Available online at www.scholarsresearchlibrary.com
Scholars Research Library
Annals of Biological Research, 2013, 4 (6):144-150
(http://scholarsresearchlibrary.com/archive.html)
ISSN 0976-1233
CODEN (USA): ABRNBW
Role of Acinetobacter baumannii AdeB, AdeJ and QacE efflux genes in
mediating decreased susceptibility to biocides
Shohreh Afshar Yavari1, Seyyal Rota2, Kayahan Caglar2 and Isıl Fidan2
1
2
Department of Medical Microbiology, Urmia University of Medical Sciences, Urmia, Iran
Department of Medical Microbiology, Gazi University Faculty of Medicine, Ankara, Turkey
_____________________________________________________________________________________________
ABSTRACT
Biocides and disinfectants are commonly used in hospital and laboratory settings. The frequent use of disinfectants
may contribute to the emergence of disinfectant-resistant microorganisms. Recent studies have shown that active
drug efflux pumps are important mechanisms of resistance in the Gram negative bacilli, including Acinetobacter
baumanii . In this study we aimed to investigate the AdeB, AdeJ and QacE efflux genes regions and impact of this
efflux mediated resistance in the disinfectants resistance of 32 Acinetobacter baumanii strains isolated in our
hospital during 2009-2011.For this purpose minimum inhibitory concentrations (MICs) of 2 disinfectants
(Chlorhexidine and Benzalkonium Chloride) were investigated by broth microdilution test in the presence and
absence of two efflux pump inhibitors, phenylalanyl-arginyl-β-naphtylamide (PAβN) and 1-(1-naphythylmethyl)piperazine (NMP) and changes in the disinfectants MICs in the presence of pump inhibitors were recorded.
Additionally, adeB and adeJ genes which encode the main transporter proteins of AdeABC and AdeIJK pumps
system and QacE resistance gene were investigated in the isolates by pyrosequencing method.In %40 and %78 of
the isolates, MICs of Chlorhexidine decreased by in order 2-8 folds and 2-16 folds in the presence of PAβN and
NMP pump inhibitors. In %43 and %68 of the isolates, MICs of Benzalkonium Chloride decreased by 4-8 folds in
the presence of PAβN and NMP pump inhibitors.These results showed that an RND type drug efflux pump seems
very likely to contribute the disinfectants resistance in majority of the isolates.
Key Words: Acinetobacter baumannii, biocides, efflux pump, NMP, PAβN, Pyrosequence
_____________________________________________________________________________________________
INTRODUCTION
Acinetobacters are the bacteria which are involved in negative non-fermentative bacillus and have low virulence
basically. They cause hospital-acquired opportunistic infections generally. They create serious nosocomial infections
such as pneumonia, urinary system infections, endocarditis, sepsis, meningitis and soft tissue infections in the
patients of ICUs and with corrupted host defense cases [ 1,2,3 ].
Among protective measurements against hospital infections, disinfection and sterilization application which shall be
applied in the whole hospital take an important place. However, disinfectant resistance seen in microorganisms
which have an important role in hospital infection is one of the problems seen in disinfection applications.
Therefore, it is obligatory to determine the resistance against disinfectant materials and the source of this resistance.
144
Scholars Research Library
Shohreh Afshar Yavari et al
Annals of Biological Research, 2013, 4 (6):144-150
_____________________________________________________________________________
Disinfectant resistance mainly arises from the permeability changes in cell walls and cell membranes and increased
pumping resistance. Some pumping resistance system in bacteria is wide-spectrum and can remove several unrelated
antibiotics and disinfectant materials out of the cell. Genes in charge of this system can be coded by plasmids
generally [ 4 ].
Active medicine pumping systems in bacteria are the members of the five protein supper family: ABC; MFS;
MATE ; SMR; RND; [ 4,5,6 ] The most significant group in terms of gram-negative bacteria is the RND supper
family. In the recent studies, it is mentioned that AdeABC and AdeIJK, members of Resistance Nodulation Cell
Division (RND) supper family, have important role in the multiple resistance of A. Baumanni [4,5 ]. On the other
hand, most of the isolates having Quaternary Ammonium Compounds resistance has one or more pumping systems.
For instance, QacE genes are related with the resistance against disinfectant and antiseptic agents in high level and
the bacteria indicating these genes have a minimum inhibition concentration (MIC) four-five times greater than
sensitive control species[ 7,8,9 ].
In order to prevent the resistance related to the pumping systems, it seems inevitable to develop the compounds
which can inhibit the effects of the pumping system pump. It is seen that Phenylalanyl-arginyl-B naphtylamide
(PAβN) and 1-(1 naphythylmethyl-piperazine) (NMP) have decreased the antibiotic MICs by inhibiting RND
pumping system pump in A. baumanii. [10 ]
In this study, our purpose is to investigate the MIC (minimum inhibition concentration) values of Acinetobacter
strains that we have isolated in Department of Microbiology, Faculty of Medicine at Gazi University as hospital
infection against disinfectants such as Chlorhexidine and Benzalkonium Chloride in the existence and lack of
pumping inhibitors (‘phenylalanyl-arginyl-β-naphtylamide’ (PAβN) and‘1-(1-naphythylmethyl)-piperazine’ (NMP))
with the method of liquid microdilution and we aimed to investigate the effectiveness of this pumping system in
disinfectant resistance and the existence of AdeB, AdeJ and QacE pumping gene regions with the method of
pyrosequence.
MATERIALS AND METHODS
In this study, 32 isolated Acinetobacter strains indicating multi drug resistance which had been sent from ICU of
Gazi Hospital to Central Laboratory, Department of Microbiology were used between the dates of January 2009
until July 2011. A.baumannii isolated from 58% of respiratory, 14% of surgical wound, 18% of blood and vascular
catheter-related, 6% of CSF, 2% of urinary tract infections and 2% of pleural fluid samples.
Acinetobacter strains were isolated from different patients and samples from the patients close to each other were
excluded. Microorganisms which were thought to be Acinetobacter defined with MicroScan 5 WalkAway
identification system (Siemens, Germany) in terms of species and the certain diagnosis were verified. 32
A.baumannii strains were included in this study.
The Determination of Disinfectant MICs in the Existence and Lack of Pumping Inhibitors PABN, NMP
In the determination of the sensitivity of isolates defined as A.baumannii against Benzalkonium Chloride (Sigma–
Germany) and Chlorhexidine (Sigma–Germany) biocides, microdilution method has been used. With this method,
MIC values of minimal inhibitory concentration of strains in accordance with Clinical and Laboratory Standards
Institute (CLSI) were found appropriate [ 11 ]. In this method, Mueller Hinton Buyyon (MHB, Difco) medium was
used. In the direction of the recommendations of Mueller-Hinton broth medium producer firm, Muller-Hinton (MH)
broth medium of which cation arranged was prepared .Then Mueller-Hinton broth medium of which cation was
arranged including PAβN (in 100mg/100µL distilled water) and Mueller-Hinton broth medium of which cation was
arranged including NMP (in 100mg/100µL dimethyl sulphoxide) was prepared.Benzalkonium Chloride <0.5> 128
mg / ml and chlorhexidine <1 -> 256 mg / ml concentration were prepared.
Determination of the Pumping System Gene Regions
DNA extraction from the bacteria was made in conformity of DNeasy Tissue (Qiagen, Valencia, CA, USA) kits and
their protocols. In the controls of amount and purity of genomic DNA isolation, NanoDrop Spektrofotometre (ND
1000) was used.
145
Scholars Research Library
Shohreh Afshar Yavari et al
Annals of Biological Research, 2013, 4 (6):144-150
_____________________________________________________________________________
Reproduction of AdeB, AdeJ and QacE Gene Regions
AdeB, AdeJ and QacE regions were reproduced with appropriate primers by making PCR in conformity with
Pyrosequence (PyroMark Q24). Therefore, Pyromax PCR kit of Qiagen was used and each gene region was
multiplied in accordance with the protocol. Primers are designed with Pyromark Assay Design Software 2.0’
program of Qiagen.
ADEB:TCATGACTCAGTCAGCTACATCAGATGCACTGACATGAGCGTACTCGATCGTAGTGCATG
ADEJ:ACGACTAGTAGAGCACTCACTACAGCGATAGAGTCACGCAGAGAGATGCTAGCATGCGCT
QACE:CGATCGATGTGAGACGTCAGAGACTATATAGCACTGCATAGCACACTGTATGATAGATCG
Table 1: Distribution of Benzalkonium Chloride and chlorhexidine MIC values of Acinetobacter strains in the existence and lack of
pumping inhibitors NMP and PaβN
Antimicrobial agent
Benzalkonium Chloride
Benzalkonium Chloride+NMP
Benzalkonium Chloride+ PAβN
Chlorhexidine
Chlorhexidine+NMP
Chlorhexidine+ PAβN
MIC (µg/ml)
128
64
32
16
8
Number of strains
1
8
21
2
%
(%3.1)
(%25)
(%65.6)
(%6.25)
128
64
32
16
8
4
2
4
11
16
1
(%12.5)
(%34.3)
(%50)
(%3.1)
128
64
32
16
8
4
2
128
64
32
16
8
4
2
7
14
11
2
11
17
2
-
(%21.9)
(%43.7)
(%34.3)
(%6.25)
(%34.3)
(%53.1)
(%6.25)
-
128
64
32
16
8
4
2
1
8
8
10
4
1
(%3.1)
(%25)
(%25)
(%31.2)
(%12.5)
(%3.1)
128
64
32
16
8
4
2
3
8
12
7
2
-
(%9.3)
(%25)
(%37.5)
(%21.8)
(%6.2)
-
146
Scholars Research Library
Shohreh Afshar Yavari et al
Annals of Biological Research, 2013, 4 (6):144-150
_____________________________________________________________________________
RESULTS
In this study, 32 Acinetobacter strains having multiple drug resistance isolated from clinical samples were selected.
The average age of patients were 60.72 (15-86) years in adults and 2.84 years (1-14) in children. 48 % of these
patients were male and 52 % female.
Table 2 : How many times decrease that pumping inhibitors cause in chlorhexidine and Benzalkonium Chloride MICs
Biocide+ pumping inhibitor
Chlorhexidine + NMP
Chlorhexidine + PAβN
Benzalkonium Chloride+ NMP
Benzalkonium Chloride+ PAβN
number of Isolate
4
7
15
5
1
6
13
10
3
4
6
18
4
3
15
12
2
(%)
12.5
21.8
46.8
15.6
3.1
18.9
40.6
31.2
9.3
12.5
18.7
56.2
12.5
9.3
46.8
37.5
6.25
How many times of decrease it causes
0
2
4
8
16
0
2
4
8
0
2
4
8
0
2
4
8
Chlorhexidine and Benzalkonium Chloride MIC Values in the Existence and Lack of Pumping Inhibitors
NMP and PAβN
In this study, chlorhexidine and Benzalkonium Chloride MIC values of 32 A.baumanii clinical isolates were tested
in the existence and lack of NMP and PAβN. 28( %87.5 ) of isolates were shown sensitive phenotype of resistance
against chlorhexidine and Benzalkonium Chloride in the presence of NMP active pump inhibitors .
In the same study, a phenotype with sensitive resistance against chlorhexidine in the existence of PAβN which were
active pumping inhibitors in 26 (82%) of isolates and Benzalkonium Chloride in 29 (90.7%) were seen. Therefore,
MIC values of isolates against biocides decrease in the existence of pumping inhibitors. No effect on chlorhexidine
and Benzalkonium Chloride MICs in 12.5 % of isolates (n:4) in the existence of pumping inhibitors NMP and no
effect on chlorhexidine MICs in 18 % (n:6), Benzalkonium Chloride MICs in 9.3 % (n:3) of isolates in the
existence of pumping inhibitor PAβN were noticed .
In chlorhexidine MICs of these isolates in the existence of NMP 2 - 16 times, in the existence of PAβN 2 - 8 times
decrease were seen .In Benzalkonium Chloride MICs of these isolates in the existence of NMP and PAβN 2 - 8
times of decrease were seen. Chlorhexidine and Benzalkonium MIC values are indicated in the existence and lack of
NMP and PAβN in Table 1 and 2.
In our study we investigated AdeB and AdeJ genes of Acinetobacter baumanii which were indicating multiple
medicine resistance with the method of Pyrosequence and determined the positivity of these genes as 100 %.
Moreover, no mutation was observed in these genes.
DISCUSSION
It is known that Acinetobacter baumaniis which can be the factor of hospital infections can have resistance against
several antibiotics and disinfectants. In the foundation of this situation, selection and mutation have a great role [12].
In a study, MIC (minimal inhibitor concentration) values of quaternary ammonium compounds were found high in
Pseudomonas, Klebsiella and Acinetobacter [13]. In another study, MIC values of MRSA strain for Benzalkonium
Chloride and chlorhexidine were found between 2 and 8 µg/ml [14 ].
147
Scholars Research Library
Shohreh Afshar Yavari et al
Annals of Biological Research, 2013, 4 (6):144-150
_____________________________________________________________________________
Benzalkonium Chloride MIC values of Ozturk S.aureus, E.coli and P.aeuroginosa bacteria were found 0.5, 32, 250
µg/ml and chlorhexidine MIC values were found 0.5-1, 1,5-60 µg/ml respectively. It has shown that MIC values for
several biocides of S.aureus were lower than E. coli and P. aeruginosa for 10-500 times [15 ].
In the study of Govindan Rajamohan et. al in 2010, they determined that Benzalkonium Chloride MIC values of
Acinetobacters were between 15-120 µg/ml and chlorhexidine MIC values were between 16-100 µg/ml [ 16 ] . In
our study, MIC values of A.baumanii strainds for Benzalkonium Chloride were between 8-64µg/ml and MIC values
for chlorhexidine were between 16-128µg/ml. therefore, MIC values were found close to each other.
The sensitivity of microorganisms against disinfectants changes according to their structural properties, periodical
controls of this activity should be made by considering that the resistance can change by time [ 17]. Even if there
are publications defining that increased MIC values due to several disinfectants do not make any change in
bactericidal effect and therefore it is not very important, on the other hand there are publications mentioning that
disinfectant resistance causes selection of strains resistant to antibiotics, there is genetic matter exchange including
genes resistant to antibiotics and disinfectants among bacteria. [12] Furthermore, Russell considers that disinfectant
resistance can cause the emergence of antibiotic resistance with of co-resistance, cross-resistance or co-selection
[19].
In recent years, the number of the studies which assert that active pumping systems have an active role in the
medicine resistance of A. baumanii increase gradually. Some new studies remark that AdeABC, AdeIJK pumping
systems, which are members of RND protein families have an active role in the multiple medicine resistance of A.
baumanii [19,20] . These pumps have a wide substrate profile as similar ones and can pump several antibiotics, toxic
compounds, paints from several classes out of the cell. The main transport protein of AdeABC and AdeJIK pumping
system with three components is AdeB and AdeJ [ 19 ]. The expression of these proteins in structural level has an
important contribution of the natural resistance of bacteria and the expression in high level causes the emergence of
multiple medicine resistance and disinfectant resistance which constitute problem in clinic. The expression level of
AdeB and AdeJ is arranged in complex mechanisms and the existence of anti-microbial medicine or toxic compound
increases the expression level [ 10, 21 ].
Pumping levels in bacteria can be induced with the usage of any of the medicines having substrates and cause the
development of a resistance against whole substrates. Specific pumping inhibitors repress the activities of pumps.
Therefore, the main approach to overcome the bacterial resistance and increase the activities of disinfectants is to
use resistance inhibitors. In this approach, antibiotics or disinfectants are used with an inhibitor which neutralizes
the resistance [22,23] . In recent years, attention on research and development of the pumping system pump
inhibitors in order to prevent the resistance depending on pumping system pump. It is shown that PAβN which is
RND type pumping system inhibitor, inhibits MexAB-OprM, MexCD-OprJ and MexEF-OprN pumping system
pumps of P. aeruginosa with AcrAB pumping system pump of E. Coli [24]. It is asserted that another new
compound decreased anti-microbial MICs in 1-(1-naphythylmethyl)-piperazine (NMP), in A. baumanii by inhibiting
AdeABC pump [25].
In our study, chlorhexidine and Benzalkonium Chloride MIC values of 32 A.baumanii clinical isolates were tested in
the existence and lack of NMP and PAβN (25 mg/L). An average decrease of 4,06 % (0-16 times) of MIC values in
the NMP existence of clinical isolates and an average decrease of 2,81 % (0-8 times) in the existence of PAβN were
determined. In Benzalkonium Chloride MIC values of these isolates in the existence of NMP, a decrease 3,62 % (08 times) and in the existence of PAβN, a decrease of 2,93 % (0-8 times) were determined. The results were found
compatible with the previous study[15 ] and it is thought that the existence of other pumping proteins in the
existence of the strains having no decrease in their own MICs can be found.
In 2010, Rajamohan et.al revealed that CCCP and PAβN pumping system inhibitors caused 5 times of decrease in
chlorhexidine MICs and 3 times of decrease in Benzalkonium Chloride MICs in the group II and III Acinetobacter
strains in which AdeB, AdeJ and QacE pumping system genes exist [16].
In our study, when 32 resistant A. baumannii clinical isolates were tested in 25 mg/L PAβN concentration,
chlorhexidine MICs caused 8 times of decrease in 9.3 % of the strains, 4 times of decrease in 31.2 % and 2 times of
decrease in 40.6% and in 18.9% no decrease was seen. It is determined that Benzalkonium Chloride MICS caused 8
148
Scholars Research Library
Shohreh Afshar Yavari et al
Annals of Biological Research, 2013, 4 (6):144-150
_____________________________________________________________________________
times of decrease in 6.25% of the strains, 4 times of decrease in 37.5%, 2 times of decrease in 46.8% and no
decrease was seen in 9.3%.
In our study, when 32 resistant A. baumannii clinical isolates were tested in 25 mg/L NMP concentration,
chlorhexidine MICs caused 16 times of decrease in 3.1% of the strains, 8 times of decrease in 15.6%, 4 times of
decrease in 46.8%, 2 times of decrease in 21.8% and no decrease was seen in 12.5%. It was determined that
Benzalkonium Chloride MICS caused 8 times of decrease in 12.5% of the strains, 4 times of decrease in 56.2%, 2
times of decrease in 18.7% and no decreased was seen in 12.5% . These findings preoccupy that pumping system
pumps are related with high MICs in biocides. Pharmacological inhibition of MDR pumping system pumps can be
an attractive purpose in order to reverse the disinfectant resistance in Acinetobacter species.
It is thought that, the resistance which does not have any decrease in its MICs, can be related with the resistance
mechanisms except pumping system. Govindan Rajamohan et.al examined AdeB, AdeJ and QacE pumping system
genes with RT-PCR method in Acinetobacter strains and stated that the expressions of these genes as 55.8%, 100%
and 40.6% respectively. They asserted that these genes have an effect on the increase of biocide MIC values in
Acinetobacters [16].
In our study, these genes were investigated with pyrosequence method. Pyrosequence Real Time is a technology
with sequence base. Actually it is an easy and safe method. It does not require separation, gel, label or probe.
Pyrosequencing is technique of real-time quantitative sequence analysis based on the determination pyrophosphates
come our during DNA synthesis [26].The results can be converted into Excel and/or Text format by the software
easily. Pyrogram graphics can be saved and printed one by one or in groups easily. With the method of
pyrosequencing, the determination of 3 gene regions in Acinetobacter strains and whether there is mutation in these
genes or not were presented in a very short time like 2 days. This time is very short in comparison with DNA
analysis. This situation provides application easiness in routine laboratories. Moreover, the test unit price of
Pyrosequencing is close to test unit prices of DNA analysis methods and cheaper than test hybridization tests [26].
In our study, chlorhexidine MIC values in 48% of Acinetobacter baumannis that we determined AdeB, AdeJ, QacE
gene existence with Pyrosequencing method were found above 64 µg/ml and above and benzalkonium chloride
MIC values were found 32 µg/ml and above in 28%. Because the whole bacteria is isolated in ICU and indicates
multiple resistance, it is not a surprise that these genes are found in whole strains and MIC values are high.
CONCLUSION
Depending on these results, it is thought that RND type active pumps have a positive contribution in the disinfectant
resistance of A.baumannii isolates. Therefore, it is necessary to determine transcription levels of these genes with
other methods in order to get a certain result.
Acknowledgement
This thesis supported by Gazi University Scientific Research Projects Unit and project number is 11/2003-1.
REFERENCES
[1] B Ozdem, F Gurelik, N Celikbilek, H Balıkcı, ZC Acıkgoz, Mikrobiyol Bül, 2011, 45(3), 526-534.
[2] SM El-Ageery , Ma Abo-Shadi , AA Alghaithy , MA Ahmad , NH Alsharif , SA Alharbi, Euro Rev Med
Pharmacol Sci, 2012,16(13),1834-1839.
[3] B Swain, S Otta, Scholars Research Library, Annals of Biological Research, 2012, 3(4),1923-1928.
[4] K Poole, J Antimicrob Chemother, 2005, 56(1), 20-51.
[5] T Schneiders, J Findlay, S Amyes, Acinetobacter Biology and Pathogenesis, Infectious Agents and Pathogenesis,
2008, 105-127.
[6] I Marchand, L Damier-Piolle, P Courvalin ,T Lambert , Antimicrob Agents Chemother, 2004, 48, 3298-3304.
[7] M Bischoff, J Bauer, P Preikschat, K Schwaiger, M Mölle, C Hölzel, Microbial Drug Resistance, 2012, 18(1), 712.
[8] R Chuanchuen, S Khemtong, P Padungtod, Southeast Asian J Trop Med Health, 2007, 38 (5), 855-862.
[9] Z Jaglic, D Cervinkova, Veterinarni Medicina, 2012, 57(6), 275–281.
[10] S Pannek,PG Higgins,P Steinke,D Jonas,M Akova ,JA Bohnert,H Seifert, WVKer, J Antimicrob Chemother,
2006, 57, 970-974.
149
Scholars Research Library
Shohreh Afshar Yavari et al
Annals of Biological Research, 2013, 4 (6):144-150
_____________________________________________________________________________
[11] Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for
Bacteria That Grow Aerobically—Seventh Edition: Approved Standard M7-A7. CLSI, Wayne, PA, USA, 2006.
[12]AY Peleg, H Seifert, DL Paterson, Clin. Microbiol. Rev, 2008, 21, 538–582.
[13] EM Walker, JA Lowes, J Hosp Infect ,1985, 6, 389-97.
[14]B Aykan, K Çaglar, ED Engin, AB Sipahi, N Sultan, MY Çirak, Mikrobiyol Bul, 2013, 47(1), 1-10.
[15] R Öztürk, Sterilizasyon Dezenfeksiyon ve Hastane İnfeksiyonları, İstanbul, Kaya Basım, 2002, 43-62.
[16] G Rajamohan, VB Srinivasan ,WA Gebreyes, J Antimicrob Chemother, 2010, 65, 228–232.
[17] AW Rutala, DJ Weber, Disinfection, Sterilization, and Control of Hospital Waste. Principles and Practice of
Infectious Diseases. 6. Ed. Philadelphia, Elsevier, 2005,3331-3347.
[18] AD Russell, TE Suller, JY Maillard, J Med Microbial, 1999, 48, 613-615.
[19]P Wieczorek, P Sacha, T Hauschild, M Zórawski, Krawczyk M, E Tryniszewska, Folia Histochemica Ed.
Cytobiologica, 2008, 46 (3), 257-267.
[20] L Damier-Piolle,S Magnet,S Bremont ,T Lambert ,P Courvalin, Antimicrob Agents Chemother, 2008, 52, 557562.
[21] T Dal ,B Aksu ,JM Pages,U Over Hasdemir, Journal of antimicrobial Chemotherapy,2013, 22,1-3.
[22] GD Wright, Chem Biol, 2000, 7, 127-132.
[23] LA Miller, K Ratman, DJ Payne, Curr Opin Pharmacol, 2001, 1, 451-458.
[24] O Lomovskaya, MS Warren, A Lee, Antimicrob Agents Chemother, 2001, 45,105-16.
[25] VK Winfried,P Steinke, A Schumacher, S Schuster and et al, J Antimicrob Chemother, 2006, 57, 339–343.
[26] S Rota, Pyrosequencing (Pyrosekanslama) ve prensipleri. Klinik Mikrobiyolojide Pyrosekans Uygulama Kursu
Kitabı, Ankara, 2010,79–90.
150
Scholars Research Library