Cov_RLM-RACE.fm Page 1 Friday, August 20, 2010 10:17 AM
FirstChoice® RLM-RACE Kit
Part Number AM1700
FirstChoice® RLM-RACE Kit
(Part Number AM1700)
Protocol
I.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
A. Background
B. RLM-RACE Procedure Overview
C. Input RNA Requirements
D. Materials Provided with the Kit and Storage Conditions
E. Materials Not Provided with the Kit
F. Related Products Available from Ambion
II.
Input RNA and PCR Primer Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
A. RNA Quality
B. Critical Details in the Procedure
C. General PCR Primer Design Suggestions
D. Primer Design for 5' RLM-RACE
E. Primer Design for 3' RACE
F. Cloning RACE products
III.
5' RLM-RACE Protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
A. RNA Processing
B. Reverse Transcription
C. Nested PCR for 5' RLM-RACE
D. Gel Analysis of Products and Expected Results
IV.
3' RLM-RACE Protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
A. Reverse Transcription
B. PCR for 3' RLM-RACE
C. Gel Analysis of Products and Expected Results
V.
Cloning and Sequence Analysis of Products . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
A. Cloning
B. Sequence Analysis
VI.
Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
A. Using the Positive Controls
B. Optimization of RLM-RACE
VII.
Appendix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
A. References
B. Quality Control
C. Safety Information
P/N 1700M Revision D
For research use only. Not for use in diagnostic procedures.
Revision Date: August 20, 2010
Information in this document is subject to change without notice. Applied Biosystems assumes no responsibility for any errors that may appear in this document.
Applied Biosystems disclaims all warranties with respect to this document, expressed or implied, including but
not limited to those of merchantability or fitness for a particular purpose. In no event shall Applied Biosystems
be liable, whether in contract, tort, warranty, or under any statute or on any other basis for special, incidental,
indirect, punitive, multiple or consequential damages in connection with or arising from this document,
including but not limited to the use thereof.
When describing a procedure for publication using this product, please refer to it as the
FirstChoice® RLM-RACE Kit.
Literature Citation:
Applied Biosystems is committed to delivering superior product quality and performance, supported by industry-leading global service and technical support teams. Warranty information for
the accompanying consumable product is available at www.ambion.com/info/warranty in “Limited Warranty
for Consumables,” which is subject to the exclusions, conditions, exceptions, and limitations set forth under
the caption “EXCLUSIONS, CONDITIONS, EXCEPTIONS, AND LIMITATIONS” in the full warranty
statement. Please contact Applied Biosystems if you have any questions about our warranties or would like
information about post-warranty support.
Warranty and Liability:
Trademarks: Applied Biosystems, AB (Design), Ambion, FirstChoice and RNAqueous are registered trademarks, and ArrayScript, MagMAX and RiboPure are trademarks of Applera Corporation or its subsidiaries in
the US and/or certain other countries. SuperTaq is a trademark of Enzyme Technologies, Ltd. All other trademarks are the sole property of their respective owners.
© 2008, 2010 Ambion, Inc. All Rights Reserved.
Introduction
I.
A.
Introduction
Background
Rapid amplification of cDNA ends (RACE) is a polymerase chain reaction-based technique which facilitates the cloning of full-length cDNA
sequences when only a partial cDNA sequence is available. Traditionally, cDNA sequence is obtained from clones isolated from plasmid or
phage libraries. Frequently these clones lack sequences corresponding to
the 5' ends of the mRNA transcripts. The missing sequence information
is typically sought by repeatedly screening the cDNA library in an effort
to obtain clones that extended further towards the 5' end of the message. The nature of the enzymatic reactions employed to produce cDNA
libraries limits the probability of retrieving extreme 5' sequence even
from libraries that are very high quality.
Classic 5' RACE
Classic 5' RACE protocols vary slightly in design, but are essentially
equivalent. First strand cDNA is synthesized from either total or
poly(A) RNA in a reverse transcription reaction. A defined sequence is
then added to the 3' end of the first strand cDNA by tailing with terminal deoxytransferase (TdT), or by ligation of an oligonucleotide adapter.
Finally, a gene specific primer is used in conjunction with a primer for
the added 3' sequence to amplify the sequence between the adapter and
the gene specific primer at the 5' end of the cDNA. Traditional
5' RACE is sometimes successful, but the major limitation of the procedure is that there is no selection for amplification of fragments corresponding to the actual 5' ends of mRNA: all cDNAs are acceptable
templates in the reaction. Additionally, the PCR step selects the most
efficient amplicons (e.g., the smallest), favoring amplification of less
than full-length products. 5' RACE usually produces a heterogeneous
population of amplified products.
RLM-RACE
RNA Ligase Mediated Rapid Amplification of cDNA Ends
(RLM-RACE) represents a major improvement to the classic RACE
technique (Maruyama and Sugano, 1994, Shaefer, 1995). RLM-RACE
is designed to amplify cDNA only from full-length, capped mRNA,
usually producing a single band after PCR. The Ambion RLM-RACE
Kit is optimized for efficiency and reliability. The procedure is shown
schematically in Figure 1.
I.A. Background
1
FirstChoice® RLM-RACE Kit
Figure 1. Overview of the RLM-RACE Procedure
5' RLM-RACE
CIP treatment to remove 5' PO4 from
degraded mRNA, rRNA, tRNA and DNA
CIP
5' PO4–––
7mG–P–P–P–
AAAAA
TAP treatment to remove cap
from full-length mRNA
TAP
7mG–P–P—P–
AAAAA
5' RACE Adapter Ligation
to decapped mRNA
5' RACE adapter
AAAAA
reverse transcription
5' RACE adapter
AAAAA
PCR
5' RACE adapter
3' RACE
7mG–P–P–P–
AAAAA
reverse transcription
with 3' RACE Adapter
NVT T T T T-adapter
AAAAA
7mG–P–P–P–
PCR
7mG–P–P–P–
B.
RLM-RACE Procedure Overview
5' RACE using the
RLM-RACE Kit
2
NVT T T T T-adapter
I.B.
Total or poly(A) selected RNA is treated with Calf Intestine Alkaline
Phosphatase (CIP) to remove free 5'-phosphates from molecules such as
ribosomal RNA, fragmented mRNA, tRNA, and contaminating
genomic DNA. The cap structure found on intact 5' ends of mRNA is
not affected by CIP. The RNA is then treated with Tobacco Acid Pyrophosphatase (TAP) to remove the cap structure from full-length
RLM-RACE Procedure Overview
Introduction
mRNA, leaving a 5'-monophosphate. A 45 base RNA Adapter oligonucleotide is ligated to the RNA population using T4 RNA ligase. The
adapter cannot ligate to dephosphorylated RNA because these molecules lack the 5'-phosphate necessary for ligation. During the ligation
reaction, the majority of the full length, decapped mRNA acquires the
adapter sequence as its 5' end. A random-primed reverse transcription
reaction and nested PCR then amplifies the 5' end of a specific transcript. Ambion provides two nested primers corresponding to the
5' RACE Adapter sequence, and the user supplies two nested antisense
primers specific to the target gene. Guidelines for the design of
gene-specific primers can be found in section II.D on page 8. We also
provide RNA and PCR primers for mouse α-2-macroglobulin for use in
control reactions.
3' RACE using the
RLM-RACE Kit
The RLM-RACE Kit can also be used to amplify and clone sequence at
the 3' end of an mRNA using the 3' RACE technique. 3' RACE is generally a much easier procedure than 5' RACE. First strand cDNA is synthesized from either total RNA or poly(A)-selected RNA, using the
supplied 3' RACE Adapter (the sequence of which can be found in section I.D. on page 4). The cDNA is then subjected to PCR using one of
the 3' RACE Primers which are complimentary to the anchored
adapter, and a user-supplied primer for the gene-of-interest. 3' RACE
may not require a nested PCR, but a pair of nested primers for the
Adapter sequence are provided in case nested PCR is determined to be
necessary. We also provide a 3' RACE Control Primer for mouse
β-actin as a control. It is not recommended to use the 3' RACE Adapter
primer as first strand primer for 5' RACE as this would require the
reverse transcriptase to transcribe through the entire mRNA to reach the
5' Adapter sequence.
RLM-RACE permits ligation of the synthetic RNA adapter only to
decapped (full-length) RNA. Additionally, RLM-RACE selects for full
length, first strand cDNA synthesis: any first strand cDNA molecules
that do not extend all the way to the 5' end of the adapter will not yield
product in the PCR (since these targets would lack the adapter-specific
primer binding sites). Together, these features insure that only true
5' ends of transcripts are amplified.
C.
Input RNA Requirements
It is not necessary to use poly(A) selected RNA as template in the
RLM-RACE procedure. At Ambion, we have successfully amplified the
5' ends of rare targets starting with total cellular RNA. Using poly(A)
RNA in RLM-RACE, however, may increase the likelihood of success
for amplification of rare or difficult-to-amplify targets. It is essential that
the starting RNA be of the best possible quality. Only full-length,
capped message will be amplifiable in the RLM-RACE procedure.
I.C. Input RNA Requirements
3
FirstChoice® RLM-RACE Kit
D.
Materials Provided with the Kit and Storage Conditions
Store the RLM-RACE Kit in a non frost-free freezer. Avoid contaminating any reagent with nuclease. Reagents for 6 CIP, TAP, ligation, and
reverse transcription reactions – and primers for 100 nested PCR reactions are included.
Amount
Component
–20°C
50 μL 10X CIP Buffer
–20°C
12 μL Tobacco Acid Pyrophosphatase
–20°C
50 μL 10X TAP Buffer
–20°C
12 μL T4 RNA Ligase
–20°C
50 μL 10X T4 RNA Ligase Buffer
–20°C
10 μL 5' RACE Adapter (0.3 μg/μL)
5'-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA-3'
–20°C
10 μL 3' RACE Adapter
5'-GCGAGCACAGAATTAATACGACTCACTATAGGT12VN-3'
–20°C
200 μL 5' RACE Outer Primer 10 μM
5'-GCTGATGGCGATGAATGAACACTG-3'
–20°C
200 μL 5' RACE Inner Primer 10 μM
5'-CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG-3'
–20°C
200 μL 3' RACE Outer Primer 10 μM
5'-GCGAGCACAGAATTAATACGACT-3'
–20°C
200 μL 3' RACE Inner Primer 10 μM
5'-CGCGGATCCGAATTAATACGACTCACTATAGG-3'
–20°C
1 mL Ammonium Acetate Stop Solution
10 μL M-MLV Reverse Transcriptase
–20°C
–20°C
50 μL 10X RT Buffer
–20°C
1.25 mL 10X PCR Buffer
–20°C
12 μL Random Decamers (50 μM)
–20°C
10 μL RNase Inhibitor (10 U/μL)
–20°C
10 μL Mouse Thymus RNA (1 mg/mL)
–20°C
25 μL 5' RACE Outer Control Primer 10 μM
5'-GATCACCAATCCATTGCCGACTAT-3'
–20°C
25 μL 5' RACE Inner Control Primer 10 μM
5'-GAAGTAGATGGTGGGCAGGAAGAT-3'
–20°C
25 μL 5' PCR Control Primer 10 μM
5'-GCAGCAGGTAGCAGTGAC-3'
–20°C
25 μL 3' RACE Control Primer
5'-AGCAGTTGGTTGGAGCAAACATC-3'
–20°C
* Store Nuclease-free Water at –20°C, 4°C or room temp.
I.D.
–20°C
500 μL dNTP Mix (2.5 mM each dNTP)
1.75 mL Nuclease-free Water
4
Storage
12 μL Calf Intestine Alkaline Phosphatase
Materials Provided with the Kit and Storage Conditions
any temp*
Introduction
E.
Materials Not Provided with the Kit
RLM-RACE specific reagents:
• Gene-specific PCR primer(s). See section II.C starting on page 8 for
details
• Acid phenol:chloroform – molecular biology grade
• Chloroform – molecular biology grade
• Thermostable DNA polymerase—recommended: Ambion SuperTaq™, recombinant thermostable DNA polymerase or SuperTaq™
Plus Extended Range Taq polymerase.
• Thermal cycler (e.g., Applied Biosystems GeneAmp® PCR System
9700 and the Veriti™ 96-Well Thermal Cycler)
• A method to clone PCR products: either a linearized cloning vector
(see sections II.F on page 9 and V.A on page 18) or a ‘quick cloning
system’ like the TA cloning kit from Invitrogen
General reagents:
• Disposable, RNase-free, pipette tips, polypropylene 1.5 mL microcentrifuge tubes and thin wall microfuge tubes for PCR
• Materials and equipment for gel electrophoresis
• Reagent grade isopropanol
• Reagent grade ethanol
• Cold 70% ethanol made with reagent grade ethanol
I.E. Materials Not Provided with the Kit
5
RLM-RACE.fm Page 6 Friday, August 20, 2010 4:28 PM
FirstChoice® RLM-RACE Kit
F.
Related Products Available from Ambion
*SuperTaq™
Thermostable DNA Polymerase (includes 10X buffers and dNTPs)
P/N AM2050, AM2052
†SuperTaq™ Plus
P/N AM2054, (50U)
P/N AM2056, (250U)
Phenols
See web or print catalog for
P/Ns
Electrophoresis
Reagents
See web or print catalog for
P/Ns
Extended Range Thermostable DNA Polymerase
Super Taq Plus has a proof reading activity, and produces significantly higher yields
of PCR products than ordinary Taq polymerase (includes 10X buffers and dNTPs)
Ambion offers a full line of prepared phenol solutions for most molecular biology
needs. These premixed, quality-tested, saturated phenols are ready-to-use and eliminate the handling concerns associated with preparing phenol for use from solid phenol.
Ambion offers gel loading solutions, agaroses, acrylamide solutions, powdered gel
buffer mixes, nuclease-free water, and RNA and DNA molecular weight markers for
electrophoresis. Please see our catalog or our website (www.ambion.com) for a complete listing as this product line is always growing.
* Use of this product is covered by US patent claims and patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser’s own internal research. No right under any other patent claim (such as the patented 5' Nuclease Process claims), no right
to perform any patented method, and no right to perform commercial services of any kind, including without limitation reporting
the results of purchaser's activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further
information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln
Centre Drive, Foster City, California 94404, USA.
† Use of this product is covered by US patent claims and patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser’s own internal research. No right under any other patent claim (such as the patented 5' Nuclease Process claims) and no
right to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a
fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only.
Diagnostic uses require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting
the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.
6
I.F.
Related Products Available from Ambion
Input RNA and PCR Primer Design
II.
A.
Input RNA and PCR Primer Design
RNA Quality
It is important to determine that the mRNA target is expressed in the
RNA that is being considered for use in RLM-RACE. If there is any
doubt, consider testing RNA samples from several tissue sources by Northern hybridization, ribonuclease protection assay, or RT-PCR to identify an
RNA source that contains the highest proportion of the target RNA.
High quality total or poly(A) selected RNA should be used for
RLM-RACE. Starting with poly(A) RNA will afford a 20–50 fold
enrichment of the target, but it is usually not necessary for successful
RLM-RACE. Ambion RiboPure™, MagMAX™, and RNAqueous® Kits
all yield extremely clean RNA, suitable for RLM-RACE. RNA prepared
with single step RNA isolation procedures, e.g., TRI Reagent® (Ambion
P/N AM9738) can also be used. Regardless of the method used to purify
the RNA, if there is any question about the cleanliness of the prep
(e.g. low A260:A280 ratio), the RNA should be further purified with an
organic extraction and alcohol precipitation. RNA can be assessed for
integrity by running an aliquot on a bioanalyzer or on a denaturing agarose gel. Look for a 28S ribosomal RNA band that is twice the intensity
of the 18S band. Also, both bands should be tight, with no smearing;
these features are good indicators of very high quality RNA.
B.
Critical Details in the Procedure
The CIP, TAP, and ligase reactions are robust and typically do not
require user optimization. Exceeding the recommended RNA concentration in the CIP, TAP, or ligation reactions, however, may compromise the reaction(s). In particular, if poly(A) RNA is used as template,
limit the amount of RNA in the TAP reaction to 250 ng as specified in
the protocol.
A phenol/chloroform extraction and ethanol precipitation following the
CIP treatment is included in the protocol because it is critical to remove
all traces of CIP enzyme. Be certain to thoroughly homogenize the phenol:chloroform with the sample by vigorous vortexing at this step.
It is recommended that the minus-TAP control reaction be run, and
that PCR annealing temperatures be optimized. The minus-TAP reaction can be used to assess whether the products produced by the procedure are true 5' RACE products. Although we have seen successful
RACE for some targets with no optimization of cycling parameters,
most targets require some tinkering with the PCR annealing
temperature to generate discrete RACE products with minimal background. The RLM-RACE kit contains primers for 100 PCRs; this is
more than enough to optimize most PCR protocols.
II.A. RNA Quality
7
FirstChoice® RLM-RACE Kit
C.
General PCR Primer Design Suggestions
Use the following PCR primer design recommendations:
• 20–24 bases in length
• 50% G:C content, with no secondary structure
• Avoid placing more than 3 G or C residues in the 3'-most 5 bases
• Avoid primers with a G as the 3'-terminal base
• Avoid sequences with 3' ends that can self-hybridize or hybridize to
the 3' ends of the other primer in the PCR (forming primer dimers)
• Finally, using primer design software, evaluate your gene-specific
primers in combination with the corresponding RACE Primer.
Figure 2 shows where the gene-specific primers should lie, and where
the primers supplied with the kit are positioned.
Figure 2. Primer positions for 5' and 3' RACE
Primers represented with dark arrows
are supplied by the user
5' RACE
5' RACE Outer Primer
5' RACE Inner Primer
gene specific 5' primer
150 bp
5' RACE Adapter
~
5' RACE g.s. inner primer
5' RACE g.s. outer primer
3' RACE
3' RACE g.s. outer primer
3' RACE g.s. inner primer
3' RACE Adapter
3' RACE Inner Primer
D.
Primer Design for 5' RLM-RACE
1. Nested gene-specific
downstream (3' or
antisense) primers
8
3' RACE Outer Primer
II.C.
The sequences of the 5' RACE Outer and Inner Primers are shown in
the list of materials provided with the kit on page 4. The inner primers
include a BamH1 site at the 5' end. The 5' RACE Primers work well in
PCR using an annealing temperature of 55–65°C (they are typically
used at ~60°C). Use primer design software to choose two nested
sequences of similar length and melting temperature as PCR primers for
your gene. If the distance to the 5' end of the RNA is known, your
primers should be designed to anneal no closer than 150–200 bases
downstream of the beginning of the RNA transcript to produce a large
enough PCR product to evaluate by gel electrophoresis. If the distance
to the 5' end of the RNA is unknown, position the gene-specific primers
as far 5' as possible, leaving room to design an upstream primer as a positive control (i.e., ~150 bp downstream of the 5' end of the known
sequence). 5' RACE gene-specific primers must be in the reverse com-
General PCR Primer Design Suggestions
Input RNA and PCR Primer Design
plement orientation to the coding sequence of the mRNA so that they
prime the antisense strand in PCR. The spacing between the inner and
outer nested primers is not critical, although placing them 50–100 base
pairs apart will produce PCR fragments that can be easily distinguished
by size. If the RACE products will be cloned using restriction sites,
design the inner gene-specific primer with a restriction enzyme site at its
5' end (see section II.F on page 9).
2. Gene-specific 5'
(upstream or sense)
primer
E.
To assist in the analysis and optimization of your reactions, we recommend synthesizing an upstream (sense-strand) gene specific primer positioned so that it produces a resolvable (≥150 bp) product in PCR when
used with the 5' RACE gene-specific outer primer. Choose a sequence
that is compatible in standard PCR with the corresponding gene-specific primers. This upstream primer can be used in conjunction with
your gene specific 5' RACE primers to verify the presence of the target
in an RNA preparation, and to evaluate RLM-RACE products (as
described in section VI.A.3 on page 22).
Primer Design for 3' RACE
The sequences of the 3' RACE Inner and Outer Primers are shown in
the list of materials provided with the kit on page 4. Basic PCR primer
design considerations as discussed above should be followed. If the distance from your primers to the 3' end of the target is larger than 1 kb or
is unknown, Ambion recommends using an extended-range Taq polymerase to have the best chance of success. The 3' RACE protocol
describes nested PCR, however 3' RACE reactions may produce significant product after a single round of PCR. You can try a PCR with a
gene specific primer and the 3' RACE Outer Primer, if enough product
is amplified, the inner nested reaction may be omitted.
F.
Cloning RACE products
The 5' RACE Inner Primer and the 3' RACE Inner Primer have
BamH1 sites at their 5' end (CGCGGATCC). If the inner gene specific
primers also have restriction sites at their 5' end, PCR fragments generated in the “inner” PCR reactions can be ligated into a digested plasmid
vector using standard cloning techniques. We recommend using a
restriction site other than BamH1 on inner gene specific primers, so that
fragments can be directionally cloned into a double-digested vector.
Alternatively, one of the ‘quick PCR cloning’ kits which use Topoisomerase or T/A overhangs to facilitate cloning can be used to clone
reaction products without restriction enzyme sites.
II.E. Primer Design for 3' RACE
9
FirstChoice® RLM-RACE Kit
III.
A.
5' RLM-RACE Protocol
RNA Processing
Standard reaction
This protocol is optimized for starting with 10 μg of total RNA, or
250 ng of poly(A)-selected RNA. Using these amounts of RNA will be
referred to as the “standard” reaction. This provides extra material in
case of partial sample loss or if a downstream reaction must be repeated.
Small-scale reaction
If only an extremely limited amount of RNA is available, the reaction
can be scaled down to start with 1 μg or less total RNA. Modifications
to the protocol for the use of only 1 μg of total RNA as template are
referred to as “small” reactions.
1. Treat with CIP at 37°C for
1 hr
a. Assemble the following
microcentrifuge tube:
Amount
components
in
an
RNase-free
Component
X μL standard rxn:10 μg total or 250 ng poly(A) RNA
small rxn: 1 μg total RNA
2 μL 10X CIP buffer
2 μL Calf Intestine Alkaline Phosphatase (CIP)
to 20 μL Nuclease-free Water
b. Mix gently, spin briefly. Incubate at 37°C for one hour.
2. Terminate CIP reaction
and extract with
phenol:chloroform, then
with chloroform
a. Add:
Amount
Component
15 μL Ammonium Acetate Solution
115 μL Nuclease-free Water
150 μL acid phenol:chloroform*
* Empirically, we have seen slightly better results with acid phenol:chloroform
than with ordinary phenol:chloroform.
b. Vortex thoroughly. Centrifuge 5 mins., room temperature at top
speed in a microfuge (≥10,000 x g). Transfer aqueous phase (top
layer) to a new tube.
c. Add 150 μL chloroform, vortex thoroughly, centrifuge 5 mins., room
temperature at top speed in a microfuge (≥10,000 x g). Transfer
aqueous phase (top layer) to a new tube.
10
III.A.
RNA Processing
5' RLM-RACE Protocol
3. Precipitate with 150 μL
isopropanol on ice for
10 min, then pellet RNA
and rinse with cold
70% ethanol
a. Add 150 μL isopropanol, vortex thoroughly. Chill on ice for
10 minutes.
4. Resuspend RNA in
Nuclease-free Water
Standard reaction: Resuspend pellet in 11 μL Nuclease-free Water.
(Optional: reserve 1 μL of CIP-treated RNA at –20°C for a
‘minus-TAP’ control reaction – see section VI.B.2 on page 24.)
b. Centrifuge at maximum speed for 20 minutes. Rinse pellet with
0.5 mL cold 70% ethanol, centrifuge 5 minutes at maximum speed,
remove ethanol carefully and discard it. Allow pellet to air dry.
Small reaction: Prepare 10 μL of 1X TAP Buffer, and resuspend sample in 4 μL of it.
Place the majority of the sample on ice and proceed to TAP reaction, or
store the sample at –20°C.
5. Treat with TAP at 37°C for
1 hr
a. Assemble the components in an RNase-free microcentrifuge tube:
standard rxn
small rxn Component
5 μL
4 μL
CIP’d RNA (from above)
1 μL
––
10X TAP buffer
2 μL
1 μL
Tobacco Acid Pyrophosphatase
2 μL
––
Nuclease-free Water
b. Mix gently, spin briefly. Incubate at 37°C for one hour.
c. Store reaction at –20°C or proceed to ligation step.
6. 5' RACE Adapter Ligation
a. Assemble the components in an RNase-free microfuge tube:
standard rxn small rxn Component
2 μL
5 μL
CIP/TAP-treated RNA
1 μL
1 μL
5' RACE Adapter
1 μL
1 μL
10X RNA Ligase Buffer*
2 μL
2 μL
T4 RNA Ligase (2.5 U/μL)
4 μL
1 μL
Nuclease-free Water
* Before use, warm the 10X RNA Ligase Buffer quickly by rolling it between gloved
hands to resuspend any precipitate. Since this buffer contains ATP, it is not recommended to heat it over 37°C, as this would compromise the ATP.
b. Mix gently, spin briefly.
c. Incubate at 37°C for one hour.
d. Store reaction at –20°C or proceed to the reverse transcription.
III.A. RNA Processing
11
FirstChoice® RLM-RACE Kit
B.
Reverse Transcription
1. Assemble reverse
transcription reaction
a. Assemble the following in an RNase-free microfuge tube on ice:
Amount
Component
2 μL
Ligated RNA (or minus-TAP control)
4 μL
dNTP Mix
2 μL
Random Decamers
2 μL
10X RT Buffer
1 μL
RNase Inhibitor
1 μL
M-MLV Reverse Transcriptase
to 20 μL
Nuclease-free Water
b. Mix gently, spin briefly.
2. Incubate at 42°C for 1 hr
a. Incubate at 42°C for one hour.
b. Store reaction at –20°C or proceed to the PCR step.
C.
Nested PCR for 5' RLM-RACE
Minus-template control
It is always a good idea to include a minus-template control in any PCR.
This control should include all of the PCR components used in the
experimental samples except template. If anything amplifies in this reaction, it indicates that one or more of the PCR reagents is contaminated
with DNA.
1. Outer 5' RLM-RACE PCR
a. Assemble the components in PCR tubes on ice:
IMPORTANT
Ambion recommends a hot start for PCRs. At a minimum, assemble reactions on ice, preheat thermal cycler to 94°C, and then place the tubes in
the thermal cycler.
Amount
Component
1 μL
RT reaction (from the previous step)
5 μL
10X PCR Buffer*
4 μL
dNTP Mix
2 μL
5' RACE gene-specific outer primer (10 μM)
2 μL
5' RACE Outer Primer
to 50 μL
1.25 U
Nuclease-free Water
thermostable DNA polymerase† (0.25 μL of 5U/μL)
* Use the 10X PCR Buffer supplied with your thermostable DNA polymerase, or
use the one supplied with the RLM-RACE Kit.
† We strongly recommend using an extended range thermostable DNA polymerase, such as SuperTaq-Plus, for targets over 1 kb.
12
III.B.
Reverse Transcription
5' RLM-RACE Protocol
NOTE
Thermal cyclers with very short
ramp times, may require slightly
longer incubation times, whereas
machines with virtually no ramp
time,
such
as
Stratagene’s
RoboCycler®, will probably require
1 minute at each temperature in the
cycle.
b. Mix gently, flick tube or spin briefly to return the contents to the
bottom of the tube.
c. Cycle as follows:
Stage
Reps
Temp
Initial denaturation
1
1
94°C
3 min
Amplification
2
35
94°C
30 sec
60°C*
30 sec
72°C
30 sec
72°C
7 min
Final extension
3
1
Time
* The 5' RACE Outer Primer works well in PCR using a annealing temperature
from 55 to 65°C. Therefore, an annealing temperature of 60°C is probably a
reasonable starting point. The optimal temperature for your primer and template combination may have to be determined empirically.
For targets longer than 1 kb, add 1 minute to the 72°C extension
time for each kilobase. For example, the 35 cycles for a 3 kb target
would be: 94°C – 30 sec, 60°C – 30 sec, 72°C – 3 minutes
2. Inner 5' RLM-RACE PCR
a. Assemble the components in PCR tubes on ice:
Amount
1–2 μL
Component
Outer PCR (from the previous step – III.C.1)
5 μL
10X PCR Buffer
4 μL
dNTP Mix
2 μL
5' RACE gene specific inner primer (10 μM)
2 μL
5' RACE Inner Primer
to 50 μL
1.25 U
Nuclease-free Water
thermostable DNA polymerase (0.25 μL of 5U/μL)
b. Mix gently, flick tube or spin briefly to return the contents to the
bottom of the tube.
c. Use the same PCR cycling profile as in the outer 5' RLM-RACE
PCR.
D.
Gel Analysis of Products and Expected Results
After the PCR is complete, run 5–10 μL of each sample in a 2% high
resolution agarose gel containing 1 μg/mL ethidium bromide and visualize on a UV transilluminator. A sample of the outer PCR can also be
run for evaluation since a product is sometimes visible after the primary
PCR. There should be one to a few bands from the nested PCR from
the experimental samples, and the minus-template control sample
III.D. Gel Analysis of Products and Expected Results
13
FirstChoice® RLM-RACE Kit
should have no visible PCR product. In the event no bands are present
in the experimental samples, or if there is an unexpectedly complicated
pattern (e.g. a smear), optimization of the procedure, as described in
section VI.B on page 23 may be beneficial.
Figure 3. RLM-RACE for Mouse CXCR-4 Gene and Xenopus
TGF-ß Related Gene
Mouse liver RNA and Xenopus stage 41 embryo RNA were used in the
RLM-RACE kit. A: Outer 5' RACE PCR. B: Inner 5' RACE PCR. CXCR-4 is
a moderately-expressed message, and the TGF-ß related gene encodes a very
rare message.
14
III.D.
Gel Analysis of Products and Expected Results
3' RLM-RACE Protocol
IV.
A.
3' RLM-RACE Protocol
Reverse Transcription
a. Assemble the following in an RNase-free microfuge tube on ice:
Amount
Component
2 μL
RNA – use 1 μg total RNA or 50 ng poly(A) RNA
4 μL
dNTP Mix
2 μL
3' RACE Adapter
2 μL
10X RT Buffer
1 μL
RNase Inhibitor
1 μL
M-MLV Reverse Transcriptase
8 μL
Nuclease-free Water
b. Mix gently, spin briefly.
c. Incubate at 42°C for one hour.
d. Store reaction at –20°C or proceed to the PCR step.
B.
PCR for 3' RLM-RACE
Often, a single PCR will amplify enough product from 3' RACE. In
case a second PCR is necessary to provide more material or greater specificity, two nested primers for the 3' RACE Adapter sequence are provided with this kit. Do an outer PCR first, and then do the inner PCR
only if necessary.
Minus-template control
It is always a good idea to include a minus-template control in any PCR.
This control should include all of the PCR components used in the
experimental samples except template. If anything amplifies in this reaction, it indicates that one or more of the PCR reagents is contaminated
with DNA.
IV.A. Reverse Transcription
15
FirstChoice® RLM-RACE Kit
1. Outer 3' RLM-RACE PCR
a. Assemble the components in PCR tubes on ice:
IMPORTANT
Ambion recommends a hot start for PCR reactions. At a minimum,
assemble reactions on ice, preheat thermal cycler to 94°C, and then place
the tubes in the thermal cycler.
Amount
Component
1 μL
RT reaction (from the previous step)
5 μL
10X PCR Buffer*
4 μL
dNTP Mix
2 μL
3' RACE gene-specific outer primer (10 μM)
2 μL
3' RACE Outer Primer
to 50 μL
1.25 U
Nuclease-free Water
thermostable DNA polymerase† (0.25 μL of 5U/μL)
* Use the 10X PCR Buffer supplied with your thermostable DNA polymerase, or
use the one supplied with the RLM-RACE Kit.
† We strongly recommend using an extended range thermostable DNA polymerase, such as SuperTaq-Plus, for targets over 1 kb.
b. Mix gently, flick tube or spin briefly to return the contents to the
bottom of the tube.
NOTE
Thermal cyclers with very short
ramp times, may require slightly
longer incubation times, whereas
machines with virtually no ramp
time,
such
as
Stratagene’s
RoboCycler®, will probably require
1 minute at each temperature in the
cycle.
c. Cycle as follows:
Stage
Reps
Temp
Time
Initial denaturation
1
1
94°C
3 min
Amplification
2
35
94°C
30 sec
60°C*
30 sec
72°C
30 sec
72°C
7 min
Final extension
3
1
* The 3' RACE Outer Primer works well in PCR using a annealing temperature
from 55 to 65°C. Therefore, an annealing temperature of 60°C is probably a
reasonable starting point. The optimal temperature for your primer and template combination may have to be determined empirically.
For targets longer than 1 kb, add 1 min to the 72°C extension time
for each kilobase. For example, the 35 cycles for a 3 kb target would
be: 94°C – 30 sec, 60°C – 30 sec, 72°C – 3 minutes
16
IV.B.
PCR for 3' RLM-RACE
3' RLM-RACE Protocol
2. Inner 3' RLM-RACE PCR
(optional)
Do this PCR if the outer PCR yield is low, or if the outer PCR yields a
smear of products instead of a discrete band(s).
a. Assemble the components in PCR tubes on ice:
Amount
Component
1 μL
Outer 3' RACE PCR (from previous step – IV.B.1)
5 μL
10X PCR Buffer
4 μL
dNTP Mix
2 μL
3' RACE gene-specific inner primer (10 μM)
2 μL
3' RACE Inner Primer
to 50 μL
1.25 U
Nuclease-free Water
thermostable DNA polymerase (0.25 μL of 5U/μL)
b. Mix gently, flick tube or spin briefly to return the contents to the
bottom of the tube.
c. Use the same PCR cycling profile as in the outer 3' RLM-RACE
PCR.
C.
Gel Analysis of Products and Expected Results
Run 5–10 μL of each PCR in a 2% agarose gel containing 1 μg/mL
EtBr and visualize on a UV transilluminator. If you have done both the
inner and outer PCRs, run samples from both reactions to compare the
products. There should be one to a few bands from the PCR. If no
bands are present, or if there is an unexpectedly complicated pattern
(e.g. a smear), optimization of the procedure, as described in section
VI.B on page 23 may help.
IV.C. Gel Analysis of Products and Expected Results
17
FirstChoice® RLM-RACE Kit
V.
A.
Cloning and Sequence Analysis of Products
Cloning
RACE products can be cloned into suitable plasmid vectors using standard techniques. Both the 5' RACE Inner Primers and 3' RACE Inner
Primers have BamH1 sites at their 5' ends. So, RACE products amplified with a gene-specific primer that also has a restriction site can be
cloned into an appropriately digested plasmid vector using standard
cloning techniques (see Current Protocols in Molecular Biology). Alternatively, one of the ‘quick PCR cloning’ kits can be used to clone RACE
products without using restriction enzymes. Before sequencing a clone,
do a diagnostic restriction digest to confirm the presence of the expected
size insert.
If the nested PCR produced several bands, this may indicate alternative
transcriptional start sites, polyadenylation sites, or splicing products.
Alternatively, it may be an indication that the PCRs should be thermal
cycled at higher stringency. The pattern of bands may be greatly simplified by raising the annealing temperature to 60°C or higher. If you want
to analyze all the products, they can be cloned en masse and sorted out
by restriction digest of individual bacterial colonies, or each band can be
gel-purified, and cloned individually.
B.
Sequence Analysis
As with any cloning experiment, it is a good idea to check insert size by
restriction digest before going to the expense and trouble of sequencing.
5' RLM-RACE
5' RLM-RACE products should contain a clean splice at the junction of
the 5' RACE Adapter and the mRNA. When analyzing the sequence of
5' RLM-RACE products, it is advisable to sequence more than one
clone.
The 5' RACE Adapter will add 45 bp to your experimental outer PCR
product, and 36 bp to your experimental inner PCR product. The
sequence that will be added to your product after the inner PCR (using
the 5' RACE Inner Primer and your gene-specific primer) is the following (assuming that no spurious rearrangement or cloning artifact has
occurred):
CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATGAAA–your sequence
(bold sequence is the BamH1 site)
18
V.A.
Cloning
Cloning and Sequence Analysis of Products
3' RLM-RACE
3' RACE products should contain either the 3' RACE Outer Primer or
the 3' RACE Inner Primer sequence at the junction of the 3' RACE
Adapter and the mRNA, depending on which was used in the final PCR
(assuming that no spurious rearrangement or cloning artifact has
occurred).
• 3' RACE Outer Primer used in final PCR:
5'-GCGAGCACAGAATTAATACGACTCACTATAGGT12VN–your sequence
(bold sequence represents the 3' RACE Outer Primer sequence.)
• 3' RACE Inner Primer used in final PCR:
5'-CGCGGATCCGAATTAATACGACTCACTATAGGT12VN–your sequence
(bold sequence is the BamH1 site)
When analyzing the sequence of RACE products, it is advisable to
sequence more than one clone.
V.B. Sequence Analysis
19
FirstChoice® RLM-RACE Kit
VI.
A.
Troubleshooting
Using the Positive Controls
An aliquot of Mouse Thymus RNA and a set of control primers is included
with the RLM-RACE kit to test both 5' and 3' RACE, and PCR.
1. 5' RACE control
a. Purpose of the control
Nested primers for CXCR-4 are provided to verify that the
RLM-RACE components are functioning properly. CXCR-4 is a
g-protein–coupled chemokine receptor (Ganju, et al. 1998). It is
over-expressed in glioblastoma and other brain tumors (Sehgal et al
1998). CXCR-4 is also a co-receptor for T-tropic human immunodeficiency virus type 1 (HIV-1) (Parolin, et al. 1998).
Figure 4. 5' RACE Control
5' RACE Outer Primer
CXCR-4 cDNA
5' RACE Adapter
5' RACE Outer Control Primer
Outer
PCR
5' RACE Inner Primer
5' RACE Adapter
CXCR-4 Outer PCR product (350 bp)
Inner
PCR
5' RACE Inner Control Primer
301 bp product
b. RNA processing and reverse transcription
Use 10 μg of the Mouse Thymus RNA in RLM-RACE following the
instructions in section III.A on page 10 through III.B on page 12.
c. Nested PCR for 5' RACE
For the PCRs, amplify 1 μL of the RT reaction from the previous
step using the 5' RACE Outer Primer with the 5' RACE Outer Control Primer in PCR using an annealing temperature of 60°C (instructions in section III.C.1 on page 12). This produces a 350 bp product
that is typically too faint to see when run on an ethidium bromide-stained agarose gel.
Use 1 μL of the outer PCR as template in the nested PCR with the
5' RACE Inner Primer with the 5' RACE Inner Control Primer.
The annealing temperature should be 60°C (instructions in
section III.C.2 on page 13).
20
VI.A.
Using the Positive Controls
Troubleshooting
d. Analysis and expected result
Analyze the results by running 5–10 μL of each sample in a 2% high
resolution agarose gel containing 1 μg/mL EtBr and visualizing on a
UV transilluminator. The inner 5' RACE control PCR should generate a 301 bp PCR product. The Control primers are positioned at
position 305 (Outer Primer) and 263 (Inner Primer) in Genbank
accession #D87747 (CXCR-4).
If the 301 bp product is not generated in this reaction, identify
whether there is a problem with the RT-PCR or with the RNA processing steps by doing the RT-PCR control described in
section VI.A.3 on page 22. Note that a second band is sometimes
seen if the PCR has a very high yield. The extra band can usually be
eliminated by either reducing the PCR template amount to only
10–50% the amount used initially, or by increasing the annealing
temperature in the PCR by 2–3°C.
2. 3' RACE control
a. Purpose of the control
An upstream 3' RACE Control Primer for mouse ß-actin is included
in with the RLM RACE kit to perform 3' RACE on the Mouse Thymus RNA (or other mouse RNA if desired) to confirm functioning
of the kit. This primer will be used in conjunction with the 3' RACE
Outer Primer to amplify the 3' end of the ß-actin gene. The
3' RACE Control Primer is at position 1424 in Genbank accession
#MMACTBR.
Figure 5. 3' RACE Control
3' RACE Control Primer
3' RACE Adapter
ß-actin cDNA
3' RACE Outer Primer
PCR
513 bp product
b. Reverse transcription
Use 1 μg of the Mouse Thymus RNA; follow the instructions in
section IV.A on page 15.
c. 3' RACE PCR
Use 1 μL of the RT from the previous step in PCR with the 3' RACE
Control Primer and the 3' RACE Outer Primer. Follow the setup
and cycling instructions in section IV.B on page 15; the annealing
temperature should be 60°C.
d. Analysis and expected result
Analyze the results by running 10 μL of each sample in a 2% high
resolution agarose gel containing 1 μg/mL EtBr and visualizing on a
UV transilluminator. There should be a predominant 513 bp product from the PCR. We observe additional bands if the PCR yielded
VI.A. Using the Positive Controls
21
FirstChoice® RLM-RACE Kit
a large amount of product; this can usually be eliminated by using
only 10–50% as much starting cDNA, or by raising the annealing
temperature by a few degrees. If no bands are present, this indicates
a problem with the kit or with your PCR protocol.
3. RT-PCR control
a. Purpose of the control
An upstream ‘sense strand’ primer for CXCR-4 is provided so that
the RT and PCR reactions can be evaluated independently of the
CIP, TAP, and ligation reactions. (The tube label reads: 5' PCR
Control Primer.) Do the control reactions described below if the
5' RACE control reaction gave unexpected results, or to check that
the RT-PCR end of RLM-RACE is working properly.
Figure 6. RT-PCR Control
5' PCR Control Primer
CXCR-4 cDNA from RT (1) or RLM-RT (2)
5' RACE Adapter
PCR
5' RACE Inner Control Primer
217 bp product
or
5' RACE Outer Control Primer
or
259 bp product
b. Set-up and cycling
The most complete control experiment would include two sets of
RT-PCRs, with different input cDNA as described below:
• Template #1: An RT reaction should be performed on a 1 μg
(2 μL) aliquot of the Mouse Thymus RNA provided in the kit.
Follow the instructions in section III.B on page 12. The resulting
cDNA (1 μL) should be used as template in control PCRs.
• Template #2: A 1 μL aliquot of the cDNA made from the
5' RACE control (in step VI.A.1.b. above) can be used directly in
PCR.
Do two PCRs on each PCR template, (for a total of 4 reactions).
• One reaction should use the 5' PCR Control Primer with the
5' RACE Outer Control Primer,
• The other reaction should use the 5' PCR Control Primer with
the 5' RACE Inner Control Primer.
Use an annealing temperature of 60°C and the cycling conditions
described in section III.C on page 12.
c. Analysis and expected result
Analyze the results by running 10 μL of each sample in a 2% high
resolution agarose gel containing 1 μg/mL EtBr and visualizing on a
UV transilluminator. The expected fragment from the outer PCR is
259 bp, from the inner PCR, it is 217 bp. There should be a single
22
VI.A.
Using the Positive Controls
Troubleshooting
band from the PCR (sometimes we observe a second band if the
amplification yielded a large amount of product or the annealing
temperature was a little low).
Each of the reactions using template #1 should produce the expected
size fragment. If the predicted fragment is not seen, there is a problem with the template, the PCR components, the experimental technique, or the thermal cycler. It is unlikely that RLM-RACE will be
successful if these PCRs do not work.
If you see specific products using template #1, but not with template
#2, your RLM-RACE RNA may be degraded. Repeat the PCR,
doing more cycles. If the reactions still fail to produce the expected
products, call Ambion’s Technical Service Department for more
help.
B.
Optimization of RLM-RACE
As part of the development of this kit, the importance of each variable in
every step of the RLM-RACE protocol were evaluated. The variable that
had the most significant impact on the outcome of our experiments was
optimization of PCR annealing temperatures. Using SuperTaq-Plus or
another extended range Taq polymerase (in lieu of SuperTaq) for the
PCRs, and raising the temperature of the reverse transcription reaction
by using a thermal-tolerant reverse transcriptase sometimes greatly
improved yield and specificity.
1. Possible causes of
ambiguous results
Without optimization, nested PCR may produce no band, a single
band, several bands, or a complicated pattern of bands (a smear). Smearing or failure to amplify could alternatively be caused by poor quality
RNA, or absence of the target in the RNA used for RLM-RACE. The
following discussion assumes that only very pure, high quality RNA
known to contain the highest amount of target was used as starting
material.
A complicated pattern of discrete bands may be due to multiple initiation sites for transcription of the target gene, or primer homology to several members of a multi-gene family. In some cases, primers can be
designed to hybridize only with specific targets, but this is not possible
without extensive sequence information.
Since it may not be possible to rule out all of the possible causes of confusing results such as no bands, several bands, or a smear of bands, we
recommend trying to optimize the experiment using the suggestions in
the following sections.
VI.B. Optimization of RLM-RACE
23
FirstChoice® RLM-RACE Kit
2. Minus-TAP control
An optional control consists of carrying a ‘minus-TAP’–treated sample
(1 μL aliquot removed at step III.A.4.) through adapter ligation, reverse
transcription and PCR. This will demonstrate that the products generated by RLM-RACE are specific to the 5' ends of decapped RNA.
A the end of the RLM-RACE procedure, the minus-TAP control RNA
should not yield the same PCR products as the experimental RNA that
underwent the entire RLM-RACE procedure. In theory, no bands
should be produced since the RNA has either been dephosphorylated
with CIP, or it has an intact cap structure (because it was not treated
with TAP) that cannot undergo ligation to the 5' RACE Adapter. Sometimes a smear of non-specific products is seen from the minus-TAP control
RNA, this is not a concern.
3. Test the gene-specific
PCR primers
A useful control reaction is to test the inner and outer gene specific
5' RLM RACE primers by using each one of them in a PCR with a gene
specific 5' primer and an aliquot of the RLM-RACE reverse transcription reaction as template (as described in section VI.A.3. RT-PCR control on page 22). Each reaction should produce a single band of the
appropriate size. Failure to produce the appropriate bands in these control reactions is a strong indication that the cycling conditions are inappropriate, or that the gene specific primers should be redesigned.
Sometimes reducing the concentration of the primers in the PCR by
50% reduces background significantly.
If the expected bands are produced in these control PCRs, optimize the
RACE PCR by varying the annealing temperature as described below.
Sometimes a complicated pattern (or no pattern at all) will resolve into
a single band with an increase in stringency of the PCR.
4. Optimization of PCR
annealing temperature
More than any other variable, optimization of the PCR annealing temperature will provide the greatest improvement to the outcome of the
RLM-RACE protocol. There is ample experimental material for thorough optimization. Each reverse transcription reaction can provide template for 20 PCRs and 5' RACE Inner and Outer Primers for 100 PCRs
are included in the kit. If you need more 5' RACE Inner and Outer
Primers, their sequence is provided in section I. on page 4. In general,
the annealing temperature in the outer PCR is less critical, and should
be 55–65°C. The annealing temperature of the inner, nested PCR may
need to be higher than predicted by calculation or by primer design software to achieve the required selectivity in the amplification. If the PCR
fails to give the expected results, repeat the experiment using a higher
(try 2°C) annealing temperature.
5. Protocol modifications for
long targets
Lack of a specific RLM-RACE product may be dependent on the distance between your nested primers and the 5' end of the target. The
72°C extension step of the amplification cycle should be extended
24
VI.B.
Optimization of RLM-RACE
Troubleshooting
1 minute for each kilobase of target over 1 kb. Larger RACE products
are more difficult to amplify in general. SuperTaq™ Plus (Ambion P/N
AM2054 & AM2056, or similar products from other companies) has a
proofreading activity, providing greater fidelity and processivity than
ordinary thermostable DMA polymerase. In routine use, PCRs using
extended range polymerases have higher yields, especially when the target amplicon is larger than 1 kb. The only drawback to using a
‘long-Taq’ instead of ordinary thermostable DNA polymerase is that
PCR products might not be clonable using the T/A method. Otherwise,
the robustness of most reactions will be improved by this simple substitution.
NOTE
SuperTaq Plus™ (P/N AM2054, AM2056) is compatible with T/A cloning.
6. Optimization of RNA
denaturation prior to
reverse transcription
GC-rich regions or other regions of stable secondary structure in RNA
transcripts may present a problem for M-MLV Reverse Transcriptase at
42°C. By increasing the temperature of the reverse transcriptase reaction, secondary structure effects can be minimized. The M-MLV
Reverse Transcriptase included in the RLM-RACE kit can be used at up
to 50°C. Increasing the temperature of the synthesis reaction may facilitate read-through by the RT enzyme.
In extreme cases, a thermostable enzyme can be used for first strand synthesis. In one unusual experiment, the correct RACE product from a
very GC-rich sequence was only obtained with the use of a thermostable
reverse transcriptase. Such enzymes can be purchased from several commercial sources. If you choose to buy a thermostable reverse transcriptase, confirm that the manufacturer certifies that the enzyme is
nuclease-free. Follow the recommended reaction conditions for the
enzyme (e.g. use the supplier’s RT reaction buffer—Ambion dNTPs
can be used). Substitution of a thermostable enzyme should be considered only if optimization using the supplied kit components fails to
yield the desired products.
VI.B. Optimization of RLM-RACE
25
FirstChoice® RLM-RACE Kit
VII.
A.
Appendix
References
Ganju RK, Brubaker SA, Meyer J, Dutt P, Yang Y, Qin S, Newman W, Groopman JE. (1998) The
alpha-chemokine, stromal cell-derived factor-1alpha, binds to the transmembrane G-protein–coupled CXCR-4
receptor and activates multiple signal transduction pathways. J Biol Chem 273(36):23169-75
Maruyama K and Sugano S. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic
mRNAs with oligoribonucleotides. Gene 138:171-174
Parolin C, Borsetti A, Choe H, Farzan M, Kolchinsky P, Heesen M, Ma Q, Gerard C, Palu G, Dorf ME,
Springer T, Sodroski J. (1998) Use of murine CXCR-4 as a second receptor by some T-cell-tropic human
immunodeficiency viruses. J Virol. 72(2):1652-6.
Sehgal A, Keener C, Boynton AL, Warrick J, Murphy GP. (1998) CXCR-4, a chemokine receptor, is overexpressed in and required for proliferation of glioblastoma tumor cells. J Surg Oncol. 69(2):99-104.
Shaefer, B. (1995) Revolution in rapid amplification of cDNA ends: new strategies for polymerase chain reaction cloning of full-length cDNA ends. Analytical Biochem. 227:255-273.
B.
Quality Control
Functional testing
All components are functionally tested in RLM-RACE following this
protocol. PCR products are assessed on a 2% agarose gel.
Nuclease testing
Relevant kit components are tested in the following nuclease assays:
RNase activity
Meets or exceeds specification when a sample is incubated with 25 ng
labeled RNA and analyzed by PAGE.
Nonspecific endonuclease activity
Meets or exceeds specification when a sample is incubated with 300 ng
supercoiled plasmid DNA and analyzed by agarose gel electrophoresis.
Exonuclease activity
Meets or exceeds specification when a sample is incubated with 40 ng
labeled Sau3A fragments of pUC19 and analyzed by PAGE.
Protease testing
26
VII.A.
References
Meets or exceeds specification when a sample is incubated with 1 μg
protease substrate and analyzed by fluorescence.
Appendix
C.
Safety Information
The MSDS for any chemical supplied by Applied Biosystems or
Ambion is available to you free 24 hours a day.
IMPORTANT
For the MSDSs of chemicals not distributed by Applied Biosystems or
Ambion, contact the chemical manufacturer.
To obtain Material Safety
Data Sheets
• Material Safety Data Sheets (MSDSs) can be printed or downloaded
from product-specific links on our website at the following address:
www.ambion.com/techlib/msds
• Alternatively, e-mail your request to:
MSDS_Inquiry_CCRM@appliedbiosystems.com. Specify the catalog or part number(s) of the product(s), and we will e-mail the associated MSDSs unless you specify a preference for fax delivery.
• For customers without access to the internet or fax, our technical service department can fulfill MSDS requests placed by telephone or
postal mail. (Requests for postal delivery require 1–2 weeks for processing.)
Chemical safety guidelines
To minimize the hazards of chemicals:
• Read and understand the Material Safety Data Sheets (MSDS) provided by the chemical manufacturer before you store, handle, or
work with any chemicals or hazardous materials.
• Minimize contact with chemicals. Wear appropriate personal protective equipment when handling chemicals (for example, safety glasses,
gloves, or protective clothing). For additional safety guidelines, consult the MSDS.
• Minimize the inhalation of chemicals. Do not leave chemical containers open. Use only with adequate ventilation (for example, fume
hood). For additional safety guidelines, consult the MSDS.
• Check regularly for chemical leaks or spills. If a leak or spill occurs,
follow the manufacturer’s cleanup procedures as recommended on
the MSDS.
• Comply with all local, state/provincial, or national laws and regulations related to chemical storage, handling, and disposal.
VII.C. Safety Information
27
FirstChoice® RLM-RACE Kit
28
VII.C.
Safety Information
Appendix
VII.C. Safety Information
29
FirstChoice® RLM-RACE Kit
30
VII.C.
Safety Information