Jpn. J. Infect. Dis., 55, 14-18, 2002
Original Article
Prevalence ofEscherichia coli Possesslng the eaeA Gene of Enteropathogenic
E. coli (EPEC) Or the aggR Gene of Enteroaggregative E･ coli (EAggEC) in
Traveler's Diarrhea Diagnosed in Those Retumlng tO Tama, Tokyo
from Other Asian Countries
Kazue Ogatal, Rei Katol, Kenichiro lto3 and Sumio Yamadal.2*
J Tama Branch Laboratory, Too,o Metropolitan Research Laboratory OfPublic Health,
Shibazaki-cho 3-16-25, Tachikawa-shi, To砂0 190-0023,
20nice ofQualiO) Assurance, To砂o Metropolitan Research Laboratory Qflpublic Health,
Hyakunin-cho 3-24-1, Shinjuku-ku, To&0 16910073 and
3National Institute of Public Health,
Shirokanedai 4-6-1, Minato-ku, Too)o l08-8638, Japan
(Received June 1 1, 2001. Accepted January 29, 2002)
SUMMARY: To elucidate the importance of enteropathogenic Escherichia colt (EPEC) and enteroaggregative
E. colt (EAggEC) as etiological agents in traveler's diarrhea, the detection of the eaeA and aggR gene in E･ coli
strains isolated from overseas travelers with diarrhea in Tama, Tokyo was carried out uslng a PCR method. Of
192 travelers who were mostly adults and had visited Asian countries from April 1998 to March 1999, aggRpositive E･ colt straiTs were detected in 26 ( 1 3 ･5%)･ These stra空represent the second predonlinant enteropathogen
following enterotoxlgenic E. colt (ETEC), whereas eaeA-posltlVe E･ coli strains were confi-ed in seven subjects
(3.6%). Tn 1 3 cases with aggR and four caseswith eaeA, the organisms were detected in stool samples of patients
as the only potential enteric pathogen. The clinical symptoms of these patients were similar to those in patients
with ETEC; however, the severlty Ofillness was milder than that associated with ETEC alone. Three strains with
eaeA and flVe Strains with aggR were typed as six different kinds of 0 serogroups, of which four strains
belonged to the classical EPEC serogroups (055, 01 14, 0119, and O127a)I These finding苧suggestthat aggR-
positive E. coli (EAggEC) is a signiflCant Causative agent in traveler's diarrhea. ln addition, lt Was demonstrated
that eaeA-positive E. colt (EPEC) is markedly correlated with diarrhea in adults.
associated with specific agg operons ( I 1 , 1 2). Tn recent studies,
INTRODUCTION
it was demonstrated that dgg operons consisted of several
Escherichia coIL'can cause gastrointestinal infectiops ( I )I
potential reading frames, e.g., aggA, aggB, aggC, aggD, and
aggR (13,14). Furthermore, it was revealed that certain
EAggEC strains produce an STJlike toxin (enteroaggregative
Diarrheagenic E. coIL'can be grouped into five categorleS (2)
Pn the basis of the types ofvirulence, i･e･, production of toxin,
ST, EAST)(15).
1nVaSiveness, patterns ofbacterial attachment to host cells,
and effects of attachment on host cells: enterotoxlgenic E.
ln some case-Control studies of infant and childhood diarrhea,
coli (ETEC), enterohemorrhagic E. colt (EHEC), enteroinvasive
the pathogenic role ofEPEC in infants younger than 12 months
E. coli (EIEC), enteropathogenic E. colt (EPEC), and entero-
old has been well described (16-20); EAggEC has been
aggregative E. coli (EAggEC). Tn addition, it has been proposed
associated with persistent diarrhea among children (20-22).
that difhsely adhering E. colt (DAEC) is diarrheagenic, but
In contrast, the slgnirlCanCe Ofthese organisms as etiologlCal
its role in acute diarrheal disease is controversial (3). In Japan,
agents in adult disease remains unclear. EAggEC was evaluated
strains belonglng tO Classical EPEC serotypes have also been
as a slgnificant etiologlCal agent in recent studies of diarrhea
included as a. group or enteropathogens (4)･
diseases in North American travelers to Mexico (23) and
EPEC stralnS usually exhibit localized adherence (LA) to
epithelial cells and induce attaching and effacing (A/E) lesions
the role ofEPEC in traveler's dia汀hea has not been thoroughly
on enterocytes (5,6)･ EPEC virulence genes eafand eae are
investlgated. ln Japan, traveler's diarrhea has also been a
respectively associated with LA and A/E lesions (7-9), and
public health problem and has affected the actual states of
among Spanish travelers to developing countries (24). However,
recently, bundle-forming pi]us (Bfp) has been reported as?ne
gastrointestinal infection (25). To determine the role played by
adherence factor (10). EAggEC strains show aggregatlVe
adherence (AA) to HEp-2 0r HeLa cells; such adherence is
mediated by aggregative adherence fimbriae 1 (AAF/1)
EPEC and EAggEC as causative agents of traveler's dia汀hea
in Japanese travelers to developlng countries, the presence or
absence of the eaeA or aggR gene ofE. colt strains isolated
from overseas travelers in Tama, Tokyo, was examined by
PCR. ln addition, the clinical symptoms oftravelers infected
with EPEC and EAggEC were investlgated.
*Corresponding author: Mailing address: O作ce of quality
Assurance, Tokyo Metropolitan Research Laboratory of Public
Health, Hyakunin-cho 3124-1, Shinjuku-ku, Tokyo 169-0073.
Tel: +81-313363-3231, Fax: +81-3-3368-4060, E-mail:
yamada@tokyo-eiken. go jp
14
Themixture was amplified by 25 cycles of denaturation at
MATERIALS AND METHODS
94oC f♭r 0.5 min, annealing at 50oC fわr 1.0 min, and exten-
Stool samples: A total of 192 fecal specimens obtained
from travelers retumng to Japan from other countries, mostly
PC-700 (ASTEC Co., Ltd., Tbkyo). Ten microliters of the
Asian countries, during the period from April 1998 to March
reaction mixture were then analyzed by electrophoresis on
sion at 72oC for 1.5 min with Program Temp Control System
1999 were examined. Stool specimens collected fTrom persons
1.5% agarose gels, and the reaction products were visualized
under quarantine or receivlng medical care were received in
by stainlng With ethidium bromide.
Cary and BlaiトtranSpOrtation medium at public health centers
0-serotyping ofE･ coli isolates and eaeA- or aggR- ppsト
in Tama, Tokyo, and were transferred within 2 days to our
tive strains: 0 antlgenS Were determined by slide agglutlna-
laboratory. Health cards of the travelers accompanied the
specimens; these cards included infbmation such as countries
visited and clinical symptoms. Infbmation on the cards was
tion tests with kits using E. coli antisera (I) (Denka-Seiken).
Adherence assay: For the eaeAl 0r aggR- positive E. coli
isolates, marlnOSe-resistant adhesion to HEp-2 cells was tested
glVen by the traveler at the time of stool sample collection.
by the method described by Cravioto et al. (29).
Standard procedures: Stool samples were cultured by
previously described methods f♭r bacterial pathogens (26).
RE StJIJTS
For the diagnosis of diarrheagenic E. colt, three suspected
colonies on DHL agar (Nissui Phamaceutical Cot, Ltd., Tbkyo)
The travelers examined were mostly adults, and were acute
plates were randomly selected and screened biochemically.
or convalescent-phase patients. According to the standard
The E. colt strains thus identified were tested for a classical
procedure (4), enteropathogens were detected in 87 0日92
EPEC serotype, ETEC, and Shiga-toxin (STX) producing-E.
colt (STEC)･ In brief, boiled cells ofEI COli strains were
cases (45.3%). As shown in Table 2, by the introduction of
serogrouped by a slide agglutination test with the fbllowlng
the aggRIPOSitive E. coli was detected in 26 cases (13.5%),
types of commercial antisera from Denka-Seiken Co., Ltd.
whereas eaeA-positive E. Colt was confirmed in only seven
PCR assays to detect eaeA or aggR genes ofEPEC or EAggEC,
0126, 0127a, 0128, 0146, and 0166. Forthe toxin tests, E.
cases (3.6%). Three cases with eaeA-E. colt and 1 3 with aggRE. coliinvolved a possible mixed infection. Consequently, a
colt strains were inoculated into casamino acid-yeast extract
tota一 of 1 04 cases were pathogen-positive, and the positivlty
broth (Nissui) and were shaken at 370C fわr overnight. The
ratio increased to 54.2%. Number orenteropathogens isolated
(Tokyo): 026, 044, 055, 086, 0111, 0114, 0日9, 0125,
culture was centrifuged for 20min at 23,000 × g, and the
were 1 62 strains, in which most prevalent one was the ETEC.
supernatant was examined for heat-labile toxin (LT) by CT-
RPLA (Denka-Seiken), for heat-stable toxin (ST) by COuST
Next most prevalent pathogen isolated was the aggRIPOSitive
E. colt, followed by Plesiomonas shigelloides, Aeromonas
EIA (Denka-Seiken), and fわr STX by VT-RPLA (Denka-
spp･, Campylobacter spp., classical EPEC serotype, Salmonella
Seiken).
spp., Vibrio parahaemolyticus, and eaeA-positive E. colt.
PCR assay: The various prlmerS used for the detection of
the virulent genes ofEPEC and EAggEC are listed in Table 1
infection with PlesEbmonas, A e710mOnaS SPP. and Campylobacter
Three of the patientswith eaeAIPOSitive E. Coli had mixed
(27,28), The determination of EPEC and EAggEC in the
spp., or AelVmOnaS SPP. and aggR-positive E. colt'. One-half
strains tested was perfonned by the identification of the eaeA
(13 cases) ofall aggRIPOSitive E. Colt cases were detected
gene, and aggR gene. Furthennore, the eaeA I 0r aggRIPOSitive
together with one to fわur other enteropathogens. They were
strains were tested for the presence of the eafand bfpA genes,
classified in ten patterns, and involved combinations or
or the astA gene. ln brief, stock cultures were hoculated onto
nutrient agar slants and incubated at 370C ovemight. A small
Aeromonas spp･, V. parahaemolyticus, and eaeA-positive E.
cluster orbacteria was suspended in 100 〝l ofdistiHed water,
L･OIt'.
Camplyobacter spp., Plesiomonas, Salmonella spp., ETEC,
The suspected countries where infectionwith eaeA-positive
and boiled at 94oC for 5 min. After a short centrifugation (I
min, 18,000 × g), 4.8 lil oftemplate were mixedwith 5 Lil
of 10 XPCRbuffer (Takara Shuzo Co. Ltd., Kyoto), 3 LEI of
Tablc 2. Detection ofenteropathogens from overseas travelers
25 mM MgCl, 2 LEI of2.5 mM dNTP (Takara Shuzo), 0.1 Lil
with diarrhea jn Tama, Tokyo (April 1998-March 1999)
of50 uM sense prlmer and antisense prlmer, 0.2 〃l ofTaq
Numbcr examined 1 92
DNA polimerase (Takara Shuzo), and 35 LLl of distilled water.
Number positive for pathogens (%) 1 04 (54.2)
No. orcases with (%):
Table L PCR prlmerS used in this study
Gene
Primer
eaeA eaek 1 *
eaek4*
EAF EAF-B* *
EAF-SR**
E!rpA bfps**
bfpas**
aggR aggRksl**
aggRkas2* *
astA EASTOS 1 **
EASTOAS2**
Sequence
Location
GCTTAG TGCTGGTTTA GGAT
TCGCCGTTCAG A GATCGC
66-85
554-537
TGG ATCG C CAATGTTCTTGG
14ト160
ATGGGG ACCATGTATTATC A
922-941
Enterotoxlgenic E. coli
36 (18.7)
aggR gene-positive E. colt
26(13.5)
P/eLu'(,m()naS Shigelloides
25 (13,0)
Aeromonas sppI
18( 9.4)
Campy/Obacter spp ,
12( 6.2)
Classical EPEC serotype
ll( 5.7)*
Salmonella spp.
10( 5.2)
V. parahaemolvticus
10( 5.2)
G AAGTAATGAGC GCAACGTC
154-173
ACATGCCGCTTTATCCAACC
387-368
eaeA gene-positive E. colt
7( 3.6)
GTATACACAAAAGAAG GAAGC
loo-120
Shigella spp.
3( 1.6)
ACAG AATC G TCAGCATC AG C
353-334
Verotoxin-producing E. coli
2( 1.0)
G CCATC AACACAGTATATC CG
3-23
V. cholerae 0- I ttox十)
1( 0.5)
CGCGAGTGACGGCTTTGTAG
11ト92
V. cholerae 0-1 (tox一)
1( 0.5)
* : Reference28.
* : One eaeA gene-positive E. C(Jli and three aggR gene-positive
** : Reference 27.
E. cL7/i were observed.
15
E. coIL'occurred were Thailand (2 cases), Indonesia (2 cases),
Viet Nam ( 1 case), and others (2 cases). Those countries where
(2 strains each), and 055, 01 19, 0125, 0126, 0127a, 0142,
or 0146 (1 strain each). Four of the strains mentioned above
aggR-positive E. Colt infection occurred were Thailand (8
were positive for either the eaeA or aggR gene. In contrast,
cases), Indonesia (5 cases), India (5 cases), Viet Nan (2 cases),
Philippines (2 cases), Iran (1 case), and South Africa (I case).
the ETEC and verotoxin-producing E. coli (VTEC) strains
that were isolated did not possess either of the genes.
The remainlng two Cases Were detected in travelers who had
visited other Asian countries. There was no special seasonal
DISCUSSION
variation associated with either of the E. coli isolations.
The eaeA- and aggR-positive strains were characterized
Enteric infection due to EPEC or EAggEC is characterized
serologlCally, phenotyplCally, and genetically; on一y three
by acute diarrhea in infants or chronic diarrhea in children in
eaeA-positive strains and five aggR-positive strains were
developing countries. In previous studies (23,24), EAggEC
typed to particular serogroups, namely, 0153 (2 strains) and
strains have been involved in the etiology or traveler's dia汀hea
055 (I strain) in the fbmer, and 015 (2 strains), 01 14, 0119,
or 0 1 27a (each I strain) in the latter. Among.serotyped strains,
eaeA-positive E. coli 055, and aggRIPOSltlVe E. coli 01 14,
01 19, and O127a had already been detemined as one of the
classic EPEC groups. In the HEp-2 cell adherence assay, a
typical LA pattern was observed in only two of the eaeAI
in North American travelers to Mexico and in Spaniards traveレ
mg to developlng COuntries. However, an association between
the presence orEAggEC or EPEC strains in stool samples of
dia汀hea in adults has not been conclusively demonstrated,
In order to dete-in° the potentially causal role orthe EAggEC
and EPEC strains in traveler's diarrhea, genetic diagnosis by
positive strains, whereas 1 4 aggR-positive strains showed the
PCR assay was performed on the E. colt strains isolated fTrom
typlCal AA pattem. Furthermore, none of the eaeA-positive
overseas travelers presentlng With diarrhea in Tam乱, Tokyo.
strains possessed the eqfand bhA gene, but 1 2 aggR-positive
The aggRIPOSitive E. coli was detected in 26 (13.5%) of the
1 92 cases oftraveler's diarrhea; thus, this strainwasthe second
most prevalent strain after ETEC. Similarly, Mathewson et
strains were asIA-positives.
To clarify the severityofillness and the clinical symptoms
of patients infected with eaeA-, or aggR-positive E. co/i,
al. (23) reported that E. colt strains showing mannose-resistant
retrospective investlgations were ca汀ied out on 1 6 patients,
focal adherence were detected in 1 7 cases (9.0%) of the North
among whom either of the two strains was fわund as the only
American travelers studied. Recent work by Gascon et al.
potential enteric pathogen; these cases were compared with
(24) showed that the plasmid DNA fわr EAggEC was present
those in which patterns were infected with ETEC alone. As
in 23 cases (13.9%) among the Spanish travelers included in
shown in Table 3, the severlty Ofthe illness and the clinical
that study. Typically, aggRIPOSitive E. co/i strains were
symptoms of patients infected with aggR-positive E. coli and
detected among travelers to Southeast Asian countries or to
those witll ETEC were almost identical, although a predomi一
the Indian subcontine叫and geographic distribution was
れance of mild cases with diarrhea occurrlng less than fわur
similaJ･ tO that observed in the case ofETEC. On the other
times per day was observed in aggR-positive E. colt infec-
hand, EAggEC strains confirmed in the study of Spanish
tions. In addition, abdominal cramps were obseⅣed in 69%
travelers were isolated in travelers retumlngfrom all geographic
of the cases; a few of the cases were accompanied by fever
areas, especially from the Indian subcontinent, West Africa,
(3 1%), nausea, and/Or vomiting (38%). A fTew patients infected
with eaeA-positive E. colt also experiencedmildly watery
and Central America.
Among the cases in which aggR-positive E, coli was
diarrhea and headache or fever, but none reported abdominal
detected, 1 3 cases involved this organism as the only potential
Cramps ･
enteropathogen. The clinical symptoms associated with the
Classic EPEC serotype strains were detected in ll cases;
these which serotypes belonged to serogroups 0 1 14 and 0 1 28
aggR-positive strain were watery diarrhea (6 I %), abdominal
cramps (69%), fever (31%), and nausea or vomiting (39%)･
How㌣er, the severlty Ofillness was milder than that obseⅣed
in patlentS With ETEC infection alone. Tn the investlgation of
Spanish travelers, Gascon et al, reported that five of 23
EAggEC strains caused chronic diarrhea (>14 days); the
clinical symptoms of patients with other EAggEC strains were
Table 3. Symptoms and severlty Oftraveler's diarrhea in patients
from whom eaeA or aggR gene positive E. colt- was isolated as
the only potential enteric pathogen
% of symptoms with:
similar to those reported in our results. The present and
eaeA-E. Colt aggRIE. COILI ETEC*
previous findings indicate that EAggEC is important as an
Characteristics
of patients
(ll-4) (n-
etiologlCal agent in travelers retumlng With gastrointestinal
13) (a-25)
illness from a developlng country.
Character Of stool
Watery
1
00 0 0
As shown in the report byAlbert et al. (20), EPEC is a
′n ヽヽ.
l 1 0n
Loose
slgnificant enteric pathogen in infants of up to 12 months of
Bloody
age; the prevalence of this pathogen tends to diminish with
age. ln the present study, jt was suggested that the eaeA-positive
Maximum nulllber of diarrhea episodes per day
Mild(1-3)
100 54
Moderrate (4-6)
0 3fS
Severe (>7)
O 8
Abdolllinal cramps
E. Colt strain is markedly correlated withadult diarrhea,
2 5 2 ′nU て｣ 4 2 4 4 ∠U
although the occu汀enCe Of such strains was lower than that
of EAggEC, which accounted fわr seven cases (3.6%). Four
of seven eaeA-positive E. colt strains were identified as only
0 69
potential enteropathogens, and their patients had mild cases
Nausea/vomitlng
50 39
Fever
50 31
Additional clinical symptoms were nausea and/Or vomltlng,
H eadache
50 15
and fever (2 cases e,ach); however, no patients in this group
with watery dia汀hea occumng less than fわur times per day.
experienced abdomlnal cramps.
* : Patients infected with enterotoxigenic E. colL- (ETEC) alone during
Although it is or interest to study the correlations between
the sallle period.
lb
certain serotypes and particular gene-positive E. coli strains,
mucosa. Infect. Immun., 55, 69-77.
only three eaeA-positive strains and five aggR-positive strains
7. Donnenberg, M. S. and Kaper, ∫. (1992): Enteropath0-
could be typed in the present study･ Of which one eaeA-
genic Escherichia coli. Infect. Immun･, 60, 3953-3961 ･
8. Giron, ∫.A., SucYue Ho,A. and Schoolnik, G. K. (1991):
positive E. coli strain and three aggR-positive E･ colt strains
belonged to the classic EPEC serogroups; 055 in the case of
eaeA and Ol14, 0119, and O127a in aggR. Among the
remainlng four strains, two eaeA-positive strains were 0 1 53,
and two aggR-positive strains were 01 5. These results agree
An inducible bundle-formlng Pilus of enteropathogenic
Escherichia coli. Science, 254, 710-713.
9. Jerse,A. E., Yu, J., Tall, B. and Kaper, J. B. (1990): A
genetic locus of enteropathogenic Escherichia coli neces-
with those ofMathewson et al. (23) and Gascon et al. (24),
sary for the production of attaching and effacing lesions
who also described that only two of28 enteroadherent E. coli
on tissue culture cells. Proc. Nath. Acad. S°i., 87, 7839-
strains isolated from North American travelers belonged to
the classical serogroup 044, and none of the EAggEC strains
7843.
10. Grion, ∫. A., Donnenberg, M. S., Martin, W. C., JaⅣis,
K. G. and Kaper, J. B. (1993): Distribution of the bundleforming pilus structural gene (bfpA) among enteropath0-
isolated from the Spanish cases was positive for the classic
serotypes. On the other hand, in a previous study on acute
infantile diarrhea (1 8), 70% of LA-E. coli strains belonged
genic Escherichia coli. J. Infect. Dis., 168, 1037-1041･
1 1. Vial, P. A., Robins-Browne, R., Lior, H., Prado, V, Kaper,
to the classical EPEC 0 serogroups. Moreover, C血an et al･
(30) demonstratedthat the predominant serogroups of AA-E･
J. B., Nataro, ∫. P., Maneval, D., EIsayed, A. E. and
coli strains from acute and chronic diarrhea were 044, 0 I 1 I ,
Levine, M. M. ( 1 988): Characterization ofenteroadherent
and 0126. These differences may indicate that there are
broader serogroups of EPEC or EAggEC than are currently
recognized and that differences in the specific 0 serogroups are
aggregative Escherichia coli, a putative agent of diarrheal
disease. J. Infect. Dis., 158, 70179.
12. Nataro, J. P., Deng, Y., Maneval, D. R., German, A. L.,
predominant in infant, childhood, and adult types of diarrhea･
Martin, W. C. and Levine, M. M. (1992): Aggregative
The identification ofEPEC and EAggEC has been performed
adherence fimbriae I of enteroaggregative Escherichia
by obseⅣlng the adherence pattems to HEp-2 cells, or by a
c(フJf mediate adherence to HEp-2 cells and hemagglutina-
combination of cell assay and hybridization with DNA probes
of virulence factors. However, several studies have demonstrated that 37% of adherent strains ofE. colt exhibit atypical
or non-characteristic pattems ( I 7), andthatthere are differences
among the results ofcell assays and DNA-hybridization tests
as regards LAIE. coli strains (17, 19,20). In present study, two
eaeA-positive E. coli strains and 14 aggR-positive E. colt
tion of human erythrocytes. Infect. Immun., 60, 22972304.
13. Savarino, S. J., Fox, P., Yikang, D. and Nataro, J. P.
(1994): Identification and characterization of a gene
cluster mediating enteroaggregative Escherichia coli
aggregative adherence fimbria I biogenesis. ). Bacterio1.,
176, 4949-4957.
strains showedtypical adherence patterns, but the other strahs
14. Nataro, J. P., Yikang, D., Yingkang, D. and Walker, K.
could not be identified. In addition, none of the eaeA-positive
(1 994): AggR, a transcriptional activator of aggregative
E･ colt str.aims possessed the bhA or eafgene, whereas 12
adherence fimbria I expression in enteroaggregative
aggR-posltlVe E. colt strains were astA-positive. Further
Escherichia colt. J. Bacterio1,, 176, 4691-4699.
studies will be necessary ln Order to determine whether EPEC
15, Savarino, S, JリFasano,A., Robertson, D. C. and Levine,
or EAggEC strains play a slgnificant role in infantile and
M. M. (199 1): Enteroaggregative Escherichia coli elabo-
childhood diarrhea, or in gastroenteritis in adults.
rate a heat-stable enterotoxin demonstrable in an in vitro
rabbit intestinal model. ∫. Clin. invest., 87, 1450-1455.
16. Comes, T. A. T., Rassi, V, MacDonald, K.し, Romos, S.
REFERENCES
R. T. S., Trabulsi,し. 良., Vieira, M.A. M., Guth, B. E. C.,
l･ Gray, L D･ (1995): Escherichia, Salmonella, Shigella,
and Yersinia. p.4501456. In P.R. Murray, E. J. Baron, M.
A. Pfaller, et al. (eds.), Manual ofClinical Microbilogy.
6th ed. AMS Press, Washington.
Candieas, ∫. A. N., lvery, C., Tbledo, M. 良. 已 and Blake,
P･ A･ (1991)‥ Enteropathogens.associated with acute
diarrheal disease in urban infantlS in S畠o Paulo, Brazil.
J. Infec. Dis., 164, 3311337.
2. Salyers, A. A. and Whitt, D. D. (1994): Escherichia colt
17. Forestier, C., Meyer, M., Favre-Bonte, S., Rich, C.,
gastrointestinal infection. p. 1 901204. In A. A. Salyers and
Malpuech, G., Le Bougenec, C., Sjrot, ∫., Joly, 良. and de
D･ D Whitt (eds･), Bacterial Pathogenesis-a molecular
approach･ AMS Press, Washington.
Champs, C. ( 1 996): Enteroadherent Escherichia colt and
diarrhea in children: a prospective case-control shdy. ∫.
Clin. Microbio1., 34, 2897-2903.
3･ Comes, T･ A., Blake, P. A. and Trabulsi, L 良. (1989):
Prevalence of Escherichia coli strains with localized,
18. Gonzalez, 良., Diaz, C., Marino, M., Cloralt, 良., Pequeneze,
M･ and Perez-Schael, I. (1 997): Age-Specific prevalence
di凪ISe, and aggregative adherence to Hela cells in infants
with diarrhea and matched controls. J. Clin. Microbio1.,
of Escherichia colt with localized and aggregative
adherence in Venezuelan infants with acute diarrhea. J.
27, 266-269.
Clin. Microbio1., 35, 1103-1107.
19･ Comes, T･A･ T･, Vieira, M.A. M.,Abe, C. M., Rodrigus,
4･ Zen-Yozi, H., Sakai, S., Terayama, T., Kudoh, Y. and Ito,
T･ ( 1 985): Manual for Examination of Enteropathogenic
D･, Grifrln, P･ M･ and Ramos, S･ R･ T･ S･ (1998): Adheren?e
Bacteria･ 4th ed･ Igakushoin, Tokyo (in Japanese).
5. Nataro, J. P,, Kaper, J. B., Robins-Browne, R., Prado, V.,
patterns and adherence-related DNA sequences ln
Vial, P. and Levine, M. M. (1987): Pattems of adherence
Escherichia colt isolates from children with and without
of diarrheagenic Escherichia coli to HEp-2 cells･ Pediatr.
Infect. Dis., 6, 8291831.
diarrhea in S孟O Paulo clty, Brazil. J. Clin. Microbio1.,
36, 3609-3613.
6. Knutton, S., Lloyd, D. R. and McNeish,A. S. (1992):
20. Albert, M. ∫., Faruque, A. S. G., Sack, 良. B. and
Adhesion of enteropathogenic Escherichia coIL'to human
Mahalanabis, D. (1999): Case-Control study of
Lintestinal enterocytes and cultured human intestinal
enteropathogens associated with childhood diarrhea in
17
Tnfect. Agents Surveillance Rep., 16, 217'-218'･
26. Yamada, S., Matsushita, S., Dejsirilert, S. and Kudoh, Y.
Dhaka, Bangladesh. ∫. Clin. Microbio1., 37, 3458-3464･
21. Baqui,A. H., Sack, R. B., Black, R. E., Haider, K., Hossain,
A.,Alim,A. R. M. A., Yunus, M., Chowdhury, H. R. and
( I 997): Incidence and clinical symptoms ofAeromonas-
Siddique, A. K. (1 992): Enteropathogens associated with
associated travellers'diarrhea in Tokyo. Epidemiol.
acute and persistent diarrhea in Bangladish children <5
Tnfect., 119, 1211126.
27. Ratchtrachenchai, 0-A., Subpasu, S. and lto, K. (1997):
Tnvestlgation on enteroaggregative Escherichia colt
years of age. J. lnfec. Dis., 166, 792-796･
22. Fang, G. D., Lima,A.A. M., Martins, C. V., Nataro, J. P.
infection by multiplex PCR. Bull. Dept･ Med･ Sci･, 39,
and Guemnt, 良.し. (1995): Etiology and epidemiology of
211-220.
persistent dia血ea in northeastem Brazil: a hospital-based,
28. Yamazaki, M., Saito, M., 1nuzuka, K., Shima, S., Taniwaki,
prospective, case-control study. ∫. Pediatr. Gastroenterol.
Nutr., 21, 137-144.
H. and Ito, K. (1997): eaeA genes in Escherichia coli
23. Mathewson, J. J,, Jolmson, P. C., DuPont, H. L., Morgan,
D. R., Thomton, S. A., Wood, L V and Ericsson, C. D.
derived from Japanese patients with sporadic diarrhea.
J. Jpn. Assoc. Infect. Dis., 71, 105911065.
29. Cravioto, A., Tello, A., Navarro, A., Ruiz, J･, Villajan, H.,
Uribe, F. and Eslava, C. (1 979): An adhesive factor found
in strains of Escherichia coli belonglng tO the traditional
infantile enteropathogenic serotypes. Curr. Microbiol.,
(I 985): A new recognized cause of travelers'diarrhea:
enteroadherent Escherichia colt. J. Infec. Dis., 15 I, 471475.
241 Gascon, J･, Vargas, M･, Quinto, L･, Corachan, M･, JimeTez
3, 95-99.
de Anta, M. T. and Vila, ∫. (1998): EnteroaggregatlVe
Escherichia coli strains as a cause of traveler's diarrhea:
30. °han, K. N., Phillips,A. D., Knutton, S., Smith, H. 良. and
a case-control study. J. Infec. Dis., 177, 1409-1412.
25. National Institute of Health and Infectious Diseases
coli: another cause of acute and chronic diarrhoea in
Walker-Smith, J. A. ( I 994): Enteroaggregative Escherichia
ControI Division, Ministry of Health and Welfare (1995):
England? ∫. Pediatr. Gastroenterol. Nutr., 18, 87-91.
Traveler's diarrhea, Japan, January 1992-July 1995.
18