From www.bloodjournal.org by guest on September 30, 2016. For personal use only.
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Vitamin K epoxide reductase significantly improves carboxylation in a cell line
overexpressing factor X
Yan-Mei Sun, Da-Yun Jin, Rodney M. Camire, and Darrel W. Stafford
Previously we reported that we could
increase the fraction of carboxylated factor X by reducing the affinity of the
propeptide for its binding site on human
gamma glutamyl carboxylase. We attributed this to an increased turnover rate.
However, even with the reduced affinity
propeptide, when sufficient overproduction of factor X is achieved, there is still a
significant fraction of uncarboxylated re-
combinant factor X. We report here that
the factor X of such a cell line was only
52% carboxylated but that the fraction of
carboxylated factor X could be increased
to 92% by coexpressing the recently identified gene for vitamin K epoxide reductase. Because vitamin K is in excess in
both the untransfected and vitamin K epoxide reductase (VKOR)–transfected cells, the
simplest explanation for this result is that
VKOR catalyzes both the reduction of vitamin K epoxide to vitamin K and the conversion of vitamin K to vitamin K hydroquinone. In addition to its mechanistic
relevance, this observation has practical
implications for overproducing recombinant vitamin K–dependent proteins for therapeutic use. (Blood. 2005;106:3811-3815)
© 2005 by The American Society of Hematology
Introduction
Posttranslational modification of glutamic acid to gamma carboxyl
glutamic acid (Gla) is required for the activity of a few proteins, most of
which are related to coagulation. These modified proteins are often
called vitamin K–dependent proteins because they require reduced
vitamin K for their Gla modification. The enzyme that catalyzes the
modification of glutamate (Glu) to Gla is the gamma-glutamyl carboxylase (GGCX), an 87.542-kDa1 integral membrane protein with 5 transmembrane domains.2 For the carboxylation reaction, a propeptide on the
substrate binds to an exosite on the vitamin K–dependent gammacarboxylase, holding the substrate in place while multiple glutamic acids
are modified to Gla.3 The carboxylation also requires CO2, O2, and
reduced vitamin K. It has been observed that for each Glu modified, at
least 1 molecule of vitamin K epoxide is formed.4 It is thought that an
intermediate of vitamin K is a sufficiently strong base to abstract a
proton from the gamma position of the glutamates in the Gla domain,5
and that during this process the reduced vitamin K is converted to
vitamin K epoxide (KO). Vitamin K epoxide reductase (VKOR), the
target of warfarin anticoagulants, is an 18.2-kDa protein6,7 with 3 transmembrane domains.8 The role of VKOR is to convert the vitamin K
epoxide back to vitamin K and, perhaps, vitamin K to reduced vitamin K.
We proposed that efficient carboxylation depends upon a
balance between the half-life of the enzyme-substrate complex and
the rate of carboxylation of the bound substrate. The half-life of the
enzyme-substrate complex is primarily dependent upon the affinity
of the propeptide of the substrate for the carboxylase. And, the rate
of carboxylation is dependent upon the concentration of reduced
vitamin K available for the reaction.3
Initially, it seemed apparent that if a sufficient supply of vitamin
K were available, the limiting factor for carboxylation would be
GGCX. This rationale seemed warranted because warfarin poisoning can be overcome by large doses of vitamin K,9,10 indicating that
alternative enzymes for converting vitamin K to reduced vitamin K
are present.11 However, after the purification and cloning of
GGCX,1,12 it was reported that coexpression of factor IX (FIX) and
GGCX failed to improve the degree of carboxylation in a Chinese
hamster ovary (CHO) cell line overexpressing human FIX.13 This
leads to the question of what is the limiting step in carboxylation of
vitamin K–dependent proteins in a cell. To obtain a clear answer to
this question we need an appropriate system. Previously, we
observed that the percentage of carboxylated factor X (FX) in the
human embryonic kidney (HEK) 293 cell line could be dramatically increased by reducing the affinity of the FX propeptide for
GGCX14; we attributed this increased carboxylation to an increase
in the steady state turnover. However, if the level of expression of
FX bearing the prothrombin propeptide is sufficiently high, the
level of expression still exceeds the ability of the cell to achieve
complete posttranslational modification of the intended Gla residues (R.M.C., unpublished observations, November 2002). Therefore these cells provide a superb system to evaluate whether
GGCX, VKOR, or VKOR plus GGCX can enhance carboxylation
in vivo. In this study, using this HEK 293 cell line overproducing
FX, we demonstrate that the percentage of carboxylated material
can be dramatically increased, from approximately 50% to approximately 95%, by coexpression of the VKOR.
From the Department of Biology, University of North Carolina at Chapel Hill;
and Division of Hematology, The Children’s Hospital of Philadelphia, PA.
Reprints: Darrel W. Stafford, Department of Biology, University of North Carolina at
Chapel Hill, Chapel Hill, NC 27599-3280; e-mail: dws@email.unc.edu.
Submitted June 23, 2005; accepted July 28, 2005. Prepublished online as
Blood First Edition Paper, August 4, 2005; DOI 10.1182/blood-2005-06-2495.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
An Inside Blood analysis of this article appears in the front of this issue.
© 2005 by The American Society of Hematology
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
Materials and methods
Materials
All restriction enzymes were from New England Biolabs (Ipswich, MA).
Pyrococcus furiosus (Pfu) DNA polymerase was obtained from Stratagene
(La Jolla, CA). Lipofectin, hygromycin B, pcDNA3.1/Hygro vector, Trizol
reagent, and Moloney murine leukemia virus reverse transcriptase
3811
From www.bloodjournal.org by guest on September 30, 2016. For personal use only.
3812
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
SUN et al
(M-MLV RT) were from Invitrogen (Carlsbad, CA). Trypsin-EDTA
(ethylenediaminetetraacetic acid), fetal bovine serum, and Dulbecco
phosphate-buffered saline were from Sigma (St Louis, MO). Antibioticantimycotic, G418 (Geneticin, Grand Island, NY) and Dulbecco modified Eagle medium (DMEM) F-12 were from GIBCO (Grand Island,
NY). Puromycin and pIRESpuro3 vector were from BD Biosciences–
Clontech (Mountain View, CA). Rabbit anti–human FX (affinitypurified IgG) and Rabbit anti–human FX (HRP conjugate) were from
Dako Corporation (Carpinteria, CA). Peroxidase-conjugated AffiniPure
rabbit anti–goat immunoglobulin G (IgG) was from Jackson ImmunoResearch Laboratories (West Grove, PA). Q-sepharose Fast Flow was
obtained from Amersham Pharmacia Biotech (Piscataway, NJ). Calciumdependent monoclonal human FX antibody [MAb; 4G3] was obtained
from Dr Harold James (University of Texas, Tyler). Bio-Scale CHT5-I
Hydroxyapatite was from Bio-Rad Laboratories (Hercules, CA). RQ1
(RNA-qualified) RNase-Free DNase was from Promega (Madison, WI).
DyNAmo SYBR Green qPCR kit was from Finnzymes (Keilaranta,
Espoo, Finland). DNA Engine An MJ Research Opticon 2 PCR thermal
cycler (MJ Research, Alameda, CA) was used for real-time polymerase
chain reaction (PCR).
Methods
Construction of expression vectors. All constructs were made in a cell
line, HEK293-FX (A6), expressing human FX with 1 mutation, Ile16Leu,
and the prothrombin propeptide.14 We selected the FX-expressing cells with
the neomycin analog G418. This particular cell line expresses FX at such
high levels (7-9 ␮g/106 cells/24 hours) that only about 50% of the protein is
carboxylated even though the FX propeptide was replaced by that of
prothrombin.
HEK293-FX (A6) expressing VKOR. 2 primers were designed to
amplify the VKOR cDNA.6,7 Primer 1: 5⬘-CCGGAATTCGCCGCCACCATGGGCAGCACCTGGGGGAGCCCTGGCTGGGTGCGG introduced a
Kozak sequence15 (underlined) and a 5⬘ EcoRI site. Primer 2: 5⬘CGGGCGGCCGCTCAGTGCCTCTTAGCCTTGCC introduced a NotI
site at the 3⬘ terminus of the cDNA. After PCR amplification and digestion
with EcoRI and NotI, we inserted the PCR product into pIRESpuro3 which
has a CMV virus major immediate early promoter/enhancer and confers
puromycin resistance upon the transformed cells. HEK293-FX (A6) was
transfected with the plasmid pIRESpuro3-VKOR using lipofectin according to the manufacturer’s protocol. Selection was done with 450 ␮g/mL
G418 and 1.75 ␮g/mL puromycin. Resistant colonies were picked and
screened for VKOR activity as previously described.6 The colony with
highest VKOR activity was selected for further analysis.
HEK293-FX (A6) expressing GGCX. Two primers were designed to
amplify the GGCX cDNA.1 Primer 3: 5⬘-CGCGGATCCGCCGCCACCATGGCGGTGTCTGCCGGGTCCGCGCGGACCTCGCCC, introduced a
BamH1 site and a Kozak sequence (underlined) at the 5⬘ terminus and
Primer 4: 5⬘-CGGGCGGCCGCTCAGAACTCTGAGTGGACAGGATCAGGATTTGACTC that introduced a NotI site at the 3⬘ terminus. After
digestion with BamHI and NotI, we inserted the PCR product into
pcDNA3.1/Hygro. pcDNA3.1/Hygro has a cytomegalovirus (CMV) promoter and confers hygromycin resistance upon the transformed cell.
Transformed colonies were selected with 300 ␮g/mL hygromycin and 450
␮g/mL of G418. Resistant colonies were picked and screened for GGCX
activity with the small peptide substrate phenylalanine-leucine-glutamateglutamate-leucine (FLEEL).1 The colony with highest GGCX activity was
selected for further studies.
HEK293-FX (A6) coexpressing VKOR and GGCX. To obtain a
HEK293-FX (A6) cell line overexpressing both VKOR and GGCX, we
transfected HEK293-FX (A6)–VKOR with plasmid pcDNA3.1/HygroGGCX; 18 resistant colonies were selected for analysis. We also
transfected HEK293-FX (A6)–GGCX with pIRESpuro3-VKOR; from
this selection only 1 resistant colony was obtained. Finally, we
transfected HEK293-FX (A6) simultaneously with both pIRESpuro3VKOR and pcDNA3.1/Hygro-GGCX; in this case, we got 10 resistant
colonies. The 29 isolated colonies were then assayed for both VKOR
and GGCX activity and the colony with the highest levels of both
activities was selected for further analysis.
Expression of FX from each cell line in roller bottles. We grew the 4
stable cell lines HEK293-FX (A6), HEK293-FX (A6)–VKOR, HEK293-FX
(A6)–GGCX, and HEK293-FX (A6)–VKOR-GGCX to confluency in T
225 flasks and transferred them into roller bottles. At 24 and 36 hours, we
replaced the media with serum-free media containing vitamin K1 at
6 ␮g/mL. We then collected the medium from each cell line every 24 hours
until a total of 3 liters was obtained.
Purification of FX from each cell line. FX was purified from
conditioned media of each cell line using a 3-step chromatographic method
(Q-sepharose Fast Flow, FX immunoaffinity [G3], and Bio-Scale CHT5-I
Hydroxyapatite) as described.14,16
Gla analysis of pooled fractions from each cell line. The Gla content
of each peak of the hydroxyapatite column for all 4 cell lines were analyzed
as described.14
Analysis of mRNA expression levels for VKOR, GGCX, and FX
among each cell line by using real-time quantitative PCR. Total RNA
extraction and real-time quantitative (Q)–PCR amplification were performed as described.6 All samples were repeated in quadruplicate. Melting
curves were analyzed for all samples. Five-fold serial dilutions were used
for each recombinant plasmid (pIRESpuro3-VKOR, pcDNA3.1/HygroGGCX, and pCMV4-ss-pro-II-hFX) to generate standard curves. We used
the following primers: VKOR forward primer: 5⬘-CAGCTATTGTTAGGTTGCCTGCGG; VKOR reverse primer: 5⬘-GCTCACGTTGATAGCATAGGTGGTG; GGCX forward primer: 5⬘-CCATAGGAGGAATGCCCACG;
GGCX reverse primer: 5⬘-AGCCAGTGCCGGGACAAATA; HFX forward primer: 5⬘-AGGGGACCGGAACACGGAGC; and HFX reverse
primer: 5⬘-GGTGGACTGCCGGCCCTTCT. ␤-actin was used as the
internal control. Its primers used were those suggested by MJ Research.17
Results
FX expression
Because it was necessary to select for cells overproducing VKOR,
GGCX, or both VKOR and GGCX, it is possible that the level of
FX expressed in the selected cells might differ from that of the
starting cells. To circumvent this, these cDNAs were introduced
into the same FX cell line (clone A6) that was overexpressing this
protein (6-9 ␮g FX/106 cells/24 hours). Each of the resulting
established cell lines (FX (A6), FX (A6)–VKOR, FX (A6)–GGCX,
and FX (A6)–VKOR-GGCX) were expressing relatively equal
amount of FX protein (data not shown).
VKOR and GGCX activities for each cell line
Figure 1 show VKOR and GGCX activities for the 4 cell lines
selected for high expression (HEK293-FX (A6), HEK293-FX
(A6)–VKOR, HEK293-FX (A6)–GGCX, HEK293-FX (A6)–
VKOR-GGCX), respectively. These data demonstrate that there is
at least a 10-fold overexpression of the introduced genes in each of
the cell lines.
Analysis of mRNA expression levels of VKOR, GGCX, and FX
by real-time Q-PCR
To confirm the results of our enzyme-linked immunosorbent assay
(ELISA) and activity measurements, the relative amounts of
VKOR, GGCX, and FX mRNA were determined for each cell line.
The amount of mRNA expressed was normalized to ␤-actin
mRNA. Table 1 shows that the mRNA for FX (A6) is similar for all
4 cell lines; this is consistent with our results on the expression
levels determined by ELISA. The cell lines transfected with VKOR
cDNA contained 10 times more VKOR mRNA than did the starting
cell line. In the case of transfection with GGCX cDNA, both cell
lines had 86 times more mRNA than the endogenous level.
From www.bloodjournal.org by guest on September 30, 2016. For personal use only.
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
VKOR IMPROVES CARBOXYLATION IN VIVO
Figure 1. VKOR and GGCX activity for the various cell lines. (A) Vitamin K
reduced from vitamin K epoxide by the VKOR was measured as previously described
(n ⫽ 3).6 HEK293-FX (A6): HEK293 cells over-expressing factor X. HEK293-FX
(A6)–VKOR: HEK293 cells overexpressing both factor X and the VKOR. HEK293-FX
(A6)–GGCX: HEK293 cells overexpressing both factor X and GGCX. HEK293-FX
(A6)–VKOR-GGCX: HEK293 cells overexpressing factor X, VKOR, and GGCX. (B)
GGCX activity for the following cell lines as defined in panel A: HEK293-FX (A6),
HEK293-FX (A6)–VKOR, HEK293-FX (A6)–GGCX, HEK293-FX (A6)–VKORGGCX. GGCX activity toward the pentapeptide substrate FLEEL was measured as
described (n ⫽ 3). Data are presented as mean ⫾ SD.1
Analysis of the efficiency of carboxylation in the different
cell lines
We have previously shown that FX may be separated into
carboxylated and uncarboxylated species by chromatography on
hydroxyapatite.14 For analysis of the carboxylation state of the FX
in the different cell lines, 3 L media were collected from cells
grown in roller bottles and the FX from each cell line was purified
by Q-sepharose and antibody affinity chromatography as described
in “Materials and methods.” Three to 4 mg/L FX was recovered
from each liter of conditioned medium. We then used hydroxyapatite chromatography to separate carboxylated FX from noncarboxylated FX. Two protein peaks were obtained. As previously observed, the first peak contains uncarboxylated FX, while the second
pool is composed of fully ␥-carboxylated human FX. Figure 2
depicts the separation of uncarboxylated and fully ␥-carboxylated
human FX from each of the 4 cell lines. Fifty-two percent of the FX
was carboxylated in the starting HEK293-FX (A6) cell line. VKOR
alone was able to increase the percentage of carboxylated FX to
92%. GGCX was only marginally improved (57%) while the cell
line with both VKOR and GGCX was essentially fully carboxylated.
Gla analysis of each pool from 4 kinds of cell line
To confirm the ␥-carboxylation state of FX of the fractions eluting
from the hydroxyapatite column, Gla analysis was performed. As
expected, in the first peak essentially no Gla was detected, while
the Gla content of the second peak was comparable to plasmaderived FX (Table 2). FX from HEK293-FX (A6)–VKOR-GGCX
cells eluted from hydroxyapatite as one peak, whose Gla content
was comparable with the Gla content of plasma-derived factor X.
Cell line
HEK293-FX (A6)
VKOR
mRNA
expression
level ratio
1
GGCX
mRNA
expression
level ratio
Figure 2. Separation of ␥-carboxylated and uncarboxylated FX by hydroxyapatite chromatography. Separation of the ␥-carboxylated and uncarboxylated factor X
is as described in “Materials and methods” and as previously described.14 Cell line
abbreviations are as defined in Figure 1. In each panel the first peak represents the
uncarboxylated factor X and the second peak is fully ␥-carboxylated factor X.
(A) HEK293-FX (A6). (B) HEK293-FX (A6)–VKOR. (C) HEK293-FX (A6)–GGCX.
(D) HEK293-FX (A6)–VKOR-GGCX. Diagonal lines indicate sodium phosphate
concentration gradient of elution.
Discussion
In this study, we investigated the effect of coexpressing VKOR
and GGCX on the efficiency of carboxylation of vitamin K–
dependent proteins expressed in HEK 293 cells. For each
transfection, we selected clones that expressed similar levels of
FX and that exhibited significant overexpression of VKOR,
GGCX, or VKOR and GGCX. Our goal is to extend our
understanding of the mechanism of carboxylation to an in vivo
system. According to our present understanding, GGCX is the
enzyme that accomplishes the carboxylation reaction.18 The role
of VKOR is to convert vitamin K epoxide back to vitamin K
and, perhaps, vitamin K hydroquinone.19
Patients who overdose on warfarin can be rescued by
treatment with vitamin K.9,10 Because VKOR is inactivated by
warfarin, this indicates that other enzymes not sensitive to
warfarin, such as the nicotinamide adenine dinucleotide (NAD)–
dependent deoxythymidine (DT)–diaphorase,11 can convert vitamin K to reduced vitamin K. Therefore, it was expected that in
the presence of adequate vitamin K, coexpression of GGCX
would greatly improve the amount of fully carboxylated vitamin K recombinant protein produced in cell culture because the
alternative pathway could provide sufficient reduced vitamin K
Table 2. Gla analysis of purified FX (A6) from each cell line,
recombinant wild-type (rwt) FX, and plasma-derived (PD) FX
Samples
Table 1. Comparison of VKOR, GGCX, and FX (A6) mRNA
expression levels determined by real-time Q-PCR
PD-FX
FX (A6) mRNA
expression
level ratio
3813
Average ⴞ SD,
M Gla per M protein
10.47 ⫾ 0.25
rwtFX
9.19 ⫾ 0.22
FX Peak II (HEK293-FX (A6))
8.85 ⫾ 0.25
FX Peak II (HEK293-FX (A6)-GGCX)
9.16 ⫾ 0.37
FX Peak II (HEK293-FX (A6)-VKOR)
1
1
FX Peak II (HEK293-FX (A6)-VKOR-GGCX)
9.52 ⫾ 0.04
10.45 ⫾ 0.68
HEK293-FX (A6)-VKOR
10.69
1.63
1.24
FX Peak I (HEK293-FX (A6))
0.07 ⫾ 0.07
HEK293-FX (A6)-GGCX
1.51
86.14
1.32
FX Peak I (HEK293-FX (A6)-GGCX)
0.18 ⫾ 0.02
FX Peak I (HEK293-FX (A6)-VKOR)
0.19 ⫾ 0.05
11.97
86.17
1.48
HEK293-FX (A6)-VKORGGCX
Theoretical value for all samples in the table is 11 M gla per M protein.
From www.bloodjournal.org by guest on September 30, 2016. For personal use only.
3814
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
SUN et al
for the reaction. However, after the purification and cloning of
GGCX,1,12 Rehemtulla et al13 reported that coexpression of
factor IX and GGCX in cell culture did not improve the fraction
of fully carboxylated FIX. Recently, Wajih et al20 concluded that
VKOR catalyzed the rate-limiting step in the carboxylation
reaction. This conclusion was based on experiments using
extracts from cell lines overexpressing exogenous VKOR,
GGCX, or VKOR and GGCX. The in vitro carboxylation of the
small substrate FLEEL was increased in extracts from cells
overexpressing VKOR only. To determine if these results held
true in a system mimicking the in vivo situation, we used a HEK
293 cell line expressing chimeric FX whose propeptide was
that of prothrombin.14 We characterized FX from cell lines
transfected with the substrate and either VKOR, GGCX, or
both enzymes.
In the HEK 293 cell line expressing only basal levels of
VKOR and GGCX activity (no transfection), 52% of the FX was
carboxylated. Transfecting the same cell lines with GGCX
increased the level of carboxylated FX marginally to 57%. In
contrast, cotransfection of these cells with VKOR increased the
fraction of carboxylated FX to 92%. Cotransfection with both
VKOR and GGCX resulted in essentially complete carboxylation of the secreted FX. The FX expression levels for each of
these cell lines were essentially equivalent based on an FXspecific ELISA and based on mRNA levels also. However, when
both VKOR and GGCX were transfected into the HEK 293 cell
line overproducing factor X, we recovered less purified factor X
compared with the other 3 cell lines. This may be attributed to
the fact that we measured FX in cells grown in T25 flasks, but
the protein was collected from cells grown in roller bottles.
These cells (HEK 293-FX (A6)–VKOR-GGCX) did not adhere
well to the roller bottles and significant numbers of cells were
lost each time we collected medium. While our paper was under
review, Wajih et al reported that factor IX expression in baby
hamster kidney (BHK) cells could also be helped by coexpressing VKOR.21 Both this work and that of Hallgren et al22 and
Rehemtulla et al13 report that GGCX expression actually
decreases the amount of functional, carboxylated, vitamin K–
dependent protein secreted from the cells. In fact, we recovered
slightly more factor X from the cell line overexpressing GGCX
than from any of the other cell lines. Our only conclusion from
this is that, in our system, GGCX does not reduce the production
of a vitamin K–dependent protein.
The results presented here indicate that coexpressing VKOR
and FX dramatically improved the extent of carboxylation in
cell culture. In our experiments, the simplest explanation for the
dramatic increase in carboxylation observed when VKOR is
coexpressed with the cell line overproducing FX is that VKOR
is responsible for both the conversion of vitamin K epoxide to
vitamin K and vitamin K to vitamin K hydroquinone. Since we
provide vitamin K to the cells, it seems unlikely that the
conversion of vitamin K epoxide to vitamin K is rate limiting.
The simplest interpretation of our results is that, at least for the
conditions used in this study, the conversion of vitamin K to
vitamin K hydroquinone by VKOR is the rate-limiting step in
the vitamin K cycle. This conclusion is consistent with several
earlier publications. Gardill and Suttie23 concluded that both
vitamin K epoxide and vitamin K are reduced by a common
enzyme. It is also consistent with the report of Preusch and
Smalley11 that the rate of conversion of vitamin K to reduced
vitamin K is much faster with a dithiothreitol (DTT) catalyzed
reaction (VKOR?) than with DT-diaphorase, which can convert
vitamin K to reduced vitamin K. An alternative, although we
feel less likely, explanation of our results is that sufficient
vitamin K epoxide is produced during carboxylation and
conversion of vitamin K to vitamin K hydroquinone is fast. In
this scenario conversion of vitamin K epoxide produced during
carboxylation to vitamin K would be rate limiting.
In addition to the mechanistic implications of this research,
there are also practical implications. At present substantial
needs exist for (1) recombinant human FIX to treat hemophilia B patients; (2) FVIIa for treating patients with autoantibodies (inhibitors) to either FIX or FVIII and for bleeding that
results from general trauma24; and (3) activated protein C, for
the treatment of sepsis.25,26 To date, these vitamin K–dependent
proteins are produced in cell cultures with CHO, BHK, and
human embryo kidney cells (HEK 293). A common problem for
all these cell lines is that, if significant overproduction is
achieved, a significant fraction of the recombinant protein
produced is undercarboxylated and therefore inactive. Including
VKOR or both VKOR and GGCX in the cell lines expressing
these important enzymes should greatly increase the yield of
active enzyme.
In summary, VKOR appears to be the rate-limiting enzyme
for carboxylation of FX in the system that was used for these
experiments. However, there will undoubtedly be circumstances
where the amount of GGCX will be limiting. For example, the
particular cell system that we used for this study should exhibit a
relatively rapid steady-state turnover because our FX bears the
propeptide of prothrombin and the affinity of the propeptide of
prothrombin for GGCX is about 40-fold less than that of the FX
propeptide. It seems likely, then, that when overproduction of a
particular vitamin K protein is achieved, and sufficient reduced
vitamin K (as opposed to vitamin K) is available, there will still
be undercarboxylated substrate and the percentage of carboxylated product can be increased by concurrently overproducing
GGCX. A logical way to test this hypothesis is to use one of the
cell lines described in our previous paper14 that overexpresses
FX with its own propeptide. Because the difference in affinity
translates into a difference in steady-state turnover, we expect
that coexpressing GGCX will have a significant effect on in vivo
carboxylation of an FX bearing its own propeptide.
References
1. Wu SM, Cheung WF, Frazier D, Stafford DW.
Cloning and expression of the cDNA for human
gamma-glutamyl carboxylase. Science. 1991;
254:1634-1636.
dependent carboxylase: stoichiometry of carboxylation and vitamin K 2,3-epoxide formation.
J Biol Chem. 1981;256:11032-11035.
in VKORC1 cause warfarin resistance and multiple coagulation factor deficiency type 2. Nature.
2004;427:537-541.
2. Tie J, Wu SM, Jin D, Nicchitta CV, Stafford DW. A
topological study of the human gamma-glutamyl
carboxylase. Blood. 2000;96:973-978.
5. Dowd P, Hershline R, Ham SW, Naganathan S.
Vitamin K and energy transduction: a base
strength amplification mechanism. Science.
1995;269:1684-1691.
8. Tie JK, Nicchitta C, von Heijne G, Stafford DW.
Membrane topology mapping of vitamin K epoxide reductase by in vitro translation/cotranslocation. J Biol Chem. 2005;280:16410-16416.
3. Presnell SR, Stafford DW. The vitamin Kdependent carboxylase. Thromb Haemost. 2002;
87:937-946.
6. Li T, Chang CY, Jin DY, Lin PJ, Khvorova A, Stafford DW. Identification of the gene for vitamin K
epoxide reductase. Nature. 2004;427:541-544.
4. Larson AE, Friedman PA, Suttie JW. Vitamin K-
7. Rost S, Fregin A, Ivaskevicius V, et al. Mutations
9. Wallin R, Martin LF. Warfarin poisoning and vitamin K antagonism in rat and human liver: design
of a system in vitro that mimics the situation in
vivo. Biochem J. 1987;241:389-396.
From www.bloodjournal.org by guest on September 30, 2016. For personal use only.
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
10. Shearer MJ, Barkhan P. Vitamin K1 and therapy
of massive warfarin overdose. Lancet. 1979;1:
266-267.
11. Preusch PC, Smalley DM. Vitamin K1 2,3epoxide and quinone reduction: mechanism and
inhibition. Free Radic Res Commun. 1990;8:401415.
12. Wu SM, Morris DP, Stafford DW. Identification
and purification to near homogeneity of the vitamin K-dependent carboxylase. Proc Natl Acad
Sci U S A. 1991;88:2236-2240.
13. Rehemtulla A, Roth DA, Wasley LC, et al. In vitro
and in vivo functional characterization of bovine
vitamin K-dependent gamma-carboxylase expressed in Chinese hamster ovary cells. Proc
Natl Acad Sci U S A. 1993;90:4611-4615.
14. Camire RM, Larson PJ, Stafford DW, High KA.
Enhanced gamma-carboxylation of recombinant
factor X using a chimeric construct containing the
prothrombin propeptide. Biochemistry. 2000;39:
14322-14329.
15. Kozak M. Selection of initiation sites by eucaryotic ribosomes: effect of inserting AUG triplets
upstream from the coding sequence for preproinsulin. Nucleic Acids Res. 1984;12:3873-3893.
16. Larson PJ, Camire RM, Wong D, et al. Structure/
17.
18.
19.
20.
21.
VKOR IMPROVES CARBOXYLATION IN VIVO
function analyses of recombinant variants of human factor Xa: factor Xa incorporation into prothrombinase on the thrombin-activated platelet
surface is not mimicked by synthetic phospholipid
vesicles. Biochemistry. 1998;37:5029-5038.
Kurtz R, Batey D. Gene expression profiling
from human tissues using RT-qPCR with SYBR
Green 1 dye on the DNA Engine Opticon System. http://www.mjr.com/pls/portal/docs/PAGE/
RESOURCE_LIBRARY/APPLICATION_NOTES/
MJRGEProf.pdf. Accessed March 10, 2005.
Esmon CT, Sadowski JA, Suttie JW. A new carboxylation reaction: the vitamin K-dependent incorporation of H14CO, into prothrombin. J Biol
Chem. 1975;250:4744-4748.
Zimmerman A, Matschiner JT. Biochemical basis
of hereditary resistance to warfarin in the rat. Biochem Pharmacol. 1974;23:1033-1040.
Wajih N, Sane DC, Hutson SM, Wallin R. Engineering of a recombinant vitamin K-dependent
gamma-carboxylation system with enhanced
gamma-carboxyglutamic acid forming capacity:
evidence for a functional CXXC redox center in
the system. J Biol Chem. 2005;280:10540-10547.
Wajih N, Hutson SM, Owen J, Wallin R. Increased production of functional recombinant human clotting factor IX by BHK cells engineered to
3815
over express VKORC1, the vitamin K 2,3 epoxide
reducing enzyme of the vitamin K cycle. J Biol
Chem. 2005;280:31603-31607.
22. Hallgren KW, Hommema EL, Mcnally BA,
Berkner KL. Carboxylase overexpression effects
full carboxylation but poor release and secretion
of factor IX: implications for the release of vitamin
K-dependent proteins. Biochemistry. 2002;41:
15045-15055.
23. Gardill SL, Suttie JW. Vitamin K epoxide and quinone reductase activities: evidence for reduction
by a common enzyme. Biochem Pharmacol.
1990;40:1055-1061.
24. Roberts HR, Monroe DM, White GC. The use of
recombinant factor VIIa in the treatment of bleeding disorders. Blood. 2004;104:3858-3864.
25. Bernard GR, Margolis BD, Shanies HM, et al. Extended evaluation of recombinant human activated protein C United States Trial (ENHANCE
US): a single-arm, phase 3B, multicenter study of
drotrecogin alfa (activated) in severe sepsis.
Chest. 2004;125:2206-2216.
26. Grinnell BW, Joyce D. Recombinant human activated protein C: a system modulator of vascular
function for treatment of severe sepsis. Crit Care
Med. 2001;29:S53-S60.
From www.bloodjournal.org by guest on September 30, 2016. For personal use only.
2005 106: 3811-3815
doi:10.1182/blood-2005-06-2495 originally published online
August 4, 2005
Vitamin K epoxide reductase significantly improves carboxylation in a
cell line overexpressing factor X
Yan-Mei Sun, Da-Yun Jin, Rodney M. Camire and Darrel W. Stafford
Updated information and services can be found at:
http://www.bloodjournal.org/content/106/12/3811.full.html
Articles on similar topics can be found in the following Blood collections
Free Research Articles (4070 articles)
Gene Expression (1086 articles)
Hemostasis, Thrombosis, and Vascular Biology (2485 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.