of
the diluted cultures, and only broth served as
control to check sterility and non-specific
binding of media. The tissue culture plates were
incubated for 24 hours at 37°C.After incubation,
the content of each well was gently removed by
tapping the plates. The wells were washed four
times with 0.2 ml of phosphate buffer saline
(PBS pH 7.2) to remove free- floating
planktonic bacteria; then 25 ul of 1% solution of
crystal violet was added to each well (this dye
stains the cells but not the polystyrene) plates.
The plates were incubated at room temperature
for 15 minutes, rinsed thoroughly and
repeatedly with saline. Adherent cells, which
usually formed biofilm on all side wells, were
uniformly stained with crystal violet. Crystal
violet-stained biofilm was solubilized in 200 uL
of 95 % ethanol (to extract the violet color), of
which 125 ul were transferred to a new
polystyrene microtiter dish, then Optical
densities (OD) at wavelength 570 nm with
ethanol as blank were determined via Da Vinci
(bioMérieux, France) microplate reader ,as an
index of bacteria adhering to surface and
forming biofilms. According to (OD570 nm)
RESULTS
Eighty tow diabetic patients with infected
diabetic foot ulcers (54 males and 28 females;
67 with type II and 15 with type I diabetes)
were included in the study.
The mean age of the patients was (58.2 ±
11.5) years, the mean duration of diabetes was
(12.3± 4.3) years and the duration of ulcers
was(3.7± 1.8)months. Forty nine patients treated
with oral antidiabetic, twenty nine treated with
insulin and four take no treatment. Fifty five
were hypertensive, 36 had retinopathy,46 had
nephropathy,65 had neuropathy, 58 had
peripheral vascular disease and osteomyelitis
were present in 11 patients (table 2).
A total of 103 isolates were detected from
82 ulcer specimens,averaging1.3 species per
patient. The most frequent isolated organism
was 43(41.7%) staphylococcus aureus, 9(8.7%)
Pseudomonas aeruginosa, each of the coagulase
negative staphylococci, Klebseilla pneumoniae
and Enterobacter species 8(7.8%),E. coli
6(5.8%) , Proteus mirabilis and serratia
marcescens 3(2.9%),1(1%) Proteus vulgaris and
finally 14(13.6%) anaerobes (table 3 & Fig. 1).
Among the 43 staphylococcus aureus, 21
(48.8%) were (MRSA) and among them 11
(52.4%) were biofilm producers . Screening of
the extent of biofilm formation of the isolated
MRSA by tissue culture assay (TCP) revealed
that 7/11(63.6%) were strong adherent,2(18.2%)
were moderate adherent and 2(18.2%) were also
non/weak adherent (tables 4,5 & Figs. 2, 3).
Regarding the demographic and clinical
characteristics of patients with MRSA and non
MRSA infected diabetic foot ulcers, the risk for
MRSA isolation was significantly increase with
older age, longer duration of diabetes mellitus,
larger size of the ulcer as well as presence of
osteomyelitis (p≤0.05) (table6).
75
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (1): Oligonucleotide primers used for PCR of MRSA and MRSA biofilm.
Primer
Primer sequence(5`-3`)
Amplicon size(bP)
AAAATCGATGGTAAAGGTTGGC
mecA(25,26)
533
AGTTCTGCAGTACCGGATTTTGC
ACACTTGCTGGCGCAGTCAA
icaA(27,28)
188
TCTGGAACCAACATCCAACA
ATGGTCAAGCCCAGACAGAG
icaD(27,28)
198
AGTATTTTCAATGTTTAAAGCAA
Table (2): Demographic and clinical characteristics of the patients .
Characteristic
Age (Years)
Gender
Male /Female
Duration of diabetes mellitus (years)
Type of diabetes mellitus
Type I
Type II
Duration of the present ulcer(months)
Size of the ulcer(cm²)
Antidiabetic treatment
Oral antidiabetic
Insulin
None
Complications
Hypertension
Retinopathy
Nephropathy
Neuropathy
Peripheral vascular diasease
Osteomyelitis
Total number
58.2 ± 11.5
54/28
12.3± 4.3
15
67
3.7± 1.8
4.51±3.1
49
29
4
55
36
46
65
58
11
Table (3): Prevalence of different micro-organisms isolated from chronic diabetic foot ulcers.
Organisms isolated
No.
(%)
Aerobes
Staphylococci spp.
41.7
staphylococcus aureus
43
7.8
coagulase negative staphylococci
8
7.8
8
Klebseilla pneumoniae
5.8
6
E. coli
8.7
9
Pseudomonas aeruginosa
Proteus spp.
2.9
Proteus mirabilis
3
1
Proteus vulgaris
1
7.8
8
Enterobacter spp.
2.9
3
Serratia marcescens
13.6
14
Anaerobes
76
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
45
40
35
30
25
20
15
10
5
A n a e ro b e s
S e rra t ia
m a rc e s c e n s
E n t e ro b a c t e r
sp p
P ro t e u s
v u lg a ris
P ro t e u s
m ira b ilis
Pseu d o m o n as
a e ru g in o s a
E . c o li
K le b s e illa
p n e u m o n ia e
C o a g u la s e
n e g a t iv e
s t a p h y lo c o c
S t a p h y lo c o c c u s
a u re u s
0
Fig. (1): Prevalence of different micro-organisms isolated from chronic diabetic foot ulcers.
Table (4): Prevalence of MRSA and its biofilm among Staphylococcus aureus isolates.
Micro-organisms
Total
MRSA
MRSA biofilm
No (%)
No
%
No
%
Staphylococcus aureus
43(41.7%)
21/43
48.8
11/21
52.4
Table (5):
Screening of the extent of biofilm formation of the isolated MRSA by tissue culture assay
(TCP).
Biofilm formation(OD570 nm)
Number of
Micro-organisms
High(strong)
Moderate
Non/weak
isolates
No
%
No
%
No
%
MRSA biofilm
11
7
63.6
2
18.2
2
18.2
45
7
40
6
35
30
5
25
4
20
3
15
10
2
5
1
0
S. aureus
MRSA
MRSA
biofilm
Fig. (2): Prevalence of MRSA and its biofilm
among Staphylococcus aureus isolates.
0
High/strong
Moderate
Non/week
Fig. (3): Screening of the extent of biofilm
formation of the isolated MRSA by tissue culture
assay (TCP)
77
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (6):
Comparison between patients with MRSA and non MRSA infected diabetic foot ulcers as
regard demographic and clinical characteristics.
Characteristic
MRSA
Infections
Other
(No:21)
than MRSA
P
(No:61)
Age (Years)
62.3 ± 8.1
56.4±10.3
0.02*
Gender
Male /Female
15/6
29/32
0.08
Duration of diabetes mellitus (years)
15.1± 7.9
8.2±3.8
0.0001*
Type of diabetes mellitus
Type I
8
28
0.8
Type II
13
54
Duration of the present ulcer(months)
4.1± 2.2
3.5±1.6
0.2
5.8±3.5
3.9±2.1
0.004*
Size of the ulcer(cm²)
Antibiotic treatment (3 months ago)
17/21
61/82
0.3
Complications
Hypertension
13
42
0.5
Retinopathy
11
25
0.4
Nephropathy
11
35
0.8
Neuropathy
14
51
0.1
Peripheral vascular diasease
13
48
0.07
Osteomyelitis
6
5
0.03*
*Significant difference ≤ 0.05.
prevalence in such studies by the indiscriminate
use of broad spectrum antibiotics, resulting in a
pathogen-selective survival advantage. As a
result, many authors mentioned that the
Presence of MRSA in DFUs as colonizers or
pathogens(22,30,32) is problematic.
The ability to adhere and form biofilm on
host surfaces is considered to be an important
virulence factor in staphylococcus aureus.
Biofilm
formation,
mediated
by
a
polysaccharide intercellular adhesin (PIA) and
encoded by the ica operon(36).
Among MRSA isolates in this study,
biofilm ica A and D genes which detect
potential ability for biofilm formation was
present in 52.4% of the isolates. Nine of icaA/D
positive MRSA isolates (81.8%) elucidate
biofilm forming capacity by TCP method ,seven
of them (63.6%) were strong adherent, 2
(18.2%)were moderate and 2 (18.2%) were
non/weak adherent. These results were in
accordance with previous study by Yazdani et
al(12) who reported that high prevalence of the
icaA/D gene among S aureus isolates and Gad
et al(27) who reported that all biofilm producing
S aureus were positive for icaA/D gene.
Eftekhar& Dadaei(36) who reported that MRSA
biofilm from clinical isolates were 53.3% but
weak biofilm production was observed in 57.8%
of them ,that can be explained by variability of
the samples. Khan et al.(31) also, reported high
tendency of MRSA for biofilm formation.
DISCUSSION
Despite all preventive measures, it is well
known that patients with diabetes mellitus (DM)
complicating with foot ulcerations and these
infections create potentially a serious problem.
Therefore, it is very important to isolate the
causative microorganism for appropriate
treatment of the infected diabetic foot ulcers
(DFUs)(21,29).
Methicillin-resistant Staphylococcus aureus
(MRSA) has emerged as a serious and common
problem in patients with diabetic foot ulcers(9,30)
in addition to its high ability for biofilm
production(31).
In the present study, gram positive aerobic
bacteria were found to be the predominant
organisms causing diabetic foot infection and
staphylococcus aureus was the most frequent
isolated organism (41.7%). Detection of mecA
gene by PCR revealed that among the
staphylococcus aureus isolates, MRSA was high
prevalent strain (48.8%). Our results were
consistent with that reported in many
studies(7,9,22,32). Although few studies report
Gram negative aerobes to be the commonest
organisms in diabetic foot ulcers(33,34). The high
prevalence may be due to the fact that this
microorganism is a skin colonizer that becomes
opportunistic in immunocompromised people
such as diabetic patients(7). Zubair et al.(33) and
Hena & Growther(35) explained the high
78
Egyptian Journal of Medical Microbiology, January 2012
In the current study, Regarding the
demographic and clinical characteristics of
patients with MRSA and non MRSA infected
diabetic foot ulcers, the risk for MRSA isolation
was significantly increase with older age, longer
duration of diabetes mellitus, larger size of the
ulcer as well as presence of osteomyelitis
(p≤0.05) .These results were compatible with
many other reports(8,37,38).
MRSA
requires
targeted
antibiotic
treatment and its involvement is generally
considered to be associated with a poor
outcome(39,40) and chronicity(22,41,42), with
consideration of these sequelae and the
respectable percentage of MRSA biofilm, an
interesting concept to explain wound chronicity
as biofilms contribution has been proposed by
the deliberate release of planktonic bacteria
from biofilm which maintain an inflammatory
response in wounds(43,44).
In conclusion, considering the frequent
isolation of MRSA and its biofilm from infected
diabetic foot ulcers, and as regard the difference
in the line of treatment between both types of
infection , caution must be taken when
treatment is prescribed.
Screening for MRSA biofilm production in
infected diabetic foot ulcers is necessary,
especially in patients with chronic ulcers and
before the beginning of treatment. Rapid
diagnosis and treatment of MRSA is important,
because biofilm formation may lead to
increased antimicrobial resistance and create a
significant impediment to wound healing.
5.
6.
7.
8.
9.
10.
11.
12.
REFERENCES
1.
2.
3.
4.
Abd El-Aziz A, El-Banna T, Abo-Kamar
A, et al. In vitro and in vivo Activity of
some Antibiotics against Staphylococcal
Biofilm and Planktonic Cells Isolated from
Diabetic Foot Infections. Journal of
American Science 2010;6(12):760-770.
Lau TW, Sahota DS, Lau CH, et al. An in
vivo Investigation on the Wound-Healing
Effect of two Medicinal Herbs Using an
Animal Model with Foot Ulcer Eur Surg
Res 2008;41:15-23.
Lima AF, Costa LB, da Silva JL, et al.
Interventions for wound healing among
diabetic
patients
infected
with
Staphylococcus aureus: a systematic
review. Sao Paulo Med J 2011; 129(3):16570.
Leinonen H, Matikainen E, Juntunen J.
Permeability and morphology of skeletal
muscle capillaries in type 1 (insulin-
13.
14.
15.
16.
17.
79
Vol. 21, No. 1
dependent) diabetes mellitus. Diabetologia
1982;22(3): 158-62.
Parkhouse N, Le Quesne PM. Impaired
neurogenic vascular response in patients
with diabetes and neuropathic foot lesions.
N Engl J Med 1988;318(20):1306-9.
Kandemir O, Akbay E, Sahin E, et al.
Risk factors of infection of the diabetic foot
with
multi-antibiotic
resistant
microorganisms .J infect 2007; 54: 439445.
Richard JL, Sotto A, Jourdan N, et al. Risk
factors and healing impact of multidrugresistant bacteria in diabetic foot ulcers.
Diabetes Metab 2008; 34 : 363-369.
Wang S, Yuan Y, Sun Z, et al. Meticillinresistant Staphylococcus aureus isolated
from foot ulcers in diabetic patients in a
Chinese care hospital: risk factors for
infection and prevalence. J Med Microbiol
2010; 59: 1219–1224.
Game F and Jeffcoate W. MRSA and
osteomyelitis of the foot in diabetes. Diabet
Med 2004; 21:16–19.
Takeuchi ST, Hashimoto N, Imaizum
IK,et al. Variation of the agr locus in
Staphylococcus aureus isolates from cows
with mastitis. Vet Microbiol 2001;79: 26774.
Cucarella C, Torlma MA, Ubeda C, et al.
Role of biofilm- associated protein Bap in
the pathogenesis of bovine Staphylococcus
aureus. Infect Immun 2004;72: 2177- 85.
Yazdani R,Oshaghi M,Havayi A,et al.
Detection of icaAD Gene and Biofilm
Formation inStaphylococcus aureus Isolates
from Wound Infections. Iranian J Publ
Health 2006;. 35( 2): 25-28.
Gotz F . Staphylococcus and biofilms. Mol
Microbiol 2002 43:1367-78.
Costerton JW, Stewart PS, Greenberg
EP. Bacterial biofilms: a common cause of
persistent infections. Science 1999;284:
1318-22.
O’Gara
JP,
Humphreys
H.
Staphylococcus
epidermidis
biofilms
importance and implications. H Med
Microboil 2001 50: 582-87.
Arciola CR, Baldassari L, Montanaro L.
Presence of icaA and icaD genes and slime
prodction in a collection of Staphylococcal
strains from catheter-associated infections.
J Clin Microbiol 2001; 39: 2151–56.
Breen GO. Skin and Soft Tissue Infections
in Immunocompetent Patients.Am Fam
Physician 2010;81(7):893-899.
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
29. Joseph WS, Lipsky BA. Medical therapy
of diabetic foot infections. J Am Podiatr
Med Assoc 2010;100:395-400.
30. Tentolouris N, Jude E, Smirnof I, et al.
Methicillin-resistant
Staphylococcus
aureus: an increasing problem in a diabetic
foot clinic. Diabet Med 1999; 16: 767–771.
31. Khan F, Shukla I, Rizvi M, et al.
Detection of Biofilm Formation in
Staphylococcus aureus. Does it have a role
in Treatment of MRSA Infections?. Trends
in Medical Research 2011; 6 (2): 116-123.
32. Dang C N, Prasad YD, Boulton AJ ,et al.
Methicillin-resistant Staphylococcus aureus
in the diabetic foot clinic: a worsening
problem. Diabet Med 2003 ;20:159-161.
33. Pappu AK, Sinha A, Johnson A, et al.
Microbiological profile of Diabetic Foot
Ulcer. Calicut Medical Journal
2011;
9(3):e2
34. Zubair M, Malik A, Ahmad J. Clinicomicrobiological study and antimicrobial
drug resistance profile of diabetic foot
infections in North India. Foot (Edinb)
2011;21(1):6–14.
35. Hena JV, Growther L. Studies on
bacterial infections of diabetic foot ulcer.
Afr J Cln Exper Microbiol 2010;11(3): 146149.
36. Eftekhar F, Dadaei T. Biofilm Formation
and Detection of IcaAB Genes in Clinical
Isolates
of
Methicillin
Resistant
Staphylococcus aureus .Iranian Journal of
Basic Medical Sciences 2011;14(2):132136.
37. Eleftheriadou I, Tentolouris N, Argiana
V,
et
al.
Methicillin-resistant
Staphylococcus aureus in diabetic foot
infections. Drugs 2010 Oct 1;70(14):178597.
38. Murugan S, Mani KR, Uma Devi P.
Prevalence of Methicillin Resistant
Staphylococcus Aureus among Diabetes
Patients with Foot Ulcers and their
Antimicrobial
Susceptibility
Pattern.
Journal of Clinical and Diagnostic Research
2008 ; 14(2): 979-984.
39. Mantey I , Hill RL, Foster AV, et al.
Infection
of
foot
ulcers
with
Staphylococcus aureus associated with
increased mortality in diabetic patients.
Commun Dis Public Health 2000; 3 : 288290.
40. Wagner A, Reike H, Angelkort B. Highly
resistant pathogens in patients with diabetic
foot syndrome with special reference to
methicillin-resistant Staphylococcus aureus
18. Stewart P S, Costerton J W. Antibiotic
resistance of bacteria in biofilms. Lancet
2001; 358: 135-8.
19. Neut D,Tijdens-Creusen E, Bulstra Sk, et
al. Biofilms in chronic diabetic foot
ulcers—a study of 2 cases. Acta
Orthopaedica 2011; 82 (3): 383–385.
20. Davis SC, Martinez L, Kirsner R. The
diabetic foot: the importance of biofilms
and wound bed preparation. Curr Diab Rep
2006;6(6):439-45.
21. Lipsky BA, Berendt AR, Embil J, et al.
Diagnosing and treating diabetic foot
infections. Diabetes Metab Res Rev 2004;
20(suppl 1): 56–64.
22. Tentolouris N, Petrikkos G, Vallianou N,
et al. Prevalence of methicillin-resistant
Staphylococcus aureus in infected and
uninfected diabetic foot ulcers. Clin
Microbiol Infect 2006; 12: 186–189
23. National Institute for health and clinical
excellence. NICE clinical guideline119:
inpatient management of diabetic foot
problems.London: National Institute for
health and clinical excellence;2011.
24. Christensen GD, Simpson WA, Younger
JA, et al. Adherence of coagulase negative
Staphylococci to plastic tissue cultures: a
quantitative model for the adherence of
staphylococci to medical devices. J Clin
Microbiol 1985;22: 996-1006.
25. Del Vecchio VG, Petroziello JM, Gress
MJ, et al. Molecular genotyping of
methicillin resistant Staphylococcus aureus
via
fluorophore-enhanced
repetitive
sequence PCR. J Clin Microbiol 1995; 33:
2141-4.
26. Murakami K, Minamide W, Wada K, et
al. Identification of methicillin-resistant
strains of Staphylococci by polymerase
chain reaction. J Clin Microbiol 1991; 29:
2240-44.
27. Gad GF, El-Feky MA, El-Rehewy MS,et
al. Detection of icaA, icaD genes and
biofilm production by Staphylococcus
aureus and Staphylococcus epidermidis
isolated from urinary tract catheterized
patients. J Infect Dev Ctries 2009;
3(5):342-351.
28. Mariana NS, Salman SA, Neela V, et al.
Evaluation of modified Congo red agar for
detection of biofilm produced by clinical
isolates
of
methicillin–resistance
Staphylococcus aureus. African Journal of
Microbiology Research 2009; 3(6) : 330338 .
80
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫;‪infections. Dtsch Med Wochenschr 2001‬‬
‫‪126: 1353-1356‬‬
‫‪41. Dissemont J, Korber A, Lehnen M, et al.‬‬
‫‪Methicillin resistant Staphylococcus aureus‬‬
‫‪(MRSA) in chronic wounds: therapeutic‬‬
‫‪options and perspectives. J Dermatol Ges‬‬
‫‪2005;3:25662.‬‬
‫‪42. Melzer M, Eykyn S, Gransden W, et al.‬‬
‫‪Is methicillin resistant Staphylococcus‬‬
‫‪aureus more virulent than methicillin‬‬
‫‪susceptible S. aureus? Clin Infect‬‬
‫‪Dis.2003;37:1453–1460.‬‬
‫‪43. Ngo Q, Vickery K, Deva AK. Role of‬‬
‫‪bacterial biofilms in chronic wounds. ANZ‬‬
‫‪J Surg 2007;77(suppl 1): A66.‬‬
‫‪44. Wolcott RD, Rhoads DD, Dowd SE.‬‬
‫‪Biofilms and chronic wound inflammation.‬‬
‫‪J Wound Care 2008;17(8): 333–41.‬‬
‫اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔاﻟﻤﻘﺎوﻣﻪ ﻟﻠﻤﺜﻴﺴﻠﻴﻦ وﻏﺸﺎؤهﺎ اﻟﺤﻴﻮى ﻓﻰ ﺗﻘﺮﺣﺎت اﻟﻘﺪم اﻟﺴﻜﺮى‬
‫ﻣﻘﺪﻣ ﺔ‪ :‬ﺑ ﺮزت اﻟﻤﻜ ﻮرات اﻟﻌﻨﻘﻮدﻳ ﺔ اﻟﺬهﺒﻴ ﺔ اﻟﻤﻘﺎوﻣ ﻪ ﻟﻠﻤﺜﻴ ﺴﻠﻴﻦ آﻤ ﺸﻜﻠﺔ ﺧﻄﻴ ﺮة ﺗﺤ ﺪث ﻋ ﺎدة ﻓ ﻲ اﻟﻤﺮﺿ ﻰ اﻟﻤ ﺼﺎﺑﻴﻦ ﺑﺘﻘﺮﺣ ﺎت اﻟﻘ ﺪم‬
‫اﻟﺴﻜﺮي ‪.‬ﻓﺈن ﻗﺪرﺗﻬﺎ ﻋﻠﻰ ﺗﻜﻮﻳﻦ اﻷﻏﺸﻴﺔ اﻟﺤﻴﻮﻳﺔ ﺗﺴﺎﻋﺪ اﻟﺒﻜﺘﻴﺮﻳﺎ ﻋﻠﻰ اﻟﺒﻘﺎء ﻋﻠﻰ ﻗﻴﺪ اﻟﺤﻴﺎة داﺧ ﻞ ﺑﻴﺌ ﺔ اﻟﻌﺎﺋ ﻞ اﻟﻤ ﻀﻴﻒ‪ ،‬وﺗﻌﺘﺒ ﺮ ﻣ ﺴﺆوﻟﻪ‬
‫ﻋﻦ اﻹﻟﺘﻬﺎﺑﺎت اﻟﻤﺰﻣﻨﺔ أو اﻟﻤﺴﺘﻤﺮة‪.‬‬
‫اﻟﻬﺪف ﻣﻦ اﻟﺒﺤﺚ‪ :‬ﺗﻮﻗﻊ واﻟﺘﻨﺒﺆ ﺑﻤﺪى إﻧﺘﺸﺎر اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ اﻟﻤﻘﺎوﻣﻪ ﻟﻠﻤﺜﻴﺴﻠﻴﻦ ‪ ،‬وآﺬﻟﻚ ﻗﺪرﺗﻬﺎ ﻋﻠ ﻰ ﺗ ﺸﻜﻴﻞ اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮى‬
‫ﺑﻴﻦ اﻟﻤﺮﺿﻰ اﻟﺬﻳﻦ ﻳﻌﺎﻧﻮن ﻣﻦ ﺗﻘﺮﺣﺎت اﻟﻘﺪم اﻟﺴﻜﺮي وﺗﻮﺿﻴﺢ ﻋﻮاﻣﻞ اﻟﺨﻄﺮ اﻟﻤﺤﺘﻤﻠﺔ اﻟﻤﺘﻌﻠﻘﺔ ﺑﻬﺬا اﻟﻤﺮض‪.‬‬
‫اﻷﺷﺨﺎص واﻟﻮﺳﺎﺋﻞ ‪ :‬ﺷﻤﻠﺖ هﺬﻩ اﻟﺪراﺳﺔ إﺛﻨﺎن و ﺛﻤﺎﻧﻮن ﻣﻦ اﻟﻤﺮﺿﻰ اﻟﻤﺼﺎﺑﻴﻦ ﺑﺘﻘﺮﺣﺎت اﻟﻘﺪم اﻟﺴﻜﺮي ﻣﻊ اﻟﻌ ﺪوى‪ .‬وﻗ ﺪ ﺗ ﻢ ﻋﻤ ﻞ اﻵﺗ ﻰ‬
‫ﻟﻠﻌﻴﻨﺎت اﻟﻤﺄﺧﻮذﻩ ﻣﻦ اﻟﻘﺮح‪:‬‬
‫‪ .١‬ﻣﺰارع هﻮاﺋﻴﻪ ﻣﺒﺎﺷﺮة ﻋﻠﻰ ﻣﺎآﻮﻧﻜﻲ ﺁﺟﺎر وﺁﺟﺎراﻟﺪم وﻣﺎﻧﻴﺘﻮل ﺁﺟﺎر اﻟﻤﻠﺢ‪.‬‬
‫‪ .٢‬ﺗﻢ زراﻋﺘﻬﺎ ﻻهﻮاﺋﻴﺎ ﻋﻠﻰ وﺳﺎﺋﻂ ﺟﻰ إن وإن إس‪.‬‬
‫‪ .٣‬ﺗ ﻢ إﺧﺘﺒﺎراﻟﻤ ﺴﺘﻌﻤﺮات اﻟﺘ ﻰ ﻇﻬ ﺮت ﻋﻠ ﻰ اﻟﻤ ﺰارع ﻇﺎهﺮﻳ ﺎ واﻟﺘﻌ ﺮف ﻋﻠ ﻰ اﻟﻤﻴﻜﺮوﺑ ﺎت اﻟﻤﺨﺘﻠﻔ ﺔ ﻋ ﻦ ﻃﺮﻳ ﻖ ﺻ ﺒﻐﺔ اﻟﺠ ﺮام‬
‫واﻹﺧﺘﺒﺎرات اﻟﺒﻴﻮآﻴﻤﻴﺎﺋﻴﺔ اﻟﻤﺘﺎﺣﺔ‪.‬‬
‫‪ .٤‬ﺗﻢ ﻋﻤﻞ إﺧﺘﺒﺎر اﻟﺘﺨﺜﺮ و اﻟﻜﺎﺗﻼز وﻧﻈﺎم إﻳﻪ ﺑﻰ ﺁى ﻟﺘﺤﺪﻳﺪ هﻮﻳﺔ اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ ‪.‬‬
‫‪ .٥‬ﺗﻢ ﻓﺤﺺ ﺟﻤﻴﻊ ﻋﺰﻻت اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ ﺑﻮاﺳﻄﺔ ﺗﻔﺎﻋﻞ اﻟﺒﻠﻤﺮة اﻟﻤﺘﺴﻠﺴﻞ ﻹآﺘﺸﺎف ﺟﻴﻦ )ﻣﻚ إﻳﻪ( ﻟﺘﺤﺪﻳﺪ اﻟﻤﻜﻮرات‬
‫اﻟﻤﻘﺎوﻣﻪ ﻟﻠﻤﺜﻴﺴﻠﻴﻦ ‪.‬‬
‫‪ .٦‬دراﺳ ﺔ ﻗ ﺪرة ه ﺬﻩ اﻟ ﺴﻼﻻت ﻋﻠ ﻰ إﻧﺘ ﺎج اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮى ﻋ ﻦ ﻃﺮﻳ ﻖ ﺗﻔﺎﻋ ﻞ اﻟﺒﻠﻤ ﺮة اﻟﻤﺘﺴﻠ ﺴﻞ ﻹآﺘ ﺸﺎف ﺟﻴﻨ ﻰ )إﻳﻜ ﺎ إﻳ ﻪ و دى(‬
‫وﺑﻄﺮﻳﻘﺔ ﻟﻮﺣﺎت زراﻋﺔ اﻷﻧﺴﺠﺔ اﻟﻜﻤﻴﻪ‪.‬‬
‫اﻟﻨﺘﺎﺋﺞ‪ :‬ﻣﻦ أﺻﻞ ‪ ٨٢‬إﺻﺎﺑﺔ ﺑﻘﺮﺣﺔ ﻗﺪم ﺳﻜﺮى ﺗﻢ ﻋﺰل ‪ ١٠٣‬ﻣﻴﻜﺮوب ﺑﻮاﻗ ﻊ ‪ ١.٣‬ﻟﻜ ﻞ ﻣ ﺮﻳﺾ ‪ .‬آﺎﻧ ﺖ اﻟﻤﻜ ﻮرات اﻟﻌﻨﻘﻮدﻳ ﺔ اﻟﺬهﺒﻴ ﺔ ‪٤٣‬‬
‫)‪ (٪٤١.٧‬هﻰ اﻷآﺜﺮ ﻋﺰﻻ‪ .‬آﺎن ﻣﻦ ﺑ ﻴﻦ اﻟﻤﻜ ﻮرات اﻟﻌﻨﻘﻮدﻳ ﺔ اﻟﺬهﺒﻴ ﺔ اﻟ ﺜﻼث وأرﺑﻌ ﻮن‪ (٪٤٨.٨) ٢١ ،‬ﻣ ﻦ اﻟﻤﻜ ﻮرات اﻟﻌﻨﻘﻮدﻳ ﺔ اﻟﺬهﺒﻴ ﺔ‬
‫اﻟﻤﻘﺎوﻣﻪ ﻟﻠﻤﺜﻴﺴﻠﻴﻦ ﻣﻦ ﺑﻴﻨﻬﻢ ‪ (٪٥٢.٤) ١١‬ﻳﺤﻤﻠﻮن اﻟﺠﻴﻦ )إﻳﻜﺎ إﻳﻪ و دى( اﻟﻤﺆﺷﺮﻹﻣﻜﺎﻧﻴﺔ إﻧﺘﺎج اﻟﻐﺸﺎء اﻟﺤﻴﻮى‪ .‬ﺑﻔﺤﺺ ﻣﺪى ﻗﺪرﺗﻬﻢ ﻋﻠﻰ‬
‫إﻧﺘ ﺎج اﻟﻐ ﺸﺎء اﻟﺤﻴ ﻮى ﺑﻮاﺳ ﻄﺔ ﻟﻮﺣ ﺎت زراﻋ ﺔ اﻷﻧ ﺴﺠﺔ اﻟﻜﻤﻴ ﻪ وﺟ ﺪ أن‪ (٪٦٣.٦) ١١/٧‬آﺎﻧ ﺖ ﻗﻮﻳ ﺔ اﻹﻟﺘ ﺼﺎق و ‪ (٪١٨.٢)١١/ ٢‬آﺎﻧ ﺖ‬
‫ﻣﺘﻮﺳﻄﺔ و ‪ (٪١٨.٢)١١/ ٢‬آﺎﻧﺖ ﻏﻴﺮﻣﻠﺘﺼﻘﺔ ‪ /‬ﺿﻌﻴﻒ‪ .‬ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﻌﻮاﻣﻞ اﻟﺨﻄ ﺮ ﻟﻠﻤﺮﺿ ﻰ واﻟﻤﺘﻌﻠﻘ ﻪ ﺑﻬ ﺬﻩ اﻟﻌ ﺪوى‪ ،‬ﻓﻘ ﺪ زاد ﻋ ﺰل ه ﺬﻩ‬
‫اﻟﺒﻜﺘﺮﻳ ﺎ ﻓ ﻲ آﺒ ﺎر اﻟ ﺴﻦ وﻣ ﻊ زﻳ ﺎدة ﻣ ﺪة اﻹﺻ ﺎﺑﻪ ﺑﺎﻟ ﺴﻜﺮى وﻣ ﻊ زﻳ ﺎدة ﺣﺠ ﻢ اﻟﻘﺮﺣ ﺔ ﻓ ﻀﻼ ﻋ ﻦ وﺟ ﻮد إﻟﺘﻬ ﺎب اﻟﻌﻈ ﻢ ﺣﻴ ﺚ آﺎﻧ ﺖ اﻟﺪﻻﻟ ﻪ‬
‫اﻹﺣﺼﺎﺋﻴﺔ أﻗﻞ ﻣﻦ‪.٠.٠٥‬‬
‫اﻟﺨﻼﺻ ﺔ‪ :‬إرﺗﻔ ﺎع ﻧ ﺴﺒﺔ اﻹﺻ ﺎﺑﻪ ﺑ ﺎﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳ ﺔ اﻟﺬهﺒﻴ ﺔ اﻟﻤﻘﺎوﻣ ﻪ ﻟﻠﻤﺜﻴ ﺴﻠﻴﻦ وﻏ ﺸﺎؤهﺎ اﻟﺤﻴ ﻮى ﻓ ﻰ ﺗﻘﺮﺣ ﺎت اﻟﻘ ﺪم اﻟ ﺴﻜﺮي ‪ .‬ﻧﻈ ﺮا‬
‫ﻹﺧﺘﻼف ﻃﺮق اﻟﻌﻼج ﺑﻴﻦ آﻼ ﻣﻦ اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ اﻟﻤﻘﺎوﻣﻪ ﻟﻠﻤﺜﻴﺴﻠﻴﻦ وﺑ ﻴﻦ ﻏ ﺸﺎؤهﺎ اﻟﺤﻴ ﻮى ﻓ ﺈن اﻟﺘ ﺸﺨﻴﺺ واﻟﻌ ﻼج اﻟ ﺴﺮﻳﻊ‬
‫ﻟﻬ ﺬﻩ اﻟﺒﻜﺘﺮﻳ ﺎ ﻣﻬ ﻢ ‪،‬و ﻓﺤ ﺺ إﻧﺘ ﺎج اﻟﻤﻜ ﻮرات اﻟﻌﻨﻘﻮدﻳ ﺔ اﻟﺬهﺒﻴ ﺔ اﻟﻤﻘﺎوﻣ ﻪ ﻟﻠﻤﺜﻴ ﺴﻠﻴﻦ ﻟﻠﻐ ﺸﺎء اﻟﺤﻴ ﻮى ﻓ ﻲ إﺻ ﺎﺑﺎت ﺗﻘﺮﺣ ﺎت اﻟﻘ ﺪم اﻟ ﺴﻜﺮي‬
‫ﺿﺮورى‪.‬‬
‫‪81‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Plasma Transforming Growth Factor β1 level in Asthmatic Children
Mervat S. Mohamed1, Khalid M Salah 2, Dina M Shokry2 , Ahmed A Halaby 2
Microbiology &s Immunology1 and Pediatrics 2 Departments
Faculty of Medicine, Zagazig University
ABSTRACT
Airway remodeling is a characteristic feature of asthma. The mechanism of this remodeling is thought to involve
Transforming growth factor - β1 (TGF-β1). We compare plasma level of TGF-β1 among asthmatic patients and
healthy children and to evaluate these levels with atopic status. 50 asthmatic patients divided into: 30 asthmatics
in between attack and 20 during attack . As regard to atopy they were subdivided into: atopic during and in
between attack and non-atopic during and in between attack. Group II (Control group): this group included 20
healthy volunteers. All subjects were subjected to history taking, chest X-ray, CBC, intra-dermal skin tests, serum
level of total IgE and determination of plasma TGF-β1. There was statistical significant difference between
asthmatics and control group, also between asthmatics inbetween attack and control group as regard the mean
total leucocytic count. Regarding the mean eosinophilic count, there was extremely statistical significant
difference between asthmatics (during and in between attack) with control group, there was statistical significant
difference between asthmatic patients inbetween attack and during attack. Regarding the mean neutrophil count
there was statistical significant difference in asthmatics compared to the control group, there was no statistical
significant difference between asthmatics inbetween attack and asthmatics during attack. Regarding to serum
level of total IgE, there was statistical significant difference between both asthmatic group and the control group.
But no statistical significant difference between asthmatic patients inbetween attack and during attack. Regarding
plasma level of TGF β1, there was significant difference between asthmatic group and the control group, also
between asthmatics during and inbetween attack. The most risky offending allergen was mixed pollens (71.4%),
followed by hay dust (61.9%), smoke (57.1%), house dust (47.6%), mixed fungi (38%), cotton (28.5%), wool
(19%) and lastly, human hair (9.5%). There was statistical significant difference as regard the mean total
leucocytic and neutrophil count in non- atopic patients compared to atopic patient. Statistical significant
difference as regard the mean serum level of total IgE in atopic patients in between attack compared to the other
groups. There was also statistical significant difference between both groups of atopic patient, also both groups
of non-atopic as regard to serum total IgE. As regard the mean level of plasma TGF β1, there was statistical
significant difference in non-atopic asthmatic patients inbetween attack compared to other groups. There was
also statistical significant difference between both groups of atopic and both group of non-atopic patients. This
study concludes that patients with non atopic asthma have elevated plasma TGFβ1 levels that may reflect a postinfective phenomenon that serves to down-regulate the host immune response
lymphocytes that are able to produce
proinflammatory cytokines and chemokines. The
selective accumulation of immune cells and
associated cytokines is considered a central event in
the pathogenesis of allergic asthma4. Since
production of Th2 cytokines is highly associated
with allergic asthma, it is rational to deduce that
nonallergic individuals may be associated either with
a failure to recognize the allergen or the
suppression of Th2 responses 5.
High level of IgE are associated with asthma in
both adults and children 6. IgE has been associated
with allergic diseases and asthma . The studies of the
effects of anti-IgE therapy have confirmed that it
plays a role in these diseases7. Transforming growth
factor- β1 (TGF-β1) is a multifunctional cytokine
that has been implicated in the pathogenesis of
asthma. TGF-β1 is important in growth,
development, transformation, tissue repair, fibrosis
INTRODUCTION
Asthma is a chronic disease of the airways that
affects people all over the world. Prevalence has
increased over recent years, especially in children
and young people, in associations^ with atopy
rather than an increased recognition of the
disease1. Approximately 10% of the population
are affected, though there is variation between
countries, and it is estimated that 1-2% of the
total health care expenditure for developed
countries is asthma related 2.
Asthma is characterized by persistent
inflammation and remodeling of the airways with
associated bronchial hyperactivity in response to
one or more allergens, resulting in episodic
obstruction of airflow 3. Asthmatic airway tissues
have increased immune cells including
basophiles, mast cells, eosinophiles, and T
83
Egyptian Journal of Medical Microbiology, January 2012
and modulation of inflammatory immune
responses and has a critical role in the remodeling
process8. TGF-β1 is expressed by airway
epithelial cells, eosinophils, helper T type2
lymphocytes, macrophage, and fibroblast and may
be bound and stored in the subepithelial extracellular
matrix of the airways 9.
The aim of this work was to compare plasma
level of TGF-β1 among asthmatic patients and
healthy children and to evaluate these levels with
atopic status.
Vol. 21, No. 1
after insertion of the 21-gauge needle for
venipuncture 11. Then blood sample were collected
in sterile EDTA containing tube , were centrifuged
for separation of the plasma for 20 minutes at 4000
xg's (≈ 6500 rpm) at 4°C using cold centrifuge and
kept frozen at -70°C.
The Assay was performed after acidification
and neutralization of plasma according to the
manufacturer's instructions. The absorbance at 450
nm is measured with a microtiter plat reader, the
intensity of color development is proportional to the
TGF-β1 concentration in the sample. Standard curve was
constructed and Plasma TGF-β1 was estimated.
Sensitivity of the kit was 1.9 pg/mL
PATIENTS, MATERIALS &
METHODS
RESULTS
This study was carried out at the Allergy
and Immunology Unit of Microbiology and
Immunology Department, and Pediatric
Pulmonology Unit; Faculty of Medicine,
Zagazig University during the period from
September 2008 to March 2010. This study
included 70 subjects that were divided into two
groups: Group I (Patient group): 50 asthmatic
patients divided into: 30 asthmatics in between
attack (17 males and 13 females with the mean
age 6.68 Y ± 2.66) and 20 during attack (12
males and 8 females with the mean age 7.45 Y ±
2.26). As regard to atopy they were subdivided
into: atopic during and in between attack and
non-atopic during and in between attack. Their
ages ranged from 2 to 12 years. Group II
(Control group): this group included 20 healthy
volunteers. The controls were 11males and 9
females of the same age. All subjects included
in this study were subjected to the following:
history taking, chest X-ray, CBC, intra-dermal
skin tests, serum level of total IgE and
determination of plasma TGF-β1.
The Skin Intradermal Test was done using
house dust, human hair, smoke, cotton, wool,
mixed fungus (Aspergellus niger, Aspergellus
Flavus, Aspergellus fumigatus), mixed pollens
and hay dust 10.
Determination of Serum Total IgE Level by
ELISA: (Monobind Inc. Lack forest, CA 92630,
USA). According to manufacturer instructions it
was read at 450 nm. The concentration of total
serum IgE was calculated corresponding to the
absorbance from standard curve.
Determination of Plasma level of TGF-β1 by
using DRG TGF-β1 ELISA (DRG instruments
GmbH, Frauenbergstr.18, D35039 Marburg,
Germany). Venous blood sample were taken under
complete aseptic conditions. To minimize platelet
degranulation and subsequent false increase in the
level of the estimated plasma TGF-β1, a tourniquet
was applied only when necessary and was removed
As shown in table (1) there was statistical
significant difference between asthmatics and
control group, also between asthmatics
inbetween attack and control group as regard the
mean total leucocytic count. Regarding the
mean eosinophilic count, there was extremely
statistical significant difference between
asthmatics (during and inbetween attack) with
control group, there was statistical significant
difference between asthmatic patients inbetween
attack and during attack. Regarding the mean
neutrophil count there was statistical significant
difference in asthmatics compared to the control
group, there was no statistical significant
difference between asthmatics inbetween attack
and asthmatics during attack.
Regarding to serum level of total IgE, as
shown in table (2) there was statistical
significant difference between both asthmatic
group and the control. But no statistical
significant difference between asthmatic
patients inbetween attack and during attack.
Regarding plasma level of TGF β1, there was
significant difference between asthmatic group
and the control group, also between asthmatics
during and inbetween attack. The most risky
offending allergen was mixed pollens (71.4%),
followed by hay dust (61.9%), smoke (57.1%),
house dust (47.6%), mixed fungi (38%), cotton
(28.5%), wool (19%) and lastly, human hair
(9.5%).
There was statistical significant difference
as regard the mean total leucocytic and
neutrophil count in non- atopic patients
compared to atopic patient. Statistical
significant difference as regard the mean serum
level of total IgE in atopic patients in between
attack compared to the other groups . There was
statistical significant difference between both
groups of atopic patient, also both groups of
non-atopic (Table 3,4). As regard the mean level
84
Egyptian Journal of Medical Microbiology, January 2012
of plasma TGF β1,there was statistical
significant difference in non-atopic asthmatic
patients inbetween attack compared to other
Vol. 21, No. 1
groups. There was also statistical significant
difference between both groups of atopic and
both groups of non-atopic (Table 5).
Table (1): Mean Total leucocytic count, absolute eosinophil count , absolute neutrophil count and
multiple comparisons showing least significant different among groups.
Asthmatic
group
During
attack
(n=20)
In
between
attack
(n=30)
Control
group
(n=20)
F
P
Total leucocytic count
Mean
± SD
Control
group
7.56 ±
1.47
0.093
7.82 ±
1.61
0.015*
Asthmatics
during
attack
0.52
Absolute eosinophil count (109/L)
Mean ±
SD
Control
group
43.8 ±
5.58
0.000***
40.9 ±
4.53
0.000***
6.8 ±
0.93
11.7±
3.97
3.21
0.047*
299.2
0.000***
Asthmatics
during
attack
0.039*
Absolute neutrophil count
/cmm
Mean
± SD
3822.0
±
754.14
3686.4
±
504.99
Control
group
Asthmatics
during
attack
0.017*
0.435
0.061
3357.9
±
551.86
3.23
0.046*
Table (2): Mean Serum level of total IgE , TGF β1 and multiple comparisons showing least
significant different among groups.
Serum level of total IgE (kU/L)
Plasma level of TGF β1 (pg/mL)
Asthmatic
Asthmatics
Asthmatics
Control
Control
group
Mean ± SD
Mean ± SD
during
during
group
group
attack
attack
During attack
290.11 ± 96.41
0.000***
3.90 ± 0.85
0.046*
(n=20)
In between
272.61 ± 93.24
0.000***
0.738
6.85 ± 3.42 0.000***
0.000***
attack (n=30)
Control group
2.40 ± 0.73
25.82 ± 9.93
(n=20)
F
14.23
23.7
P
0.000***
0.000***
Table (3): Mean TLC, absolute eosinophil , absolute neutrophil counts and mean total IgE , TGF β1
among different groups according to atopy.
Mean ± SD of
Mean ± SD of
Absolute
eosinophil
count (109/l)
Absolute
neutrophil count
/cmm
6.01 ± 0.99
6.17 ± 0.85
45.0 ± 5.71
40.1 ± 4.09
3052.0 ± 290.28
3320.46 ± 554.41
139.72 ± 42.58
508.83 ± 17.16
4.81 ± 0.25
3.96 ± 0.66
8.59 ± 0.48
9.08 ± 0.5
6.80 ± 0.93
44.58
0.000***
43.0 ± 5.59
41.5 ± 4.87
11.7 ± 3.97
148.81
0.000***
4337.9 ± 458.32
3966.23 ± 199.22
3357.9 ± 551.86
16.6
0.000***
390.36 ± 133.12
91.96 ± 25.51
25.82 ± 9.93
68.61
0.000***
3.29 ± 0.45
9.05 ± 2.98
2.40 ± 0.73
46.49
0.000***
Total
leucocytic
count
Atopic*
During attack(8)
In between attack(13)
Non-atopic
During attack(12)
In between attack(17)
Control group(20)
F
P
85
Total IgE
(kU/L)
TGF β1
(pg/mL)
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table (4): Multiple comparisons showing least significant different among different groups
regarding total IgE.
Atopic
Non-atopic
In
During
Control
In between
During
between
attack(8)
attack(13)
attack(12)
attack(17)
Atopic*
During attack(8)
0.006**
0.000***
0.000***
0.248
In between attack(13)
0.000***
0.000***
0.003**
0.000***
Non-atopic
During attack(12)
0.000***
0.000***
0.003**
0.000***
In between attack(17)
0.040*
0.248
0.000***
0.000***
Table (5): Multiple comparisons showing least significant different among different groups
regarding plasma TGF β1 level.
Atopic
Non-atopic
Control
During
In between
During
In between
attack (8)
attack(13)
attack(12)
attack(17)
Atopic*
During attack(8)
0.000***
0.233
0.038*
0.000***
In between attack(13)
0.007**
0.233
0.291
0.000***
Non-atopic
During attack(12)
0.125
0.038*
0.291
0.000***
In between attack(17)
0.000***
0.000***
0.000***
0.000***
chronic asthma, thus pointing toward a proinflammatory role for this cytokine 16.
In our study there was increased total
leucocytic count (TLC) in asthmatics during
and in between attack compared to the control
group with their mean 7.56 ± 1.47, 7.82 ± 1.61
and 6.8±0.93 respectively and there were
statistical significant difference between
asthmatics (during and in between attack) and
control group (P < 0.047).
Our results were in agreement with
Hansen et al 17, they found increased TLC on
their studies as they are pivotal in airway
inflammation and their infiltration into
bronchial wall; interaction with inhaler antigen
leads to bronchial cell damage and airway
inflammation.
In our study there was increased absolute
eosinophilic count in asthmatic during and in
between attack more than control group with
their mean count 43.8 ± 5.58, 40.9 ± 4.53 and
11.7±3.97 respectively and there was extremely
statistical significant difference (P<0.000).
Our findings were in line with Nomura et
al18, who found that TGF-beta1 were
significantly correlated with eosinophil counts,
also, the spontaneously released amount of
TGF- beta1 was correlated positively with both
neutrophils and eosinohils19 and the eosinophils
are the major source of TGF-beta 120.
DISCUSSION
Bronchial asthma is unlikely to be a single
disease. It is more likely to be a series of
complex, overlapping or phenotypes each
defined by its unique interaction between
genetic and environmental factors. Asthma is
characterized by chronic lung inflammation and
airway remodeling associated with wheezing,
shortness of breath, chest tightness, coughing
and acute bronchial hyperresponsiveness to a
variety of stimuli 12.
Airway remodeling is the general
description for the thickening and restructuring
of the airways seen in asthmatic patients. The
characteristics of airway remodeling include
subepithelial
fibrosis,
myofibroblast
hyperplasia,
myocyte
hyperplasia
and
hypertrophy, together with epithelial damage,
goblet cell metaplasia, edema and increased
vascularity 13. The transforming growth factorbeta1 is a central mediator of tissue fibrosis and
structural remodeling 14.
TGF- β1 is produced by nearly all cell types
of the immune system. The role of TGF- β1 is
more complex and involves a dual role as both
an anti-inflammatory and a pro-inflammatory
cytokine 15. However, the secretion of TGF- β1
immediately after an allergic disorder
contributes to fibrosis and the irreversible
changes associated with airway remodeling in
86
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
by hay dust (61.9%), smoke (57.1%), house dust
(47.6%), mixed fungi (38%), cotton (28.5%),
wool (19%) and lastly, human hair (9.5%). In
addition, 80% of patients showed positive skin
test for more than one allergen. Our results are
in line with Etewa25, who found that the
commonest allergens were mixed pollens,
followed by hay dust, then smoke and house
dust mite. This is explained by the global
climate change hypothesis where there is now a
considerable evidence of impacts of climate
change on aeroallergens, particularly pollen. It
appears that plants produce a greater quantity of
pollen with a stronger allergenicity under
increased
CO2
concentrations
and
temperatures26,27.
In our study, increased total leucocytic
count in non atopic patients either during or in
between attack more than atopic patients either
during or in between attack and control group
with their mean counts 8.59 ± 0.48, 9.08 ± 0.5,
6.01±0.99, 6.17±0.85and 6.80±0.93 respectively
and there was extremely statistical significant
difference ( P<0.000) .
Regarding absolute eosinophil count, there
was increase absolute eosinophilic count in
asthmatic patients either atopic or non atopic
during or in between attack more than control
group with their mean counts 45.0 ± 5.71 , 40.1
± 4.09, 43.0 ± 5.59 , 41.5 ± 4.87and 11.7 ± 3.97
respectively and there was extremely statistical
significant difference ( P < 0.000) .
Regarding absolute neutrophilic count,
increased in non atopic asthmatics either during
or in between attack more than atopic either
during or in between attack or control group
with their mean counts 4337.9 ± 458.32 ,
3966.23 ± 199.22 , 3052.0± 290.28 , 3320.46 ±
554.41 and 3357.9 ± 551.86 respectively and
there was extremely statistical significant
difference ( P < 0.000).
Our results were in line with Joseph et al28,
who found that the total white blood cell count
in the non atopic asthmatic group was
significantly higher compared with the atopic
and healthy control groups. The mean absolute
neutrophil count was also significantly higher
compared with atopic patients and healthy
control group. The percentages of eosinophils
were higher in asthmatics than those in normal
controls, as the eosinophils play an important
role in the pathogenesis of air way remodeling
in asthma through the production of various
fibrogenic cytokines such as TGF beta-1 19 ,29.
In our study there was increase serum level
of total IgE in atopic patients in between attack
compared with atopic during attack, non atopic
(during and in between attack) and control
In our study, increased absolute neutrophil
count in asthmatics during attack more than in
between attack and the control group with their
mean 3822 ± 754.14, 3686.4 ±504.99 and
3357.9 ± 551.86 respectively and there was
statistical significant difference, P value <0.046.
Our results were in agreement with Xiao-yan et
al19, who reported that the percentages of
eosinophils and neutrophils were higher in
asthmatics than those in normal controls.
In our study there was increased serum
level of total IgE in asthmatics during and in
between attack more than the control group with
their mean level 290.11 ± 96.41, 272.61 ± 93.24
and 25.82 ± 9.93 respectively and there was
extremely statistical significant difference
between both asthmatic patients during and in
between attack with control group, but no
statistical significant difference between
asthmatic patients in between attack and during
attack.
Our results were in line with those of
Bettiol et al 21, who found that atopic asthma
displays raised total serum IgE. Also, current
attacks of asthma showed an association with
total IgE adjusted for specific IgE, sex and age
which did not vary by bronchial responsiveness.
Individuals with current wheezing and bronchial
responsiveness without attacks of asthma also
showed an adjusted association with total IgE,
which remained for persons without specific
IgE. These finding reinforce the evidence that
asthma is associated with increased levels of
total IgE even in subjects negative for specific
IgE to common aeroallergens 22.
In our study there was increased plasma
level of TGF β1 in asthmatics in between attack
more than during attack and the control group
with their mean level 6.85 ± 3.42 , 3.90 ± 0.85
and 2.40±0.73 respectively and there was
extremely significant difference between
asthmatics (in between attack) and each of
during attack and the control group (P < 0.000).
There was statistical significant difference
between asthmatics during attack and the
control group (P<0.046).
Our results are in line with Vignola et al 23,
who found that the plasma level of TGF β1 was
higher in stable asthmatic patients without
treatment compared to those seen in healthy
control subjects or patients with severe asthma.
Peripheral blood neutrophils also expressed
TGF beta-1 protein and mRNA, and blood
neutrophils from asthmatics spontaneously
released significantly higher levels of TGF beta1 than those of normal controls 24.
In our study, the most risky offending
allergen was mixed pollens (71.4%), followed
87
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
and each of control group, atopic patients
(during and inbetween attack) and non-atopic
during attack, P<0.000. There was highly
statistical significant difference between atopic
patients inbetween attack and control group, P
=0.007. There was statistical significant
difference between atopic patients during attack
and non atopic during attack. Joseph et al 37,
found that the median value of plasma TGFβ1
was significantly higher in non atopic asthmatic
patients compared with controls and atopic
asthmatic patients. The plasma TGFβ1 was
highest in stable asthmatic groups when
compared to the moderate asthma and asthma in
remission. These data support the role of TGFβ1
in airway remodeling in asthma 38.
This study concludes that patients with non
atopic asthma have elevated plasma TGFβ1
levels that may reflect a post-infective
phenomenon that serves to down-regulate the
host immune response. We recommended that
novel therapies for asthma targeted to
manipulate TGF- beta1 could change the
outcome of many children suffering from this
disease.
group with their mean 508.83 ± 17.16 , 139.72 ±
42.58, 390.36±133.12, 91.96±25.51 and
25.82±9.93 respectively with extremely
statistical significant difference (P<0.000). This
is concordant with Blaiss 30, who reported that
serum IgE levels were higher in asthmatic
patients than in non asthmatics and the median
total serum IgE level was significantly higher in
atopic asthmatic patients compared with the non
atopic asthma and control groups28. But
Srivastava et al31, who found that, raised serum
IgE was detected in all groups of asthmatic
patient compared to the control group, they
observed lower IgE levels in late onset asthma
compared to early onset asthma patients.
In our study there was increased level of
plasma TGF β1 in non atopic asthmatic patients
in between attack compared with non atopic
during attack ,atopic (during and in between
attack) and control group with their mean 9.05 ±
2.98, 3.29 ± 0.45, 4.81 ± 0.25, 3.96 ± 0.66 and
2.40±0.73 respectively with extremely statistical
significant difference, (P<0.000).
Our results were in line with Joseph et al28,
who found that the median value of plasma TGF
beta-1 was significantly higher in stable non
atopic asthmatic group compared with controls
and atopic asthmatic patients , also , the TGF
beta-1 suppresses airway inflammation 32.
Accordingly, our observation of increased TGF
β1 levels in the plasma of nonatopic asthmatic
patients might reflect a protective mechanism to
suppress ongoing inflammation in the airways33.
Our results found agreement with Minshall
et al34, who reported that many studies
performed in humans showing that eosinophils
are a major cellular source of TGFβ1 in
asthmatic lungs by demonstrating a liner
relationship between the degree of eosinophils
and the expression of TGFβ1 in different lung
tissues. Also, positive correlation between
eosinophil counts and the number of cells
staining positive for TGFβ1 in plasma samples
of asthmatics 18.
Our results were in line with Bossẻ and
Rold 35, who found that blood neutrophils in
normal and asthmatic individuals were shown to
express TGFβ1. Neutrophilis could contribute
significantly to the increased expression of
TGFβ1 particularly prominent in non atopic
asthma and in more sever forms of the disease.
The median absolute neutrophil count in the non
atopic asthmatic patients was significantly
higher compared with a topic asthmatic patients
and healthy controls 36.
Regarding plasma TGF β 1 level, there was
extremely statistical significant difference
between non atopic patients in between attack
REFERENCES
1.
2.
3.
4.
5.
6.
88
Koster E, Wijga A, Koppelman, G,
Postma, Brunekreef B, et al (2011):
Uncontrolled asthma at age 8: The
importance of parental perception towards
medication.
Pediatric
Allergy
and
Immunology, no. doi: 10.1111/j.13993038.01150.x.
Moore WC and Pascual R (2010):
"Update in asthma ". American journal of
respiratory and critical care medicine 181
(11): 1181–1187.
Fanta CH (2009): "Asthma". N Engl J
Med 360 (10): 1002–14.
Walker C, Virchow JC, Bruijnzeel PB
and Blaser K (2009): T cell subset and
their soluble products regulate eosinophilia
in allergic and nonallergic asthma. J
Immunol; 146:1829-1835.
Woodruff P, Modrek B, Choy D, Jia G,
Abbas A, et al (2009): T-helper type 2driven
inflammation
defines
major
subphenotypes of asthma. Am J Respir Crit
Care Med; 180:388-395.
Sunyer J,Anto J, Castellsague J, Soriano
J and Roca J ( 1996 ) : Total serum IgE is
associated with asthma independently of
specific IgE levels. The Spanish Group of
the European study of asthma. Eur Respir
J., 9: 1880 – 1884.
Egyptian Journal of Medical Microbiology, January 2012
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Vol. 21, No. 1
19. Xiao-Yan GAI, Young- chang SUN and
Wen-li
CAO
(2006):Effect
of
dexamethasone on the release of
transforming growth factor β1, interleukin8, interleukin-10 and RANTES release by
sputum cells in severe asthma. Chinese
Medical Journal; 119 (18) 1567-1571.
20. Cho J, Miller M, Baek K, Han J W, Lee
S, et al(2004): Inhibition of airway
remodeling in IL-5- deficient mice, J Clin.
Inves.113, pp.551-560.
21. Bettiol J , Bartsch P , Louis R, De Groote
D, Gevaerts Y,et al (2000): Cytokine
production from peripheral whole blood in
atopic
and
nonatopic
asthmatics:relationship with blood and
sputum eosinophilia and serum IgE levels.
Allergy, volume 55 ,Number 12, pp. 11341141(8) 2000.
22. Sunyer J, Anto J, Castellsague J, Soriano
J and Roca J (2008): Total serum IgE is
associated with asthma independently of
specific IgE levels. The Spanish Group of
the Europian Study of Asthma. Eur Respir
J;9: 1880-1884.
23. Vignola A, Chiappara G, Chanez P,et al
(2005): Transforming Growth Factor-β
expression in mucosal biopsies in asthma
and chronic bronchitis. Am J Respir Crit
Care Med; 156:591-599.
24. Chu H, Trudeau J, Balzar S and Wenzel
S (2008): peripheral blood and airway
tissue expression of transforming growth
factor β by neutrophils in asthmatic subject
and normal control subject.J Allergy Clin
Immunol; 106:1115-1123.
25. Etewa, R. (2005): Some Biochemical
Markers in Atopic Patients and PCR-Based
Assay for Detection of R576 Interleukin-4
Receptor α Allele Gene MD., Thesis
Medical Biochemistry Department, Faculty
of Medicine, Zagazig University.
26. Beggs, P.J. (2004): Impacts of climate
change on aeroallergens: past and future.
Clin Exp Allergy; 34: 1507-1513.
27. Beggs, P.J. and Bambrick, H.J. (2005): Is
the Global Rise of Asthma an Early Impact
of Anthropogenic Climate Change?
Environ. Health Perspect. 113(8): 915-919.
28. Joseph j, Sheela B, Padmanabhan B,
Safa W, Maries J, et al (2003):
AnnAllergy Immunol;91:472-476.
29. Kato Y, Fujisawa T, Nishimori H,
Katsumata H, Atsuta J,et al (2009):
Leucotriene D4 induces production of
transforming growth factor- beta1 by
eosinophils. Int.Arch. Allergy Immunol.,
137 (Supple. 1): 17-20.
Ong YE , Menzies-Gow A , Barkans J .
Benyahia F , Ou TT and Ying S ( 2005 ) :
Anti-IgE ( Omalizumab ) inhibits late phase reaction and inflammatory cells after
repeat skin allergen challenge. J Allergy
Clin Immunol., 116 ( 3 ) : 558-564.
Ueda T, Niimi A, Matsumoto H, et al
(2008): TGFB1 promoter polymorphism C509T and pathophysiology of asthma. J
Allergy Clin Immunol; 121: 659-664.
Kay B, Phipps S, and Robinson D.S
(2008): A role for eosinophils in airway
remodelling in asthma. Trends in
Immunology; Volume 25, Issue 9 Pages
477-482.
IndrajanaT, Spieksma F. and Voorhost
R (1971): Comparative study of the
intracutaneous, scratch and prick tests in
allergy. Ann Allergy; 29: 639-650. Cited
from: LI, J.T.(2002): Allergy Testing.
American Family Physician; 66: 4.
Kropf, J.; Schurek, J.O. and Wollner, A.
(1997): Irnmunologieal measurement of
Transforming Growth Factor-beta 1 (TGFbeta 1) in blood, assay development and
comparison; 43: 1965-1974.
Borish L, Culp J (2010): Asthma: a
syndrome composed of heterogenous
diseases. Ann Allergy Asthma Immunol;
101:8-11.
Busse W, Banks S and Noel P (2010):
Future research directions in asthma: An
NHLBI Working Group Report. Am J
Respir Crit Care Med. 170: 683-690.
Howell J and McAnulty R (2006): TGFbeta: Its role in asthma and therapeutic
potential. Curr Drug Targets; 7 (5): 547565.
Xie S, Sukkar M and Issa R (2005):
Regulation of TGF-β1induced connective
tissue growth factor expression in airway
smooth muscle cells. Am. J. Physiol. Lung
Cell Mol. Physiol. 288: L68-L76.
Schmidt-Weber C and Blaser K (2006):
The role of TGF-beta in allergic
inflammation. Immunol Allergy Clin North
Am. 26 (2): 233-244.
Hansen G, Berry G, DeKrayf R, Umetsu
DT(2007): Allergen specific Th1 cells fail
to counterbalance Th2 cells induced airway
hyper activity but because sever airway
inflammation. J Clin Invest; 103:175-183.
Nomura A, Uchida Y, Sakamoto T, Ishii
Y, Masuyama K, et al (2009): increase in
collagen type 1 synthesis in asthma: the
role of eosinophils and transforming growth
factor –beta. Clin. Exp. Allergy, 32:860865.
89
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫‪Vol. 21, No. 1‬‬
‫‪bronchial asthma. Am J Respir Cell Mol‬‬
‫‪Biol;17:326-333.‬‬
‫‪Bosse and Rold-Pleszcznski (2010):‬‬
‫‪Controversy surrounding the increased‬‬
‫‪expression of TGF β1 in Asthma, respire‬‬
‫‪Res; 8 (1):66.‬‬
‫‪Abdulkhalik S, Josef J, Benedict S,‬‬
‫‪Badrinath P, Josef M ,et al(2010) :‬‬
‫‪Elevation of plasma Transforming Growth‬‬
‫‪Factor beta 1 level in stable nonatopic‬‬
‫‪asthma. Ann Allergy Athma. Immunol; 91‬‬
‫‪(5):472-476.‬‬
‫‪Joseph M, Wassef S, Josef J, Benedict S,‬‬
‫‪Badrinath P ,et al (2010) : Elevation of‬‬
‫‪plasma Transforming Growth Factor beta 1‬‬
‫‪level in stable nonatopic asthma. Ann‬‬
‫‪Allergy Athma. Immunol; 91 (5):472-476.‬‬
‫‪Manuyakorn W, Kamchaisatian W,‬‬
‫‪Atomosirikui K, Sasisakulporn C,‬‬
‫‪Direkwattanuh ,et al (2008): Plasma TGF‬‬‫‪β1‬‬
‫‪in‬‬
‫‪atopic‬‬
‫‪asthma.‬‬
‫‪Asian‬‬
‫‪Pack.Allergy.Immunol; 26 (4) 185-189.‬‬
‫‪30. Blaiss MS (2005): Epidemiology and‬‬
‫‪pathophisiology of immunoglobulin E‬‬‫‪mediated asthma. Allergy Asthma Proc.,‬‬
‫‪26(6):423-427.‬‬
‫‪31. Srivastava N, Srivastava L and Gupta S‬‬
‫‪(2002): Studies on serum complement and‬‬
‫‪IgE in bronchial asthma Clinical and‬‬
‫‪Experimental Allergy ;12:560-569.‬‬
‫‪32. Heneda k, Sano k, Tamura G, Sato T,‬‬
‫‪Habu S,et al (2009): TGF- β induced by‬‬
‫‪oral tolerance ameliorates experimental‬‬
‫‪tracheal‬‬
‫‪eosinophilia.‬‬
‫‪J‬‬
‫‪Immunol.;159:4484-4490.‬‬
‫‪33. Nakao A, Miike S, Hatano M, et al‬‬
‫‪(2008): Blockade of transforming groeth‬‬
‫‪factor β⁄Smad signaling in T cells by‬‬
‫‪overexpression of Smad7 enhances antigen‬‬‫‪indused airway inflammation and airway‬‬
‫‪reactivity. J Exp Med;192:151-158.‬‬
‫‪34. Minshall E, Leung D, Martin R, et al‬‬
‫‪(2010): Eosinophil-associated TGF-β1‬‬
‫‪mRNA expression and airway fibrosis in‬‬
‫‪35.‬‬
‫‪36.‬‬
‫‪37.‬‬
‫‪38.‬‬
‫ﻣﺴﺘﻮى ﻣﻌﺎﻣﻞ اﻟﻨﻤﻮ اﻟﺘﺤﻮﻟﻰ ﺑﻴﺘﺎ ‪ ١‬ﻓﻰ ﺑﻼزﻣﺎ أﻃﻔﺎل اﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ‬
‫ﻣﺮﻓﺖ ﺳﻠﻴﻤﺎن ﻣﺤﻤﺪ ‪ – ١‬ﺧﺎﻟﺪ ﻣﺤﻤﺪ ﺻﻼح ‪ - ٢‬دﻳﻨﺎ ﻣﺤﻤﺪ ﺷﻜﺮى ‪ – ٢‬أﺣﻤﺪ ﻋﺒﺪ اﻟﻔﺘﺎح ﺣﻠﺒﻰ‬
‫ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻰ و اﻟﻤﻨﺎﻋﺔ ‪ – ١‬ﻗﺴﻢ ﻃﺐ اﻷﻃﻔﺎل ‪٢‬‬
‫آﻠﻴﺔ اﻟﻄﺐ – ﺟﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ‬
‫ﻳﻌ ﺪ اﻟﺮﺑ ﻮ اﻟ ﺸﻌﺒﻰ ﻓ ﻰ اﻷﻃﻔ ﺎل ﻣ ﻦ أآﺜ ﺮ اﻷﻣ ﺮاض اﻟ ﺼﺪرﻳﺔ اﻟﻤﺰﻣﻨ ﺔ ﺷ ﻴﻮﻋﺎ وﻳﺘ ﺼﻒ ﺑ ﺄﻋﺮاض ﻣﺨﺘﻠﻔ ﺔ ﻣﻨﻬ ﺎ اﻟﻜﺤ ﺔ وﺿ ﻴﻖ ﻓ ﻰ اﻟ ﺸﻌﺐ‬
‫واﻟﺸﻌﻴﺒﺎت اﻟﻬﻮاﺋﻴﺔ ﻣﻊ اﻟﺘﻬﺎﺑﺎت وأزﻳﺰ ‪ ،‬وﺗﺨﺘﻠﻒ ﺣﺪة اﻟﻤﺮض ﻣﻦ ﻣﺮﻳﺾ إﻟ ﻰ ﺁﺧ ﺮ ‪.‬اﻟﺘﺤ ﻮر ﻓ ﻰ اﻟ ﺸﻌﺐ اﻟﻬﻮاﺋﻴ ﺔ ﻗ ﺪ ﻳﻠﻌ ﺐ دورا هﺎﻣ ﺎ ﻓ ﻰ‬
‫اﻟﻔﺴﻴﻮﻟﻮﺟﻴﺎ اﻟﻤﺮﺿﻴﺔ ﻟﻠﺮﺑﻮ اﻟﺸﻌﺒﻰ ‪ .‬وﻳﻌﺪ ﻣﻌﺎﻣﻞ اﻟﻨﻤﻮ اﻟﺘﺤﻮﻟﻰ ﺑﻴﺘﺎ ‪ ١-‬ﻣﺎدة ﻣﺤﺮآﺔ ﻟﻠﺨﻠﻴﺔ ذات ﻋﺪة وﻇ ﺎﺋﻒ ﺣﻴ ﺚ ﻳﻌﻤ ﻞ آﻤﻨ ﺸﻂ وﻣ ﻀﺎد‬
‫ﻟﻼﻟﺘﻬﺎﺑﺎت ‪.‬‬
‫ﺗﺴﺘﻬﺪف هﺬﻩ اﻟﺪراﺳﺔ ﻗﻴﺎس ﻣﺴﺘﻮى ﻣﻌﺎﻣﻞ اﻟﻨﻤﻮ اﻟﺘﺤﻮﻟﻰ ﺑﻴﺘﺎ ‪ ١-‬ﻓﻰ ﺑﻼزﻣﺎ اﻷﻃﻔﺎل اﻟﻤﺼﺮﻳﻴﻦ اﻟﻤﺼﺎﺑﻴﻦ ﺑﺎﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ أﺛﻨﺎء وﺑ ﻴﻦ ﻧﻮﺑ ﺎت‬
‫اﻟﻤﺮض ﻣﻘﺎرﻧﺔ ﺑﺎﻷﻃﻔﺎل اﻷﺻﺤﺎء ‪.‬‬
‫أﺟﺮﻳﺖ هﺬﻩ اﻟﺪراﺳﺔ ﻓﻲ وﺣﺪة اﻟﺤﺴﺎﺳﻴﺔ واﻟﻤﻨﺎﻋﺔ وﺑﻘﺴﻢ اﻟﺼﺪر ﺑﻤﺴﺘﺸﻔﻲ اﻷﻃﻔﺎل اﻟﺠﺎﻣﻌﻲ ﺑﻜﻠﻴﺔ اﻟﻄﺐ ﺟﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ ﺧﻼل اﻟﻔﺘﺮة ﻣ ﻦ‬
‫ﺳﺒﺘﻤﺒﺮ ‪ ٢٠٠٨‬إﻟﻲ ﻣﺎرس ‪ .٢٠١٠‬ﺷﻤﻠﺖ اﻟﺪراﺳﺔ ‪ ٧٠‬ﻃﻔﻞ وﻗﺪ ﺗﻢ ﺗﻘﺴﻴﻤﻬﻢ إﻟﻲ ﻣﺠﻤﻮﻋﺘﻴﻦ‪-:‬‬
‫اﻟﻤﺠﻤﻮﻋﺔ اﻷوﻟﻲ )ﻣﺠﻤﻮﻋﺔ اﻟﻤﺮﺿﻲ(‪ :‬ﺗﺸﻤﻞ ‪ ٥٠‬ﻣﺮﻳﻀﺎ ﺑﺎﻟﺮﺑﻮ اﻟﺸﻌﺒﻲ وﺗﺘﺮاوح أﻋﻤﺎرهﻢ ﻣﻦ ‪ ٢‬وﺣﺘﻰ ‪ ١٢‬ﺳﻨﺔ وﻗﺪ ﺗﻢ ﺗﻘﺴﻴﻤﻬﻢ إﻟﻲ‪-:‬‬
‫أ‪.‬‬
‫‪ ٣٠‬ﻣﺮﻳﺾ ﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض )‪ ١٧‬ﻣﻦ اﻟﺬآﻮر و ‪ ١٣‬ﻣﻦ اﻹﻧﺎث(‪.‬‬
‫‪ ٢٠‬ﻣﺮﻳﺾ أﺛﻨﺎء ﻧﻮﺑﺎت اﻟﻤﺮض )‪ ١٢‬ﻣﻦ اﻟﺬآﻮر و ‪ ٨‬ﻣﻦ اﻹﻧﺎث(‪.‬‬
‫ب‪.‬‬
‫ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﺎﺧﺘﺒﺎر اﻟﺤﺴﺎﺳﻴﺔ ﻋﻦ ﻃﺮﻳﻖ اﻟﺠﻠﺪ ﺗﻢ ﺗﻘﺴﻴﻤﻬﻢ إﻟﻲ‪-:‬‬
‫• إﻳﺠﺎﺑﺎ أﺛﻨﺎء وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض ﻋﻠﻲ اﻟﺘﻮاﻟﻲ ) ﺣﺴﺎس(‪.‬‬
‫• ﺳﻠﺒﺎ أﺛﻨﺎء وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض ﻋﻠﻲ اﻟﺘﻮاﻟﻲ )ﻏﻴﺮ ﺣﺴﺎس(‪.‬‬
‫اﻟﻤﺠﻤﻮﻋﺔ اﻟﺜﺎﻧﻴﺔ )اﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ(‪ :‬ﺷﻤﻠﺖ هﺬﻩ اﻟﻤﺠﻤﻮﻋﺔ ‪ ٢٠‬ﻣﺘﻄﻮﻋ ﺎ ﻣ ﻦ اﻷﺻ ﺤﺎء ‪ ١١‬ﻣ ﻦ اﻟ ﺬآﻮر و ‪ ٩‬ﻣ ﻦ اﻹﻧ ﺎث ﻣ ﻦ ﻧﻔ ﺲ اﻟﻔﺌ ﺔ‬
‫اﻟﻌﻤﺮﻳﺔ‪.‬‬
‫وﻟﻘﺪ ﺗﻢ إﺟﺮاء اﻵﺗﻲ ﻋﻠﻰ اﻟﻤﺮﺿﻰ و أﻓﺮاد اﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ‪:‬‬
‫اﻟﺘﺤﻠﻴ ﻞ اﻟﻜﺎﻣ ﻞ ﻟﻠﺘ ﺎرﻳﺦ اﻟﻤﺮﺿ ﻰ‪ .‬اﻟﻔﺤ ﺺ اﻷآﻠﻴﻨﻴﻜ ﻰ اﻟﻌ ﺎم واﻟﺨ ﺎص ﻟﻠ ﺼﺪر‪ .‬اﻟﻔﺤﻮﺻ ﺎت‪ :‬أﺷ ﻌﺔ ﺳ ﻴﻨﻴﺔ ﻋﻠ ﻰ اﻟ ﺼﺪر ﺧﻠﻔ ﻲ أﻣ ﺎﻣﻲ‬
‫وﺟﺎﻧﺒﻲ‪.‬ﺗﺤﻠﻴﻞ ﺑﻮل وﺑﺮاز ﻻﺳﺘﺒﻌﺎد اﻹﺻﺎﺑﺔ ﺑﺎﻟﻄﻔﻴﻠﻴﺎت‪.‬اﺧﺘﺒﺎر ﺑﻄﺮﻳﻘﺔ اﻟﺤﻘﻦ ﺑﺎﻟﺠﻠﺪ ﻟﻠﺘﻌﺮف ﻋﻠﻰ اﻟﻤﻮاد اﻟﻐﺮﻳﺒﺔ اﻟﻤﺴﺒﺒﺔ ﻟﻠﺤﺴﺎﺳﻴﺔ ‪.‬‬
‫اﺧﺘﺒﺎرات اﻟﺪم‪ :‬ﻋﺪ ﺧﻼﻳﺎ اﻟﺪم اﻟﺒﻴ ﻀﺎء وﻣ ﺸﺘﻘﺎﺗﻬﺎ ﻣ ﻦ اﻷﻳﺰﻳﻨﻮﻓﻴ ﻞ واﻟﻨﻴﺘﺮوﻓﻴ ﻞ‪ .‬ﻗﻴ ﺎس ﻣ ﺴﺘﻮى اﻟﺠﻠﻮﺑﻴ ﻮﻟﻴﻦ اﻟﻤﻨ ﺎﻋﻲ اﻟﻜﻠ ﻰ )ه ـ( ﻓ ﻰ‬
‫ﻣﺼﻞ اﻟﺪم ﺑﺎﻻﻟﻴﺰا‪ .‬ﻗﻴﺎس ﻣﺴﺘﻮى ﻣﻌﺎﻣﻞ اﻟﻨﻤﻮ اﻟﺘﺤﻮﻟﻲ ﺑﻴﺘﺎ ‪ ١-‬ﻓﻰ ﺑﻼزﻣﺎ اﻟﺪم ﺑﺎﻻﻟﻴﺰا‪.‬‬
‫‪90‬‬
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫*ﻧﺘﺎﺋﺞ اﻟﺒﺤﺚ ‪:‬‬
‫و ﻗﺪ أﺳﻔﺮت اﻟﺪراﺳﺔ ﻋﻦ اﻟﻨﺘﺎﺋﺞ اﻟﺘﺎﻟﻴﺔ‪:‬‬
‫زﻳﺎدة ﻧﺴﺒﺔ آ ﻼ ﻣ ﻦ ﺧﻼﻳ ﺎ اﻟ ﺪم اﻟﺒﻴ ﻀﺎء واﻷﻳﺰﻳﻨﻮﻓﻴ ﻞ واﻟﻨﻴﺘﺮوﻓﻴ ﻞ واﻟﺠﻠﻮﺑﻴ ﻮﻟﻴﻦ اﻟﻤﻨ ﺎﻋﻲ اﻟﻜﻠ ﻲ )ه ـ( ﻓ ﻲ ﻣﺮﺿ ﻲ اﻟﺮﺑ ﻮ اﻟ ﺸﻌﺒﻲ ﻣﻘﺎرﻧ ﺔ‬
‫ﺑﺎﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ‪ .‬زﻳ ﺎدة ﻋ ﺪد اﻷﻳﺰﻳﻨﻮﻓﻴ ﻞ ﻓ ﻲ اﻟﻤﺮﺿ ﻲ أﺛﻨ ﺎء ﻧﻮﺑ ﺎت اﻟﻤ ﺮض ﻣﻘﺎرﻧ ﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض واﻟﻤﺠﻤﻮﻋ ﺔ‬
‫اﻟﻀﺎﺑﻄﺔ ﻣﻊ وﺟﻮد ﻓﺮق ذو دﻻﻟﻪ إﺣﺼﺎﺋﻴﺔ‪.‬‬
‫ﻓﻴﻤ ﺎ ﻳﺘﻌﻠ ﻖ ﺑﺨﻼﻳ ﺎ اﻟ ﺪم اﻟﺒﻴ ﻀﺎء‪ :‬ﻻ ﻳﻮﺟ ﺪ ﻓ ﺮق ذو دﻻﻟ ﺔ إﺣ ﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض وآ ﻼ ﻣ ﻦ اﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ‬
‫واﻟﻤﺮﺿﻲ أﺛﻨﺎء ﻧﻮﺑﺎت اﻟﻤﺮض‪.‬‬
‫ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﺎﻟﺠﻠﻮﺑﻴﻮﻟﻴﻦ اﻟﻤﻨﺎﻋﻲ اﻟﻜﻠﻲ )هـ(‪ :‬ﻻ ﻳﻮﺟﺪ ﻓﺮق ذو دﻻﻟﺔ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ أﺛﻨﺎء وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪.‬‬
‫زﻳ ﺎدة ﻣﻌﺎﻣ ﻞ اﻟﻨﻤ ﻮ اﻟﺘﺤ ﻮﻟﻲ ب ‪ ١‬ﻓ ﻲ اﻟﻤﺮﺿ ﻲ ﺑ ﻴﻦ وأﺛﻨ ﺎء ﻧﻮﺑ ﺎت اﻟﻤ ﺮض ﻣﻘﺎرﻧ ﺔ ﻣ ﻊ اﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ‪ .‬وآ ﺎن هﻨ ﺎك ﻓ ﺮق ذو دﻻﻟ ﺔ‬
‫إﺣﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض وآ ﻼ ﻣ ﻦ اﻟﻤﺮﺿ ﻲ أﺛﻨ ﺎء ﻧﻮﺑ ﺎت اﻟﻤ ﺮض واﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ‪ .‬أﻳ ﻀﺎ وﺟ ﻮد ﻓ ﺮق ذو دﻻﻟ ﺔ‬
‫إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ أﺛﻨﺎء ﻧﻮﺑﺔ اﻟﻤﺮض واﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ‪.‬‬
‫أن اﻟﻤﻮاد اﻷآﺜﺮ ﺷﻴﻮﻋﺎ آﺴﺒﺐ ﻟﺤﺴﺎﺳﻴﺔ اﻟﺼﺪر هﻲ ﺣﺒﻮب اﻟﻠﻘﺎح اﻟﻤﺨﺘﻠﻔﺔ ﺛﻢ ﻳﻠﻴﻬﺎ ﻗﺶ اﻷرز‪ ،‬اﻟﺪﺧﺎن‪ ،‬ﺗﺮاب اﻟﻤﻨ ﺰل‪ ،‬اﻟﻔﻄﺮﻳ ﺎت اﻟﻤﺨﺘﻠﻔ ﺔ‪،‬‬
‫اﻟﻘﻄﻦ‪ ،‬اﻟﺼﻮف و ﺷﻌﺮ اﻹﻧﺴﺎن و أن هﻨﺎك أآﺜﺮ ﻣﻦ ‪ %٨٠‬ﻣﻦ اﻟﻤﺮﺿﻰ ﻳﻌﺎﻧﻮن ﻣﻦ ﺣﺴﺎﺳﻴﺔ ﻷآﺜﺮ ﻣﻦ ﻣﺎدة‪.‬‬
‫زﻳﺎدة ﺧﻼﻳﺎ اﻟﺪم اﻟﺒﻴﻀﺎء واﻟﻨﻴﺘﺮوﻓﻴﻞ ﻓﻲ اﻟﻤﺮﺿﻲ اﻟﻐﻴﺮ اﻟﺤﺴﺎﺳﺔ ﻣﻘﺎرﻧﺔ ﻣﻊ اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ أو اﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ ﻣ ﻊ وﺟ ﻮد ﻓ ﺮق ذو‬
‫دﻻﻟﻪ إﺣﺼﺎﺋﻴﺔ‪.‬‬
‫زﻳﺎدة ﻋﺪد اﻷﻳﺰﻳﻨﻮﻓﻴﻞ ﻓﻲ ﻣﺮﺿﻲ اﻟﺮﺑﻮ ﺳﻮاء اﻟﺤﺴﺎﺳﺔ أو ﻏﻴﺮ اﻟﺤﺴﺎﺳﺔ ﻣﻘﺎرﻧﺔ ﺑﺎﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ ﻣﻊ وﺟﻮد ﻓﺮق ذو دﻻﻟﻪ إﺣﺼﺎﺋﻴﺔ‪.‬‬
‫زﻳﺎدة ﻧﺴﺒﺔ اﻟﺠﻠﻮﺑﻴﻮﻟﻴﻦ اﻟﻤﻨﺎﻋﻲ )هـ( ﻓﻲ اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ ﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض ﻣﻘﺎرﻧﺔ ﻣﻊ اﻟﻤﺠﻤﻮﻋﺎت اﻷﺧ ﺮى واﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ ﻣ ﻊ‬
‫وﺟﻮد ﻓﺮق ذو دﻻﻟﻪ إﺣﺼﺎﺋﻴﺔ‪.‬‬
‫زﻳ ﺎدة ﻣ ﺴﺘﻮي ﻣﻌﺎﻣ ﻞ اﻟﻨﻤ ﻮ اﻟﺘﺤ ﻮﻟﻲ ب ‪ ١‬ﻓ ﻲ اﻟﻤﺮﺿ ﻲ ﻏﻴ ﺮ اﻟﺤ ﺴﺎﺳﺔ ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض ﻣﻘﺎرﻧ ﺔ ﺑﺎﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ واﻟﻤﺠﻤﻮﻋ ﺎت‬
‫اﻷﺧﺮى ﻣﻊ وﺟﻮد ﻓﺮق ذو دﻻﻟﻪ إﺣﺼﺎﺋﻴﺔ‪.‬‬
‫ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﺨﻼﻳﺎ اﻟﺪم اﻟﺒﻴﻀﺎء‪ :‬وﺟﻮد ﻓ ﺮق ذو دﻻﻟ ﻪ إﺣ ﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ اﻟﻐﻴ ﺮ ﺣ ﺴﺎﺳﺔ ﺳ ﻮاء أﺛﻨ ﺎء أو ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض وآ ﻼ ﻣ ﻦ‬
‫اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎ ﺳﻪ واﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ‪ .‬وﻟﻜﻦ ﻻ ﻳﻮﺟﺪ ﻓﺮق ذو دﻻﻟﻪ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ أﺛﻨﺎء أو ﺑﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض )ﺳ ﻮاء ﺣ ﺴﺎﺳﺔ‬
‫أم ﻻ(‪.‬‬
‫ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﻌﺪد اﻷﻳﺰﻳﻨﻮﻓﻴﻞ‪ :‬وﺟﻮد ﻓﺮق ذو دﻻﻟﻪ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ وﻏﻴﺮ اﻟﺤﺴﺎﺳﺔ‪-‬أﺛﻨ ﺎء وﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض‪ -‬ﻣﻘﺎرﻧ ﺔ ﻣ ﻊ‬
‫اﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ‪ .‬أﻳﻀﺎ وﺟﻮد ﻓﺮق ذو دﻻﻟﺔ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ أﺛﻨﺎء وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪.‬‬
‫ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﻌﺪد اﻟﻨﻴﺘﺮوﻓﻴﻞ‪ :‬وﺟﻮد ﻓﺮق ذو دﻻﻟ ﺔ إﺣ ﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ ﻏﻴ ﺮ اﻟﺤ ﺴﺎﺳﺔ ‪-‬أﺛﻨ ﺎء وﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض‪ -‬ﻣﻘﺎرﻧ ﺔ ﻣ ﻊ آ ﻼ ﻣ ﻦ‬
‫اﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ واﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ‪-‬أﺛﻨﺎء وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪, -‬أﻳﻀﺎ وﺟﻮد ﻓﺮق ذو دﻻﻟﺔ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ ﻏﻴﺮ اﻟﺤﺴﺎﺳﺔ أﺛﻨﺎء‬
‫وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪ .‬وﻟﻜﻦ ﻻ ﻳﻮﺟﺪ ﻓﺮق ذو دﻻﻟﺔ إﺣﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ اﻟﺤ ﺴﺎﺳﺔ ‪-‬أﺛﻨ ﺎء وﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض – ﻣﻘﺎرﻧ ﺔ ﻣ ﻊ اﻟﻤﺠﻤﻮﻋ ﺔ‬
‫اﻟﻀﺎﺑﻄﺔ‪.‬‬
‫ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﺎﻟﺠﻠﻮﺑﻴﻮﻟﻴﻦ اﻟﻤﻨﺎﻋﻲ اﻟﻜﻠ ﻲ )ه ـ(‪ :‬وﺟ ﻮد ﻓ ﺮق ذو دﻻﻟ ﺔ إﺣ ﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ ﻏﻴ ﺮ اﻟﺤ ﺴﺎﺳﺔ أﺛﻨ ﺎء اﻟﻤ ﺮض ﻣﻘﺎرﻧ ﺔ ﺑﻜ ﻼ ﻣ ﻦ‬
‫اﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ واﻟﻤﺮﺿ ﻲ اﻟﺤ ﺴﺎﺳﺔ أﺛﻨ ﺎء اﻟﻤ ﺮض وﻏﻴ ﺮ اﻟﺤ ﺴﺎﺳﺔ ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض‪ .‬أﻳ ﻀﺎ وﺟ ﻮد ﻓ ﺮق ذو دﻻﻟ ﺔ إﺣ ﺼﺎﺋﻴﺔ ﺑ ﻴﻦ‬
‫اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ أﺛﻨﺎء اﻟﻤﺮض ﻣﻘﺎرﻧﺔ ﺑﺎﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ‪ .‬ﻟﻜﻦ ﻻ ﻳﻮﺟﺪ ﻓﺮق ذو دﻻﻟ ﺔ إﺣ ﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ اﻟﺤ ﺴﺎﺳﺔ أﺛﻨ ﺎء اﻟﻤ ﺮض‬
‫وﻏﻴﺮ اﻟﺤﺴﺎﺳﺔ ﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪.‬‬
‫ﻓﻴﻤﺎ ﻳﺘﻌﻠﻖ ﺑﻤﻌﺎﻣﻞ اﻟﻨﻤﻮ اﻟﺘﺤﻮﻟﻲ ب ‪ :١‬وﺟﻮد ﻓ ﺮق ذو دﻻﻟ ﺔ إﺣ ﺼﺎﺋﻴﺔ ﺑ ﻴﻦ اﻟﻤﺮﺿ ﻲ ﻏﻴ ﺮ اﻟﺤ ﺴﺎﺳﺔ ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض ﻣﻘﺎرﻧ ﺔ ﺑﻜ ﻸ ﻣ ﻦ‬
‫اﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ واﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ ‪-‬أﺛﻨﺎء وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪ -‬واﻟﻤﺮﺿﻲ ﻏﻴﺮ اﻟﺤﺴﺎﺳﺔ ﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪ .‬ﻻ ﻳﻮﺟ ﺪ ﻓ ﺮق ذو دﻻﻟ ﺔ‬
‫إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ ﻏﻴﺮ اﻟﺤﺴﺎﺳﺔ أﺛﻨﺎء اﻟﻤﺮض ﻣﻘﺎرﻧﺔ ﺑﻜﻼ ﻣ ﻦ اﻟﻤﺠﻤﻮﻋ ﺔ اﻟ ﻀﺎﺑﻄﺔ واﻟﻤﺮﺿ ﻲ اﻟﺤ ﺴﺎﺳﺔ ﺑ ﻴﻦ ﻧﻮﺑ ﺎت اﻟﻤ ﺮض‪ .‬وﺟ ﻮد‬
‫ﻓﺮق ذو دﻻﻟﺔ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ ﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض واﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ‪ .‬وﺟﻮد ﻓﺮق ذو دﻻﻟﺔ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ أﺛﻨ ﺎء‬
‫اﻟﻤﺮض اﻟﺤﺴﺎﺳﺔ وﻏﻴﺮ اﻟﺤﺴﺎﺳﺔ‪ .‬ﻻ ﻳﻮﺟﺪ ﻓﺮق ذو دﻻﻟﺔ إﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ اﻟﻤﺮﺿﻲ اﻟﺤﺴﺎﺳﺔ أﺛﻨﺎء وﺑﻴﻦ ﻧﻮﺑﺎت اﻟﻤﺮض‪.‬‬
‫اﻟﺘﻮﺟﻴﻬﺎت ‪:‬‬
‫ﻋﻼﺟﺎت ﺟﺪﻳﺪة ﻟﻠﺮﺑﻮ اﻟﺸﻌﺒﻲ ﺗﺴﺘﻬﺪف اﺳﺘﺨﺪام ﻣﻌﺎﻣﻞ اﻟﻨﻤﻮ اﻟﺘﺤﻮﻟﻲ ب‪ ١-‬ﻳﻤﻜﻦ أن ﻳﻐﻴﺮ ﻓﻲ ﻧﺘﺎﺋﺞ اﻟﻌﺪﻳﺪ ﻣﻦ اﻷﻃﻔﺎل اﻟﺬﻳﻦ ﻳﻌﺎﻧﻮن ﻣﻦ ه ﺬا‬
‫اﻟﻤﺮض‪.‬‬
‫‪91‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Direct Ag Detection in Stool versus Conventional Culture for Diagnosis
of Campylobacter as a Causative Agent in Pediatric Gastroenteritis
Abeer A Abo Elazem MD, Sherin M Emam MD
Microbiology and Immunology Department, Faculty of Medicine Benha University
ABSTRACT
Background/Aim Campylobacter is a major cause of human bacterial gastroenteritis in many
industrialized and developing countries. The majority (approximately 90%) of cases of campylobacter
gastroenteritis in humans is caused by Campylobacter jejuni(C jejuni), and most of the remainder is
caused by Campylobacter coli (C. coli). The aim of this study was to evaluate the performance of
campylobacter antigen(Ag) detection by enzyme immunne assay(EIA) using Premier™ Campy assay
(Meridian Bioscience, Cincinnati, OH), and ImmunoCard STAT (Meridian Bioscience, Cincinnati, OH),
in comparison to conventional culture for detection of Campylobacter in pediatric stool specimens in
cases of gastroenteritis. Methods: This study was held in Microbiology and Immunology Department,
Faculty of Medicine, Benha University, from May 2011 to August 2011. A total of 80 stool specimens
were collected from pediatric patients attending the Pediatric outpatient clinic and Pediatric Department
of Benha University Hospital. All patients were complaining of diarrhea, abdominal pain and fever. Stool
samples were cultured on modified charcoal cefoperazol dextrose agar (mCCDA) and were examined for
Ag detection by ELISA using Premier Campy assay and lateral flow ImmunoCard STAT. Results: The
sensitivities of these tests were 100% and 88.9%. The specificities were 97% and 95.5%. The positive
predictive values (PPVs) were 81.9% and 72.7%. The negative predictive values (NPVs) were 100% and
98.5% respectively. On conclusion: These results showed that Premier Campy assay and ImmunoCard
STAT are convenient methods with short turnaround times for final test results; they provide rapid and
reliable alternatives for conventional culture in the laboratory diagnosis of campylobacter enteric
infections.
Abbreviations:
C jejuni, Campylobacter jejuni; C. coli, Campylobacter coli; EIA ,enzyme immunne assay; mCCDA,
modified charcoal cefoperazol dextrose agar; PPV, positive predictive value ; NPV, negative predictive
value
caused by Campylobacter jejuni, and most of
the remainder is caused by Campylobacter
coli(3).
According to WHO(4), Campylobacter
represents the second cause of travellers'
diarrhoea and enteric disease in military
populations after enterotoxigenic Escherichia
coli (ETEC). In developing countries, infection
is nearly universal in early childhood. It is also
an important cause of food borne illness in
young children, including less than 1 year-old
infants. Perhaps of greater concern is its
reported association with life-threatening cases
of Guillain-Barré syndrome (GBS)(5).
Several methods have been developed for
establishing the laboratory diagnosis of
Campylobacter enteritis. Some of these involve
the direct microscopic detection of the
microorganism in stool, the recovery of the
organism from culture following the use of a
filtration method, or the use of a specialized
selective medium for the enhanced recovery of
Campylobacter from stool. Most clinical
laboratories do not use the direct microscopic or
INTRODUCTION
Campylobacteriosis is an infectious disease
caused by bacteria of the genus Campylobacter.
Although Campylobacter was first identified in
1886 by Escherich in stool samples of children
with diarrhea, its public health importance was
not recognized until the 1970’s when the
development of selective growth media
permitted more laboratories to isolate the
organism
from
stool
samples.
Soon
Campylobacter was identified as a common
human pathogen(1).
Campylobacter (meaning 'twisted bacteria')
is a genus of bacteria that are Gram-negative,
spiral, microaerophilic and motil with either
unipolar or bipolar flagellae. The organisms
have
a
characteristic
spiral/corkscrew
appearance and are oxidase-positive(2).
Campylobacter species are a major cause of
human bacterial gastroenteritis in many
industrialized and developing countries. The
majority (approximately 90%) of cases of
campylobacter gastroenteritis in human are
93
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
collected from 80 pediatric patients attending
the Pediatric Outpatient Clinic and Pediatric
Department of Benha University Hospital, their
ages ranged from 6 to 30 months. All patients
were complaining of diarrhea, abdominal pain
and fever.
Sampling
Stool specimens were collected using
cotton-tipped swabs and transported to the
laboratory in Cary-Blair transport medium
(Difco Laboratories). Fresh specimens were
immediately used for culture and Ag detection
by lateral flow ImmunoCard STAT! Campy
(Meridian Bioscience, Cincinnati, OH), then
preserved at -20°C till used in Ag detection by
ELISA using Premier™ Campy assay (Meridian
Bioscience, Cincinnati, OH).
Stool culture
Stool specimens were immediately cultured
on plates of mCCDA (oxoid), incubated at 42ºC
under microaerophilic condition for 48 h and
observed for the appearance of typical growth.
Isolates that were oxidase positive and were
observed to be curved, Gram-negative rods
following Gram staining were identified as C.
jejuni/C. Coli(9).
Microaerophilic condition was achieved using
CampyGen CN0025(Oxoid). The active
ingredient in the kit is ascorbic acid. When a
CampyGen paper sachet is exposed and placed
in a sealed jar, the atmospheric oxygen in the jar
is rapidly absorbed with the simultaneous
generation of carbon dioxide. Preparation of
mCCDA
according
to
manufacturer
recommendation
22.75g of dehydrated media were suspend
in 500ml of distilled water and boiled for one
minute till complete dissolution. It was
sterilized by autoclaving at 121°C for 15
minutes. After being cooled to 50°C, one vial of
CCDA
selective
supplement
SR01555(containing 16mg Cefoperazone and
5mg Amphotericin B) reconstituted in 5ml of
sterile distilled water was aseptically added to
the media and gently homogenized. The
medium was poured into sterile Petri dishes.
The prepared medium was stored at 8-15°C for
to2 weeks.
Preparation of Cary-Blair medium
It was prepared according to manufacturer’s
instructions. 13.2 grams of the medium were
suspended in one liter of distilled water and
boiled for one minute till complete dissolution.
It was dispensed into screw-capped test tubes.
With the caps loosened, it was sterilized by
steaming at 100°C for 15 minutes. The caps
were tightened after sterilization and stored at 28°C.
filtration method, because microscopy is
insensitive and filtration is cumbersome and
may lack sensitivity(6).
The use of a selective medium is
recommended for the optimal recovery of
Campylobacter from stool samples. Some of
these selective media are Skirrow's medium,
CCDA, and Campy-CVA medium. Once
inoculated, the medium is placed in a
microaerophilic growth environment, incubated
at 42°C for 48 h, and observed daily for the
appearance of characteristic Campylobacter
growth. Most individuals recommend the use of
a single medium, such as Campy-CVA or
CCDA, for the recovery of C. jejuni and C. coli
from stool specimens(7).
Stool culture on selective agar medium
commonly requires at least 48 h due to the slow
growth of Campylobacter organisms, and the
identification of suspected colonies is a
laborious and time-consuming procedure. A
simple and rapid non culture assay for the
detection of C. jejuni and C. coli in human stool
specimens, therefore, has been desired. Several
methods, including a commercially available
enzyme immunoassay and PCR-based assays
are used(3). Three commercially available
enzyme immunoassays (EIAs): the Premier
Campy EIA (Meridian Bioscience, Cincinnati,
OH), the ProSpecT Campylobacter EIA (Remel,
Lenexa, KS), and the ImmunoCard STAT!
CAMPY test (Meridian Bioscience, Cincinnati,
OH). All of them detect campylobacter specific
Ag in stool and they are rapid and easy
methods. Each of the three EIAs detects a
Campylobacter
surface
antigen,
called
Campylobacter- specific antigen (SA), that is
shared by C. jejuni and C. coli. As such, each
EIA method can detect both species of
Campylobacter in stool specimens but cannot
differentiate them(8).
Aim and Objective:
The aim of this study was to evaluate the
performance of campylobacter Ag detection by
ELISA using Premier™ Campy assay (Meridian
Bioscience, Cincinnati, OH), and the lateral
flow ImmunoCard STAT (Meridian Bioscience,
Cincinnati, OH), in comparison to conventional
culture for detection of campylobacter in
pediatric
stool specimens in cases of
gastroenteritis.
PATIENTS & METHODS
This study was held in Microbiology and
Immunology Department, Faculty of Medicine,
Benha University, from May 2011 to August
2011
. A total of 80 stool specimens were
94
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
reactions in the positive and negative control
wells. These results were interpreted in
accordance with the manufacturer's guidelines.
Statistical methods
The collected data were tabulated and
analyzed using SPSS version 17. Microstate
software was used to calculate Z test and the
corresponding p value for sensitivity,
specificity, PPV & NPV of Premier™ Campy
assay and ImmunoCard STAT using culture as
the reference method. The accepted level of
significance was 0.05 (P<0.05 is significant).
Detection of campylobacter Ag in stool by
ImmunoCard STAT! CAMPY (Meridian
Biosciences). This is a rapid (20 minutes) lateral
flow monoclonal antibody-based immunoassay
that uses a monoclonal antibody specific for C.
jejuni and C. coli specific Ag using a
disposable, rectangular test cartridge. It was
performed
according
to
manufacturer’s
instructions as follows:
Fifty µL of stool specimen in Cary-Blair
medium were suspended in 350 µl of sample
diluent. After proper mixing for 15 seconds, 175
µL of each diluted specimen were transferred to
the specimen port of the test cartridge. After 20
min incubation at 25ºC, the test was read within
one
minute.
In
positive
samples,
Campylobacter specific Ag binds to the
monoclonal antibody-colloid conjugate in the
membrane filter of the device and two visible
pink-red lines were seen at the test and the
control positions of the device's central window.
In negative samples, no complex is formed, and
a single visible pink-red line at the control
position of the device's central window. If no
pink-red Control Line was seen, adequate
specimen flow has not occurred, and the test is
considered invalid. The total assay time is less
than 30 min.
Detection of campylobacter Ag in stool by
ELISA using Premier™ Campy assay
(Meridian Biosciences). This microplate EIA
was performed according to manufacturer’s
instructions as follows:
Two hundreds µl of the stool samples in Cary–
Blair medium were thoroughly mixed in 200µl
of the diluent provided, then 200 µl of each
diluted stool specimen, positive and negative
controls were transferred to the appropriate
wells and incubated at room temperature for one
hour. Wells were washed 5 times with the wash
buffer and 2 drops of enzyme conjugate were
added to each well, sealed and incubated at
room temperature for 30 minutes. The washing
step is repeated, then 2 drops of substrate were
added to all wells, sealed and incubated at room
temperature for 10 minutes and lastly 2 drops of
stop solution were added and the reaction was
read at 450 nm (ETI System Fast Reader,
SorinBiomedica, Saluggia, Itlay). The validity
of each test run was based on appropriate
RESULTS
This study included 80 pediatric patients
attending the Pediatric Outpatient Clinic and
Pediatric Department of Benha University
Hospital, their ages ranged from 6 to 30 months
(20±8). All patients were complaining of
diarrhea, abdominal pain and fever. A total of
80 stool specimens were tested by culture using
mCCDA and were tested by the Premier Campy
assay and ImmunoCard STAT. Out of 80 stool
specimens, 9 were positive by culture and 71
were negative. The isolation rate of
campylobacter
among
children
with
gastroenteritis
was
11.25%.
These
9
campylobacter strains were isolated from 7
infants and 2 children. These were 6 males and
3 females.
Premier Campy assay detected the 9 true
positive samples and ImmunoCard STAT
detected 8 true positive samples out of the 9
culture- positive specimens. Premier Campy
assay detected 69 true negative specimens out of
the 71 true negative by culture in addition to 2
false positive samples and ImmunoCard STAT
detected 68 true negative specimens with 3 false
positive samples. The sensitivity of Premier
Campy assay and ImmunoCard STAT was
100% and 88.9%respectively. The specificities
were 97% and 95.8%. The PPVs were
81.9%and 72.7% and the NPVs were100% and
98.5%respectively. There was no statistically
significant difference in sensitivity, specificity,
PPV and NPV of both methods.
95
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Table 1. Statistical analyses of the Premier™ Campy assay and ImmunoCard STAT methods using
culture as the reference method
Premier™ Campy
ImmunoCard
Z
P
assay/culture
STAT/culture
True positive
9
8
False negative
0
1
True negative
69
68
False positive
2
3
Sensitivity
(9/9) 100%
(8/9) 88.9%
1.03
0.3
Specificity
(69/71) 97%
(68/71) 95.8%
0.46
0.64
PPV
(9/11) 81.9%
(8/11) 72.7%
0.51
0.61
NPV
(69/69) 100%
(68/69) 98.5%
1.004
0.31
Table 2 . Distribution of the 9 positive cases studied according to age group, gender and breast feeding
Age group
Total no.
No. male
No. female
Breast feeding
Infants
7
4
3
4
Children
2
2
0
Total
9
6
3
4
preservation of microbiological samples(15). In
this study Cary–Blair medium was used as a
transport medium for transport of stool
specimens to the laboratory for immediate
inoculation and for preservation of stool
specimens at -20 °C for up to 4 months prior
used in EIA as described by Dediste et al.(14).
Endtz et al.(15) showed that six of 11 C. jejuni
culture-positive samples, that had been obtained
from patients with Guillain–Barré syndrome and
stored at - 20 °C for periods of up to 5 years,
tested
positive
with
the
ProSpecT
Campylobacter Microplate Assay.
Our study showed that the isolation rate of
campylobacter
among
children
with
gastroenteritis was 11.25% and this result agrees
with that reported by Coker et al.(16) who
reported that campylobacter isolation rates in
developing countries range from 5 to 20%. It
also agrees with the study of Pazzaglia et al (17)
who showed that the overall isolation
frequencies of Campylobacter spp. were 16.8%
for cases of campylobacter-associated diarrhea
in Egyptian infants and with that of Rao et al (18)
who demonstrated in their study that the
isolation rate of campylobacter was 9% in rural
Egyptian children, and finally with the result of
Emilie et al (8) who showed that the incidence of
campylobacter infection was 9.5%
Patti (19) showed in his Multicenter study to
evaluate diagnostic methods for detection and
isolation of campylobacter from stool in 8 states
of USA that 3.2% of stool specimens were
positive for campylobacter by culture. This
lower isolation rate of campylobacter in his
DISCUSSION
Campylobacter is one of the most
frequently isolated bacteria from stools of
infants with diarrhea in developing countries as
a result of contaminated food or water(10). Acute
enteritis is the most common presentation of C.
jejuni infection, and
the illness is
indistinguishable from that caused by other
organisms. Although campylobacter enteritis
has a good prognosis, appropriate chemotherapy
can decrease the duration and severity of illness
and prevent complications of C. jejuni infection
including Guillain–Barré syndrome(11). The
appropriate identification of the etiologic agent
of infectious gastroenteritis is important, since
there are major differences in the treatment
required for the different agents(12).
Several selective media, with and without
blood, have been developed for the isolation of
campylobacter from stool specimens(13). For the
isolation of C. jejuni and C. coli from clinical
specimens, incubation on a selective agar at 42
°C for 48–72 h is necessary. Although obtaining
cultures of the organism from stool samples
remains the best way to confirm the etiology of
infection, the diagnosis comes too late and does
not allow beneficial chemotherapy. Therefore, a
rapid non-culture assay for detection of
Campylobacter may be of interest to both the
clinician and the microbiology laboratory.
Same-day results would allow triage of patients
for early therapy(14).
Many microbiological laboratories use
several transport media for short-term
96
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
specimens from patients for whom antimicrobial
therapy (erythromycin) is justified, including
acutely ill patients, persistent fever, persistent
bloody diarrhea, and significant volume loss, a
history of diarrhea of more than 7 days; HIVinfected individuals; and immunocompromised
persons.
As regard evaluation of the lateral-flow
ImmunoCard STAT in this work, it has a
sensitivity of 88.9%. & specificity of 95.8%, its
PPV was 72.7%, NPV was 98.5%.This results
agree with that of Granato et al(9) who reported
an acceptable performance sensitivity of 98% &
specificity of 94.2%, its PPV was 92.6%, NPV
was 98.8% giving its convenience in use and the
short turnaround times for final test results. It
provides early therapeutic decision, not affected
by organism viability and can be used in routine
use in small-volume laboratories. Also Killer et
al. (23) in their evaluation of Immunocard Stat
!Campy using 30 specimens from children,
stated that it could be an advantageous
alternative to conventional culture.
Kawatsu et al (3) have evaluated an
immunochromatographic assay (Campy-ICA)
using a single monoclonal antibody against a
15-kDa cell surface protein of Campylobacter
jejuni to detect C. jejuni and C. coli in human
stool. The Campy-ICA results showed a
sensitivity of 84.8% (28 of 33 specimens) and a
specificity of 100% (189 of 189 specimens)
compared to the results of isolation of C. jejuni
and C. coli from the stool specimens by a
bacterial culture test. The Campy-ICA was
simple to perform and was able to detect
campylobacter antigen in a fecal extract within
15 min. These results suggest that Campy-ICA
testing of fecal extracts may be useful as a
simple and rapid adjunct to stool culture for
detecting C. jejuni and C. coli in human stool
specimens.
From this study we conclude that Premier
Campy assay and ImmunoCard STAT are
convenient methods with short turnaround times
for final test results, they provide rapid and
reliable alternatives for the laboratory diagnosis
of campylobacter enteric infections. The use of
these methods offers the potential for providing
same-day results and eliminates the need of
42°C incubation and special kits for generating
a microaerophilic environment. They are useful
as simple and rapid methods for detecting C.
jejuni and C. coli in human stool specimens and
that conventional culture may no longer be the
recommended method for diagnosis.
Conclusion:
Our study revealed that Premier Campy
assay and ImmunoCard STAT are convenient
study is much lower than the above studies.
This may be due to good sanitary condition
which is not available in developing countries
including Egypt. Poor hygiene and sanitation
and the close proximity to animals in
developing countries all contribute to easy and
frequent acquisition of any enteric pathogen,
including campylobacter.
Also our study demonstrates that 7 out of
the 9 cases of campylobacter infection were
infants and this result agrees with Rao et al (17)
who reported that campylobacter is the most
commonly isolated bacterial pathogen from
children <2-years-old with diarrhea.
As regard evaluation of Premier Campy
microplate EIAs in this work, the sensitivity
was 100% & the specificity was 97%, its PPV
was 81.8% and NPV was 100%. This is in line
with and near the results of Granato et al.(9)
who showed in his study that, the Premier
Campy microplate EIAs had sensitivity of
99.3%, & specificity of 96.1%, its PPV was
90%, NPV was 99.7%. Our results are also in
agreement with that of Tolcin et al (20) who
showed that rapid enzyme immunoassay for the
detection of campylobacter-specific antigens
demonstrated 96% sensitivity and 99%
specificity and it is an acceptable alternative
method of campylobacter detection.
Endtz et al.(21) recorded a sensitivity of
ProspecT Campylobacter Microplate Assay
(Alexon-Trend, USA) relative to culture to be
80% (24/30) and all of the 24 positive samples,
except for one, remained positive after being
stored at -20 °C for 60 days. The specificity of
the test was 100%. Hindiyeh et al.(22) in their
study evaluated
ProSpecT Campylobacter
Microplate Assay compared to culture on a
Campy-CVA plate (Remel, Lenexa, Kans.) and
blood-free
campylobacter
agar
with
cefoperazone (20 microg/ml), amphotericin B
(10 microg/ml), and teicoplanin (4 microg/ml)
and the results confirmed a high sensitivity and
a specificity of 89% and 99%, respectively. The
positive and negative predictive values found
were 80% and 99%, respectively. There was no
statistically significant difference in sensitivity
and specificity if the stool was fresh or
preserved in Cary-Blair medium.
Dediste et al.(14) reported that the ProSpecT
Campylobacter Microplate Assay allows sameday treatment. They found that, although it is
less sensitive than the standard culture (89.1%)
for both C. jejuni and C. coli, the high
specificity of the ProSpecT Campylobacter
Microplate Assay (97.7%) allows a firm
diagnosis to be made with a positive result. The
test could therefore be useful when examining
97
Egyptian Journal of Medical Microbiology, January 2012
methods with short turnaround times for final
test results and they provide rapid and reliable
alternatives for conventional culture in the
laboratory diagnosis of campylobacter enteric
infections.
10. Oberhelman RA, Taylor DN.
Campylobacter infections in developing
countries. In: I Nachamkin and MJ Blaser
(eds). Campylobacter,
2nd
edition.
Washington: American Society for
Microbiology. 2000; p.139-53.
11. 11-Allos BM, Lippy FT, Carlsen A,
Washburn RG, Blaser MJ. 1998.
Campylobacter jejuni strains from patients
with Guillain–Barre syndrome. Emerg
Infect Dis. 4: 263–8.
12. Vandenberg O, Houf K, Douat N, Vlaes
L, Retore P, Butzler J-P and Dediste A.
2006. Antimicrobial susceptibility of
clinical
isolates
of
non-jejuni/coli
campylobacters and arcobacters from
Belgium
Journal
of
Antimicrobial
Chemotherapy. 57:908–3
13. Lopez L, Castillo FJ, Clavel A, Rubio
MC. 1998. Use of a selective medium and a
membrane filter method for isolation of
Campylobacter species from Spanish
paediatric patients. Eur J Clin Microbiol
Infect Dis.17: 489–92.
14. Dediste A, Vandenberg O, Vlaes L,
Ebraert A, Douat N, Bahwere P, Butzler
JP. 2003. Evaluation of the ProSpecT
Microplate Assay for detection of
Campylobacter: a routine laboratory
perspective.
Clin
Microbiol
Infec.
9(11):1085-90.
15. Wasfy M, Oyofo B, Elgindy A, Churilla
A. 1995. Comparison of preservation media
for storage of stool samples. J Clin
Microbiol. 33: 2176–8.
16. Coker AO, Isokpehi RD, Thomas BN,
Amisu KO, and Obi CL.
Human
Campylobacteriosis
in
Developing
Countries .Emerging Infectious Disease
Journal. 2002; 8(3).
17. Pazzaglia
G, Bourgeois
AL, Araby
I, Mikhail
I, Podgore
JK, Mourad
A, Riad S, Gaffar T, Ramadan AM..
Campylobacter-associated diarrhoea in
Egyptian infants: epidemiology and clinical
manifestations of disease and high
frequency of concomitant infections. J
Diarrhoeal Dis Res. 1993; 11(1):6-13.
18. Rao MR, Naficy AB, Savarino SJ, AbuElyazeed R, Wierzba TF, Peruski LF.
Pathogenicity and convalescent excretion of
Campylobacter in rural Egyptian children.
Am J Epidemiol. 2001;154:166–73.
19. Patti, F. Multicenter Study to Evaluate
Diagnostic Methods for Detection and
Isolation of Campylobacter from Stool.
2011;15thAnnual Pulse Net CDC
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
Vol. 21, No. 1
Ryan, KJ. Campylobacter In: KJ Ryan
and CG Ray (eds), Sherris Medical
Microbiology (4th ed.). McGraw Hill.
2004; p. 378–80.
Adedayo O, and Kirkpatrick B D.
Campylobacter jejuni infections: update on
presentation, diagnosis, and management.
Hosp. Physician 2008; 44:9-15.
Kawatsu K, Kumeda Y, Taguchi M,
Yamazaki-Matsune W, Kanki M, Inoue
K. Development and evaluation of
immunochromatographic assay for simple
and rapid detection of Campylobacter jejuni
and Campylobacter coli in human stool
specimens.
J
Clin
Microbiol.
2008;46(4):1226-31.
World Health Organization. 2009
Diarrhoeal Diseases (Updated February
[http://www.who.int/vaccine_research/disea
ses/diarrhoeal/en/index.html
Cooker AO, Isokpehi R, Thomas BN,
Amisu KO and Obi CL.
Human
campylobacteriosis in developing countries.
Emerg Infect Dis. 2002;8(3):237-44
Fitzgerald C, and Nachamkin I.
Campylobacter and Arcobacter In :P. R.
Murray, E. J. Baron, J. H. Jorgensen, M.
L. Landry, and M. A. Pfaller (eds),
Manual of Clinical Microbiology, 9th ed.
ASM Press, Washington, DC. 2007; p. 933946.
Skirrrow M B and Blaser M J. Clinical
aspects of Campylobacter infection In I.
Nachamkin and M. J. Blaser (ed.),
Campylobacter, 2nd ed. ASM Press,
Washington, DC. 2000; p. 69-88.
Emilie B, Adline D, Elodie SI, Alice B
and Francis M. New Methods for
Detection of Campylobacters in Stool
Samples in Comparison to Culture . J. Clin.
Microbiol. vol. 2011; 49 (3) 941-944
Granato P A, ChenI, Holiday I, Rawling
R, Novak-Weekley S M, Quinlan T, and
Musser KA. Comparison of Premier
CAMPY Enzyme Immunoassay (EIA),
ProSpecT Campylobacter EIA, and
ImmunoCard STAT! CAMPY Tests with
Culture for Laboratory Diagnosis of
Campylobacter Enteric Infections J Clin
Microbiol. 2010; 48(11): 4022–4027.
98
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
22. Hindiyeh M, Jense S, Hohmann S, Benett
H, Edwards C, Aldeen W, Croft A, Daly
J, Mottice S, Carroll KC. Rapid detection
of Campylobacter jejuni in stool specimens
by an enzyme immunoassay and
surveillance for Campylobacter upsaliensis
in the greater Salt Lake City area. J Clin
Microbiol. 2000;38(8):3076-9.
23. Keller L, Cohen-Bacrie S, Prère MF..
Evaluation of three rapid assays for direct
diagnosis of Campylobacter jejuni and C.
coli from stools. Pathol Biol (Paris).
2011;59(1):16-8.
20. Tolcin R, Margaret M, Barbara A, Emily
A, Franklin R and Gary W. Evaluation of
the Alexon-trend ProSpecT Campylobacter
microplate assay. J. Clin. Microbiol. 2000;
38:3853–3855.
21. Endtz HP, Ang CW, van den Braak N,
Luijendijk A, Jacobs BC, de Man P, van
Duin JM, van Belkum A, Verbrugh HA.
Evaluation of a new commercial
immunoassay for rapid detection of
Campylobacter jejuni in stool samples. Eur
J Clin Microbiol Infect Dis. 2000;
19(10):794-7.
99
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫اﻻآﺘﺸﺎف اﻟﻤﺒﺎﺷﺮ ﻟﻤﻮﻟﺪات اﻟﻌﻄﺎﺋﻒ ﻓﻰ اﻟﺒﺮاز ﻣﻘﺎرﻧﺔ ﻣﻊ ﻃﺮﻳﻘﺔ اﻟﺰرع اﻟﺘﻘﻠﻴﺪﻳﺔ ﻟﺘﺸﺨﻴﺺ‬
‫داء اﻟﻌﻄﺎﺋﻒ آﻤﺴﺒﺐ ﻟﻠﻨﺰﻻت اﻟﻤﻌﻮﻳﺔ ﻓﻰ اﻻﻃﻔﺎل‬
‫ﻋﺒﻴﺮ أﺣﻤﺪ أﺑﻮاﻟﻌﺰم ‪ ,‬ﺷﻴﺮﻳﻦ ﻣﺤﻤﺪ اﻣﺎم‬
‫ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻲ واﻟﻤﻨﺎﻋﺔ آﻠﻴﺔ اﻟﻄﺐ ﺟﺎﻣﻌﺔ ﺑﻨﻬﺎ‬
‫اﻟﺨﻠﻔﻴ ﺔ ‪ /‬اﻟﻬ ﺪف داء اﻟﻌﻄ ﺎﺋﻒ ﻣ ﻦ اﻷﻣ ﺮاض اﻟﻤﻌﺪﻳ ﺔ اﻟﺘ ﻲ ﺗ ﺴﺒﺒﻬﺎ اﻟﺒﻜﺘﻴﺮﻳ ﺎ ﻣ ﻦ ﺟ ﻨﺲ اﻟﻌﻄ ﺎﺋﻒ‪ .‬اﻟﻌﻄﻴﻔ ﺔ ه ﻲ أﺣ ﺪ اﻷﺳ ﺒﺎب‬
‫اﻟﺮﺋﻴﺴﻴﺔ ﻻﻟﺘﻬﺎب اﻟﻤﻌﺪة واﻷﻣﻌﺎء اﻟﺒﻜﺘﻴﺮﻳﺔ ﻓ ﻰ اﻹﻧ ﺴﺎن ﻓ ﻲ آﺜﻴ ﺮ ﻣ ﻦ اﻟﺒﻠ ﺪان اﻟ ﺼﻨﺎﻋﻴﺔ واﻟﻨﺎﻣﻴ ﺔ‪ .‬وﺗﺤ ﺪث اﻟﻐﺎﻟﺒﻴ ﺔ )‪ (٪٩٠‬ﻣ ﻦ‬
‫ﺣﺎﻻت اﻟﺘﻬﺎب اﻟﻤﻌﺪة واﻷﻣﻌﺎء اﻟﻌﻄﻔﻴﺔ ﻓﻲ اﻟﺒﺸﺮ ﺑﻮاﺳﻄﺔ اﻟﺼﺎﺋﻤﻴﺔ اﻟﻌﻄﻴﻔﺔ‪ ،‬اﻣﺎ ﺳﺒﺐ ﻣﻌﻈﻢ ﻣﺎ ﺗﺒﻘﻰ ﻣﻦ اﻟﺤﺎﻻت هﻮ اﻟﻌﻄﻴﻔ ﺔ‬
‫اﻟﻘﻮﻟﻮﻧﻴﺔ‪ .‬زرع اﻟﺒ ﺮاز ﻋﻠ ﻰ وﺳ ﻂ ﺁﺟ ﺎر اﻧﺘﻘ ﺎﺋﻲ ﻳﺘﻄﻠ ﺐ ﻋ ﺎدة ﻣ ﺎ ﻻ ﻳﻘ ﻞ ﻋ ﻦ ‪ ٤٨‬ﺳ ﺎﻋﺔ ﻧﻈ ﺮا ﻟ ﺒﻂء اﻟﻨﻤ ﻮ ﻣ ﻦ اﻟﻜﺎﺋﻨ ﺎت اﻟﺤﻴ ﺔ‬
‫اﻟﻌﻄﻴﻔﺔ‪ ،‬واﻟﺘﻌﺮف ﻋﻠﻰ اﻟﻤﺸﺘﺒﻪ ﺑﻪ ﻣﻦ اﻟﻤﺴﺘﻌﻤﺮات هﻮ إﺟﺮاء ﺷﺎق وﻳﺴﺘﻬﻠﻚ اﻟﻜﺜﻴﺮ ﻣﻦ اﻟﻮﻗ ﺖ ‪ .‬و اﻟﻬ ﺪف ﻣ ﻦ ه ﺬﻩ اﻟﺪراﺳ ﺔ‬
‫هﻮ ﺗﻘﻴﻴﻢ ﻃﺮق ﻣﺨﺘﻠﻔﺔ ﻟﺘﺸﺨﻴﺺ داء اﻟﻌﻄﺎﺋﻒ وذﻟﻚ ﻋﻦ ﻃﺮﻳﻖ اﻟﻜﺸﻒ ﻋﻦ ﻣﻮﻟﺪات اﻟﻌﻄﻴﻔ ﺔ ﻣﺒﺎﺷ ﺮة ﻓ ﻰ ﻋﻴﻨ ﺔ اﻟﺒ ﺮازﻋﻦ‬
‫ﻃﺮﻳﻖ اﺧﺘﺒﺎر اﻹﻟﻴﺰا و اﺧﺘﺒﺎر اﻟﺘﺪﻓﻖ اﻟﻄﺮﻓﻰ اﻟﻤﻨﺎﻋﻰ ﺑﺎﻟﻤﻘﺎرﻧﺔ ﻣ ﻊ ﻃﺮﻳﻘ ﺔ اﻟ ﺰرع اﻟﺘﻘﻠﻴﺪﻳ ﺔ ﻟﻠﻜ ﺸﻒ ﻋ ﻦ اﻟﻌﻄﻴﻔ ﺔ ﻓ ﻲ ﻋﻴﻨ ﺎت‬
‫اﻟﺒﺮاز ﻟﻸﻃﻔﺎل ﻓﻲ ﺣﺎﻻت اﻟﺘﻬﺎب اﻟﻤﻌﺪة واﻷﻣﻌﺎءز‬
‫اﻟﻄ ﺮق‪:‬وﻗ ﺪ ﻋﻘ ﺪت ه ﺬﻩ اﻟﺪراﺳ ﺔ ﻓ ﻲ ﻗ ﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟ ﻮﺟﻲ واﻟﻤﻨﺎﻋ ﺔ اﻟﻄﺒﻴ ﺔ ﺑﻜﻠﻴ ﺔ اﻟﻄ ﺐ ﺟﺎﻣﻌ ﺔ ﺑﻨﻬ ﺎ‪ ،‬ﻣ ﻦ ﻣ ﺎﻳﻮ ‪ ٢٠١١‬اﻟ ﻰ‬
‫اﻏ ﺴﻄﺲ ‪ .٢٠١١‬وﻗ ﺪ ﺗ ﻢ ﺟﻤ ﻊ ‪ ٨٠‬ﻋﻴﻨ ﺔ ﺑ ﺮاز ﻣ ﻦ اﻷﻃﻔ ﺎل اﻟﻤﺮﺿ ﻰ اﻟ ﺬﻳﻦ ﻳﺤ ﻀﺮون اﻟﻌﻴ ﺎدة اﻟﺨﺎرﺟﻴ ﺔ ﻟﻸﻃﻔ ﺎل وﻗ ﺴﻢ ﻃ ﺐ‬
‫اﻷﻃﻔﺎل ﻓﻲ ﻣﺴﺘﺸﻔﻰ ﺑﻨﻬﺎ اﻟﺠﺎﻣﻌﻲ‪ ،‬ﺗﺘﺮاوح أﻋﻤﺎرهﻢ ﻣﻦ ‪ ٣٠-٦‬ﺷ ﻬﺮا‪ .‬وآ ﺎن ﺟﻤﻴ ﻊ اﻟﻤﺮﺿ ﻰ ﻳ ﺸﻜﻮن ﻣ ﻦ اﻻﺳ ﻬﺎل واﻷﻟ ﻢ ﻓ ﻲ‬
‫اﻟﺒﻄﻦ واﻟﺤﻤﻰ وﻗﺪ ﺗﻢ زرع ﻋﻴﻨﺎت اﻟﺒﺮاز ﻋﻠﻰ ﻣﺴﺘﻨﺒﺖ اﻧﺘﻘﺎﺋﻲ ﻟﻠﻌﻄﺎﺋﻒ وآﺬﻟﻚ ﺗﻢ اﻟﻜﺸﻒ ﻋ ﻦ ﻣﻮﻟ ﺪات اﻟﻌﻄﻴﻔ ﺔ ﻣﺒﺎﺷ ﺮة ﻓ ﻰ‬
‫ﻋﻴﻨﺔ اﻟﺒﺮازﻋﻦ ﻃﺮﻳﻖ اﺧﺘﺒﺎر اﻹﻟﻴﺰا و اﺧﺘﺒﺎر اﻟﺘﺪﻓﻖ اﻟﻄﺮﻓﻰ اﻟﻤﻨﺎﻋﻰ ‪.‬‬
‫اﻟﻨﺘ ﺎﺋﺞ‪ .:‬وآ ﺎن اﺧﺘﺒ ﺎر اﻹﻟﻴ ﺰا ﺣ ﺴﺎﺳﻴﺘﻪ ‪ ٪ ١٠٠‬و ﻣﺘﺨ ﺼﺺ ﺑﻨ ﺴﺒﺔ ‪ ٪ ٩٧‬وآﺎﻧ ﺖ ﻗﻴﻤﺘ ﻪ اﻟﺘﻨﺒﺆﻳ ﺔ اﻹﻳﺠﺎﺑﻴ ﺔ ‪ ٪٨١.٨‬و‬
‫اﻟﺴﻠﺒﻴﺔ ‪ %١٠٠‬اﻣﺎ اﺧﺘﺒﺎر اﻟﺘﺪﻓﻖ اﻟﻄﺮﻓﻰ اﻟﻤﻨﺎﻋﻰ ﻓﻜﺎﻧﺖ ﺣﺴﺎﺳﻴﺘﻪ ‪ . ٪ ٨٨.٩‬وآﺎن ﻣﺘﺨﺼﺺ ﺑﻨﺴﺒﺔ ‪ ٪ ٩٥.٨‬و‪ .‬آﺎﻧﺖ اﻟﻘﻴﻤﺔ‬
‫اﻟﺘﻨﺒﺆﻳﺔ اﻹﻳﺠﺎﺑﻴﺔ ‪ ٪ ٧٢.٧‬اﻣﺎ اﻟﻘﻴﻤﺔ اﻟﺘﻨﺒﺆﻳﺔ اﻟﺴﻠﺒﻴﺔ ﻓﻘﺪ آﺎﻧﺖ ‪.٩٨.٥%‬‬
‫ﻓﻲ اﻟﺨﺘﺎم‬
‫ﺗﻌﺪ ﻃﺮﻳﻘﺔ اﻟﻜﺸﻒ اﻟﻤﺒﺎﺷﺮ ﻋﻦ ﻣﻮﻟﺪات اﻟﻌﻄﻴﻔﺔ ﻓﻰ ﻋﻴﻨﺔ اﻟﺒﺮازﻋﻦ ﻃﺮﻳﻖ اﺧﺘﺒﺎر اﻹﻟﻴﺰا و اﺧﺘﺒﺎر اﻟﺘ ﺪﻓﻖ اﻟﻄﺮﻓ ﻰ اﻟﻤﻨ ﺎﻋﻰ‬
‫اﻋﻄﻰ ﻧﺘﺎﺋﺞ ﻣﻤﺘﺎزة آﻤﺎ ﻳﺆﺧﺬ ﺑﺎﻻﻋﺘﺒﺎر ﻣﺪى ﺳﺮﻋﺘﻬﺎ وﺳﻬﻮﻟﺘﻬﺎ ﺑﺎﻟﻤﻘﺎرﻧﺔ ﻣﻊ ﻃﺮﻳﻘﺔ اﻟﺰرع اﻟﺘﻘﻠﻴﺪﻳﺔ ﻟﻠﻜ ﺸﻒ ﻋ ﻦ اﻟﻌﻄﻴﻔ ﺔ ﻓ ﻲ‬
‫ﻋﻴﻨﺎت اﻟﺒﺮاز ﻟﻸﻃﻔﺎل ﻓﻲ ﺣﺎﻻت اﻟﻨﺰﻻت اﻟﻤﻌﻮﻳﺔ‪.‬‬
‫‪100‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Identification of Il-13 1923 C/T as Risk Locus for Asthma in Children
Eman M El-Behady and Rabab M El-Behady*
Microbiology and Immunology & Pediatrics* Departments,
Faculty of Medicine, Zagazig University
ABSTRACT
Objective To investigate the single nucleotide polymorphism (SNP) of +1923C/T in intron-3 region of
interleukin-13 (IL-13) gene and the susceptibility of asthma, and to study the impact of this
polymorphism upon degree of asthma severity. Methods: The method of restriction fragment length
polymorphism (RFLP) was adopted in detecting +1923 site polymorphism of IL-13 gene in intron 3
region, ELISA was employed in detecting the levels of serum IL-13, and total immunoglobulin E (IgE).
There were 50 asthmatic children with varying degrees of asthma severity and 30 control children with
matching age and sex. Pulmonary function was done for all. Results: TT and TC genotypes frequency
were significantly higher in asthma group than control group. CC genotype frequency was higher in the
control group than in the asthma group. TT genotype frequency was significantly higher in sever asthma
than mild and moderate asthma .TC and CC genotype frequency were significantly higher in mild and
moderate asthma groups than sever asthma group .The levels of serum IL-13 and IgE were significantly
higher in asthmatics than controls and in TT genotype than TC and CC genotypes in asthmatics. FEV1%
was significantly reduced in TT genotype asthmatics than others. TT genotype was the frequent allele in
sever asthmatics in comparison to mild and moderate ones. Conclusion: IL-13 intron 3 +1923 locus is a
susceptible SNP for asthma in our population. The TT genotype variant is a predictive factor for asthma
severity.
Several cytokine gene polymorphisms in
the cytokine gene regulatory regions correlate
with cytokine secretion, and one individual may
have a cytokine expression pattern quite
different from another with different degree of
severity(7).
The IL13 gene is located on chromosome
5q31, in a region in which genome searches
have identified some linkage with asthma and
atopic diseases in different populations(8).
During the past 10 years, numerous studies
have begun to assess the contribution of specific
genes and SNPs to the development of the
asthmatic phenotype(3).
Two single nucleotide polymorphisms
(SNPs) of IL13 have been investigated in
relation to asthma. One is located in the
promoter region, at position –1112 relative to
the transcription start site. Another is a G→A
2044 in the coding region which leads to the
R130Q amino acid substitution(9).
Intron, which is thought to have no function
at all, is one of the major uncoding elements.
But recent studies have indicated that intron has
an important function for pre RNA splicing. The
point mutation in intron may cause abnormal
splicing and form different proteins(10).
There is no data on Egyptian children on
the association of the C +1923 T intron 3
polymorphism with asthma. Hence, we thought
INTRODUCTION
Asthma is a common clinical syndrome
resulting from several factors such as immunity,
heredity, and environment. A number of genes
have been proposed as causing or contributing
to the development of asthma. In all cases,
chronic inflammation coupled with the rise of
total immunoglobulin (Ig) E and allergy specific
IgE levels leads to airway hyper-responsiveness,
which is a hallmark clinical feature of allergic
asthma(1).
Asthma main immunologic pathogenesis is
an imbalance in helper T cell (Th) with
decreased Th1 cytokine secretion and increased
Th2 cytokine secretion(2). Interleukin (IL)-13 is
a central mediator of Th2 immune responses(3).
IL-13 promotes the differentiation and
survival of eosinophils and mast cells. It also
induces the IgE isotype switch and vascular cell
adhesion molecule-1 (VCAM-1) expression(4).
However, it inhibits monocyte-mediated
antibody-dependent
cellular
cytotoxicity,
proinflammatory
cytokine/chemokine
production and nitric oxide secretion(5).
Administration of IL-13 induces eosinophilic
infiltration
of
the
airways.
IL-13–
overexpressing mice exhibit eosinophilic
bronchial inflammation, mucus hypersecretion,
fibrosis, eotaxin production, and nonspecific
airway hyperreactivity(6).
101
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
and the remainder was left for 30-60 minutes for
spontaneous clotting at room temperature and
centrifuged at 3000 rpm for 10 minutes. Serum
samples were transferred to 1.5 ml Eppendorf
tube. The serum samples were kept frozen at –
20oC, until used for cytokine assay.
Measurement of serum IL13 level:
Serum IL13 was measured using
commercial human IL-13 ELTZA kit employs
the quantitative sandwich enzyme immunoassay
(ADipo Bioscience, USA) in which IL13 if
present binds and becomes immobilized by the
monoclonal antibody precoated on the well. The
test was made according to the instructions of
the manufacture.
Measurement of total IgE level:
Total IgE level was measured by
commercial enzyme immunoassay (EIA) for the
quantitative detection of IgE antibodies in
human serum. (RIDScreen, R-Biopharma AG,
Germany) according to the manufacture's
instructions .
Genotyping
*DNA extraction
Genomic DNA was extracted using Axy
Prep Blood Genomic DNA Miniprep kit
(Axygen bioscence, USA) according to the
intstructions of the manufacture.
Polymerase chain reaction (PCR) combined
with restriction fragment length polymorphism
(RFLP) analysis was used to analyze IL13
interon 3+ 1923.
* PCR amplification
PCR reactions were all performed using
Taq PCR beads. (BIORON, Germany). Each
beads contains all necessary reagents for
amplification .
PCR primers were, Sense primer (5\
GGCTGAATATCCATGGTGTGTGTCC
3\)
and
antisense
primer
(5\GGCTGAGGTCGGCTAGGCTGAAGAC3\)
(14)
(Operon Biotoechnologies , Germany).
2ul of extracted DNA were amplified in 50
ul PCR reaction mixture mix contaning (2.5
units Taq DNA Polymerase, 250m M each
dNTP, 10mM tris–Hcl (pH 9), 30mM Kcl and
1.5 mM Mgcl2) and 25 pmol each primer. The
amplification was performed in DNA thermal
cycler (Heated lid thermal cycler, Biometra Ltd
Germany )
Amplification program set at 94oC for 10
minutes, 94oC for 30 seconds, 58oC for 40
seconds, 72oC for 50 seconds for 38 cycles, and
finally 72 oC for 7 minutes(15).
Restriction endonuclease analysis:
2 ul of BsaAI (New England Biolabs) were
added to 16 ul PCR products and 2ul 10x buffer.
The mixture was kept in 37oC water bath for 4
to investigate the possibility of such association
with asthma susceptibility and severity.
MATERIAL AND METHODS
The study was carried in Pediatrics &
Microbiology and Immunology Departments.
From December 2010 to November 2011 in
Faculty of Medicine, Zagazig University.
This case-control study comprised 50
asthmatic and 30 healthy children as a control
group. The asthmatic children were enrolled
consecutively from the Pediatric pulmonology,
Allergy and Immunology Unit, Children's
Hospital, Zagazig University. The diagnosis of
asthma in the studied patients was made
according to the criteria of the American
Thoracic Society(11). They were 25 males and 25
females, their ages ranged from 8 to 13 years
with a mean age of 9.3±1.8 years. According to
the GINA(12) classification, the selected patients
were classified into 15 patients with severe
persistent asthma, 16 patients with moderate
persistent asthma and 19 patients with mild
persistent asthma. Children with data suggestive
of chest infection, parasitic or concomitant
diseases were excluded from the study.
The control group comprised 30 clinically
healthy children (15 males and 15 females).
Their ages ranged from 8 to 13 years with a
mean value of 9.2±1.6 years. The inclusion
criteria for the control group were as follows: no
symptoms or history of asthma, no symptoms or
history of other pulmonary diseases, no
symptoms or history of allergy, and no firstdegree relatives with a history of asthma or
atopy.
This study was conducted with approval
from the Ethics Committee of the Zagazig
University Hospital. An informed consent was
obtained from the parents or care-givers of all
children before enrollment.
Study Measurements
Lung
Function
Tests:
Short-acting
bronchodilators were stopped at least 8 hrs.
before the test. Dynamic spirometry was
performed by means of a pneumotachograph
(Masterlab Jaeger, Wu¨rzberg, Germany), with
measurement of forced expiratory volume in 1
sec (FEV1)٪ predicted, according to the
standards of the European Respirator Society(13).
The highest values of FEV1 of three forced
expiratory maneuvers were used.
Blood sample collection
A 4 ml blood sample were taken under
aseptic conditions and divided into 2 portions . 1
ml of whole blood was collected in sterile
EDTA- containing tubes for DNA extraction
102
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
(16.7%) showed TC genotype and 25 (83.3%)
showed CC genotype.
TT and TC genotypes frequency were
significantly higher in asthma group than
control group. CC genotype frequency was
higher the control group than in the asthma
group. TT genotype frequency was significantly
higher in sever asthma than mild and moderate
asthma .TC and CC genotype frequency were
significantly higher in mild and moderate
asthma groups than sever asthma group (Table 1
and Fig. 1).
hours. The amplified products were separated
by electrophoresis on 2.5% agarose gel stained
with ethidium bromide in parallel with 100bp
DNA molecular weight marker (Promega USA).
After digestion with restriction enzyme and
subsquent genotype for IL 13 intron3+ 1923
lous were TT gene type manifested as a single
band 559 bp, CC type as 2 bands 310 bp and
249 bp, TC type was 3bands 559bp , 310 bp 249
bp(15).
Statistical analysis
Data were analyzed by computer using the
statistical program SPSS for Windows version
13. The mean, standard deviation, were
presented for the descriptive analysis of the
groups. Groups were compared using the
Student's t-test or the Mann-Whitney test (in
case of non-parametric data). Fisher's Exact test
was used for comparison of categorical data.
Anova used for comparison between different
groups, also correlation was done to define the
association between different parameters. In all
tests p values less than 0.05 were considered
statistically significant.
The levels of serum IL13 and total IgE
Serum IL13 and total IgE levels were
significantly higher in asthmatics in comparison
to controls. Serum IL13 and total IgE levels
were significantly higher in TT asthma
genotype in comparison to TC and CC asthma
genotypes (Table 2).
There was significant positive correlation
between serum IL-13 and IgE levels in different
asthma groups (Table 3 and Figs. 2, 4, 6).
FEV1% predicted in studied children
FEV1% was significantly reduced in
asthmatics in comparison to controls. TT
asthmatic genotype was significantly reduced
than TC and CC asthmatic genotypes (Table 2).
There was significant negative correlation
between serum IL-13 levels and FEV1%
different asthma groups (Table 3 and Figs. 3, 5,
7).
RESULTS
Gene type frequency distribution of IL13
intron3 +1923 locus. Among 50 asthmatic
children, 10 (20%) showed TT genotype, 20
(40%) showed TC genotype, and 20 (40%)
showed CC genotype. In the control group, 5
Table (1): Genotype distribution among asthmatic children and controls.
Number(n)
TT
TC
50
10(20%) 20(40%)
All asthmatics
19
0
6(30%)
Mild persistent asthma
16
1(10%)
8(40%)
Moderate persistent asthma
15
9(90%)
6(30%)
Sever persistent asthma
30
0
5(16.7%)
Control
X2==27.94
P<0.001
103
CC
20(40%)
13(65%)
7(35%)
0
25(83.3%)
P
<0.001
0.29
<0.01
<0.001
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Fig. (1): Gel electrophoresis of RFLP:
Lane 1: 100bpDNA molecular weight marker
Lane 3: TT genotypes
Lane 4: CC genotypes
Lane 7: TC genotypes
Table (2): Comparison of serum IgE, IL-13 levels and FEV1% predicted in different genotypes in asthma
and control.
Asthma
Control
TT
TC
CC
TC
CC
261.9±53*
170.6±70.8
123.9± 37
23± 4.5
19.8 ± 3
IgE IU/ml
19.3± 2.9*
13.9 ± 4.9
10.7 ± 2.2
4.5± 0.86
3.9 ± 0.6
IL-13 pg/ml
76.9 ± 4.2*
83.5± 5.7
87.1± 3.4
99.9 ±4.7
100 ± 5.4
FEV1%
* P<0.05
Table (3): Correlation between serum IL-13 and IgE and FEV1% in different genotypes in asthmatic
children.
TT(IL-13)
TC(IL-13)
CC(IL-13)
r
P
R
p
r
P
0.84
<0.001
0.91
<0.001
0.73
<0.001
IgE
-0.79
<0.001
-0.88
<0.001
-0.7
<0.001
FEV1%
104
Egyptian Journal of Medical Microbiology, January 2012
100
90
80
350
r = 0.84, P<0.001
250
FEV1%
IgE (IU/ml)
300
Vol. 21, No. 1
200
150
100
70
60
50
40
30
20
10
0
50
0
0
10
20
r = -0.79, P<0.001
0
30
10
Fig. (2): Correlation between IL-13 and IgE in TT
genotype.
Fig. (3): Correlation between IL-13 and FEV1% in
TT genotype.
100
90
80
350
r = 0.91, P<0.001
FEV1%
IgE (IU/ml)
250
200
150
100
70
60
50
40
30
20
10
0
50
0
0
10
20
r = -0.88, P<0.001
0
30
10
20
30
IL-13 (pg/ml)
IL-13 (pg/ml)
Fig. (4): Correlation between IL-13 and IgE in TC
genotype.
Fig. (5): Correlation between IL-13 and FEV1% in
TC genotype.
94
250
r = 0.73, P<0.001
92
200
90
FEV1%
IgE (IU/ml)
30
IL-13 (pg/ml)
IL-13 (pg/ml)
300
20
150
100
88
86
84
82
50
80
r = -0.70, P<0.001
78
0
0
5
10
15
20
0
IL-13 (pg/ml)
Fig. (6): Correlation between IL-13 and IgE in CC
genotype.
5
10
15
20
IL-13 (pg/ml)
Fig. (7): Correlation between IL-13 and FEV1% in
CC genotype.
105
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
in IgE synthesis and airway obstruction with
decreased FEV1%.
Thus the close relationship of IL-13 gene
polymorphism with the levels of serum IL-13(22)
and IgE(15) suggests that IL-13 gene
polymorphism may play an important role in the
mechanism of childhood asthma. However non
of researchers investigate the effect of this
polymorphism on asthma severity.
This is the first Egyptian study verifying
the association of intron 3 +1923 locus gene
polymorphisms with asthma severity.
There was significant difference in
frequency of TT genotype when the mild,
moderate and severe groups and controls were
compared. There was a high level of
homozygotes for the TT genotype allele in the
severe group. Almost nine times more severe
asthmatics had the TT genotype, when
compared to asthmatics in the moderate group,
and none of mild and control group had TT
genotype. Saha et al. (23) found that IL-13
overexpression in sputum and bronchial biopsy
specimens is a feature of severe asthma. In
particular, IL-13 up-regulation is associated
with severe disease(24).
IL-13 gene polymorphism influences IL13 expression due to deficient methylated DNA
and methylcytidine when de-amino to form
thymine which interfere with IL-13 trascription,
thus the speed of transcription and IL-13
expression increase(25).
Thus TT genotype, the significant
frequent allel in severe asthmatic children, was
associated with highest IL-13 and IgE levels and
lowest FEV1%. These results suggest that this
allele is a predictive factor of asthma severity.
In conclusion IL-13 intron 3 +1923 locus
is a susceptible SNP for asthma in our
population. The TT genotype variant is a
predictive factor for asthma severity with
overexpression of IL-13. Larger studies are
needed to validate our findings which should
have larger sample sizes and analyze more SNP
loci.
DISCUSSION
Asthma can be said to be a complex
genetic disease in which there are multiple
genetic effects interacting with the environment
to modify susceptibility and severity of this
disease(16). In the present study on Egyptian
children, we investigated the association of
(SNP) IL-13 intron 3+1923 locus that control
the expression of important asthma molecules.
We
found
statistically
significant
difference in the IL-13 +1923 TT and TC
mutant genotype in our patients, compared to
controls. Therefore + 1923 locus is a susceptible
(SNP) for asthma in our population .This is
consistent with the findings of a similar study
by Li et al.(17) on this specific (SNP) in Chinese
children.
While Xiaoyan et al.(18) in another study in
Chinese children found no association between
the (SNP) IL-13 C 1923T and childhood
asthma. Such varied conclusions may be due to
the diverse genetic backgrounds in populations
of different nationalities.
When the impact of IL13 +1923
polymorphism on IL-13 levels was explored ,
serum IL13 was significantly elevated in
asthmatic children in comparison to controls
with significant elevation in IL-13 +1923 TT
genotype in comparison to TC and CC
asthmatic genotypes.
Thavagnanam et al.(19) found that IL13
drives pediatric bronchial epithelial cells of
normal children toward an asthmatic phenotype
and worsens the pediatric bronchial epithelial
cells phenotype in asthmatics with reduced
ciliated cell numbers and increased goblet cells.
In a study on Egyptian asthmatic children
Hussein et al.(20) found that the IL-13R +1398
A/G polymorphism does not contribute to
asthma or allergic rhinitis susceptibility, yet
serum IL-13 was significantly high in atopic
asthmatic children.
In the present study IgE was significantly
elevated in asthmatics in comparison to controls
with significant elevation in TT genotype in
comparison to TC and CC asthma genotypes,
this result was in agreement with other study(21).
TT genotype had the most lower FEV1%
predicted at base of study. There was significant
positive correlation between serum IL-13 and
IgE levels. Wang et al.(10) found a significant
correlation between the polymorphisms of
+1923C/Tsites of IL-13 gene and susceptibility
to asthma and increase of the total serum IgE.
There was also significant negative
correlation between serum IL13 and FEV1%.
Hence IL-13 is implicated as a central regulator
REFERENCES
1.
2.
106
Rigoli L, Briuglia S, Caimmi S, et al.
(2011): Gene-environment interaction in
childhood asthma. Int J Immunopathol
Pharmacol; 24(4) :41-7.
Kaminuma O, Kitamura F, Miyatake S,
et al. (2009): T-box 21 transcription factor
is responsible for distorted T(H)2
differentiation in human peripheral CD4+ T
cells. J Allergy Clin Immunol; 123: 813–
823.
Egyptian Journal of Medical Microbiology, January 2012
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Vol. 21, No. 1
15. Qing Chen J, Ping Zhou G and Ping Sun
H (2005): Effects of IL-13 gene
polymorphism on the levels of serum IL-13
and total Ig-E in asthmatic children. World
J Pediatr; 1(1): 66-68.
16. Faria ICJ, Faria EJ, Toro ADC, et al.
(2008): Association of TGF-β1, CD14, IL4,
IL-4R
and
ADAM33
gene
polymorphisms with asthma severity in
children and adolescents .Jornal de
Pediatria; 84(3):203-210.
17. Li X, Zhang Y, Zhang J, et al. (2010):
Asthma susceptible genes in Chinese
population: A meta-analysis. Respiratory
Research; 11:129
18. Xiaoyan HD, Quanhua L, Jie L, et al.
(2009): Single-Nucleotide Polymorphisms
in Genes Predisposing to Asthma in
Children of Chinese Han Nationali. J
Investig Allergol Clin Immunol; 19(5):
391-395.
19. Thavagnanam S, Parker JC, Mcbrien
ME, et al. (2011): Effects of IL-13 on
Mucociliary Differentiation of Pediatric
Asthmatic Bronchial Epithelial Cells.
Pediatr Res; (69): 95–100.
20. Hussein YM, El-Tarhouny SA, Shalaby
SM, et al. (2011): Interleukin-13 receptor
A1 gene polymorphism and IL-13 serum
level in atopic and non-atopic Egyptian
children. Immunol Invest; 40 (5): 523-34.
21. Ogbuanu LU, Karmaus WJ, Zhang H,
et al. (2010): Birth order modifies the
effect of IL13 gene polymorphisms on
serum IgE at age 10 and skin prick test at
ages 4, 10 and 18: a prospective birth
cohort study. Journal of Allergy, Asthma &
Clinical Immunology; (6): 6-10.
22. Sun HP, Chen JQ, Guo XR, et al. (2003):
The relationship between IL-13 gene
polymorphism and the levels of serum IL13 and serum eosinophil cation protein in
asthmatic children. Zhonghua Yi Xue Yi
Chuan Xue Za Zhi; 20(6): 547-8.
23. Saha SK, Berry MA, Parker D, et al.
(2008): Increased sputum and bronchial
biopsy IL-13 expression in severe asthma J
Allerg Clinl Immunol; 121: 685-691.
24. Brightling CE, Saha S, Hollins F (2010):
Interleukin-13:
prospects
for
new
treatments. Clin Exp Allergy; 40(1):42-9.
25. Yao X, Zha W, Song W, et al. (2012):
Coordinated regulation of IL-4 and IL-13
expression in human T cells: 3C analysis
for DNA looping. Biochem Biophys Res
Commun; 417 (3): 996-1001.
Miyake Y, Tanaka K, Arakawa M
(2011): IL13 genetic polymorphisms,
smoking, and eczema in women: a casecontrol study in Japan. BMC Med Genet;
21: 12:142.
Galli SJ and Tsai M (2012): IgE and mast
cells in allergic disease. Nat Med; 18
(5):693-704.
Poon AH, Eidelman DH, Martin JG, et
al. (2012): Pathogenesis of severe asthma
Clinical & Experimental Allergy; 42 (5):
611–808.
Lambrecht BN and Hammad H (2012):
The airway epithelium in asthma. Nat Med;
18 (5): 684-92
Huang HR, Zhong YQ, Wu JF, et al.
(2011): The association between IFN-γ and
IL-4 genetic polymorphisms and childhood
susceptibility to bronchial asthma. Gene;
494: 96-101.
El-Sayed ZA, El-Sayed SS, Shereen B, et
al. (2010): IL-13 R130Q single nucleotide
polymorphism in asthmatic Egyptian
children. Egypt J Pediatr Allergy Immunol;
8 (1): 9-18.
Yang H, Dong H, Dai Y, et,al (2011):
Association of interleukin-13 C-1112T and
G+2044A polymorphisms with asthma: a
meta-analysis. Respirology; 16 (7): 112735.
Wang XH, Zhao W, Liu SG, et al. (2009):
Correlation of IL-4 and IL-13 gene
polymorphisms with asthma and total
serum IgE levels. Zhonghua Yi Xue Yi
Chuan Xue Za Zhi ; 32(3):161-4.
American Thoracic Society. Medical
Section of the American Lung
Association. Guidelines for the evaluation
of impairment / disability in patients with
asthma. Am Rev Resp Dis 1993; 147(4):
1056-61.
GINA: Global Strategy for Asthma
Management and Prevention issued
January, 1995, and revised 2005. NIH
Publication
No.
02-3659.
http://www.ginasthma.com.
Miller MR, Hankinson J, Brusasco V, et
al. (2005): Standardization of spirometry.
Eur. Respir. J; 26: 319–38.
Graves PE, Kabesch M, Halonen M, et
al. (2000): A cluster of seven tightly linked
polymorphisms in the IL-13 gene is
associated with total serum IgE level in
three population of white children. J
Allergy Clin Immunol; 105: 506-513.
107
‫‪Vol. 21, No. 1‬‬
‫‪Egyptian Journal of Medical Microbiology, January 2012‬‬
‫ﺗﺤﺪﻳﺪ اﻧﺘﺮﻟﻮآﻴﻦ‪ ١٩٢٣ ١٣ -‬ﺳﻰ‪/‬ﺗﻰ آﻤﻮﺿﻊ ﺧﻄﺮ ﻟﻠﺘﻌﺮض ﻟﻤﺮض اﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ ﻓﻰ اﻷﻃﻔﺎل‬
‫إﻳﻤﺎن ﻣﺤﻤﺪ اﻟﺒﻬﻴﺪى – رﺑﺎب ﻣﺤﻤﺪ اﻟﺒﻬﻴﺪى*‬
‫ﻗﺴﻤﻰ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻰ واﻟﻤﻨﺎﻋﺔ واﻷﻃﻔﺎل* ‪ -‬آﻠﻴﺔ اﻟﻄﺐ اﻟﺒﺸﺮى – ﺟﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ‬
‫اﻟﻬ ﺪف ﻣ ﻦ اﻟﺒﺤ ﺚ‪ :‬اﻟﺘﺤﻘ ﻖ ﻣ ﻦ ﺗﻌ ﺪد اﺷ ﻜﺎل اﻟﻨﻴﻮآﻠﻴﻮﺗﻴ ﺪ اﻟﻤﻔ ﺮد )‪١٩٢٣ (SNP‬ﺳ ﻰ‪/‬ﺗ ﻰ ﻓ ﻰ ﻣﻨﻄﻘﻘ ﺔ اﻹﻧﺘ ﺮون ‪ ٣‬ﻣ ﻦ ﺟ ﻴﻦ‬
‫اﻧﺘﺮﻟﻮآﻴﻦ‪ ١٣-‬واﻟﺘﻌﺮض ﻟﻤﺮض اﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ‪ ،‬ودراﺳﺔ ﺗﺄﺛﻴﺮ هﺬﻩ اﻷﺷﻜﺎل ﻋﻠﻰ درﺟﺔ ﺧﻄﻮرة اﻟﻤﺮض‪.‬‬
‫اﻟﻄﺮﻳﻘﺔ‪ :‬إﻋﺘﻤﺪ أﺳ ﻠﻮب ﺗﻘﻴﻴ ﺪ ﺟ ﺰء ﻃ ﻮل ﺗﻌ ﺪد اﻷﺷ ﻜﺎل )‪ (RFLP‬ﻓ ﻲ اﻟﻜ ﺸﻒ ﻋ ﻦ ﺗﻌ ﺪد اﻷﺷ ﻜﺎل ﻟﺠ ﻴﻦ اﻻﻧﺘﺮﻟ ﻮآﻴﻦ‪ ١٣-‬ﻓ ﻰ‬
‫ﻣﻨﻄﻘﺔ اﻹﻧﺘﺮون ‪ ،٣‬وآﺬﻟﻚ ﺗﻢ اﺳ ﺘﺨﺪام ﻃﺮﻳﻘ ﺔ اﻹﻟﻴ ﺰا )‪ (ELISA‬ﻟﻘﻴ ﺎس ﻣ ﺴﺘﻮى اﻻاﻧﺘﺮﻟ ﻮآﻴﻦ ‪ ،١٣-‬واﻟﺠﻠ ﻮﺑﻠﻴﻦ اﻟﻤﻨ ﺎﻋﻰ إى‬
‫اﻟﻜﻠﻰ‪.‬‬
‫وﻗﺪ ﺗﻢ إﺟﺮاء هﺬﻩ اﻟﺪراﺳﺔ ﻋﻠﻰ ‪ ٥٠‬ﻃﻔﻞ ﻣﺼﺎﺑﻴﻦ ﺑ ﺎﻟﺮﺑﻮ اﻟ ﺸﻌﺒﻰ‪ ،‬وﻗ ﺪ ﺗ ﻢ إﺧﺘﻴ ﺎرهﻢ ﻋ ﺸﻮاﺋﻴﺎ وﻳﻌ ﺎﻧﻮن ﻣ ﻦ درﺟ ﺎت‬
‫ﻣﺘﻔﺎوﺗﺔ ﻣﻦ اﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ وآﺬﻟﻚ ‪ ٣٠‬ﻃﻔﻞ أﺻﺤﺎء آﻤﺠﻤﻮﻋﺔ ﺿﺎﺑﻄﺔ‪ ،‬وﺗﻢ ﻋﻤﻞ إﺧﺘﺒﺎرات وﻇﺎﺋﻒ اﻟﺮﺋﺔ ﻟﻬﻢ‪.‬‬
‫اﻟﻨﺘﺎﺋﺞ‪ :‬أﺛﺒﺘﺖ اﻟﺪراﺳﺔ أﻧﻪ ﺑﺎﻟﻨﺴﺒﺔ ﻟﺘﻮزﻳﻊ اﻟﺘﺮددات اﻟﻮراﺛﻴﺔ‪ :‬آﺎﻧﺖ اﻟﻤﻮرﺛﺎت ذات اﻟﻨﻤﻂ اﻟﺠﻴﻨﻰ ﺗىﺘﻰ )‪(TT‬وﺗ ﻰ ﺳ ﻰ )‪(TC‬‬
‫اﻧﺘﺮﻟﻮآﻴﻦ‪ ١٣-‬اﻧﺘﺮون ‪ ١٩٢٣+ ٣‬ﻓﻲ اﻻﻃﻔﺎل اﻟﻤﺼﺎﺑﻴﻦ ﺑﺎﻟﺮﺑﻮ اﻟ ﺸﻌﺒﻰ أﻋﻠ ﻰ ﻣ ﻦ اﻟ ﻨﻤﻂ اﻟﺠﻴﻨ ﻰ اﻟ ﻮراﺛﻰ ﺳى ﺴﻰ )‪ (CC‬ﻣ ﻊ‬
‫وﺟﻮد دﻻﻟﺔ اﺣﺼﺎﺋﻴﺔ‪.‬وﻗﺪ آﺎن اﻟﻨﻤﻂ اﻟﺠﻴﻨﻰ اﻟﻮراﺛﻰ ﺳىﺴﻰ) ‪ (CC‬أﻋﻠﻰ ﻓﻲ اﻟﻤﺠﻤﻮﻋﺔ اﻟﻀﺎﺑﻄﺔ‬
‫ﻼ ﻣ ﻦ اﻻﻧﺘﺮﻟ ﻮآﻴﻦ‪ ١٣-‬واﻟﺠﻠ ﻮﺑﻠﻴﻦ اﻟﻤﻨ ﺎﻋﻰ إى اﻟﻜﻠ ﻰ ﻓ ﻰ اﻟﻤ ﺼﺎﺑﻴﻦ ﺑ ﺎﻟﺮﺑﻮ اﻟ ﺸﻌﺒﻰ أﻋﻠ ﻰ ﻣ ﻦ‬
‫وﻗﺪ آ ﺎن ﻣ ﺴﺘﻮى آ ً‬
‫ﻼ ﻣ ﻦ اﻻﻧﺘﺮﻟ ﻮآﻴﻦ‪ ١٣-‬واﻟﺠﻠ ﻮﺑﻠﻴﻦ اﻟﻤﻨ ﺎﻋﻰ إى اﻟﻜﻠ ﻰ ﻓ ﻰ اﻟﻤ ﺼﺎﺑﻴﻦ ﺑ ﺎﻟﺮﺑﻮ اﻟ ﺸﻌﺒﻰ‬
‫اﻟﻤﺠﻤﻮﻋﺔ اﻟ ﻀﺎﺑﻄﺔ‪ .‬وﻗ ﺪ آ ﺎن ﻣ ﺴﺘﻮى آ ً‬
‫ذوى اﻟﻨﻤﻂ اﻟﺠﻴﻨﻰ ﺗىﺘﻰ )‪ (TT‬أﻋﻠﻰ ﻣﻦ اﻟﺘﺮآﻴ ﺐ اﻟ ﻮراﺛﻰ ﻣ ﻦ اﻟﻤﻮرﺛ ﺎت ذات اﻟ ﻨﻤﻂ اﻟﺠﻴﻨ ﻰ ﺳى ﺴﻰ )‪ (CC‬وﺗى ﺴﻰ )‪(TC‬‬
‫ﻓﻰ اﻟﻤﺼﺎﺑﻴﻦ ﺑﺎﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ ﻣﻊ وﺟﻮد دﻻﻟﺔ اﺣﺼﺎﺋﻴﺔ‪.‬‬
‫وﻗﺪ آﺎن اﻟﺤﺠﻢ اﻟﺰﻓﻴﺮي اﻟﻘﺴﺮي ﻓ ﻲ اﻟﺜﺎﻧﻴ ﺔ اﻻوﻟ ﻲ اآﺜ ﺮ اﻧﺨﻔﺎﺿ ﺎ ﻓ ﻲ اﻟ ﻨﻤﻂ اﻟﺠﻴﻨ ﻰ ﺗىﺘ ﻰ )‪ (TT‬ﻋ ﻦ اﻟ ﻨﻤﻂ اﻟﺠﻴﻨ ﻰ ﺳى ﺴﻰ‬
‫)‪ (CC‬وﺗىﺴﻰ )‪ (TC‬ﻓﻰ اﻟﻤﺼﺎﺑﻴﻦ ﺑﺎﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ ﻣﻊ وﺟﻮد دﻻﻟﺔ اﺣﺼﺎﺋﻴﺔ‪.‬‬
‫وﻗﺪ آﺎن اﻟﻨﻤﻂ اﻟﺠﻴﻨﻰ ﺗىﺘﻰ )‪ (TT‬اﻷﻟﻴﻞ اﻟﻤﺘﻜﺮر ﺑﺪﻻﻟﺔ اﺣﺼﺎﺋﻴﺔ ﻓﻰ اﻟﻤ ﺼﺎﺑﻴﻦ ﺑ ﺎﻟﺮﺑﻮ اﻟ ﺸﻌﺒﻰ اﻟ ﺸﺪﻳﺪ ﺑﺎﻟﻤﻘﺎرﻧ ﺔ ﻣ ﻊ اﻷﻃﻔ ﺎل‬
‫اﻟﻤﺼﺎﺑﻴﻦ ﺑﺎﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ اﻟﺨﻔﻴﻒ واﻟﻤﺘﻮﺳﻂ‪ .‬و آﺎن اﻟﻨﻤﻂ اﻟﺠﻴﻨﻰ ﺗ ﻰ ﺳ ﻲ )‪(TC‬و اﻟﺠﻴﻨ ﻰ ﺳى ﺴﻰ )‪ (CC‬اآﺜ ﺮ ﺗﻜ ﺮرا ﺑﺪﻻﻟ ﺔ‬
‫اﺣﺼﺎﺋﻴﺔ ﻓﻲ اﻷﻃﻔﺎل اﻟﻤﺼﺎﺑﻴﻦ ﺑﺎﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ اﻟﺨﻔﻴﻒ واﻟﻤﺘﻮﺳﻂ ﺑﺎﻟﻤﻘﺎرﻧﺔ ﺑﺎﻷﻃﻔﺎل اﻟﻤﺼﺎﺑﻴﻦ ﺑﺎﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ اﻟﺸﺪﻳﺪ‪.‬‬
‫اﻻﺳﺘﻨﺘﺎج‪ :‬اﻧﺘﺮﻟﻮآﻴﻦ ‪ ١٣-‬اﻹﻧﺘﺮون ‪ ٣‬ﻣﻮﺿﻊ ‪ ١٩٢٣+‬ﻣﻮﺿﻊ ﺧﻄﺮ ﻟﻼﺻﺎﺑﺔ ﺑﻤﺮض اﻟﺮﺑﻮ وﻳﻌﺘﺒﺮ اﻟﻤﺘﻐﻴ ﺮ اﻟ ﻮراﺛﻲ ‪ TT‬ه ﻮ‬
‫ﻋﺎﻣﻞ اﻟﺘﻨﺒﺆﻳﺔ ﻟﺸﺪة اﻟﺮﺑﻮ اﻟﺸﻌﺒﻰ‪.‬‬
‫‪108‬‬
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Phenotypic analysis of Candida Species Associated with
Vulvovaginal Candidiasis
Mai M. Helmy1, 2
Department of Microbiology & Immunology, Faculty of Medicine, Zagazig University1
Faculty of Pharmacy, October University for Modern Sciences and Arts 2
ABSTRACT
Vulvovaginal candidiasis is a common infection among women worldwide. According to previous
epidemiological studies, Candida albicans is the most common species of Candida that causing vaginitis.
However, the prevalence of Candida infections by non-Candida albicans species is increasing.
Identification of Candida species among population will not only help health professional to choose
suitable antifungal treatments, but also prevent development of drug resistance. The aim of this study was
to characterize Candida species from vulvovaginal candidiasis using various phenotypic methods such as
Germ tube test, Chlamydospore production, HiChrome Candida Differential Agar and API ID32C.
This work was done in the department of Microbiology and Immunology, Faculty of Pharmacy, October
University for Modern Sciences and Arts, in the period from September 2010 to June 2011. A total of 60
swab samples of vaginal discharge were collected using sterile cotton swabs from patients who are
admitted to the Gynecology Clinic in Kasr El Aeiny Hospital with a clinical presentation suggestive of
vulvovaginal candidiasis. Swabs were cultured on Sabouraud dextrose agar. Candida species were
identified by HiChrom Candida Agar medium, germ tube formation in pooled human serum,
chlamydospore production on Corn Meal Agar and carbohydrate absorption using the APIID32C kit.
Results: Fifty out of sixty isolates (83.3 %) were yeast positive while 10/60 (16.7 %) was negative for
yeast. Candida albicans accounted for 86% (43/50) of isolated yeast, whereas 14% (7/50) were nonCandida albicans and included: C.tropicalis 8% (4/50) and C. glabrata 6 % (3/50). Germ tube positive
C.albicans were 81.4% while 18.6 % were germ tube negative. All the 43 isolates identified as C.
albicans produced chlamydospores on Corn meal agar. HiChrom agar media results were 100 %
agreement with API ID32C.
In conclusion: Candida albicans was the most common cause of vulvovaginitis. This study suggests
HiCrome Candida Differential Agar as a convenient and cost effective reliable method to isolate the
species of Candida especially in cases where more than one species is present.
5
. Candida species are part of the normal
vaginal flora of 20-50% of woman without
clinical presentation6. Non Candida albicans
especially C.glabrata, C.krusei, C. tropicals and
C. parapsilosis show more resistance to
antifungal drugs, especially to first line
treatment. Some previous studies showed an
increase in the incidence of C. galabrata
infection which might be due to the extensive
and long term utilization of antifungal drugs
such as azoles7. Thus, the differentiation of
diverse species of Candida in the laboratory
seems imperative. In addition, a vaginal sample
may contain mixed species of Candida and the
isolation and separation process of those
different species seem complicated and time
consuming using the usual culture media8. The
ability of C. albicans to produce short, slender,
tube like structures called germ tubes and
chlamydospores is the basis of its preliminary
identification. However reports indicated that C.
tropicalis, C. parapsilosis and Cryptococcus
gastricus also produce structure which
INTRODUCTION
Infections due to Candida species and other
fungi have increased dramatically in recent
years and are of particular importance because
of the rising number of immuno-compromised
patients1. Although Candida albicans is one of
the most frequently isolated yeasts in clinical
laboratories and indeed studies have shown it
accounts up to 80% of the yeasts recovered
from sites of infection2; other Candida species
(non-Candida albicans) have been reported as
significant opportunistic pathogens colonizing
patients and medical devices causing genital
tract infections3. Candida infection is a common
disease of lower genital tract in women. The
prevalence of vulvovaginal candidiasis (VVC)
is increasing worldwide due to the extensive
utilization of broad spectrum antibiotics as well
as increased cases of immuno-compromised
patients4. About 75% of women experience at
least one episode of VVC at some point during
their lifetime and 5% experience recurrent VVC
109
Egyptian Journal of Medical Microbiology, January 2012
resembles germ tube9. In addition C.
dubliniensis has recently been described that is
very similar to C. albicans in many
characteristics, especially germ tube formation
and chlamydospore production10. Since C.
albicans share these characteristics; it is likely
that some C. dubliniensis isolates have been and
will continue to be identified in clinical
laboratory as C.albicans. Notably, C.
dubliniensis is resistant to fluconazole and more
virulent than C. albicans necessitating its
differentiation11. The diversity and spectrum of
Candida species of clinical significance means
there a need to develop fast and cost effective
methods of identification. CHROMagar
Candida technique has been used and has been
useful in discriminating different Candida
species as well as mixed infestations. It is a
reliable and sensitive method for presumptive
identification of more commonly isolated yeast
species of the genus Candida12. Rapid
identification and speciation of Candida species
is essential in clinical laboratories. However, no
single phenotypic test is highly effective in
identifying Candida species and combination of
tests is sometimes necessary for identification.
Although molecular techniques have been
employed to characterize Candida spp. But it is
not cost effective as a routine test in clinical
mycology laboratories10. Therefore, to make an
efficient and accurate diagnosis, the aim of the
study was to characterize Candida species from
vulvovaginal
candidiasis
using
various
phenotypic methods such as Germ tube test,
Chlamydospore production, HiChrome Candida
Differential Agar and API ID32C.
Vol. 21, No. 1
incubated at 37 °C for 24 - 72 hours before
observation and subsequent tests carried out.
Germ tube test: This used as a test for
identification of Candida albicans. The
procedure was carried out as follows; a small
inoculum of the test yeast cells from a pure
culture was suspended in 0.5 ml fresh pooled
human sera (Vacsera, Egypt) in a Wassermann
tubes. The suspension was incubated at 37 °C
for three hours after which a drop of the
incubated serum was placed on a microscope
slide and covered with a cover slip. The wet
mounts were examined for presence of germ
tubes using the 40 x objective lens. The isolates
were classified as either germ tube positive or
germ tube negative.
HiCrome Candida Differential Agar
M1297A (Himedia, India) was used for
presumptive identification of different Candida
species and to detect any mixed colonies. The
method is based on the differential release of
chromogenic breakdown products from various
substrates following differential exoenzyme
activity. HiChrome agar medium was prepared
according to the manufacturers' instructions. It
doesn’t require autoclaving and was dispensed
into Petri plates after cooling. Using an
inoculating needle, a single colony from a pure
culture was seeded into HiCrome Candida
Differential Agar and incubated at 37 °C for 48
hours after which color changes were noted.
Chlamydospore
production:
Chlamydospore production on Corn Meal Agar
“CMA M146” (Himedia, India) was prepared
according to the manufacturer’s instructions and
used as a confirmatory test for the identification
of Candida albicans. The isolated yeast strains
were inoculated on CMA plates by slide culture
technique. The test involved streaking and
stabbing the media with a 48 hour old yeast
colony, covered with sterile cover slip and
incubated at 25 °C for 72 hours to 7 days.
Chlamydospore production was detected using
the 40 x objective lens. The isolates were
categorized as chlamydospore positive or
negative.
API ID 32 C (bioMerieux, Inc France) was
used as a reference identification method for all
isolates. The procedures were done according to
the manufacturer’s instructions. The strip
consists of 10 cupules, each containing
dehydrated substrates allowing 12 colorimetric
tests to be performed:
5 carbohydrate
acidification tests (glucose, galactose, sucrose,
trehalose, and raffinose) and 7 enzymatic tests
(b-maltosidase, a-amylase, b-xylosidase, bglucuronidase, urea hydrolysis, N-acetyl-bglucosaminidase,
and
b-galactosidase).
MATERIAL & METHODS
This work was done in the department of
Microbiology and Immunology, Faculty of
Pharmacy, October University for Modern
Sciences and Arts, in the period from September
2010 to June 2011. A total of 60 vaginal
specimens were collected using sterile cotton
swabs from patients who are admitted to the
Gynecology Clinic in Kasr El Aeiny Hospital.
All women were informed of the general design
of the study and gave their consent. Medical
history, including previous episodes of lower
genital tract infection, was documented. Each
woman was asked to report her partner’s
symptoms (pruritus, and mucosal irritation).
Growth on Sabouraud Dextrose Agar
(SDA): Primary isolation of yeast from swabs
was done using SDA (Oxoid). The SDA media
was prepared according to manufacturer’s
instructions. The cultures on SDA were
110
Egyptian Journal of Medical Microbiology, January 2012
appearance). Microscopic morphology showed
spherical budding yeast cell. The remaining
10/60 swabs (16.7%) were yeast negative.
The appearance of yeast strains (50 isolates)
on HiCrome Candida Differential Agar:
Color readings were made at 48 h, as
suggested by manufacturer. Further incubation
resulted in deepening of colors. The
distributions of colors observed in the morphotypes are listed in (Table 1). Out of the 50 yeast
isolates 43/50 (86%) gave several shades of
green colonies suggestive of C. albicans (Fig.
1a). Only 4/50 (8%) of the isolates developed a
distinctive dark blue color typical of C.
tropicalis (Fig.1b). The remaining 3/50 (6 %) of
the isolates developed white to pink color
suggestive of C. glabrata (Fig. 1c).
Inoculation of the tubes was performed by
adding yeast suspension (inoculum [McFarland
standard of 3] in saline) to the dehydrated
substrates. After 24-h incubation at 35 °C, the
reactions were read visually without addition of
reagents. The results were transformed into a
numerical profile which was compared with
those given in the profile list in the package
insert.
RESULTS
This study was done on 60 vaginal swabs,
50/60 swabs (83.3%) were positive for yeast
cells on SDA (colonies were white to creamy
colored, smooth, glabrous and yeast like in
Fig.1a (C.albicans)
Vol. 21, No. 1
Fig. 1b (C.tropicalis)
Fig. 1c (C.galabrata)
Table 1: Distribution of Colony Colors of Candida Isolates on HiCrome Candida Differential Agar
Candida colonial Species
Number of Isolates (%)
Colors Observed
C.albicans
43 (86%)
Green
C.tropicals
4 (8%)
Dark blue
C.glabrata
3 (6%)
White to pink
pseudohyphae on CMA,while C. glabrata did
not form any pseudohyphae but small, oval,
budding cells. API ID 32C (gold standard test)
is used as a confirmatory identification test for
all Candida isolates. The results of all methods
were presented in (Table 2).
Germ tube test indicated that 35/43 (81.4%)
of the C. albicans were germ tube positive (Fig.
2) and 8/43 (18.6%) were germ tube negative.
C. albicans produced abundant chlamydospores
and pseudohyphae with clusters of spores (Fig.
3) on CMA. C. tropicalis formed long
111
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
Fig. 3 (C.albicans chlamydospores and
pseudohyphae with clusters of spores on
CMA)
Fig. 2 (C.albicans germ tube positive)
Table 2: Growth and Characteristics of 50 Candida Isolates on HiCrome Candida Differential Agar, Corn
meal, and Identification of Candida Isolates by Germ Tube and API ID32C.
Candida
Colony characteristics Morphological features
Identification
Identification by
species
on HiCrome Candida
on Corn meal
by germ tube
APIID32C
Differential Agar
C.albicans (43)
Green colony
Chlamydospores, pseudo 35 were positive,
identified as
and true hyphae
8 were negative
C. albicans(43)
C.tropicalis (4)
Dark blue
long pseudohyphae
Negative
C.galabrata (3)
White to pink
No pseudohyphae.
Small, oval, single
terminal budding cells.
Negative
Identified as
C.tropicalis (4)
Identified as
C.glabrata (3)
Candida species other Candida albicans as
emerging significant pathogens16,17. Some
Candida species are more virulent and
intrinsically resistant to commonly available
antifungal drugs, C. tropicalis and C. glabrata
are examples of them. The ability to easily
differentiate between C. albicans and other
Candida species in routine laboratory practice
remains a technical problem. Various studies
have described the yeast C. dubliniensis as a
worldwide opportunistic pathogen which is
phylogenetically closely related to C. albicans18.
In vitro fluconazole resistance to C. dubliensis
strain has been demonstrated in immunocompromised patients receiving long term
fluconazole prophylaxis19. This situation has
necessitated that clinical laboratories be able to
isolate and discriminate yeasts of medical
importance rapidly and as accurately as
possible.
The detection and identification of
microorganisms depend on the availability of
easy to perform screening and cost- effective
methods. The medium most widely used for the
isolation of Candida and other yeast species
DISCUSSION
Candida species cause severe opportunistic
infections. The predominant species remains
C.albicans and is the sole species recovered
from up to 70 % of HIV infected individuals
and up to 90 % of cases of Candida vaginitis13.
However there has been a significant trend in
the emergence of species other than C.albicans
(C.glabrata, C. krusei)14. During the study
period 50 Candida isolates was obtained from
60 vaginal swabs. C. albicans was the most
frequently isolated yeast pathogen accounting
for 86 % of the isolates. This agreed with
previous study done by Wade15 where C.
albicans accounted for up to 80 % of the
candidiasis infection and with Kangogo et al.16
who reported that C.albicans was the
commonest isolates accounting to 86.8 %.
Although C. albicans was the most frequently
isolated yeast pathogen, other Candida species
were identified. These species included C.
tropicalis (8 %) and C. glabrata (4 %). This is
in accordance with other studies that reported
112
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
This is in accord with Reef and Mayer25 who
report that up to 5 % of Candida albicans are
germ tube negative and with Kangogo et al.16
who found that 3.9 % of C.albicans was germ
tube negative. All the C. albicans were positive
for chlamydospores production, while the non
albicans Candida did not form any
chlamydospores. This is in line with that of
Kangogo et al.16. API ID32C confirmed that
they were non albicans Candida.
HiCrome Candida Differential Agar was
selected as a primary culture, gave an easily
presumptive identification of several species of
Candida on the basis of color and morphology
within 48 hours. This medium not only
facilitates the provision of rapid patient care, but
may also assist to control the rise in antifungal
agent resistance by reducing the time taken for
presumptive identification of the organism
species on level. This was in line with that
reported by Girgis et al.26 and Nadeem et al.27.
In addition, HiCrome Candida Differential Agar
facilitates recognition of mixed fungal
specimens24. The cost price per culture for germ
tube was 0.5 Egyptian Pound, Corn meal agar (1
Pound) and API ID32C (4.5 Pounds) in addition
the 3 methods needed primary isolation of the
sample on SDA , while HiChrom Candida agar
costs (5 Pounds) and used as isolating and
identifying media, thus it is more economical.
The cost-benefit survey were carried out in this
study, it seems that chromoagar media are
economical in terms of labor and time.
Moreover their cost would be more than offset
by the decreased need for secondary
biochemical test (API). Also in the presence of
HiChrome Candida agar it is not necessary to
perform germ tube test for C.albicans to
confirm as was also reported by Odds and
Bernaerts28.
In
conclusion:
HiCrome
Candida
Differential Agar is a suitable primary isolation
medium for yeast from clinical specimens,
providing rapid direct identification of Candida
species, enhanced detection of mixtures and
may provide additional information
to
laboratories that don’t regularly perform
identifications beyond the germ tube test.
Acknowledgments
The author wishes to express sincere
appreciation to Sara Mohamed Hassan,
Ass.prof. at Gynacology & Obstatric
Department in Kasr El Aeiny Hospital for the
collection of clinical specimens. Bishoy Maher,
teaching assistant and undergraduate Pharmacy
students at MSA University (Heba El-Tawab,
Fatma Essam, Hager Osama, Mai Salah,
Showikar Adel, Motaz Gamal) for processing of
from clinical specimens is Sabouraud Dextrose
Agar20. This is a universal medium that supports
the growth of most pathogenic fungi. However
SDA is not a differential medium and colonies
of different pathogenic yeast species grown on
this agar cannot be easily distinguished from
each other. Even careful observers are often
unable to recognize mixtures of different yeast
species when they occur on a single clinical
specimen on SDA. Therefore, there is no
guarantee that mixed yeast cultures will be
detected.
To be of value for routine isolation and
presumptive differentiation of yeasts, an
indicator medium should exhibit several
properties. It should support the growth of yeast
but not that of bacteria. If the medium also
facilitates the growth of filamentous fungi, that
is not necessarily a disadvantage, since for
many clinical samples it is not possible to
predict whether yeast or filamentous fungi is
likely to be isolated. The differential property of
the medium should also allow unambiguous
presumptive discrimination between the yeast
species most commonly encountered in clinical
samples. Finally it should facilitate the
recognition of specimens containing mixtures of
yeast species, and exposure of the fungi to the
differential indicator substances should not
affect their viabilities for subsequent subculture.
CHROMAgar Candida appears to fulfill all
these requirements16.
Since C. albicans is the yeast species most
often isolated from clinical material, most
clinical
laboratories
approach
yeast
identification by applying simple rapid tests as
germ tube formation to distinguish C. albicans
from other species which require more
extensive testing for proper identification.
However newly described yeast, C. dubliniensis
is very similar to C. albicans in many
characteristics like germ tube formation and
chlamydospore production21. So C.dubliensis
strains may have been identified as C. albicans
in the clinical laboratory. Several methods for
identification
of
C.
dubliniensis
and
discrimination from C. albicans have been
reported. They include formation of dark green
colonies on HiCHROM Candida agar22 and lack
of ability to assimilate xylose23.
In this work, no C.dubliniensis was
detected. Although the germ tube is rapid (2-3
h) problems with germ tube negative strains of
C.albicans, misinterpretation of elongated
blastoconidia as germ tubes, and time –
consuming microscopy, make this common test
less desirable24. In this study 8 out of 43 C.
albicans (18.6 %) were germ tube negative.
113
Egyptian Journal of Medical Microbiology, January 2012
specimens. Finally, words alone cannot express
my gratitude to the Dean of Faculty (Prof. Dr.
M. Seif Eldin. Ashour), for his guidance.
Vol. 21, No. 1
12. Yocesoy, M. and Marol, S. (2003):
Performance of Chromagar Candida and
BIGGY Agar for presumptive identification
of yeasts. Clin. Microbiol. Infect. 9: 25.
13. Sobel, J. D. (2007). Vulvovaginal
candidosis. Lancet, 369:1961– 1971.
14. Tortorano, A. M.; Peman. J.; Bernhardt,
H.; klingspor, L.; Kibbler, C. C.; Faure,
O. et al. (2004): ECMM working group on
candidaemia. Epidemiology of candidaemia
in Europe: results of 28-month European
Confederation
of
Medical
Mycology(ECMM)
hospital-based
surveillance study. Eur. J. Clin. Microbiol.
Infect. Dis., 23:317-322.
15. Wade, J. M. (1993): Epidemiology of
Candida infection in AIDS. In:
Candidiasis: Pathogenesis, diagnosis and
treatment. Eds, Vanden Bossche et al.
Plenum Press. NewYork, N.Y. 67 - 74.
16. Kangogo, M. C.; Wanyoike, M. W.;
Revathi, G. and Bii, C. C. (2011).
Phenotypic characterization of Candida
albicans from clinical sources in Nairobi
Kenya. African Journal of Health Sciences,
19 ( Number 3-4)19-22.
17. Moran, G. P.; Sullivan, D. J. and
Coleman, D. (2003): Emergence of nonCandida albicans species as pathogens. In:
Candida and Candidiasis. Ed, R. A.
Calderone.American
Society
for
Microbiogy, Washington D. C. 37-53
18. Sullivan, D. and Coleman, D. (1998):
Candida dubliensis: Characteristics and
identification.
Journal
of
Clinical
Microbiology Reviews. 35: 960 -964.
19. Moran, G. P.; Sanglard, D.; Donnelly, S.
M.; Shannloy, D. B. and Coleman, D. C.
(1997): Identification and expression of
multidrug transporters responsible for
fluconazole
resistance
in
Candida
dubliensis.
Antimicrob
Agents
Chemotherap. 41: 617 -623.
20. Odds, F.C. (1991): Sabaraud (‘s) agar. J.
Med. Vet. Mycol. 29: 355 - 359.
21. Pincus, D. H.; Coleman, D. C.; Pruitt, W.
R.; Padhyr, A. A.; Salkin, I. F. and
Geimer, M. (1999): Rapid identification of
Candida dubliniensis with commercial
yeast identification systems. J. Clin.
Microbiol. Reviews. 37: 3533-3539.
22. Tintelnot, K.; Haase, G.; Seibold, M.;
Bergmann, F.; Staemmler, M.; Franz, T.
and Naumnn, D. (2000): Evaluation of
Phenotypic markers for selection and
identification of Candida dubliensis. J.
Clin. Microbiol. Reviews. 38: 1599 -1608.
REFERENCES
1.
Fraser, V. J.; Jones, M.; Dunkel, J.;
Storfer, S.; Medoff, G. and Dunagan, W.
C. (1992): Candidemia in a tertiary care
hospital: epidemiology, risk factors and
predictors of mortality. J. Clin. Infect.
Dis.15: 415-421
2. Paula, C. R. (1998): Candidíases in: Zaitz
C., Campbell, I.; Marques, A. S., et al.
Compêndio de Micologia Médica. Rio de
Janeiro: Medsi, 99-107.
3. Pontion, J.; Ruckehl, R.; Clemons, K.
V.; Coleman, D. C.; Grillot, R.; Guarro,
J., et al. (2000): Emerging pathogens. Med.
Mycol. 38:225-236
4. Sendid, B.; Francois, N.; Standaert, A.,
et al. (2007): Prospective evaluation of the
new chromogenic medium CandiSelect 4
for differentiation and presumptive
identification of the major pathogenic
Candida species. J. Med. Microbiol.
56:495-499.
5. Sobel,
J.
D.
(1997):
Candidal
vulvovaginitis. Clin Obstet. Gynecol.
36:153-212.
6. Abi-Said, D.; Anaissie, E.; Uzun, O.;
Raad,
F.;
Pinzcowski,
H.
and
Vartivarian, S. (1997): The epidemiology
of hematogenous candidiasis caused by
different Candida species. Clin Infect Dis.
24:1122-1128.
7. Berek, J. S. and Berek, N. E. (2007):
Novak’s Gynecology, 14th d., Philadelphia:
Lippincott Williams7 Wilkins, 545-547.
8. Willinger, B. and Manafi, M. (1999):
Evaluation of Chromagar Candida for rapid
screening of clinical specimens for Candida
species. Mycosis. 42:61-65
9. Campbell, C.K.; Holmes, A. D.; Davey,
K. C.; Szekely, A. and Warnock, D. W.
(1998): Comparison of a new chromogenic
agar with the germ tube method for
presumptive identification of Candida
albicans. European J. of Clin. Microbiology
and Infectious Diseases. 17: 367: 368.
10. Juliana, C. R. (2004): Phenotypic and
Genotypic Identification of Candida spp.
isolated from hospitalized patients. Rev
Iberoam Micol. 21:24 - 26.
11. Richardson, M. D. and Warnock D.W.
(2003): Fungal infection, Diagnosis and
treatment, 3rd ed, Blackwell Publishing
UK. 38 - 43.
114
Egyptian Journal of Medical Microbiology, January 2012
Vol. 21, No. 1
26. Girgis, S. A.; El-Mehalawy, A. A. and
Rady, L. M. (2009): Comparison between
culture and non-culture based methods for
detection of Nosocomial fungal infections
of Candida spp. in intensive care unit
patients. Egypt. Acad. J. Biolog. Sci., 1(1):
37-47.
27. Nadeem, S.G.; Hakim, S. T. and Kazmi,
S. U. (2010): Use of Chromoagar Candida
for the presumptive identification of
Candida species directly from clinical
specimens in resource- limited setting.
Libyan J. Med. 5: 2144.
28. Odds, F. C. and Bernaerts R. (1994):
Chromoagar Candida a new differential
isolation
medium
for
presumptive
identification of clinically important
Candida species. J. Clin. Microbiol. 32(8):
1923-1929
23. Gales, A. C.; Pfaller, M. A.; Huston, A.
K.; Joly, S.; Sullivan, D. J.; Coleman,
D.C. and Soll, D. R. (1999): Identification
of Candida dubliensis based on temperature
and utilization of Xylose and α-Methyl-DGlucoside as determined with the API 20 C
AUX and Vitec YBC system. J. Clin.
Microbiol. Reviews. 37: 3804 -3808.
24. Ca´rdenesa, C. D.; Carrillob, A. J.;
Arias, A.; Rodri’guez- Alvarez, C.;
Torres- Lana, A.; Sierra, A. and
Are’valo, M. P. (2002): Comparison of
albicans ID2 agar plate with germ tube for
presumptive identification of Candida
albicans. Diagnostic Microbiology and
Infectious Diseases. 42:181-185.
25. Reef, S. E. and Mayer, K. H. (1995):
Opportunistic candidal infections in
patients
infected
with
human
immunodeficiency virus: prevention issues
and priorities. Clin Infect Dis. 21: 99 - 102.
‫ﺗﺤﻠﻴﻞ اﻟﻨﻤﻂ اﻟﻈﺎهﺮى ﻷﻧﻮاع اﻟﻜﺎﻧﺪﻳﺪا اﻟﻤﻘﺘﺮﻧﺔ ﺑﺎﻟﺘﻬﺎﺑﺎت اﻟﻔﺮج اﻟﻤﻬﺒﻠﻰ‬
٢ ‫و‬١
‫ﻣﻰ ﻣﺄﻣﻮن ﺣﻠﻤﻰ‬
‫ ﺟﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ‬، ‫ آﻠﻴﺔ اﻟﻄﺐ‬،‫ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟﻮﺟﻰ واﻟﻤﻨﺎﻋﺔ‬١
‫ ﺟﺎﻣﻌﺔ اﻟﻌﻠﻮم اﻟﺤﺪﻳﺜﺔ واﻷداب أآﺘﻮﺑﺮ‬، ‫آﻠﻴﺔ اﻟﺼﻴﺪﻟﺔ‬٢
‫اﻟﺘﻬﺎﺑﺎت اﻟﻔﺮج اﻟﻤﻬﺒﻠﻰ اﻟﻤﻘﺘﺮﻧﺔ ﺑﺄﻧﻮاع اﻟﻜﺎﻧﺪﻳﺪا هﻮ اﻟﻨﻮع اﻷآﺜﺮ ﺷﻴﻮﻋﺎ ﺑﻴﻦ اﻟﻨﺴﺎء ﻓﻲ ﺟﻤﻴﻊ أﻧﺤﺎء اﻟﻌﺎﻟﻢ وﻓﻘ ﺎ ﻟﺪراﺳ ﺎت وﺑﺎﺋﻴ ﺔ‬
‫ وﻟﻜﻦ أﻳﻀﺎ‬، ‫ﺳﺎﺑﻘﺔ وﺗﺤﺪﻳﺪ أﻧﻮاع اﻟﻜﺎﻧﺪﻳﺪا ﻻ ﻳﺴﺎﻋﺪ ﻓﻘﻂ ﻋﻠﻰ اﻟﺼﺤﺔ اﻟﻤﻬﻨﻴﺔ ﻓﻲ اﺧﺘﻴﺎر اﻟﻌﻼﺟﺎت اﻟﻤﻨﺎﺳﺒﺔ اﻟﻤﻀﺎدة ﻟﻠﻔﻄﺮﻳﺎت‬
.‫ﻳﻤﻨﻊ ﻧﺸﻮء ﻣﻘﺎوﻣﺔ هﺬﻩ اﻟﻔﻄﺮﻳﺎت ﻟﻠﻌﻘﺎﻗﻴﺮ‬
‫واﻟﻬﺪف ﻣﻦ هﺬﻩ اﻟﺪراﺳﺔ هﻮ ﺗﺤﻠﻴﻞ اﻟﻨﻤﻂ اﻟﻈﺎهﺮى ﻷﻧﻮاع ﻓﻄﺮ اﻟﻜﺎﻧﺪﻳﺪا ﺑﺎﺳﺘﺨﺪام ﻃﺮق ﻣﻈﻬﺮﻳﺔ ﻣﺜﻞ‬
Germ tube test, Chlamydospore production, HiChrome Candida Differential Agar and API
ID32C
‫ ﻓ ﻲ اﻟﻔﺘ ﺮة ﻣ ﻦ‬، ‫ﺟﺎﻣﻌ ﺔ اﻟﻌﻠ ﻮم اﻟﺤﺪﻳﺜ ﺔ واﻷداب أآﺘ ﻮﺑﺮ‬، ‫ آﻠﻴ ﺔ اﻟ ﺼﻴﺪﻟﺔ‬، ‫ﺗ ﻢ ه ﺬا اﻟﻌﻤ ﻞ ﻓ ﻲ ﻗ ﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﻟ ﻮﺟﻰ واﻟﻤﻨﺎﻋ ﺔ‬
‫ ﻣﺴﺤﺔ ﻣﻦ إﻓﺮازات ﻣﻬﺒﻠﻴﺔ ﺑﺎﺳﺘﺨﺪام ﻗﻄﻌﺔ ﻗﻄﻦ ﻣﻌﻘﻤﺔ ﻣﻦ ﻋﻴ ﺎدات ﻣﺴﺘ ﺸﻔﻰ‬٦٠ ‫ وﻗﺪ ﺗﻢ ﺟﻤﻊ‬.٢٠١١ ‫ اﻟﻰ ﻳﻮﻧﻴﻮ‬٢٠١٠ ‫ﺳﺒﺘﻤﺒﺮ‬
‫أﻣﺮاض اﻟﻨﺴﺎء ﻓﻲ ﻣﺴﺘﺸﻔﻰ اﻟﻘﺼﺮ اﻟﻌﻴﻨﻰ‬
:‫وأﻇﻬﺮت ﻧﺘﺎﺋﺞ هﺬا اﻟﺒﺤﺚ اﻷﺗﻰ‬
yeast negative (10.7 %) ‫ و ﻋﺸﺮة‬yeast positive‫( ا‬83.3 %) ‫ ﺧﻤﺴﻮن ﻣﻦ أﺻﻞ ﺳﺘﻴﻦ ﻣﺴﺤﺔ‬C.galabrat % 6 ‫ و‬C.tropicalis 8 % : ‫ وﺗﻀﻤﻨﺖ ﻣﺎ ﻳﻠﻲ‬C.non albicans 14 % ‫ ﺑﻴﻨﻤﺎ‬،C.albicans ٪ ٨٦ .C.albicans germ tube negative ٪ ١٨.٦ ‫ ﻓﻰ ﺣﻴﻦ‬C.albicans germ tube positive % ٨١.٤ .chlamedospore on corn meal agar ‫ أﻧﺘﺠﺖ‬C.albicans ‫ آﻞ‬.API ID32C‫ و‬HiChrom Candida agar ‫ اﺗﻔﺎق ﻓﻰ اﻟﻨﺘﺎﺋﺞ ﺑﻴﻦ‬٪ ١٠٠
‫ وﺳ ﻴﻠﺔ ﺳ ﻬﻠﺔ وﻓﻌﺎﻟ ﺔ ﻣ ﻦ ﺣﻴ ﺚ اﻟﺘﻜﻠﻔ ﺔ وﻳﻤﻜ ﻦ اﻻﻋﺘﻤ ﺎد‬HiCrom Cadida agar ‫ﻧﺨﻠﺺ ﻣﻦ ه ﺬة اﻟﺪراﺳ ﺔ اﻟ ﻰ أن‬
.‫ﻋﻠﻴﻬﺎ ﻟﻌﺰل أﻧﻮاع اﻟﻜﺎﻧﺪﻳﺪا وﺧﺎﺻﺔ ﻓﻲ اﻟﺤﺎﻻت اﻟﺘﻲ ﺗﺤﺘﻮى ﻋﻠﻰ أآﺜﺮ ﻣﻦ ﻧﻮع ﻓﻰ اﻟﻌﻴﻨﺔ اﻟﻮاﺣﺪة‬
115