CTX-M β-lactamases
Beta-lactamases are bacterial enzymes that are able to hydrolyze beta-lactam antimicrobial
drugs. Pressures from widespread use of antimicrobials have led to selection of bacteria producing
extended spectrum β-lactamases (ESBL). ESBLs are characterized by their ability to hydrolyze
peniclillins, early cephalosporins, oxyimino-thiazolyl cephalosporins (including third and fourth
generation cephalosporins) and monobactams but not cephamycins or carbapenems. They are inhibited
by suicide-inhibitors such as clavulanic acid, tazobactam and sulbactam. These plasmid encoded
periplasmic enzymes are often produced by members of Enterobacteriaceae as well as non-fermenters
such as Acinetobacter spp and Pseudomonas spp. ESBLs have originated due to one-seven point
mutations in the beta-lactamase (bla) genes, usually of the TEM and SHV types. Most of the ESBLs
are placed in Bush’s group 2be and Ambler’s A class. There are over 186 TEM types and 142 SHV
types, although not all of them have ESBL phenotype. Several among them are penicillinases or early
cephalosporinases (belonging to group 2b) or inhibitor resistant TEMs (belonging to 2br). Some
members of OXA-penicillinases (Bush’s group 2de, Ambler’s class D) have an ESBL phenotype.
There are other lesser prevalent ESBLs such as BEL-, BES-, SFO-, TLA-, PER- and VEB-types.
Another most notable of non-TEM, non-SHV ESBLs that have gained widespread importance are
CTX-M-β-lactamases.
Properties of CTX-M ESBLs:
Discovery:
Most of the early ESBLs were mainly ceftazidimases, with little or no hydrolytic activity
against cefotaxime. ESBLs differed in substrate variability, with some enzymes hydrolyzing one or
more cephalosporin type over other types. The first enzyme with cefotaximase property but
susceptibility to ceftazidime was reported in 1986 in Japan from an E. coli isolate obtained from a dog
that was used to study cephalosporin pharmacokinetics. It was designated as FEC-1. On subsequent
amino acid sequencing, it was identified similar to CTX-M-3 β-lactamase.
The first clinical isolate with a cefotaximase property was reported from an E. coli grown from
ear discharge of a 4-month child in Munich, Germany in 1989. It was named CTX-M-1 (CTX for
cefotaximase and M for Munich). In the same year, another cefotaximase designated as MEN-1 (based
on patient’s name) was observed in an E. coli isolate obtained in France from an Italian patient. It was
later found to be identical to CTX-M-1. In 1989, cefotaximases were observed in S. typhimurium
obtained from patients with meningitis, septicemia and enteritis in Argentina. This enzyme had a
different pI value than that of CTX-M-1. Amino acid sequencing showed that it had only 84%
homology with that of CTX-M-1 and was designated as CTX-M-2.
In 1993, a cefotaximase was detected in an E. coli obtained from urine of a 1-year old child
with cystitis in Japan. It was designated as Toho-1 (based on Toho University School of Medicine). In
1995, another E. coli isolate with cefotaximase property was found in urine of a patient with colon
cancer in Japan. It was designated as Toho-2. Few years later, the amino acid sequencing led to their
renaming as CTX-M-44 and CTX-M-45, respectively.
In 1996 CTX-M-3 was identified among C. freundii and E. coli isolates obtained from urine
specimens in Warsaw, Poland. It was subsequently reported from France (1998) and Taiwan (1999). It
differs from CTXM-1 in four amino acid positions. CTX-M-4 was isolated in Russia in 1996 from S.
© Sridhar Rao P.N (www.microrao.com)
1
typhimurium isolates from stool specimens of patients with gastroenteritis as well as sewage specimen.
CTX-M-9 were reported from E. coli obtained from urine specimens from Spain and Brazil in 1996,
followed by detection in China (1997). A retrospective study in France suggested that CTX-M-9
producers existed in isolates collected during 1994.
CTX-M-10, which differs from CTX-M-3 by two amino acid substitutions, was discovered in
Spain in 1997. CTX-M-14 was detected in a stool isolate of Shigella sonnei and in blood isolates of E.
coli and K. pneumoniae in Korea in 1995. This was followed by its detection in China (1997) and
France, Taiwan and Brazil (in 1999). It differs from CTX-M-9 by only one amino acid change, at
position 231. CTX-M-15 was first described in fecal E. coli isolate from India in 1999. It differs from
CTX-M-3 in only one amino acid at position 240 (Asp→Gly), which confers increased catalytic
activity against ceftazidime. A retrospective study in Poland on Enterobacteriaceae isolates collected
during 1998 revealed the presence of CTX-M-15 in S. marcescens and E. coli strains. It is currently the
most widely disseminated CTX-M type.
Organisms producing CTX-M-β-lactamases:
CTX-M-β-lactamases are often observed in clinical isolates of E. coli and K. pneumoniae. But,
they have also been recovered from several members of Enterobacteriacae such as Citrobacter spp,
Enterobacter spp, S. marcescens, M. morganii, Proteus spp, Salmonella spp , Shigella spp etc.
They have also been observed among non-lactose fermenting isolates such as Pseudomonas
spp and Acinetobacter spp. CTX-M-1 was observed in sputum isolates of P. aeruginosa and
Strenotrophomonas maltophilia in Greece from patients with cystic fibrosis in 2004. In the same year
CTX-M-43 was identified in P. aeruginosa and Acinetobacter spp in isolates recovered from Bolivia.
In 2005, a CTX-M-2 producing P. aeruginosa was detected in a hospitalized patient in Brazil. CTXM-β-lactamases have also been detected in Aeromonas spp and Vibrio spp. However, their occurrences
in non-fermenters are still very less, which is probably because of incompatibility of plasmids in these
bacteria or could also be due to difficulty in detecting ESBLs in these isolates.
Classification:
CTX-M β-lactamases are typical ESBLs that belong to Bush’s group 2be and Ambler’s class
A. There are at least 128 CTX-M types that have been described so far. By using amino-acid sequence
relatedness, phylogenic tree of CTX-M β-lactamases has been constructed. They are divided into five
clusters (CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9 and CTX-M-25). Naming of the cluster was on
the basis of the first member of the group that was described.
Few members are shown below:
CTX-M-1 cluster: CTX-M-1, -3, -10, -12, -15, -22, -23
CTX-M-2 cluster: CTX-M-2, -4, -5, -6, -7, -20, -76, -77
CTX-M-8 cluster: CTX-M-8, -40, -63
CTX-M-9 cluster: CTX-M-9, -14, -15, -16, -17, -18, -19
CTX-M-25 cluster: CTX-M-25, -26, -39, -41, -91
Members within a group have >94% amino acid relatedness and ≤90% relatedness across the groups.
Hydrolytic property:
The blaCTX-M gene encodes a 291 amino acid enzyme. A single amino acid change in blaCTX-M
constitutes a new CTX-M type. Most of the CTX-M β-lactamases are resistant to cefotaxime and
ceftriaxone while being susceptible to ceftazidime. The active sites of many of these enzymes are not
enlarged to accommodate the drug; instead point substitutions leading to specific interactions may be
responsible for the improved activity against ceftazidime and cefotaxime. The C7 beta-amino thiazoloxyimino-amide side chain of ceftazidime has a protective effect against most CTX-M betalactamases. However, Asp240Gly CTX-M derivatives demonstrate enhanced hydrolytic activity
© Sridhar Rao P.N (www.microrao.com)
2
against this compound. Acquisition of ceftazidime resistance is frequently associated with mutations at
positions 167 and 240.
Some enzymes conferring ceftazidime resistance in each of the clusters are:
CTX-M-1 (CTX-M-15, CTX-M-23, CTX-M-28, CTX-M-29, CTXM-32, CTX-M-33, CTX-M-42)
CTX-M-2 (CTX-M-35 and CTX-M-43)
CTX-M-9 (CTX-M-16, CTX-M-19, and CTXM-27)
CTX-M-25 (CTX-M-25 and CTX-M-41)
CTX-M-93 has reduced activity against cefotaxime but increased activity against ceftazidime. It has
been observed that as these enzymes evolve a broader substrate range, they sacrifice stability.
Origin and evolution:
Unlike TEM and SHV enzymes, CTX-M enzymes have not evolved from point mutations in
the parent enzymes. They are believed to have originated from the chromosomal bla genes of Kluyvera
sps following mobilization into plasmids. Subsequent mutations have contributed to the diversification
of the CTX-M family. These mutations also gave the opportunity to expand the hydrolytic activity to
ceftazidime. Earlier CTX-M-β-lactamases were cefotaximases, but nowadays more than 60% of CTXM variants are able to hydrolyze both cefotaxime and ceftazidime.
Kluyvera species are environmental bacteria that are often isolated from water, soil, sewage,
and food products of animal origin. They also occur in low counts as commensal in human and animal
intestines. They have been found to be responsible for few opportunistic infections and have been
isolated from urine and soft tissue infections. CTX-M-1 cluster is believed to have originated from the
bla gene (kluC) of Kluyvera cryocrescens. CTX-M-2 cluster is believed to have originated from kluA
gene of K. ascorbata. CTX-M-8, CTX-M-9 and CTX-M-25 clusters are believed to have originated
from chromosomal bla genes of K. georgiana kluG, kluY and blaCTX-M-78 respectively. It is believed
that CTX-M-74 and CTX-M-75 represents another newer cluster. More recently, it has been suggested
that CTX-M-45 also forms a new, separate cluster.
It is believed that recombination events have also helped in evolution and diversification of
CTX-M-β-lactamase. It is suspected that CTX-M-64, which was described in a Shigella sonnei isolate
in Japan from a tourist who had visited China, has evolved out of recombination between CTX-M-14
and CTX-M-15 genes. Such an event is likely to occur in the presence of multiple CTX-M type in the
same habitat. CTX-M-64 were isolated from three patients in China, who also harboured isolates with
other CTX-M enzymes.
Mobilization and spread:
Even though many Kluyvera spp contain the blaklu genes, they don’t express the betalactamases and are susceptible to inhibition by cefotaxime as these genes are weakly expressed. The
presence of a strong promoter upstream of the bla gene results in expression of cefotaxime resistance.
Insertion sequences (IS) containing a strong promoter have been observed in clinical isolates
exhibiting CTX-M phenotype. These insertion sequences are not found in the natural isolates of
Kluyvera.
In some cases, the insertion sequences that lie adjacent
to blaCTX-M gene are found in integrons, which in turn
are present in transposons. These transposons may
integrate into the plasmids. Various IS identified
upstream of blaCTX-M genes include ISEcp1, ISCR1,
IS10 and IS26. ISEcp1, which was first detected
adjacent to a CTX-M-15 gene, is the most widely found
IS that is located 42–266 bp upstream of different
blaCTX-M. It provides a high-level expression promoter
for blaCTX-M. It has been associated with almost all
© Sridhar Rao P.N (www.microrao.com)
3
clusters except CTX-M-8. ISCR1 has been found in members of CTX-M-2 and CTX-M-9 clusters.
IS10 has been found in CTX-M-8 cluster. It is believed that there are nine mobilization events; three in
CTX-M-1 cluster, two in CTX-M-2 cluster, two in CTX-M-9 cluster and one each in CTX-M-8 and
CTX-M-25 clusters.
Integrative and conjugative elements (ICE) that include ‘conjugative transposons’ and
‘integrated conjugated plasmids’ are diverse group of mobile genetic elements are present in both gram
positive and gram negative bacteria. They are usually found integrated into the bacterial chromosome
but can excise themselves and reintroduce themselves into another chromosome and transfer between
bacterial cells like plasmids. Some of the ICE and IS fail to recognize their own terminal sequences
resulting in mobilization of adjacent sequences by a process known as open-end transposition. This is
often seen with ISEcp1 and ISCR1 as well as transposons Tn3 and Tn21.
blaCTX-M-10 gene has been associated with phage related sequences, which suggests the
involvement of bacteriophage in the mobilization of this CTX-M gene.
blaCTX-M genes are usually present on large plasmids that also carry additional resistance genes,
but have been found on plasmids ranging in size from 7 to 430 kb. The blaCTX-M gene is mainly
associated with incompatibility group FII plasmids, which are narrow host-range plasmids and are
characterized by low copy numbers. These plasmids, which have the propensity to readily acquire and
disseminate resistance genes in Enterobacteriaceae members, are termed as ‘epidemic resistance
plasmids’. It is believed that IncFII plasmids were widely distributed in Enterobacteriaceae and well
adapted to the hosts even before the introduction of antibiotics. Broad host-range plasmids such as
IncN, IncI1 and IncL/M have also been involved in the dissemination of CTX-M genes. These
plasmids are also known to harbour additional genes conferring resistances to aminoglycosides and
fluoroquinolones. IncL/M plasmids have been involved in the spread of blaCTX-M-3 in Poland and
several other Eastern European countries. IncHI2 seems to have preference for blaCTX-M-9 whereas
IncK has preference for blaCTX-M-14. The spread of blaCTX-M-14 in Southern Europe has been mainly on
IncK plasmids whereas its spread in Northern Europe has been on IncI1 and IncFII plasmids.
Just as the chromosomal genes have integrated into plasmids, there are reports of the reverse;
where plasmid meditated CTX-M-15 genes have been integrated into chromosomes of E. coli, S.
enterica and K. pneumoniae.
Clonal dispersion:
Worldwide dissemination of CTX-M enzymes has been helped by the participation of specific
E. coli and K. pneumoniae clones. Despite high diversity among CTX-M producers, a few clones or
sequence types (ST) are often found associated with CTX-M enzymes. It is believed that CTX-M
genes have successfully adapted in these clones and have led to dissemination of these enzymes. They
have been termed as ‘high risk clones’. E. coli belonging to ST 131, phylogenetic B group and
serotype O25:H4 has been particularly associated with CTX-M-15. This international clone is also
associated with CTX-M-1, CTX-M-3 and CTX-M-9, CTX-M-10 and CTX-M-14. It is often seen in
community acquired urinary tract infection, but also has been recovered in hospitalized patients as well
as from animals. Other lineages such as ST38, ST393 and ST405, which belong to phylogenetic D
group, too have been associated with CTX-M enzymes. ST38 and ST393 have been found to be
associated with CTX-M-9 and CTX-M-14 genes whereas ST405 has been associated with CTX-M-15,
CTX-M-14, and CTX-M-3 genes. CTX-M-associated E. coli clones are highly virulent, easily
transmitted among family members of colonized or infected patients, and have been found in animals.
Most CTX-M enzymes have more frequently been linked to E. coli isolates of groups D and B. CTXM-15-producing strains seems to be more common with groups B2 and D, whereas CTX-M-14
producing strains are more common with phylogenetic groups A, B1, and D. CTX-M-9 producing E.
coli strains are more commonly linked to groups D and A.
© Sridhar Rao P.N (www.microrao.com)
4
K. pneumoniae clonal complex (CC11) is widely spread in Asia and is associated with CTXM-14 and CTX-M-15 enzymes. CC11 along with ST15 and ST147 has been responsible for countrywide dissemination of CTX-M-15 producing K. pneumoniae in Hungary. A K. pneumoniae clone
ST16 bearing CTX-M-15 and SHV-28 was responsible for hospital infection in Denmark.
Epidemiology and spread across the world:
Most reports of ESBLs worldwide indicted either TEM or SHV derived enzymes until the early
2000. The first decade of 2000 has seen an explosive spread and high degree of diversification of
CTX-M β-lactamases. These enzymes have been observed in E. coli isolated from community
acquired UTIs and infections in both ICU and non-ICU sections of hospitals worldwide. This has been
termed as “CTX-M pandemic”. At present the most widely distributed CTX-Ms are CTX-M-1,
CTXM-3, and CTX-M-15 of the group 1 and CTX-M-9 and CTX-M-14 of group 9.
Some studies have shown that dissemination across the globe have occurred due to
international travel and immigration. Travel to the Indian Subcontinent and the Middle East is
suspected to be associated with high risk of colonization or infection by ESBL producing isolates.
Import of animals or animal-derived food contaminated by CTX-M producing bacteria is another route
of dissemination. Few studies have revealed simultaneous origins of certain CTX-M types in
geographically different locations at the same time period and plasmid studies suggested that they
originated independent of each other.
The most prevalent CTX-M-1 cluster has been reported throughout Europe and includes CTXM-1, CTX-M-3, CTX-M-32, and CTX-M-15. CTX-M group 9 are mostly present in South-Eastern
Europe, including Spain, Portugal and United Kingdom. CTX-M-9 and CTX-M-14 are prevalent in
Northern Europe. CTX-M-40 and CTX-M-26 have been described in the United Kingdom. In the
Canada and the United States CTX-M clusters 1 and 9 are found in clinical isolates of
Enterobacteriaceae. Majority of CTX-Ms detected in Canada are CTX-M-15 followed by a minority of
CTX-M-14. CTX-M types -14 and -3 are predominant in China. CTX-M-2 and CTX-M-14 were
isolated at high frequencies in Japan. Most of CTX-Ms described in India belong to CTX-M-15; the
other types being CTX-M-3 and CTX-M-1. CTX-M-2 is the most prevalent CTX-M type across South
America. Other reported CTX-M types include CTX-M-31, CTX-M-8, CTX-M-9, CTX-M-12, CTXM-14, CTX-M-15, and CTX-M-16. CTX-M-15 is the dominant ESBL type among clinical isolates of
E. coli and K. pneumoniae in Australia.
Multi-drug resistance:
Many of the CTX-M ESBL producing isolates are often resistant to fluoroquinolones and
aminoglycosides. The IncFII plasmids that bear blaCTX-M genes also bear aac(6’)-Ib-cr gene, which
encodes an aminoglycoside- and fluoroquinolone-modifying enzyme. Genes encoding resistance to
macrolides, tetracyclines, sulphonamides, trimethoprim, and chloramphenicol have all been associated
with blaCTX-M containing plasmids. It is believed that fluoroquinolone or multi-drug resistance gives
advantage to CTX-M for maintenance due to co-selection process. Some of the CTX-M-15 producers
have been found to be resistant to carbapenem, but no mutations are involved in this resistance. It is
often due to co-production of other beta-lactamases or loss of porins. Carbapenem resistance in K.
pneumoniae is often due to loss of OmpK35 and OmpK36 whereas decreased expression of OmpF and
OmpC is associated with carbapenem resistance in E. coli. Some CTX-M producers have been found
to co-produce VIM-1, NDM-1 or OXA-48 carbapenemases. The resistant bacteria tend to become
even more resistant by acquiring multi-drug resistant phenotypes; this has been described as ‘genetic
capitalism of resistant bacteria’.
Detection of CTX-M-β-lactamases:
Phenotypic detection of CTX-M ESBL producing Enterobacteriaceae isolates is difficult as
there are no specific tests to identify CTX-M types. . CTX-M ESBLs have pI values that fall in the
range 7.4-9. Because of overlapping isoelectric points, isoelectric focusing is not used in the
identification of these enzymes.
© Sridhar Rao P.N (www.microrao.com)
5
Isolates resistant to cefotaxime but susceptible ceftazidime should indicate possible CTX-M type, but
many of the CTX-M types can hydrolyze cefotaxime as well as ceftazidime. PCR amplification and
sequencing of blaCTX-M genes are used to characterize organisms producing CTX-M-β-lactamases.
A multiplex CTX-M PCR was developed, which allowed differentiation between different
blaCTX-M subtype groups. This method was reported to give non-specific PCR amplification in K1
producing K. oxytoca isolates. Another approach is to use a CTX-M-consensus primer-pair to establish
a blaCTX-M-genotype in Enterobacteriaceae, including K. oxytoca. Consensus primers, which recognize
almost all of the known variant genes of blaCTX-Ms, are used to generate an amplified product of 544
bp. Further identification of the specific groups of blaCTX-Ms, restriction fragment length polymorphism
(RFLP) analysis can be employed. However, this method gives false positive amplification with
OXY/K1-genes. Hence, PCR alone is not sufficient to detect these enzymes; the amplicons must be
subjected to DNA sequencing.
CTX-M consensus primers:
MA1 (F) SCSATGTGCAGYACCAGTAA
MA2 (R) CCGCRATATGRTTGGTGGTG
or
CTX-M-U1 ATGTGCAGYACCAGTAARGTKATGGC
CTX-M-U2 TGGGTRAARTARGTSACCAGAAYCAGCGG
(R stands for purine, Y stands for pyrimidine, and S stands for G or C)
CTX-1F (F) CCCATGGTTAAAAAATCACTG 891bp
CTX-1R (R) CCGTTTCCGCTATTACAAAC
CTX-2F (F) ATGATGACTCAGAGCATTCGC 893bp
CTX-2R (R) TCGCTCCATTTATTGCATCA
CTX-8F (F) ATGTTAATGACGACAGCCTGTG 689bp
CTX-8R (R) CCGGTTTTATCCCCGACA
CTX-9F (F) GATTGACCGTATTGGGAGTTT 909bp
CTX-9R (R) TATTGAGAGTTACAGCCCTTCG
CTX-25 (F) ATGATGACTCAGAGCATTCG
CTX-25 (R) TGGGTTACGATTTTAGCCGC
Ligation-mediated amplification combined with detection of amplified products on a microarray has
been used to detect the various CTX-M groups with 95% specificity and sensitivity.
Last edited on 03rd July, 2012
Further reading/reference:
1. Cantón R, González-Alba JM, Galán JC. CTX-M Enzymes: Origin and Diffusion. Front
Microbiol. 2012;3:110
2. Naseer U, Sundsfjord A. The CTX-M conundrum: dissemination of plasmids and Escherichia
coli clones. Microb Drug Resist. 2011 Mar;17(1):83-97
© Sridhar Rao P.N (www.microrao.com)
6