Research Article
543
Integrin-mediated functional polarization of Caco-2
cells through E-cadherin–actin complexes
Cyrille Schreider, Gregory Peignon, Sophie Thenet, Jean Chambaz and Martine Pinçon-Raymond*
INSERM U505, Université Pierre et Marie Curie, EPHE, 15 rue de l’Ecole de Médecine, 75006 Paris, France
Author for correspondence (e-mail: pincon@ccr.jussieu.fr)
Accepted 25 October 2001
Journal of Cell Science 115, 543-552 (2002) © The Company of Biologists Ltd
Summary
Enterocyte differentiation is a dynamic process during
which reinforcement of cell-cell adhesion favours migration
along the crypt-to-villus axis. Functional polarization of
Caco-2 cells, the most commonly used model to study
intestinal differentiation, is assessed by dome formation
and tightness of the monolayer and is under the control
of the extracellular matrix (ECM). Furthermore, our
biochemical and confocal microscopy data demonstrate
that the ECM dramatically reinforces E-cadherin targeting
to the upper lateral membrane, formation of the apical
actin cytoskeleton and its colocalization with E-cadherin in
functional complexes. In our model, these effects were
produced by native laminin-5-enriched ECM as well as by
type IV collagen or laminin 2, which suggests a common
pathway of induction through integrin receptors. Indeed,
these effects were antagonized by blocking anti-β1- and
anti-α6-integrin antibodies and directly induced by a
stimulating anti-β1-integrin antibody. These results
demonstrate that integrin-dependent cell to ECM adhesion
reinforces E-cadherin-dependent cell-cell adhesion in
Caco-2 cells and further support the notion that enterocyte
differentiation is supported by a molecular crosstalk
between the two adhesion systems of the cell.
Introduction
The epithelium forms a barrier made of polarized cells joined
by a complex set of cell-cell junctions. The assembly of
adherens junctions through the interaction of E-cadherin of
adjacent cells initiates this process (Gumbiner, 1996; Kemler,
1992). The importance of cell-cell adhesion in differentiation
and in the maintenance of the differentiated phenotype is well
established in epithelial cells (Braga et al., 1999). In addition,
epithelial cells are separated from the underlying connective
tissue by a basement membrane that is composed of a variety
of extracellular matrix (ECM) molecules that control cell
differentiation in many tissues through interactions with their
cellular receptors, for example, with integrins (Boudreau and
Bissell, 1998).
The basement membrane is mostly composed of type IV
collagen, different types of laminins, entactin and heparan
sulfate proteoglycan (Beaulieu, 1997). ECM molecules,
originating from both epithelial and underlying mesenchymal
cells, create a framework that is essential for maintaining tissue
integrity (Simon-Assmann and Kedinger, 1993). Besides this
structural role, ECM proteins are involved in the control of
adhesion, migration, proliferation, differentiation and gene
expression of adjacent cells, which emphasizes the dynamic
reciprocity between epithelial and mesenchymal cells (Bissell
et al., 1982). Additionally, ECM is able to control the effects
of trophic factors by sequestration outside of the cell (SimonAssmann et al., 1998) and by crosstalk between their signaling
pathways (Yamada and Geiger, 1997). It is admitted that cell
adhesion to the ECM contributes to the apical-to-basal axis of
polarity, in vivo as well as in vitro. Appearance of polarized
cells coincides with the expression of laminin 1 (LN1) in the
developing kidney (Klein et al., 1990). Similarly, the addition
of laminin boosts the formation of polarized alveoles in various
types of epithelial cells, including mouse mammary (Li et al.,
1987), human salivary (Hoffman et al., 1996) and rat lung
(Matter and Laurie, 1994) cells in culture. ECM-integrin
interactions have either been demonstrated to be directly
involved in ECM control of cell functions or found to be
aberrant in embryos or animals carrying mutations in integrin
genes (Wang et al., 1999).
Both cell-ECM and cell-cell adhesion systems are connected
to the cytoskeleton, which controls cell polarization. Numerous
studies have established that the interaction between ECM and
integrin results in cytoskeletal rearrangements (Larjava et
al., 1990; Wang et al., 1999). Integrins are heterodimeric
transmembrane receptors composed of α and β subunits
associated in a noncovalent manner (Hynes, 1987; Yamada and
Miyamoto, 1995). Integrin initiates, through its β1 cytoplasmic
domain, the assembly of specialized cytoskeletal and signaling
protein complexes at the contacting membrane (Gimond et
al., 1999). In the same way, epithelial cells forming strong cellcell junctions assemble a subcortical actin skeleton instead of
focal adhesion and actin stress fibers (Larjava et al., 1990).
Cadherins are also dependent on cytoskeletal organization
(Tsukita et al., 1992); correct function of the E-cadherin–
catenin complex requires association with the cytoskeleton
(Skoudy et al., 1996). In epithelial cells, about one half of
plasma membrane E-cadherin is connected to the actin
cytokeleton: the rest is free within the membrane (Sako et al.,
1998). The linkage between E-cadherin and the F-actin
cytoskeleton is mediated through direct binding of the
cytoplasmic domain of E-cadherin to β-catenin, which binds
Key words: Caco-2 cells, β1 integrin, E-cadherin, Extracellular
matrix, Actin cytoskeleton
544
Journal of Cell Science 115 (3)
to α-catenin (Aberle et al., 1994; Jou et al., 1995) in a 1:1:1
stochiometry. Crosstalk between the two adhesion systems has
also been demonstrated in mammary epithelial cells through
the integrin signaling pathway. In these cells, integrins promote
the formation of morphologically differentiated acini-like
structures, which involves the assembly of adherens junctions
through the relocalization of E-cadherin at the lateral side of
the cells (Weaver et al., 1997).
The mammalian intestinal epithelium is peculiar in that it is
a constantly renewing monocellular epithelium, which
migrates ‘en cohorte’ along the basement membrane from the
proliferative undifferentiated compartment in the crypts to the
tips of the villi. Enterocytes can probably glide over the
basement membrane through loose adhesion, through them
being tied to each other by strong cell-cell junctions. Whereas
type IV collagen is constantly present in the basement
membrane, LN2 is preferentially found in the proliferative
compartment, LN5 in the villus and LN1 at the junction of the
two compartments (Vachon et al., 1993; Lorentz et al., 1997).
Similarly, villus and crypt epithelial cells display a different
pattern of integrins, β1-containing integrins being more
abundant in the villi than in the crypts. Furthermore, β1 is
mainly associated with α2 in the crypt and with α3 integrins
in the villus (Beaulieu, 1992). Whereas α2β1 integrin
preferentially binds to collagen IV but also to LN1 and LN2,
α3β1 integrin binds to both collagen IV and LN5 (Beaulieu,
1999; Rousselle and Garrone, 1998). Integrin α6β4 binds to
both LN1 and LN5 (Fleischmajer et al., 1998). This differential
pattern of expression of ECM proteins and their receptors
along the crypt-to-villus axis parallels the differentiation
process of epithelial cells. One can wonder whether changes in
ECM-integrin interactions at the crypt to villus junction are
accompanied by changes in cell-cell adhesion, which allow cell
migration to the tip of the villus.
The colon cancer Caco-2 cell line in culture mimics
enterocyte differentiation. We previously showed that ECM was
required for the expression of the apoA-IV gene, an intestinal
differentiation marker (Le Beyec et al., 1997). Here, we observed
that the functional polarization of Caco-2 cells, assessed by
dome formation and permeability of the monolayer, is under the
control of integrin-mediated adhesion to ECM. Furthermore, we
demonstrate that integrin activation by ECM reinforces cell-cell
adhesion by targeting E-cadherin at the lateral membrane in
functional complexes with actin cytoskeleton.
Materials and Methods
Antibodies and products
Antibodies used included monoclonal anti-β1 (6S6) and anti-α6
(NKI-GoH3) human integrins with a blocking activity and anti-β1integrin (B3B11) with a stimulating activity and purified control
mouse anti-IgG (Chemicon); polyclonal anti-human E-cadherin
(HECD-1) (Zymed); monoclonal anti-β-catenin (clone 14)
(Transduction Laboratories); FITC-labeled antibodies (Sigma) and
RITC-labeled antibodies (Boehringer). TRITC- or FITC-labeled
phalloidin (Sigma) was used to visualize the actin cytoskeleton. We
also used human merosin LN2 (Gibco) and mouse collagen type IV
and synthetic poly-D-lysine (Becton-Dickinson).
Cell culture
Caco-2 cells (43rd to 50th passage) and HT29 cells adapted to 10–5 M
of methotrexate (Lesuffleur et al., 1990) and cultured without the drug
and named HT29-MTX (9th passage) were cultured at 37°C with 10%
CO2 in Dulbecco’s minimal essential medium (DMEM), 25 mM
glucose (Gibco), pen/strept (50 µg/ml) and non-essential amino acid
(1%) (Gibco) supplemented with 5% foetal calf serum (Boehringer).
Mesenchymal intestinal cells C9, C11, C20 obtained from M.
Kedinger (Fritsch et al., 1999) (28th, 29th and 14th passages,
respectively) were cultured at 37°C with 7.5% CO2 in RPMI 1640
medium, pen/strept (50 µg/ml) (Gibco), supplemented with 10%
foetal calf serum (Boehringer). Muscle 129CB3 cells were cultured
as described (Pinçon-Raymond et al., 1991) to form contracting
myotubes and secrete a large amount of ECM.
Extracellular matrix preparation and coating
Native ECM was prepared from 129CB3 myotubes, mesenchymal
C9, C11, C20 cells (at confluence), HT29-MTX cells (3 days postconfluence) or Caco-2 cells (12d post-confluence) as described
previously (Le Beyec et al., 1997). Coating of plastic petri dishes
was performed by overnight incubation with poly-D-lysine, 5
µg/cm2, collagen type IV, 10 µg/cm2 and merosin LN2, 8.4 µg/cm2
at 4°C.
Perturbation experiments
Caco-2 cells were seeded at 125,000 cells/cm2 (pre-confluence) in
24-well plates coated or not with native ECM or ECM components.
At the time of plating, cells were mixed with control mouse IgG or
anti-β1-integrin monoclonal blocking antibody (6S6) or anti-α6integrin used to block β4 integrin (CD49F) or anti-E-cadherin
monoclonal blocking antibody (HECD-1) at the indicated dilutions.
Under these conditions, control cells were confluent within 24 hours.
For each kinetics experiment, triplicate wells were observed using
a phase contrast microscope. Confluence was evaluated, and
counting triplicate wells on a phase contrast microscope numerated
the domes.
Ribonuclease protection assay
A specific 400 bp cDNA encoding the human apoA-IV gene was
obtained by RT-PCR using the coding oligonucleotide HindIIIAIV (5′-CTGGAGAAGCTT+149ACACTTACGCAGGTGACCTGCAG+171-3′) and the noncoding oligonucleotide Xba-AIV (5′-CTGCAGTCTAGA+550AGGGCGTAAGGCGTCCCTTGA+530-3′). The
PCR product was digested using XbaI and HindIII, and ligated into
the XbaI/HindIII-digested PSK vector to obtain the pAIV-RPA
plasmid. For E-cadherin mRNA analysis, a specific 407 bp cDNA
encoding the human E-cadherin gene was obtained using the
coding oligonucleotide (5′-+2660GACCAGGACTATGACTACTTGAACG+2684-3′) and the noncoding oligonucleotide (5′-+3067ATCTGCAAGGTGCTGGGTGAACCTT+3043-3′) inserted into PCR 2.1
vector. An antisense AIV RNA probe (445 bp) was generated by in
vitro transcription of the HindIII-digested pAIV-RPA plasmid using
[α-32P]UTP and T3 RNA polymerase (Promega). An antisense
E-cadherin RNA probe (523 bp) was generated by in vitro
transcription of the Kpn1-digested E-cadherin-PCR2.1 plasmid
using [α-32P]UTP and T7 RNA polymerase (Promega). An antisense
β-actin RNA probe (Human Internal Standards kit, Ambion Inc.)
was synthesized with T3 as an internal control. Total RNA was
extracted from cells using an RNAzol kit (Bioprobe Systems). Equal
amounts (6 µg) of total RNA samples were subjected to the RNase
protection assay using the RPAII kit (Ambion Inc) following the
manufacturer’s recommendations. The protected A-IV RNA (400
bp), E-cadherin RNA (407 bp) and β-actin RNA (245 bp) probes
were separated on a 5% denaturing polyacrylamide-urea gel in Tris
borate-EDTA buffer. The gel was dried and exposed to X-ray film
at –80°C.
Integrin-induced E-cadherin–actin complexes
545
Table 1. ECM components produced by mesenchymal and
epithelial cells used in this study
LN1
(α1β1γ1)
LN2
(α2β1γ1)
LN5
(α3β3γ2)
LN10
(α5β1γ1)
Col IV
C9
no α1 [1]a
α2 + [1]a
γ2 + [1]a
α5 ++ [2]a
+ [1]c
C11
no α1
α2 +
γ2 +
α5 ++
[2]a
+ [1]c
C20
no α1 [1]a
γ2 + [1]a
α5 ++ [2]a
+ [1]c
129CB3*
α1 +
α3 –
α5 +
[7]c
+ [6]c
[2]a,d
nd
[1]a
[7,8]a
[1]a
α2 + [1]a
α2 +
[7,8]c
HT29MTX
no α1
no protein [2]d
Caco-2
α1 RNA +a α2 + [2]a
no protein [5]b
RNAa
nd
[1]a
[7]c
α3 ++ [3]b,d
β3 ++ [3]d
γ2 ++ [3]b,d
α3 – [3]b
β3 – [3]d
γ2 + [3]b,d
α5 +
α5 + [2]a,b α5 + [9]c
[5]d
The nature of ECM components produced by mesenchymal (C9; C11;
C20) or epithelial cells from intestine (HT29-MTX; Caco-2) was determined
by RT-PCR (a), Western blot (b), IF (c), or IP (d) by (Fritsch et al., 1999) [1],
Simon-Assmann et al. (personal communication) [2], (Orian-Rousseau et al.,
1998) [3], (De Arcangelis et al., 1996) [4], (Velling et al., 1999) [5]. *The
composition of the native ECM secreted and deposited by mesenchymal
muscle cells (129CB3) is deduced from studies on similar cell lines (G8;
C2C12) from mouse skeletal muscle by (Rao et al., 1985) [6], (Patton et al.,
1997) [7], (Vachon et al., 1996) [8] (Beaulieu, 1997) [9]. nd=not determined.
Cell surface biotinylation
Caco-2 cells were seeded on plastic coated or uncoated dishes with
native ECM or ECM components and grown for 6 days. All
manipulations were performed at 4°C according to Sander et al.
(Sander et al., 1998). Briefly, cells were incubated for 15 minutes in
phosphate-buffered saline (supplemented with 1 mM MgCl2 and 0.5
mM CaCl2) containing 500 µg/ml sulfo-NHS-biotin (Pierce Chemical
Co.), washed three times in phosphate-buffered saline containing 50
mM glycine, pH 7.4, lysed in RIPA buffer (50 mM Tris-HCl, pH 7.5,
150 mM NaCl, 1% Nonidet P40, 0.5% sodium deoxycholate, 0.1%
SDS, protease inhibitors, 10% glycerol, 1 mM EDTA, 3 mM MgCl2,
1 mM dithiothreitol) and centrifuged for 15 minutes at 13,000 g. The
supernatant was incubated with avidin-coated agarose beads (Sigma
Chemical Co.) for 1 hour. Immunoprecipitates of biotinylated surface
proteins bound to avidin-agarose were washed five times in RIPA
buffer and analysed for E-cadherin (HECD-1) by western blotting.
Western blotting
The protein concentration of Caco-2 lysates, biotinylated or not, was
assessed by the Biorad ‘Dc’ protein assay. A 20 µg aliquot of each
sample mixed with Laëmmli buffer was boiled and submitted to 7%
SDS polyacrylamide gel electrophoresis. Samples were then
transferred onto nitrocellulose and blocked in 1% non-fat milk
overnight at 4°C. After a 2 hour incubation with the primary antibody
in the blocking solution at room temperature, blots were washed in
PBS 1× pH 7.4, incubated with appropriate HRP-conjugated
secondary antibody and washed again. The blots were visualized by
chemiluminescence (Amersham ECL system). Signals were scanned
(Umax vistaScan S6E) from chemiluminescence into Adobe
Photoshop.
Immunofluorescence studies
Caco-2 cells were grown on Lab-Tek chambered borosilicate
coverglasses (Nunc), coated or not with native ECM or ECM
components. At the indicated time, cells were fixed in 4%
paraformaldhehyde in phosphate-buffer saline, then permeabilised in
0.1% Triton X-100 during all incubations. Non-specific antigens were
blocked for 30 minutes in 3% bovine serum albumin. Double labeling
Fig. 1. Native ECM differentially increases expression of the
differentiation marker apoA-IV in Caco-2 cells. The Caco-2 cells
were grown until confluence on plastic or on different native ECM
previously secreted and deposited by mesenchymal cells from the
intestine (C9; C11; C20) or the muscle (129CB3), or by colon
tumour epithelial cells (HT29-MTX; Caco-2 at 12 day post
confluence). Composition of these ECMs is described in Table 1.
Total RNA was isolated, and the abundance of apoA-IV transcripts
was assayed by RNAse Protection Assay, using β actin mRNA as an
internal control. The mRNA ratio of apoA-IV:β actin (mean±s.e.m.
of three independent cultures performed in triplicate) is expressed as
a percentage of the value obtained from Caco-2 on plastic. * and **
differ from the control at P<0.05 and P<0.01 (t-test), respectively.
Note that LN5-rich ECM deposited from HT29 MTX cells is the
most effective ECM to induce apoA-IV expression in Caco-2 cells.
was performed sequentially to avoid crossreactions. Anti-β1-integrin
(6S6) primary antibodies diluted in the blocking solution were
incubated for 1 hour 30 minutes, followed by a 1 hour 30 minute
incubation with RITC-labeled secondary antibodies, followed by
overnight incubation at 4°C with an anti-E-cadherin antibody (HECD1). These antibodies were visualized with FITC-labeled secondary
antibodies after a 1 hour 30 minute incubation. Images were acquired
with a Zeiss LSM-510 laser-scanning confocal microscope (Carl
Zeiss, Oberkochen, Germany) equiped with Zeiss Axiovert 100M
(plan Apochromat 63×1.40 NA oil immersion objective). The contrast
and brightness settings were constant during the course of image
acquisition. The E-cadherin/actin colocalization visualized by
confocal analysis was quantified using a program from Zeiss LSM
510 confocal. The data were recorded from cells in the upper half of
the cell in six random fields from three independent experiments.
Results
Native ECM induces the expression of a differentiation
marker gene and cell polarity
Of the criteria for epithelial cell differentiation, modifications
in cell shape (polarization) and gene expression are those most
often reported. We have previously reported that the expression
of a differentiation marker gene of enterocytes, apolipoprotein
A-IV (apoA-IV), was induced in human colon carcinoma Caco2 cells when they were grown on filters coated with a native
extracellular matrix (ECM) (Le Beyec et al., 1997). To
determine whether this effect was due either to ECM-cell
adhesion or to cell polarization, which would be induced
independently by culturing cells on a filter, we grew Caco-2
cells on native ECM deposited on a plastic support. Fig. 1
clearly shows that ECM is able to induce apoA-IV expression
546
Journal of Cell Science 115 (3)
Fig. 2. Native LN5-rich ECM reinforces cell-cell interactions
between Caco-2 cells. Caco-2 cells were plated at 20,000 cells/cm2
on plastic (䊐) or on native LN5-rich ECM (䊏) deposited by HT29MTX cells. (A) Phase contrast micrography (X 25; bar, 200 µm)
shows that domes appear on cultures grown on ECM 2 days earlier
than on plastic support. (B) shows the confluence rates observed by
phase microscopy. (C) At the indicated times, domes were counted.
Values represent mean ±s.m.d. from triplicate wells from three
independent cultures. (D) shows a 3D confocal reconstruction of the
diffusion of FITC-conjugated biotin added at the apical side of Caco2 cultures grown on plastic (a) or on LN5-rich ECM (b). (bar, 10
µm). Note that the presence of ECM restricts biotin diffusion at the
apical compartment, which indicates a reinforcement of cell-cell
interactions as compared to cultures grown on plastic without ECM.
The result is representative of three independent experiments.
independently of the polarization effect of the filter.
Furthermore, the level of induction varies according to the
origin of the different ECM tested. Table 1 summarizes
available data on the production of ECM components by the
Fig. 3. Native LN5-rich ECM induces E-cadherin targeting to the
lateral membrane. Caco-2 cells were plated at 20,000 cells/cm2 on
glass or on native LN5-rich-ECM deposited by HT29-MTX cells,
and RNA and proteins were prepared for further analysis.
(A) RNase Protection Assay of apoA-IV and E-cadherin mRNA,
using β actin mRNA as a control. The ratio of apoA-IV or Ecadherin to β actin mRNA on LN5-rich ECM was compared to that
measured in Caco-2 cells grown on glass and expressed as a
percentage. Note that ECM increases apoA-IV but not E-cadherin
mRNA levels. (B) Western blot analysis of the total amount of
E-cadherin and β-catenin. Note that the total amount of either
E-cadherin or β-catenin proteins does not vary. (C) Western blot
analysis of E-cadherin after immunoprecipipation of biotinylated
membrane-associated proteins. Total E-cadherin (a,c) and
biotinylated E-cadherin (b,d) amounts of E-cadherin in cells grown
on plastic without ECM (a,b) or LN5-rich ECM (c,d). Note the
increase in E-cadherin localized at the cell surface in cultures
grown on ECM. The data are means ±s.e.m. of three independent
cultures performed in triplicate. * differs from the control at
P<0.05.
Integrin-induced E-cadherin–actin complexes
547
Fig. 4. Effect of ECM on cell-cell interactions, E-cadherin and actin
subcellular localization. (A) Caco-2 cells were plated at 20,000
cells/cm2 on glass (a) or on native LN5-rich ECM (b), processed for
immunofluorescence with anti E-cadherin at confluence and analysed
by confocal microscopy. Note that E-cadherin is mostly located at
the cell-cell junction membrane on domes formed by cells grown on
ECM. 3D confocal reconstruction (XZ) shows an E-cadherin signal
at the basal side of the Caco-2 cells grown on glass (c), which
disappears in cells grown on ECM (d) where the localization of Ecadherin aggregation (i.e. 25 µm from the basal side out of a 30 µm
total height) is compatible with the position adherens junction (bar,
10 µm). (B) Caco-2 cells were plated at 50,000 cells/cm2 on glass
(a,a’), polylysine (b,b’), native LN5-rich ECM (c,c’) type IV
collagen (d,d’), or LN2 (e,e’), processed for immunofluorescence
with anti-E-cadherin and FITC (green) and TRITC-conjugated
phalloidin (red) after 72 hours of culture and analysed by confocal
microscopy. Note that ECM increases E-cadherin-actin
colocalization (yellow merge signal) and allows the formation of
cortical actin cytoskeleton (bar, 10 µm). (C) Actin labelling in cells
grown (72 hours) on glass in presence of the β1-integrin-activating
antibody (bar, 10 µm). The results are representative of three
independent experiments.
various mesenchymal and epithelial cell types used to deposit
native ECM on the plastic support. Most of these data were
obtained by measuring mRNA levels by RT-PCR, which is
insufficient to predict the amount of laminin synthesized and
deposed by the cells. Indeed discrepancies between mRNA and
protein measurements were reported for α1 laminin in HT29MTX and Caco-2 cells. Furthermore, C9, C11 and C20
intestinal mesenchymal cells have been reported to express
laminin chain mRNA in the same range. Nevertheless, the
native ECM deposited by C20 cells was much more efficient
in inducing apoA-IV gene expression than that from the other
clones. However, Fig. 1 indicates that the most effective ECM
to induce apoA-IV expression is the native LN5-rich ECM from
HT29 cells adapted to 10–5 M methotrexate.
Observation of Caco-2 cells during these experiments
revealed that cells grown on native LN5-rich ECM formed
domes 2 days earlier than cells grown on the plastic support,
and the ECM-grown domes were larger (Fig. 2A). It is known
that, at confluence, epithelial cells grown on a non-porous
support such as plastic are elevated by the fluid accumulated
under the monolayer and form domes (Pinto et al., 1983).
Comparison, every 2 days for 14 days, of Caco-2 cells grown
on native ECM or on plastic shows that this dramatic increase
in domes formed by Caco-2 cells on native LN5-rich ECM
(Fig. 2C) does not rely on the confluence rate of the cells (Fig.
2B), which is the same under both conditions. The permeability
of the monolayer was further assessed by the use of FITCbiotin, an outside marker to which cells are impermeable. Fig.
2D confirms an overall inductive effect of ECM on the
tightness of cell-cell junctions and functionality of tight
junctions by displaying the ability of FITC-labelled biotin to
penetrate between adjacent cells within the monolayer. Clearly,
this molecule remained apical on the monolayer grown on
ECM substrate (Fig. 2Db) whereas it penetrated much deeper
between cells grown on plastic without ECM (a) or on
polylysine (not shown), an artificial substrate which does not
binds to integrins (Machesky and Hall, 1997). In contrast to
the purpose of the experiment, which was to differentiate
between the effects of ECM and filter-induced cell
polarization, it suggests that functional polarization of Caco-2
cells, as assessed by dome formation and permeability of the
monolayer, is under the control of ECM.
Native ECM triggers E-cadherin accumulation at the
lateral membrane and colocalization with actin
cytoskeleton
The aggregation of E-cadherin molecules at the adherens
junctions is the primary event, which organizes the formation
of the other cell-cell junctions, that is gap, desmosome, and
tight junctions, which ensure the formation of an impermeable
polarized epithelium (Cereijido et al., 2000; Fujimoto et al.,
1997; Jongen et al., 1991; Lampe et al., 1998). We therefore
studied the expression of E-cadherin in our system. We saw
that native LN5-rich ECM induced a threefold increase in
548
Journal of Cell Science 115 (3)
ECM (Fig. 4Ab) compared with cells grown on an inert support
(Fig. 4Aa). In addition, confocal 3D analysis shows that Ecadherin was clearly visible at the base of cells, which form a
flat monolayer on an inert support (Fig. 4Ac), whereas the
signal almost disappeared from the base of cells forming
domes on ECM and concentrated in focal spots in the upper
third of the lateral membrane (Fig. 4Ad). Fig. 4B (c,d,e) shows
that purified ECM components such as type IV collagen and
laminin 2 were as efficient as native ECM in inducing Ecadherin targeting to the lateral membrane of cells that do not
form domes. Since E-cadherin localized to adherens junctions
is intimately associated with actin cytoskeleton in polarized
epithelial cells, we also investigated by confocal analysis the
actin cytoskeleton and its association with E-cadherin. In
addition, culturing cells on ECM components reinforced the
formation of the apical actin cytoskeleton and its colocalization
with E-cadherin at the upper part of the lateral membrane (Fig.
4Bc’,d’,e’), as revealed by the merge yellow signal, as
compared to an inert support (Fig. 4Ba’). Similar observations
were made using a stimulating anti-β1-integrin antibody in
Caco-2 cells grown on an inert support, resulting in the
formation of a cortical network of actin at the apical side of
the cell (Fig. 4C). Altogether, these results favour a role of
native ECM or of its components in the accumulation of Ecadherin at the lateral membrane in functional complexes
anchored to the apical actin cytoskeleton.
Fig. 5. Dome formation is under the control of both E-cadherin and
β1 integrin expressions. Caco-2 cells were plated at 125,000
cells/cm2 on plastic (䊉) or on native LN5-rich ECM (䊏) in the
presence of 10 µg/ml mouse non-specific IgG (䉫), 10 µg/ml (䊊) or
2.5µg/ml (ⵧ) anti-β1-integrin blocking antibody. (A) shows the
appearance of domes as a function of time. Note that anti-β1-integrin
antibody dose dependently decreases the number of domes formed
on ECM substrate as early as 2 days in culture. These perturbations
are not correlated with the confluence rate. (B) shows the confluence
rate of Caco-2 cells. The presence of β1-integrin antibody or plastic
support delays confluence, which is reached 2 days later than in
untreated cells grown on ECM or in the presence of control IgG
antibody.
apoA-IV gene expression. At the same time, the total amount
of E-cadherin protein (Fig. 3B) and mRNA (Fig. 3A) remained
in the same range, as did that of β-catenin protein, a partner of
E-cadherin required for an efficient exit from endoplasmic
reticulum in MDCK cells (Chen et al., 1999). The amount of
E-cadherin associated with the membrane was obtained after
surface biotinylation in the presence of 0.5 mM Ca2+, a
concentration resulting in a slight loosening of tight junctions
but still too high for inducing the disruption of adherens
junctions, which occurs under 0.1 mM Ca2+ (Cereijido et al.
2001; Braga et al., 1997) (Fig. 3C). Similar to the observation
by Sander et al. in MDCK cells expressing Tiam1/Rac (Sander
et al. 1998), Figure 3C shows that the association of E-cadherin
with the membrane was increased fourfold in cells grown on
ECM compared with those grown on plastic without ECM,
although ECM did not influence the total amount of Ecadherin–β-catenin.
The targeting of E-cadherin to the membrane induced by
ECM was further characterized by confocal analysis. The
signal detected by indirect immunofluorescence was stronger
and cell-cell junctions were better delineated in cells grown on
E-cadherin targeting to the lateral membrane involves β1
integrin
ECM components interact at the cell surface with their receptor
integrins, which are mainly α3β1 and α6β4 for LN5, in
differentiated intestinal epithelial cells. In order to see whether
ECM induced modification in integrin distribution in Caco-2
cells, we performed confocal analysis after double labeling
against β1 or β4 integrin and E-cadherin. As expected, we
observed that β1 integrin colocalized with E-cadherin at the
lateral membrane of cells forming domes, mostly when cells
were grown on ECM, a condition in which domes are much
more numerous than in cells grown on an inert support (data
not shown). We also verified that β4 integrin was only found
at the basal membrane of cells forming domes on ECM but not
on an inert support (data not shown).
To further establish the role of ECM on Caco-2 cell
polarization and E-cadherin targeting to the membrane, we
performed perturbation experiments using functional blocking
antibodies against β1 integrin, the β chain of the major integrin
receptor for laminins and type IV collagen. Indeed, dome
formation in cells grown on ECM was drastically impaired by
the anti-β1-integrin blocking antibody, in a dose dependent
manner, and it was reduced to the range observed in cells
grown on plastic support (Fig. 5A). Similarly, upon treatment
with antibodies, cells grown on ECM reached confluence 1 day
later than those not treated, at a time similar to that observed
with cells grown on plastic. The effect of anti-β1 antibody on
dome formation was observed when cells were at confluence
whereas non-specific mouse IgG displayed no effect (Fig. 5B).
Under these conditions, we investigated the effects of antiβ1 or anti-α6 blocking antibodies on E-cadherin accumulation
at the lateral membrane and anchoring to the cortical actin
cytoskeleton. Colocalization of E-cadherin and actin at the
Integrin-induced E-cadherin–actin complexes
apical-lateral side of cells was estimated by computer analysis
of confocal stack series. Pixel count and pixel intensity
measurements gave the same results. Fig. 6A shows that Col
IV and LN2 increased the amount of colocalization of Ecadherin and actin signals up to 30% as compared to cells
grown on plastic. Thus, either ECM component could be used
in the experiments. Confocal 3D reconstruction of cells grown
on Col IV reveals double, cortical and basal rows of actin
cytoskeleton with an important level of E-cadherin and actin
colocalization (Fig. 6Ba). The addition of anti-β1-integrin
blocking antibody resulted in dramatic disorganization of the
cortical row of the actin cytoskeleton and, in parallel, a
reduction in E-cadherin and actin colocalization (Fig. 6Bb).
The blockade of either of the β1 integrins in cells grown
on LN2 (Fig. 6C) or α6β4 integrin in cells grown on native
ECM (Fig. 6D) resulted in a significant reduction in the
colocalization of E-cadherin and actin at the apical lateral side
of Caco-2 cells. Altogether, these results demonstrate that
ECM, by interacting with its receptor integrins, influences the
association of E-cadherin and actin at the level of adherens
junction as functional complexes responsible for Caco-2 cell
polarization.
Discussion
Enterocyte differentiation is a dynamic process that takes place
within a polarized epithelium migrating ‘en cohorte’ from the
proliferative compartment located in the crypt. Proliferative
cells arise by successive asymmetric divisions from stem
cells, which themselves are part of the polarized intestinal
epithelium, the integrity of which is essential for its barrier
function. The localization of stem cells at a fixed position
within the crypt, the gradual loss of stem cell properties in the
upwardly migrating cells and changes in cell adhesion to the
ECM during cell migration toward the villus indicate that the
cell environment may control differentiation through different
attachment properties (Booth and Potten, 2000). The
composition of ECM varies, as does the integrin repertoire
expressed by enterocytes (Potten et al., 1997). At the same
time, E-cadherin is mostly localized at the apical junctional
complexes in the villus, contrary to the crypt (Hermiston et al.,
1996). Altogether, these changes might allow enterocytes to
glide over the basement membrane through a looser type of
adhesion and might reinforce cell-cell junctions to perform the
driving force.
In the present paper, we show in vitro that cell-ECM
adhesion improves cell-cell adhesion through the
reinforcement of E-cadherin–actin complexes at the level of
adherens junctions in Caco-2 cells. This effect is specific for
cell-ECM adhesion as it is antagonized by function-blocking
anti-integrin antibodies.
In vitro, epithelial cells form polarized monolayers at
confluence, even though full differentiation is not reached.
Studying the influence of native ECM on the expression of the
apoA-IV gene, an enterocytic marker, in Caco-2 cells we
observed that the ECM boosted the formation of domes by the
monolayer. Formation of domes by confluent epithelial cells
cultured on a non-porous support signals the formation of an
impermeable monolayer, which rises owing to the fluid
accumulated underneath. This requires the setting of
intercellular tight junctions, the activation of pumps for
549
electrolytes and water and a decrease in adherence to the
substrate. The formation of domes, while occurring
spontaneously on plastic support (Pinto et al., 1983), has been
shown to be enhanced by differentiation inducers such as
dimethyl sulfoxide (DMSO) or 8-Br-cAMPC in LA7 epithelial
cells (Zucchi et al., 1998). Here, time of dome formation, their
number and size and monolayer tightness specifically depend
on cell-ECM interactions, as FITC-labelled biotin penetrated
much deeper between Caco-2 cells grown on plastic or
polylysine as compared to cells grown on native ECM. It
should be emphasized that the time for the delayed formation
of domes by Caco-2 cells grown on plastic was compatible
with the time necessary for the deposition of ECM material
produced by Caco-2 cells themselves (Vachon and Beaulieu,
1995).
Assembly of tight junctions, as well as gap and desmosomal
junctions, depends on E-cadherin recruitment at adherens
junctions (Cereijido et al., 2000; Jongen et al., 1991; Matsuzaki
et al., 1990; Mege et al., 1988; Fujimoto et al., 1997; Green et
al., 1987; Gumbiner et al., 1988; van Hengel et al., 1997).
Therefore, we investigated E-cadherin status in our cells.
Native ECM did not affect the total amount of E-cadherin and
of β-catenin protein, as shown by biochemical analysis and
confocal microscopy, but we demonstrated that ECM
dramatically increases E-cadherin localization to the plasma
membrane. Confocal microscopy revealed that, in cells grown
on native LN5-rich ECM, the E-cadherin signal focused at the
cell-cell junction domain in the upper third of the lateral
membrane, where adherens junctions are known to be
localized. Furthermore, the observation that ECM induced
an increase in E-cadherin–actin colocalization suggests
a reinforcement of E-cadherin anchoring to the actin
cytoskeleton and a better organization of the subcortical
network of actin by ECM. It is well established that tethering
of E-cadherin to the actin cytoskeleton underlies strong cellcell adhesion and is loosened in weak adhesion (Adams and
Nelson, 1998; Kaibuchi et al., 1999b). The lateral membrane
targeting of E-cadherin is produced not only by a native LN5rich ECM but also by Col IV alone, which is a common
component of all native ECMs (Rousselle and Garrone, 1998).
In our model, the coordinated reorganization of cell-cell
adhesion and the F-actin cytoskeleton was produced by native
laminin-5-enriched ECM as well as by type IV collagen or
laminin 2, suggesting a common pathway of induction. We
therefore questioned the role of ECM receptors expressed in
Caco-2 cells (i.e. α3β1 and α6β4 integrins). Blocking
experiments with anti-β1-integrin or anti-α6-integrin
antibodies in Caco-2 cells grown on ECM substrates resulted
in a phenotype similar to that obtained on an inert support: a
random distribution of E-cadherin along the basolateral
membrane, a looser organisation of the F-actin network and a
reduction in the merge signal from E-cadherin and F-actin
cytoskeleton. These results demonstrate that recruitment of
integrin receptors by their external ligands results in the
reinforcement of E-cadherin–actin functional complexes. But,
upon ligand binding, integrin linkage to the F-actin
cytoskeleton is known to be reinforced (Calderwood et al.,
2000). This apparent contradiction might be explained by the
existence of distinct pools of F-actin forming functional
complexes with E-cadherin and integrin. Alternatively,
translocation of regulatory proteins from E-cadherin to integrin
550
Journal of Cell Science 115 (3)
Fig. 6. β1 integrin mediates the effects of ECM on E-cadherin
targeting to the lateral membrane. Caco-2 cells were plated at
125,000 cells/cm2 on plastic, native LN5-rich ECM, type IV collagen
or LN2 in the presence or absence of either anti-β1- or anti-α6integrin blocking antibodies. Cells were then processed for
immunofluorescence with anti-E-cadherin and FITC (green) or
TRITC-conjugated phalloidin (red) and analysed by confocal
microscopy. Colocalization (yellow merge signal) of E-cadherin and
actin at the apical-lateral side of cells was estimated by computer
analysis of confocal stack series. (A) shows that ECM components
increase the colocalization of E-cadherin and actin as compared to
plastic without ECM, as expressed in arbitrary units. (B) 3D
reconstruction of cells grown on type IV collagen in the absence (a)
or in the presence (b) of anti-β1-integrin blocking antibody (bar,
10µm). The result is representative of three independent experiments.
(C) Effect of anti-β1-integrin blocking antibody on the colocalization
of E-cadherin and actin in cells grown on LN2. (D) Effect of anti-α6integrin blocking antibody on the colocalization of E-cadherin and
actin in cells grown on native LN5-rich ECM. Note that anti-β1
antibody treatment results in delocalization of the E-cadherin-actin in
cells grown on native ECM, type IV collagen and LN2. Data,
expressed as the percentage of control in absence of blocking
antibody, are means ±s.e.m. of three independent cultures performed
in triplicate. *, **, and *** differ from the control at P<0.05, P<0.01
and P<0.001, respectively.
complexes has been proposed to mediate crosstalk between
N-cadherin and β1 integrin in neural retina explants (Arregui
et al., 2000). Both hypotheses are challenged by the
colocalization of E-cadherin and β1 or β4 integrin that we
observed by confocal microscopy in the lateral membrane of
Caco-2 cells grown on ECM, whereas no colocalization was
found on an inert support. Such a colocalization of β1 integrin
and E-cadherin has already been reported at cell-cell junctions
in keratinocytes (Braga et al., 1997), although keratinocytes
form a different system in which integrin loses contact with
ECM while migrating towards the superficial layers of this
stratified epithelium, where E-cadherin finally downregulates
integrin expression (Hodivala and Watt, 1994).
Our results favour cooperation between ligand-bound
integrin and E-cadherin in the organization of the subcortical
F-actin cytoskeleton. In accordance with our results, it has been
shown in kidney epithelial cells that E-cadherin–catenin
complexes at cell-cell junctions were not sufficient to maintain
the subcortical F-actin cytoskeleton in the absence of α3β1
integrin (Wang et al., 1999). Similarly, laminin-5-activated
α3β1 integrin has been demonstrated to promote gap junctional
communication in keratinocytes (Lampe et al., 1998). In
contrast, expression of β1 integrin splice variants in β1deficient epithelium-like cells resulted in downregulation of
cadherin function, disruption of cell-cell adhesion and
induction of cell scattering (Gimond et al., 1999), all of which
underlie the cell-type specificity of cadherin localization
(Braga et al., 1999).
The extrinsic spatial cues mediated by cell-cell and cellsubstratum adhesions and trophic factor signaling need to be
coordinated to ensure a differentiated phenotype. The Rho
family GTPases (Rho, Rac and Cdc42) are good candidates for
a central role in coordinating adhesion systems. Rho GTPases
have been demonstrated to intervene in the inside-outside
control of cell-substrate adhesion (Calderwood et al., 2000).
Reciprocally, Rho, Rac1 and Cdc42 play roles in parallel and
convergent signaling pathways triggered by cell adhesion to an
ECM substrate (Clark et al., 1998). The control of E-cadherinmediated cell-cell adhesion by the Rho family GTPases and
their modulators has been recently characterized in the context
of epithelial-mesenchymal transition, where the loss of cellcell junctions promotes cell migration (Braga et al., 1997;
Hordijk et al., 1997; Takaishi et al., 1997; Kuroda et al., 1998;
Braga et al., 1999; Fukata et al., 1999). At the same time, it
was established that Rho GTPases play a key role in the control
of actin polymerization, cell shape and motility (Kaibuchi et
al., 1999a).
Our findings lend support to the notion that enterocyte
differentiation is an active process supported by molecular
crosstalk involving cell-ECM and cell-cell adhesions
(Hermiston and Gordon, 1995). We report for the first time that
integrin-dependent cell-ECM adhesion reinforces E-cadherin-
Integrin-induced E-cadherin–actin complexes
dependent cell-cell adhesion in epithelial cells (see Note in
Proof). This reinforcement most probably allows cell migration
along the crypt to the villus of the intestinal epithelium
(Hermiston et al., 1996). By contrast, it is well documented
that cell migration is promoted by the loss of cell-cell junctions
during the epithelial-mesenchymal transition of epithelial cells.
Our results supports the hypothesis that crosstalk between
integrin and cadherin, as well as regulation of E-cadherin
localization and function, depends on the cell fate (Braga et al.,
1999). The identification of the Rho GTPase and its partners
that are involved in the network will contribute to the
understanding of the mechanisms set up at the crypt-to-villus
transition checkpoint. Coordinated changes in ECM
components, integrin repertoire and E-cadherin localization
might also result in migration of differentiating enterocytes
along the crypt-to-villus axis.
Note in Proof
A similar conclusion was drawn from experiments performed
in fibroblasts and recently published in this journal (Whittard
and Akiyama, 2001a; Whittard and Akiyama, 2001b).
We would like to acknowledge financial support from Université
Paris VI, INSERM and CNRS. This work was performed using IFR
58 facilities. Cyrille Schreider is recipient of a fellowship from MRT
then FRM (Fondation pour la Recherche Médicale). We would like to
thank Christophe Klein (IFR 58) for excellent technical assistance.
References
Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R. and Hoschuetzky,
H. (1994). Assembly of the cadherin-catenin complex in vitro with
recombinant proteins. J. Cell Sci. 107, 3655-3663.
Adams, C. L. and Nelson, W. J. (1998). Cytomechanics of cadherin-mediated
cell-cell adhesion. Curr. Opin. Cell Biol. 10, 572-577.
Arregui, C., Pathre, P., Lilien, J. and Balsamo, J. (2000). The nonreceptor
tyrosine kinase fer mediates cross-talk between N-cadherin and beta1integrins. J. Cell Biol. 149, 1263-1274.
Beaulieu, J. F. (1992). Differential expression of the VLA family of integrins
along the crypt-villus axis in the human small intestine. J. Cell Sci. 102,
427-36.
Beaulieu, J. F. (1997). Extracellular matrix components and integrins in
relationship to human intestinal epithelial cell differentiation. Prog.
Histochem. Cytochem. 31, 1-78.
Beaulieu, J. F. (1999). Integrins and human intestinal cell functions. Front.
Biosci. 4, D310-D321.
Bissell, M. J., Hall, H. G. and Parry, G. (1982). How does the extracellular
matrix direct gene expression? J. Theor. Biol. 99, 31-68.
Booth, C. and Potten, C. S. (2000). Gut instincts: thoughts on intestinal
epithelial stem cells. J. Clin. Invest. 105, 1493-1499.
Boudreau, N. and Bissell, M. J. (1998). Extracellular matrix signaling:
integration of form and function in normal and malignant cells. Curr. Opin.
Cell Biol. 10, 640-646.
Braga, V. M., Machesky, L. M., Hall, A. and Hotchin, N. A. (1997). The
small GTPases Rho and Rac are required for the establishment of cadherindependent cell-cell contacts. J. Cell Biol. 137, 1421-1431.
Braga, V. M., Del Maschio, A., Machesky, L. and Dejana, E. (1999).
Regulation of cadherin function by Rho and Rac: modulation by junction
maturation and cellular context. Mol. Biol. Cell 10, 9-22.
Calderwood, D. A., Shattil, S. J. and Ginsberg, M. H. (2000). Integrins and
actin filaments: reciprocal regulation of cell adhesion and signaling. J. Biol.
Chem. 275, 22607-22610.
Cereijido, M., Shoshani, L. and Contreras, R. G. (2000). Molecular
physiology and pathophysiology of tight junctions. I. Biogenesis of tight
junctions and epithelial polarity. Am. J. Physiol. Gastrointest. Liver Physiol.
279, G477-G482.
Chen, Y. T., Stewart, D. B. and Nelson, W. J. (1999). Coupling assembly of
551
the E-cadherin/beta-catenin complex to efficient endoplasmic reticulum exit
and basal-lateral membrane targeting of E-cadherin in polarized MDCK
cells. J. Cell Biol. 144, 687-699.
Clark, E. A., King, W. G., Brugge, J. S., Symons, M. and Hynes, R. O.
(1998). Integrin-mediated signals regulated by members of the rho family
of GTPases. J. Cell Biol. 142, 573-586.
De Arcangelis, A., Neuville, P., Boukamel, R., Lefebvre, O., Kedinger, M.
and Simon-Assmann, P. (1996). Inhibition of laminin alpha 1-chain
expression leads to alteration of basement membrane assembly and cell
differentiation. J. Cell Biol. 133, 417-430.
Fleischmajer, R., Utani, A., MacDonald, E. D., Perlish, J. S., Pan, T. C.,
Chu, M. L., Nomizu, M., Ninomiya, Y. and Yamada, Y. (1998). Initiation
of skin basement membrane formation at the epidermo-dermal interface
involves assembly of laminins through binding to cell membrane receptors.
J. Cell Sci. 111, 1929-1940.
Fritsch, C., Orian-Rousseaul, V., Lefebvre, O., Simon-Assmann, P.,
Reimund, J. M., Duclos, B. and Kedinger, M. (1999). Characterization of
human intestinal stromal cell lines: response to cytokines and interactions
with epithelial cells. Exp. Cell Res. 248, 391-406.
Fujimoto, K., Nagafuchi, A., Tsukita, S., Kuraoka, A., Ohokuma, A. and
Shibata, Y. (1997). Dynamics of connexins, E-cadherin and alpha-catenin
on cell membranes during gap junction formation. J. Cell Sci. 110, 311-322.
Fukata, M., Nakagawa, M., Kuroda, S. and Kaibuchi, K. (1999). Cell
adhesion and Rho small GTPases. J. Cell Sci. 112, 4491-4500.
Gimond, C., van Der Flier, A., van Delft, S., Brakebusch, C., Kuikman, I.,
Collard, J. G., Fassler, R. and Sonnenberg, A. (1999). Induction of cell
scattering by expression of beta1 integrins in beta1-deficient epithelial cells
requires activation of members of the rho family of GTPases and
downregulation of cadherin and catenin function. J. Cell Biol. 147, 13251340.
Green, K. J., Geiger, B., Jones, J. C., Talian, J. C. and Goldman, R. D.
(1987). The relationship between intermediate filaments and microfilaments
before and during the formation of desmosomes and adherens-type junctions
in mouse epidermal keratinocytes. J. Cell Biol. 104, 1389-1402.
Gumbiner, B., Stevenson, B. and Grimaldi, A. (1988). The role of the cell
adhesion molecule uvomorulin in the formation and maintenance of the
epithelial junctional complex. J. Cell Biol. 107, 1575-1587.
Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue
architecture and morphogenesis. Cell 84, 345-357.
Hermiston, M. L. and Gordon, J. I. (1995). In vivo analysis of cadherin
function in the mouse intestinal epithelium: essential roles in adhesion,
maintenance of differentiation, and regulation of programmed cell death. J.
Cell Biol. 129, 489-506.
Hermiston, M. L., Wong, M. H. and Gordon, J. I. (1996). Forced expression
of E-cadherin in the mouse intestinal epithelium slows cell migration and
provides evidence for nonautonomous regulation of cell fate in a selfrenewing system. Genes Dev. 10, 985-996.
Hodivala, K. J. and Watt, F. M. (1994). Evidence that cadherins play a role
in the downregulation of integrin expression that occurs during keratinocyte
terminal differentiation. J. Cell Biol. 124, 589-600.
Hoffman, M. P., Kibbey, M. C., Letterio, J. J. and Kleinman, H. K. (1996).
Role of laminin-1 and TGF-beta 3 in acinar differentiation of a human
submandibular gland cell line (HSG). J. Cell Sci. 109, 2013-2021.
Hordijk, P. L., ten Klooster, J. P., van der Kammen, R. A., Michiels, F.,
Oomen, L. C. and Collard, J. G. (1997). Inhibition of invasion of epithelial
cells by Tiam1-Rac signaling. Science 278, 1464-1466.
Hynes, R. O. (1987). Integrins: a family of cell surface receptors. Cell 48,
549-554.
Jongen, W. M., Fitzgerald, D. J., Asamoto, M., Piccoli, C., Slaga, T.
J., Gros, D., Takeichi, M. and Yamasaki, H. (1991). Regulation of
connexin 43-mediated gap junctional intercellular communication by Ca2+
in mouse epidermal cells is controlled by E-cadherin. J. Cell Biol. 114,
545-555.
Jou, T. S., Stewart, D. B., Stappert, J., Nelson, W. J. and Marrs, J. A.
(1995). Genetic and biochemical dissection of protein linkages in the
cadherin-catenin complex. Proc. Natl. Acad. Sci. USA 92, 5067-5071.
Kaibuchi, K., Kuroda, S. and Amano, M. (1999a). Regulation of the
cytoskeleton and cell adhesion by the Rho family GTPases in mammalian
cells. Annu. Rev. Biochem. 68, 459-486.
Kaibuchi, K., Kuroda, S., Fukata, M. and Nakagawa, M. (1999b).
Regulation of cadherin-mediated cell-cell adhesion by the Rho family
GTPases. Curr. Opin. Cell Biol. 11, 591-596.
Kemler, R. (1992). Classical cadherins. Semin. Cell Biol. 3, 149-155.
Klein, G., Ekblom, M., Fecker, L., Timpl, R. and Ekblom, P. (1990).
552
Journal of Cell Science 115 (3)
Differential expression of laminin A and B chains during development of
embryonic mouse organs. Development 110, 823-837.
Kuroda, S., Fukata, M., Nakagawa, M., Fujii, K., Nakamura, T., Ookubo,
T., Izawa, I., Nagase, T., Nomura, N., Tani, H. et al. (1998). Role of
IQGAP1, a target of the small GTPases Cdc42 and Rac1, in regulation of
E-cadherin- mediated cell-cell adhesion. Science 281, 832-835.
Lampe, P. D., Nguyen, B. P., Gil, S., Usui, M., Olerud, J., Takada, Y. and
Carter, W. G. (1998). Cellular interaction of integrin alpha3beta1 with
laminin 5 promotes gap junctional communication. J. Cell Biol. 143, 17351747.
Larjava, H., Peltonen, J., Akiyama, S. K., Yamada, S. S., Gralnick, H. R.,
Uitto, J. and Yamada, K. M. (1990). Novel function for beta 1 integrins
in keratinocyte cell-cell interactions. J. Cell Biol. 110, 803-815.
Le Beyec, J., Delers, F., Jourdant, F., Schreider, C., Chambaz, J., Cardot,
P. and Pincon-Raymond, M. (1997). A complete epithelial organization of
Caco-2 cells induces I-FABP and potentializes apolipoprotein gene
expression. Exp. Cell Res. 236, 311-320.
Lesuffleur, T., Barbat, A., Dussaulx, E. and Zweibaum, A. (1990). Growth
adaptation to methotrexate of HT-29 human colon carcinoma cells is
associated with their ability to differentiate into columnar absorptive and
mucus-secreting cells. Cancer Res. 50, 6334-6343.
Li, M. L., Aggeler, J., Farson, D. A., Hatier, C., Hassell, J. and Bissell, M.
J. (1987). Influence of a reconstituted basement membrane and its
components on casein gene expression and secretion in mouse mammary
epithelial cells. Proc. Natl. Acad. Sci. USA 84, 136-140.
Lorentz, O., Duluc, I., Arcangelis, A. D., Simon-Assmann, P., Kedinger,
M. and Freund, J. N. (1997). Key role of the Cdx2 homeobox gene in
extracellular matrix-mediated intestinal cell differentiation. J. Cell Biol. 139,
1553-1565.
Machesky, L. M. and Hall, A. (1997). Role of actin polymerization and
adhesion to extracellular matrix in Rac- and Rho-induced cytoskeletal
reorganization. J. Cell Biol. 138, 913-926.
Matsuzaki, F., Mege, R. M., Jaffe, S. H., Friedlander, D. R., Gallin, W. J.,
Goldberg, J. I., Cunningham, B. A. and Edelman, G. M. (1990). cDNAs
of cell adhesion molecules of different specificity induce changes in cell
shape and border formation in cultured S180 cells. J. Cell Biol. 110, 12391252.
Matter, M. L. and Laurie, G. W. (1994). A novel laminin E8 cell adhesion
site required for lung alveolar formation in vitro. J. Cell Biol. 124, 10831090.
Mege, R. M., Matsuzaki, F., Gallin, W. J., Goldberg, J. I., Cunningham,
B. A. and Edelman, G. M. (1988). Construction of epithelioid sheets by
transfection of mouse sarcoma cells with cDNAs for chicken cell adhesion
molecules. Proc. Natl. Acad. Sci. USA 85, 7274-7278.
Orian-Rousseau, V., Aberdam, D., Rousselle, P., Messent, A., Gavrilovic,
J., Meneguzzi, G., Kedinger, M. and Simon-Assmann, P. (1998). Human
colonic cancer cells synthesize and adhere to laminin-5. Their adhesion to
laminin-5 involves multiple receptors among which is integrin alpha2beta1.
J. Cell Sci. 111, 1993-2004.
Patton, B. L., Miner, J. H., Chiu, A. Y. and Sanes, J. R. (1997). Distribution
and function of laminins in the neuromuscular system of developing, adult,
and mutant mice. J. Cell Biol. 139, 1507-1521.
Pincon-Raymond, M., Vicart, P., Bois, P., Chassande, O., Romey, G.,
Varadi, G., Li, Z. L., Lazdunski, M., Rieger, F. and Paulin, D. (1991).
Conditional immortalization of normal and dysgenic mouse muscle cells by
the SV40 large T antigen under the vimentin promoter control. Dev. Biol.
148, 517-528.
Pinto, M., Robine-Leon, S., Appay, M. D., Kedinger, M., Triadou, N.,
Dussaulx, E., Lacroix, B., Simon-Assmann, P., Haffen, K., Fogh, J. et al.
(1983). Enterocyte-like differentiation and polarization of the human colon
carcinoma cell line Caco-2 in culture. Biol. Cell 47, 323-330.
Potten, C. S., Booth, C. and Pritchard, D. M. (1997). The intestinal epithelial
stem cell: the mucosal governor. Int. J. Exp. Pathol. 78, 219-243.
Rao, J. S., Beach, R. L. and Festoff, B. W. (1985). Extracellular matrix
(ECM) synthesis in muscle cell cultures: quantitative and qualitative studies
during myogenesis. Biochem. Biophys. Res. Commun. 130, 440-446.
Rousselle, P. and Garrone, R. (1998). [Collagen and laminin: which
messages for which cells?]. Pathol Biol (Paris) 46, 543-554.
Sako, Y., Nagafuchi, A., Tsukita, S., Takeichi, M. and Kusumi, A. (1998).
Cytoplasmic regulation of the movement of E-cadherin on the free cell
surface as studied by optical tweezers and single particle tracking: corralling
and tethering by the membrane skeleton. J. Cell Biol. 140, 1227-1240.
Sander, E. E., van Delft, S., ten Klooster, J. P., Reid, T., van der Kammen,
R. A., Michiels, F. and Collard, J. G. (1998). Matrix-dependent Tiam1/Rac
signaling in epithelial cells promotes either cell-cell adhesion or cell
migration and is regulated by phosphatidylinositol 3-kinase. J. Cell Biol.
143, 1385-1398.
Simon-Assmann, P. and Kedinger, M. (1993). Heterotypic cellular
cooperation in gut morphogenesis and differentiation. Semin. Cell Biol. 4,
221-230.
Simon-Assmann, P., Lefebvre, O., Bellissent-Waydelich, A., Olsen, J.,
Orian-Rousseau, V. and De Arcangelis, A. (1998). The laminins: role in
intestinal morphogenesis and differentiation. Ann. N Y Acad. Sci. 859, 4664.
Skoudy, A., Llosas, M. D. and Garcia de Herreros, A. (1996). Intestinal HT29 cells with dysfunction of E-cadherin show increased pp60src activity and
tyrosine phosphorylation of p120-catenin. Biochem. J. 317, 279-284.
Takaishi, K., Sasaki, T., Kotani, H., Nishioka, H. and Takai, Y. (1997).
Regulation of cell-cell adhesion by rac and rho small G proteins in MDCK
cells. J. Cell Biol. 139, 1047-1059.
Tsukita, S., Nagafuchi, A. and Yonemura, S. (1992). Molecular linkage
between cadherins and actin filaments in cell-cell adherens junctions. Curr.
Opin. Cell Biol. 4, 834-839.
Vachon, P. H. and Beaulieu, J. F. (1995). Extracellular heterotrimeric laminin
promotes differentiation in human enterocytes. Am. J. Physiol. 268, G857G867.
Vachon, P. H., Durand, J. and Beaulieu, J. F. (1993). Basement membrane
formation and re-distribution of the beta 1 integrins in a human intestinal
co-culture system. Anat. Rec. 235, 567-576.
Vachon, P. H., Loechel, F., Xu, H., Wewer, U. M. and Engvall, E. (1996).
Merosin and laminin in myogenesis; specific requirement for merosin in
myotube stability and survival. J. Cell Biol. 134, 1483-1497.
van Hengel, J., Gohon, L., Bruyneel, E., Vermeulen, S., Cornelissen, M.,
Mareel, M. and von Roy, F. (1997). Protein kinase C activation upregulates
intercellular adhesion of alpha-catenin-negative human colon cancer cell
variants via induction of desmosomes. J. Cell Biol. 137, 1103-1116.
Velling, T., Tiger, C. F., Ekblom, P. and Gullberg, D. (1999). Laminin alpha
chains in colon carcinoma cell lines: detection of a truncated laminin alpha1
mRNA in Caco-2 cells. Exp. Cell Res. 248, 627-633.
Wang, Z., Symons, J. M., Goldstein, S. L., McDonald, A., Miner, J. H. and
Kreidberg, J. A. (1999). (Alpha)3(beta)1 integrin regulates epithelial
cytoskeletal organization. J. Cell Sci. 112, 2925-2935.
Weaver, V. M., Petersen, O. W., Wang, F., Larabell, C. A., Briand, P.,
Damsky, C. and Bissell, M. J. (1997). Reversion of the malignant
phenotype of human breast cells in three-dimensional culture and in vivo by
integrin blocking antibodies. J. Cell Biol. 137, 231-245.
Whittard, J. D. and Akiyama, S. K. (2001a). Activation of beta1 integrins
induces cell-cell adhesion. Exp. Cell Res. 263, 65-76.
Whittard, J. D. and Akiyama, S. K. (2001b). Positive regulation of cell-cell
and cell-substrate adhesion by protein kinase A. J. Cell Sci. 114, 3265-3272.
Yamada, K. M. and Geiger, B. (1997). Molecular interactions in cell adhesion
complexes. Curr. Opin. Cell Biol. 9, 76-85.
Yamada, K. M. and Miyamoto, S. (1995). Integrin transmembrane signaling
and cytoskeletal control. Curr. Opin. Cell Biol. 7, 681-689.
Zucchi, I., Montagna, C., Susani, L., Vezzoni, P. and Dulbecco, R. (1998).
The rat gene homologous to the human gene 9-27 is involved in the
development of the mammary gland. Proc. Natl. Acad. Sci. USA 95, 10791084.