UNIVERSIDADE DE LISBOA
FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE QUÍMICA E BIOQUÍMICA
Anoctamins: A Novel Family of Ion Channels with Extended Functions
and Significance in Disease
Sara Cerqueira Afonso
Dissertação
Mestrado em Bioquímica
2012/2013
UNIVERSIDADE DE LISBOA
FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE QUÍMICA E BIOQUÍMICA
Anoctamins: A Novel Family of Ion Channels with Extended Functions
and Significance in Disease
Sara Cerqueira Afonso
Dissertação
Mestrado em Bioquímica
Supervisors: Prof. Dr. Margarida D. Amaral and Prof. Dr. med. Karl Kunzelmann
2012/2013
1
Index
Index
Acknowlegments
4
I Summary
6
II Resumo
8
III Abbreviations
10
1 Introduction
12
1.1 Cystic Fibrosis – Historical overview
12
1.2 Cystic Fibrosis – The Phenotype
12
1.3 Cystic Fibrosis – CFTR Gene and Mutations
13
1.4 CFTR – Structure and function
13
1.5 CFTR – Folding and trafficking
15
1.6 CFTR and Anoctamins
16
1.6.1 Crosstalk between cAMP and Ca2+ signalling
16
1.6.2 Calcium-activated Chloride Channels
17
1.6.3 Anoctamins
18
1.6.4 Interaction between CFTR and Anoctamins
21
2 Objectives
23
3 Materials and Methods
24
3.1 Cell Culture
24
3.1.1 Mammalian Cell Lines and Culture Conditions
24
3.1.2 Transfections
24
3.2 Molecular Biology
24
3.2.1 Plasmid vectors
24
3.2.2 Competent bacteria production and transformation
25
3.2.3 DNA extraction
25
3.2.4 DNA sequencing
25
3.2.5 Mutagenesis
26
3.2.6 RNA extraction, DNaseI treatment, reverse transcription and semiquantitative PCR
27
3.3 Protein Analysis
29
3.3.1 Immunocytochemistry
29
3.3.2 Immunoprecipitation and Western Blot
29
3.4 Functional Analysis
31
3.4.1 Patch clamp
31
3.5 Statistical Analysis
32
4 Results
33
4.1 Endogenous expression of Anoctamins in CFBE cells overexpressing WT-CFTR
and F508del-CFTR
33
4.2 Cell localization of Ano1 and Ano6 on BHK WT- and F508del-CFTR
overexpressing cells
36
4.3 Interaction of Ano1 and Ano6 with CFTR
38
4.4 CFTR influence on Ano1 and Ano6 function
41
5 Discussion
44
5.1 CFTR influence on Anoctamins’ expression
44
5.2 CFTR effect on Ano1 and Ano6 cell localization
45
5.3 Co-immunoprecipitation of CFTR with Ano1 and Ano6
46
5.4 CFTR influence on Ano1 and Ano6 function
46
6 Future Perspectives
48
7 References
49
8 Appendices
55
8.1 Appendix I - pcDNA3.1 Ano1 eGFP plasmid map
55
8.2 Appendix II – pcDNA3.1 Ano1 eYFP plasmid map
57
8.3 Appendix III – pcDNA3.1 Ano1 CFP plasmid map
59
2
Index
8.4 Appendix IV – pIRES Ano1 eGFP CD8 plasmid map
8.5 Appendix V – pIRES Ano1 L982A CD8 plasmid map
8.6 Appendix VI - pcDNA3.1 Ano6 eGFP plasmid map
8.7 Appendix VII – pIRES Ano6 eGFP CD8 plasmid map
8.8 Appendix VIII – pcDNA3.1 Ano9 eGFP plasmid map
8.9 Appendix X – Live-cell imaging of Ano1 and Ano6 eGFP tagged
8.10 Appendix XI – Anoctamin constructs testing
61
63
65
67
69
71
73
3
Acknowledgments
Acknowlegments
First and foremost I would like to show my appreciation to my supervisors, Prof.
Margarida Amaral and Karl Kunzelmann, for allowing me to pursuit my carrier in this
wonderful field and showing me how excellent science is performed. Thank you for all
the guidance, support, incentive and healthy pressure put on this project which allowed
me to go forward and made me enjoy every small victory. This immense gratitude is
extended to both labs which share a tremendous ethic, a very stimulating work
environment and a true love for science that can be seen in every single member.
In Prof. Margarida’s lab where I began my work, I specially want to thank Inna, my
first teacher among friends, for all the support, huge help (even from so far away) and to
pass me on some of her unbelievable knowledge. Since the beginning Ana Cachaço, my
microscope “buddy”, had a very special place in my heart, her sense of humour is so
keen and accurate that is impossible not to laugh out loud in the lab, her readiness to
help everyone is beyond limits and her words are always the right ones when you seek
for comfort. Marta Palma (aka Martuxa) is for sure, as Prof. Margarida says, “the most
important person in the lab”, a teacher in the cell culture, a mother to the lab and a friend
that does not even realize how great and remarkable she is. João Fernandes is the one
with whom we can always count when we have a doubt, when we need help and when
a bigger lunch break is needed (a great teacher of slow motion eating). João Amorim
was the one who started this thesis adventure with me and with whom I could share the
frustration of the slow appearance of good results. Thank you to big Sara, probably the
busiest person in the lab but the one that always found a little bit of time to help me with
all the RNA, cDNA and quantitative PCR related stuff and to whom I owe many laughs
due to her elegant humour even when she was part of the teasing. Verónica was always
a source of support and joy without whom the DNA sequencing results analysis wouldn’t
be possible. Simão was the most important piece in my cloning saga, helping me with
primers’ design, ordering and interpretation of the cloning results and whose Christmas,
Easter and Carnival songs always cheered up the lab, however his little maize breads
were also a big source of happiness. I worked, or better I learned with Marisa only for
a few weeks (being responsible for my first meeting with the Ussing chamber) but that
was enough time for her to teach me how life should be taken easily and to accept the
not so great results as well as the good ones because they are as important and you can
always retrieve something from them. Ana Marta (aka Chica) arrived a little bit later but
after only two days of hard immunocytochemistry work I realized that she would surely
be the sunshine of the lab, bringing laugher, joy and just a good vibe, she gave me
support, delivered me calmness and with her I could share the grieving about the not so
good stainings. Susana was also a later arrival but a very welcoming one bringing a huge
experience and knowledge as well as happiness. Thank you to Hagen, my “Erasmus
student”, with whom I learned as much as I thought. I would also like to express my
deepest gratitude to Prof. Carlos, Anabela and Luka who were always ready to kindly
help me, sharing a bit of their great wisdom and without whom the work related with cell
culture and molecular biology wouldn’t be possible.
I also want to recognise the importance of everyone in Prof. Karl’s lab who made me
feel that I belonged and that I would succeed since the very first day. I would like to very
deeply thank Rainer who assisted me when I was still in Lisbon and even only by e-mail
helped me to be successful in my mutagenesis experiments which I had never done
before and would not be possible without him and also for ALL the plasmids done for me
and for the advices that made me realized that I was learning with one of the best in his
field. To Ji for all the time spent with me around the infamous Co-IPs and for showing
me just a glimpse of her great, great patch clamp knowledge (by the way I also would
like to thank her for providing us a great shoe parade which left us all with jealous ;) ).
Gam always reminds me my first week in the lab when she transmitted me the most
4
Acknowledgments
welcoming feeling and showed her big kindness by being my brief patch clamp teacher,
always exhibiting her huge passion for this technique and for science in general. I need
to show her all of my appreciation for helping me with all the patch clamp done in this
thesis and to allow me to share some of her results. Kip was the one with whom I worked
the most, she was my western blot teacher, my co-ip “buddy”, my support and incentive
when things were and were not working, my unburden shoulder and above all my friend
who convinced me beyond any doubt to go to Thailand. Stephi arrived to the lab around
the same time as me and from the beginning I knew that she was a very special lady,
bright, joyful and with a huge sense of humour, to her I need to thank for some of the
funniest moments in the lab and the camaraderie shared. Thank you to Patricia for all
the help with the plasmids which allowed me to succeed in my experiments. To my
warbler Tini I would like to recognize all the support and the words said in the right
moment which were felt as a driving force when I was feeling down. My lab mother
Brigitte was the first lab member that I knew and since that very first hug I felt that she
would be a very special person and a pillar to me as it turned out to be, I need to thank
for every single moment spent in the lab, not only for showing some of her immense cell
culture knowledge (I will always be the electroporator backup handler) but also for being
there for me when I needed her, for being a corner where I could seek for comfort, for
giving me the right advices, for being funny and to show me the life of a true “luxury
women” allowing me to meet her wonderful children and husband. My last
acknowledgments must go to the two persons that made this Regensburg experience
truly unforgettable and who will always have a very special place in my heart. Firstly to
my sweet Carina (aka Flash Gordon) who was one of my biggest supports while in
Regensburg, always pushing each other forward and the one capable of putting a smile
on my face when everything seemed so difficult. Our bike trips to and from work are one
of the highlights of this adventure for sure and her friendship one of the best things that
I brought from Regensburg. And finally I want to thank my dear Diana (aka Lady Di) from
the bottom of my heart, for all the help in the Lab on almost everything, for her guidance
on many of my experiments and for her friendship which made me feel that I was part of
the engine that kept the Lab running and that even dough I arrived Regensburg alone I
would never feel lonely.
I want to express my profound gratitude to my family in Regensburg, headed by Frau
Gunda and followed by Ruth, Stefan, Karl-Heinz, Agnes, Herbert and Sina (the most
original cat ever) whose enormous kindness I will never forget. Since my arrival they
made me feel that their house was also mine and that I was no guest but a daughter, a
sister, an aunt or a very old friend instead. Specially to Frau Gunda, not my landlady but
my deepest friend with whom I shared every day of these 7 months, there´s nothing that
I can say that shows how grateful I am, so I will only say that she is in my heart forever.
Finalmente, quero expressar todo o meu amor e gratidão a toda a minha família por
todo o apoio dado desde que decidi seguir esta carreira, sem eles esta tese não teria
sido possível. O incentivo dos meus pais e irmão durante todo este ano foi incansável,
nunca me deixando desanimar e fazendo-me sentir que estiveram sempre comigo
durante todo este percurso, apesar dos 2518 km de distância. Os seus conselhos
fizeram de mim uma melhor pessoa e uma investigadora mais dotada e consciente e
por isso não tenho como lhes agradecer, prometendo apenas que todos os dias darei o
meu máximo, pois tal como eles me ensinaram: “não interessa aquilo que fazes desde
que o faças com gosto, dando o teu melhor e tentando sempre superar-te a cada dia
que passa”.
5
Summary
I Summary
Cystic Fibrosis (CF) is the most common lethal monogenic autosomal recessive
disease in the Caucasian population. It´s characterized by a quick loss of pulmonary
function, with obstruction of the airways caused by the accumulation of mucus and the
bacterial infections that follows.
This disease is caused by various mutations on the Cystic Fibrosis Transmembrane
Conductance Regulator (CFTR) gene in chromosome 7 which lead to a dysfunctional
product. F508del (deletion of a phenylalanine in the 508º position of the protein) is the
most predominant disease-causing mutation between the 1949 already known.
CFTR is expressed in luminal membranes of both secretory and absorptive epithelia,
where it not only works as a chloride channel but also controls a number of other ion
channels and transporters, being crucial to the ionic flow on epithelia. Among these other
channels is the Anoctamins family, better known as calcium (Ca2+) -activated Clchannels (CaCCs). CaCCs mediate Ca2+-dependent Cl− secretion in glands and flat
epithelia and modify cellular responses to adequate stimuli in muscle, nerve and
receptors.
Some studies already reported a functional relationship between these two entities,
however the mechanism behind this crosstalk is still unknown.
The aim of this work was to understand whether CFTR has a regulatory role on Ano1
and Ano6 biogenesis and trafficking, beyond the apparent functional relationship and if
this is impaired in CF patients. To achieve this we looked into Anoctamins’ expression,
cell localization, function and direct interaction with CFTR in cells expressing WT-CFTR
and in cells mimicking CF disease which expressed F508del-CFTR. This study was
performed always having in mind that the disclosure of the relationship between these
two protein families with similar function could shed a light on a new alternative target to
fight against CF and somehow circumvent the complex process that is targeting CFTR,
given the vast range of its mutations which cause an equally wide range of anomalies.
The Anoctamin (Ano1, Ano6, Ano9 and Ano10) endogenous expression was
quantified by semi-quantitative polymerase chain reaction (PCR) and compared in cystic
fibrosis bronchial epithelial (CFBE) cells stably expressing either WT-CFTR or F508delCFTR. Then on baby hamster kidney (BHK) cells, cell localization of Ano1 and Ano6 was
evaluated both in the presence of WT-CFTR and F508del-CFTR by microscopy.
Physical interaction between CFTR and Ano1 or Ano6 was also assessed by
performing a co-immunoprecipitation assay.
Finally, Ano1 and Ano6 functions were studied in the presence of WT-CFTR and
F508del-CFTR and evaluated by patch clamp.
Overall the results showed that:
- For both CFBE WT- and F508del-CFTR cells, Ano6 is the most expressed
anoctamin between Ano1, 6, 9 and 10 and that this cell line does not express
Ano10;
- Ano1 and 6 are more expressed on CFBE WT-CFTR cells when compared to
F508del-CFTR, and although not statistically significant Ano9 mRNA levels are
much higher in WT-CFTR expressing cells than in F508del-CFTR cells;
- Ano1 is mostly located on the cell membrane in both BHK WT-CFTR and F508delCFTR cells. However the expression level in significantly higher in WT than in
F508del-CFTR cells;
- Ano6 expression on the cell membrane is not so clear since that in the presence
of both CFTR forms the protein was also detected intracellular;
- Both Ano1 and Ano6 have a direct interaction with CFTR, although this is not true
for F508del-CFTR;
- The interaction between CFTR and Ano1 does not appear to be made through
PDZ scaffold proteins;
6
Summary
-
Ano1 is constitutively active on both BHK cell lines stably expressing WT- and
F508del-CFTR when transiently transfected with Ano1;
Ano1 seems to inhibit WT-CFTR channel activation;
The mutation into Ano1’s PDZ binding domain does not seem to affect WT-CFTR
currents by Ano1, corroborating the non-interaction through the PDZ binding
domain.
7
Resumo
II Resumo
A Fibrose Quística (FQ) é a doença autossómica recessiva letal mais comum na
população caucasiana com uma prevalência de 1 em 2500-4000 nascimentos.
Apresenta como sintomas característicos um declínio rápido na função pulmonar, com
obstrução das vias aéreas devido à ineficaz remoção de muco e consequentes infeções
bacterianas recorrentes. Estas alterações estão associadas a um ambiente de
hiperinflamação, que exacerba os processos de remodelação do tecido pulmonar e
acaba por culminar na fibrose dos tecidos e perda da sua função. Além deste fenótipo
respiratório, os pacientes apresentam ainda insuficiência pancreática, obstrução
intestinal e hepática, e elevados níveis de infertilidade masculina.
Esta doença tem como causa mutações ocorridas num gene, localizado no
cromossoma 7 (7q31), que codifica para uma glicoproteína com 1480 resíduos de
aminoácidos, designada Cystic Fibrosis Transmembrane Conductance Regulator
(CFTR). Esta proteína tem a função de canal de cloreto (Cl-) presente na membrana
apical de células epiteliais, regulando o transporte transepitelial de iões e água, quando
ativada por fosforilação via proteína cinase A (PKA) dependente do cAMP. Sendo que
a disrupção da função da CFTR leva a um desequilíbrio iónico do líquido que reveste as
vias respiratórias, airway surface liquid (ASL), levando ao aumento de espessura e
viscosidade do muco provocados pela sua desidratação.
A deleção de um único aminoácido, uma fenilalanina na posição 508 (F508del) está
presente em aproximadamente 90% dos pacientes com FQ, sendo a mais comum de
entre as mais de 1949 conhecidas. Esta mutação afeta o correto processamento da
proteína que, devido a um folding incorreto, fica retida intracelularmente a nível do
retículo endoplasmático (RE) onde é rapidamente enviada para a via de degradação
proteolítica do proteassoma associada ao RE, não chegando assim à membrana
plasmática.
A função fisiológica da CFTR no epitélio vai para além do seu papel como canal de
Cl-, existindo várias evidências da sua atuação como proteína reguladora de outros
canais iónicos relevantes na patofisiologia da FQ. Entre eles encontram-se o canal de
sódio epitelial (ENaC) e canais de potássio como KVLQT-1. Outros canais que
possivelmente interatuam com a CFTR são os canais de cloreto ativados por cálcio
(CaCC) e outwardly rectifying (ORCC). Os primeiros têm a função de transporte iónico
transepitelial em células secretoras e são caracterizados por apresentarem uma
ativação dependente da subida dos níveis de Ca2+ intracelular.
Por sua vez, os ORCC distinguem-se por demonstrarem uma relação I/V outwardly
rectifying e serem ativados por despolarização celular e via PKA e UTP extracelular.
A produção de corrente pelos CaCCs encontra-se aumentada nas vias respiratórias
de doentes com fibrose quística, provavelmente para tentar compensar de algum modo
a ineficácia da CFTR. Enquanto que a ativação dos ORCC pela PKA encontra-se
afetada nos tecidos de doentes com fibrose quística.
A relação da CFTR com estes canais tornou-se ainda mais interessante quando, em
2008, estes foram molecularmente identificados como Anoctaminas, uma família de dez
proteínas que apresenta semelhança estrutural, com oito segmentos transmembranares
e um poro entre os segmentos 5 e 6, mas diferenças em termos funcionais. A
Anoctamina 1 é reconhecida como o grande componente dos CaCCs, enquanto que a
Anoctamina 6 atua como ORCC.
O trabalho elaborado teve como objetivo explorar esta relação entre a CFTR e as
Anoctaminas (mais especificamente Ano1 e Ano6). Foi estudado o tipo de interação
existente entre ambas as proteínas (física ou só funcional) e o impacto que a presença
da CFTR-WT ou CFTR-F508del teria na expressão, localização celular e função da
Ano1 e Ano6. Nunca esquecendo o grande potencial desta nova família de proteínas
como alvo farmacológico alternativo para a terapêutica da fibrose quística.
8
Resumo
Inicialmente estudou-se a expressão endógena das anoctaminas (Ano1, 6, 9 e 10)
nas células CFBE, estavelmente transfectadas com CFTR-WT ou F508del, através da
técnica de PCR semi-quantitativo. De seguida, em células BHK, foi estudada a potencial
influência da CFTR-WT e F508del na localização celular da Ano1 e 6, usando técnicas
de microscopia.
Foram também realizados ensaios de co-imunoprecipitação com o objetivo de
compreender se a interação entre a CFTR e a Ano1 ou 6 seria física/direta e não só
funcional.
Finalmente, investigou-se o impacto da CFTR-WT e F508del na funcionalidade das
anoctaminas Ano1 e 6 através de técnicas de patch clamp.
Os resultados obtidos sugerem que:
Em células CFBE, a Ano6 é a Anoctamina mais expressa de entre a Ano1, 6, 9
e 10 e que estas células não apresentam expressão endógena de Ano10;
A Ano1 e 6 são significativamente mais expressas em células CFBE
expressando estavelmente CFTR-WT, os níveis de mRNA da Ano9 são bastante mais
elevados nas células que expressam a forma WT, mas não estatisticamente diferentes
dos níveis detetados nas CFBE CFTR-F508del;
Tanto em BHK CFTR-WT como em CFTR-F508del, a Ano1 localiza-se
maioritariamente na membrana plasmática. Contudo, os níveis de expressão
membranar são significativamente maiores nas células que expressam CFTR-WT;
A Ano6 encontra-se não só localizada na membrana plasmática como também
intracelularmente;
Tanto a Ano1 como a Ano6 apresentam uma interação direta com a CFTR-WT.
No entanto, tal não acontece quando a CFTR-F508del é expressa;
A interação entre a CFTR e a Ano1 não se efetua através de proteínas de
ancoragem ao domínio PDZ;
A Ano1 encontra-se constitutivamente ativa quando transientemente expressa
em células BHK que expressam estavelmente CFTR-WT ou F508del;
A Ano1 parece inibir a ativação das correntes produzidas pela CFTR-WT;
As experiências funcionais corroboram a ausência de interação direta entre Ano1
e CFTR através do domínio de ligação PDZ.
9
Abbreviations
III Abbreviations
A549 – human alveolar epithelial cells (cell line)
ABC- ATP-binding cassete
AC1 – adenylyl cyclase I
ASL – airway surface liquid
ATP – adenosine triphosphate
BHK – baby hamster kidney (cell line)
BSA – bovine serum albumin
C – cysteine
CaCC – calcium-activated chloride channel
CAM – calcium-modulated protein
CAMK – Ca2+/calmodulin-dependent kinase
cAMP – cyclic adenosine monophosphate
CAP70 – CFTR associated protein of 70 kDa
Cch – carbachol
cDNA – complementary DNA
CF – cystic fibrosis
CFBE41o- / CFBE – cystic fibrosis bronchial epithelial (cell line)
CFP – cyan fluorescent protein
CFTR – cystic fibrosis transmembrane conductance regulator
CLC – chloride channel
CPAE – calf pulmonary artery endothelial cells
dNTP – deoxynucleoside triphosphate
DAPI – 4',6-diamidino-2-phenylindole
EDTA – ethylenediaminetetraacetic acid
ENaC – epithelial sodium channel
ER – endoplasmic reticulum
ERAD – endoplasmic-reticulum-associated protein degradation
Erk1, 2 – extracellular signal-regulated protein kinase 1 and 2
ERM – ezrin–radixin–moesin protein family
ERQC – endoplasmic reticulum quality control
FBS – fetal bovine serum
FSK / F – forskolin
GABA – gamma-aminobutyric acid
GFP – green fluorescent protein
eGFP – enhanced green fluorescent protein
GPCR – G protein-coupled receptors
HEK – human embryonic kidney (cell line)
HeLa – human cervical carcinoma (Henrietta Lacks) (cell line)
HRP - horseradish peroxidase
Hsp40/70/90 – heat shock 40 kDa / 70 kDa / 90 kDa protein
IBMX – 3-isobutyl-1-methylxanthine
IP – immunoprecipitation
IP3 – inositol triphosphate
IRBIT – IP3 receptor-binding protein
IRES – internal ribosome entry site
K – lysine
KD – equilibrium dissociation constant
MSD – membrane-spanning domain
NBD – nucleotide binding domain
NFM – non fat milk
NHERF1 – Na+/H+ Exchanger Regulatory Factor
10
Abbreviations
NKCC1 – Na+/2Cl−/K+ co-transporter
ORCC – outwardly rectifying chloride channel
P – phosphorylation site
PBS – phosphate buffer saline
PBS-T - phosphate buffer saline with tween
PCR – polymerase chain reaction
PDZ – post synaptic density protein (PSD95), Drosophila disc large tumor suppressor
(Dlg1), and zonula occludens-1 protein (zo-1)
PKA – protein kinase A
PLC – phospholipase C
PM – plasma membrane
PP2A – protein phosphatase 2
PPase – protein phosphatase
PS – phosphatidylserine
PYK2 – proline-rich tyrosine kinase 2
R – arginine
RD – regulatory domain
RNC – ribosome-nascent chain complex
SRP – signal recognition particle
TBS – tris buffer saline
TBS-T – tris buffer saline with tween
TM – transmembrane segments
UTP – uridine triphosphate
Vm – membrane voltage
YFP – yellow fluorescent protein
eYFP – enhanced yellow fluorescent protein
11
Introduction
1 Introduction
1.1 Cystic Fibrosis – Historical overview
Cystic Fibrosis (CF) is the most common lethal autosomic recessive disorder in the
Caucasian population. It affects 1 in 2500 to 6000 live births and has a carrier frequency
of 1 in 25 to 40 individuals. The disease frequency is variable among different ethnic
groups, being the highest in Northeastern Europe and quite rare among Oriental
populations (1:90,000)[1].
It was first described in 1938 by Anderson and colleagues (who came to find that CF
has a recessive autosomal pattern inheritance) as a digestive disorder, since the first
detectable symptoms were intestinal obstruction in newborns and malnutrition in infants,
being associated with a progressive fibrosis of the pancreatic tissue. Because infants
died at a very young age, these were the only symptoms that were noticeable. However
the healthcare developing allowed to overcome this situation and then problems in the
respiratory tract became the major cause for morbidity and mortality.
The 1950s saw the beginning of the sweat test, the standard test now used for
diagnosing cystic fibrosis. An excess of salt in the sweat of patients was identified, which
was later attributed to a defect in chloride transport in the sweat glands. This defective
chloride transport was also detected in the lung, pancreas and intestinal epithelium, the
most affected tissues[1].
In 1989, the gene responsible for the disease was identified and named Cystic
Fibrosis Transmembrane Conductance Regulator (CFTR). This gene encodes for a
cAMP-regulated chloride channel expressed in a number of epithelial tissues. It was
found to harbour mutations in all CF patients analysed, the most common of which being
a deletion of three nucleotides encoding for a phenylalanine in 508º position in the protein
(F508del or ΔF)[2]. This mutation is present in about 70% - 90% of all patients, and
represents only one of the 1949 mutations in the CF gene described until now[3].
Availability of the gene sequence and direct mutation analysis were turning points in
the history of CF and opened a new chapter of molecular and cellular studies in CF
research.
The study made through the years on this complex disease allowed the average life
expectancy of the patients to reach the 37 years, compared to a mere five years around
50 years ago and only now therapies related with the molecular basis of the disease,
resulting from an intensive study on the biogenesis and function of CFTR, are reaching
the patients.
1.2 Cystic Fibrosis – The Phenotype
Cystic fibrosis in its classic and most common form manifests with chronic obstructive
lung disease, exocrine pancreatic insufficiency, elevated sweat chloride concentration
and in males infertility due to obstructive azoospermia[4].
The respiratory tract has the biggest involvement on the clinical features of this
disease. The reduced volume of ASL and development of a thick, dehydrated airway
mucus cause the failure of mucociliary clearance, the lungs’ innate defence mechanism.
The mucociliary dysfunction leads to an ineffective clearance of inhaled bacteria
meaning recurring infections[5]. The patients’ lungs develop chronic hyperinflammation
from a very early age, exacerbating tissue remodelling processes and fibrosis.
12
Introduction
The end result of the abnormalities described above is irreversible airway damage
with bronchiectasis and respiratory failure in most patients, being the main cause of
morbidity and mortality among CF patients.
The involvement of the gastrointestinal tract is also common, with 85% of the patients
presenting pancreatic insufficiency as a result of the obstruction of the pancreatic ducts.
Around 10% of newborns with CF present a form of intestinal obstruction called
meconium ileus, and 2 to 5% develop liver complications at some time during the course
of the disease[6].
Elevated concentrations of sodium chloride in the sweat is characteristic of CF
patients; in fact, this is the basis for the already referred most common diagnostic test
for cystic fibrosis where the sweat electrolyte levels are measured[5].
Finally, in adults with CF, infertility is almost universal in males, due to congenital
bilateral absence of the vas deferens.
Most of the different therapeutic approaches that have been used in the last 25 years
focus mainly on the amelioration of these symptoms. This includes antiinflammatory and
antibiotic drugs, as well as treatments directed towards restoring the levels of airway
surface liquid, preventing mucus accumulation and overcoming the nutritional defects in
patients[7].
1.3 Cystic Fibrosis – CFTR mutations
The CFTR gene (or ABCC7) is located on the long arm of chromosome 7 (7q.31.2)
and is one of the longest in the human genome. Consists of a TATA-less promoter and
27 exons spanning about 215 kb of genomic sequence[4]. It can suffer several disease
causing mutations that can be grouped in 6 different classes, according to the functional
defect conferred by them. Class I mutations abolish protein production. Class II
mutations result in defective protein processing; this is the case of the most common
F508del mutation. Class III proteins confer defects in the regulation of the channel. Class
IV mutations have a defective ion conductance. Class V mutations result in decreased
protein synthesis. Class VI mutations decrease the protein’s stability at the cell surface.
Currently, therapeutic focused research includes a multiplicity of approaches: search
of candidate modifier proteins to identify new potential therapeutic targets and
pharmacological therapy to rescue the molecular defects responsible for CF are the most
important topics under development[7].
Kalydeco, previously named VX-770, is the first drug developed and approved by the
Food and Drugs Administration in the USA that is centred on the molecular basis of CF.
VX-770 is a CFTR Potentiator (corrects the gating defect on CFTR) approved for patients
with the G551D mutation of cystic fibrosis, which accounts for 4-5% of CF cases.
There are ongoing clinical trials for new drugs combining VX-770 with other
compounds (VX-809 and VX-661), that correct the trafficking defect of proteins with other
mutations, like F508del[8].
1.4 CFTR – Structure and function
The CFTR gene encodes a protein (1480 aminoacid residues) with a symmetrical,
multi-domain structure. The proposed domain structure was based on a comparison of
CFTR with members of the ATP-binding cassette (ABC) transporter family, being
composed of two motifs, each containing a membrane-spanning domain (MSD) that is
usually but not always composed of six transmembrane segments (TMs) and a
nucleotide-binding domain (NBD) that contains sequences predicted to interact with ATP
and harbours the F508del mutation. In CFTR, the two MSD-NBD motifs are linked by a
13
Introduction
unique domain, called the regulatory domain (RD), that contains multiple consensus
phosphorylation sites (P) many charged amino acids[9] (Figure 1.1). CFTR C-terminus is
also a highly regulatory site that binds protein kinases together with at least one
phosphatase[10]. This region is known as well to accommodate a PSD95, Dlg1, ZO-1
(PDZ)-binding motif through which it is involved in a complex PDZ-based protein
interaction networks with a number of proteins. These multivalent PDZ proteins (for
example CAP70 and NHERF1) have been proposed to regulate the gating of CFTR
channels at the plasma membrane (PM), being able to enhance CFTR channel activity
in excised inside–out membrane patches[11].
CFTR is expressed in
luminal membranes of both
secretory and absorptive
epithelia, where it works as
a
chloride
channel[13].
Contrary to other ABC
transporters,
CFTR
is
incapable of actively driving
ion transport against a
gradient;
instead,
it
functions as a passive
channel
that
allows
bidirectional flow of ions
when open[10]. Channels
like CFTR exhibit several
distinguish characteristics:
Figure 1.1 – Model of CFTR topology and Cl channel regulation.
1)
small single-channel
This schematic model shows the regulation of CFTR from an
inactive (A) to an active (B) state, through cAMP-dependent conductance (6-10 pS); 2)
phosphorylation at the RD and ATP binding and hydrolysis at the linear current-voltage (I-V)
NBDs. Retrieved from Amaral (2013)[12].
relationship; 3) selectivity for
anions over cations; 4) show
time-voltage independent gating behaviour; 5) regulated by cAMP-dependent
phosphorylation and by intracellular nucleotides. In CFTR the MSDs, the NBDs and RDs
are responsible for these features.
The MSDs contribute to the formation of the Cl—selective pore, the NBDs hydrolyze
ATP to regulate channel gating and RD phosphorylation controls channel activity[9].
CFTR channel is tightly controlled by the balance of kinase and phosphatase activity
within the cell and by cellular ATP levels.
Activation of the cAMP-dependent protein kinase (PKA) causes the phosphorylation
of multiple serine residues within the RD. Once the RD is phosphorylated, channel gating
is regulated by a cycle of ATP hydrolysis at NBDs (Figure 1.1 B). Finally, protein
phosphatases (PPases) dephosphorylate the RD and return the channel to its quiescent
state[9] (Figure 1.1 A).
The raising of intracellular cAMP is achieved in membrane-confined regions, most
likely through CFTR recruitment of its own regulatory machinery to its proximity,
comprising receptors, adenylate cyclases, phosphodiesterases and kinases (in
experimental preparations, increased cAMP is attained through global stimulation of the
adenylate cyclase by forskolin (FSK or F), which floods the entire cytosol with cAMP and
it is not compartmentalized). The formation of multiple-protein macromolecular
complexes in subcellular microdomains increases the specificity and efficiency of
signalling towards CFTR and the membrane-local cAMP concentrations can further be
controlled by cell excretion. The previously mentioned C-terminal region of CFTR is
essential for this process interacting with proteins carrying ERM (ezrin, radixin, moesin)
domains that link the CFTR complex to the cortical actin network enabling then an
extensive network of protein interactions[10].
14
Introduction
Besides this function as a Cl- channel CFTR can also act as a Cl-/HCO3- exchanger.
It was observed that after stimulation of colonic human cells with FSK the Cl-/HCO3exchange activity was increased and that was independent of CFTR Cl- channel
activity[14].
CFTR is also involved in glutathione transport. Through macroscopic current
recordings from excised membrane patches, was observed that glutathione is permeant
in the CFTR channel. This permeability may account for the high concentrations of
glutathione that have been measured in the ASL. Furthermore, loss of this pathway for
glutathione transport may contribute to its reduced levels observed in the airway surface
fluid of cystic fibrosis patients, which has been suggested to contribute to the oxidative
stress observed in the lung in this disease[15].
CFTR not only generates a Cl- conductance but also controls a number of other ion
channels. These include the calcium-activated chloride channel (CaCC) and the
outwardly rectifying chloride channel (ORCC). It has been reported that CFTR inhibits
endogenous Ca2+ activated Cl- currents in Xenopus oocytes, bovine pulmonary artery
endothelium and isolated parotid acinar cells[16–18]. CaCC was also found to be
augmented in airways of patients suffering from cystic fibrosis[19].
The ORCC regulation by PKA was found to be defective in CF airway epithelia when
compared with that of normal epithelia and, once complemented with the WT-CFTR
gene, PKA regulation of ORCCs was corrected[20, 21]. In 2008, the long search for the
Ca2+ activated Cl- channel, succeeded in the identification of the Anoctamin protein family
as CaCC[10, 22, 23]. These proteins may represent a family of Ca2+-activated Cl- channels
with different affinities for Ca2+. Kunzelmann and colleagues found that the Ca2+activated Cl- channel function of anoctamin 1 (Ano1; TMEM16A) was inhibited during
activation of CFTR, while CFTR currents were attenuated by overexpression of
Anoctamin 1[16].
Also to ORCC an association with the anoctamin family was found. Recently the main
component of these ORCCs was identified as Anoctamin 6 (Ano6; TMEM16F)[24]. It is
now established that expression and activation of CFTR induces a typical CFTR Cl−
conductance and in parallel activates outwardly rectifying Cl− currents[24, 25].
This subject will be followed with more detail on section 1.6.
It is also known the interaction between CFTR and other proteins like the epithelial
sodium channel (ENaC) and KVLQT-1 K+ channels.
Na+ conductance was found enhanced in apical membranes of lung epithelia and
intestinal mucosa of CF patients and an inhibition of ENaC by CFTR was also detected
in rat colonic epithelial cells and in normal human but not in CF airways[25].
The K+ conductance was discovered to be enhanced when CFTR was expressed in
Xenopus oocytes and activated by intracellular cAMP[25].
1.5 CFTR – Folding and trafficking
CFTR folding and intracellular trafficking are highly regulated processes that once
disrupted lead to abnormalities of water, chloride, and/or bicarbonate transport which
results in the already referred dysfunction of target tissues including: pancreatic
insufficiency, increased sweat chloride, intestinal obstruction, and most importantly,
chronic pulmonary infection, inflammation, and ultimately death due to respiratory
failure[26, 27].
In CFTR biogenesis only 20%-40% of newly synthesized nascent chains acquire the
native conformation, exit the endoplasmic reticulum (ER), and undergo complex
glycosylation in the Golgi compartment[28]. Biogenesis occurs at the ER, and requires
coordinated folding of individual domains in three distinct cellular compartments: the ER
membrane, the ER lumen, and the cytosol. This compartmentalization takes place as the
nascent chain emerges from the ribosome[26]. NBD1 domain folds largely co15
Introduction
translationally, but the native structure of NBD2 and, hence, of the full channel are
attained post-translationally[28].
CFTR, as membrane protein, is firstly targeted to the surface of the ER during
synthesis by the cytosolic signal recognition particle (SRP), bringing the ribosome
nascent chain complex (RNC) to the Sec61 translocon complex, which co-translationally
inserts the protein in the ER membrane[26]. The folding process is then facilitated by a
large cohort of cytosolic and luminal chaperones including Hsp70, Hsp40, Hsp90,
calnexin, calreticulin and others[29]. Cytosolic chaperone interactions begin cotranslationally during synthesis as Hsp/c70 binds and presumably shields extended
hydrophobic regions of the nascent chain to prevent aggregation. Whereas the luminal
chaperones calnexin and calreticulin promote the ER retention of core glycosylated
CFTR folding intermediates until their folding cycle or degradation is completed[28].
During the maturation process, CFTR goes through several steps of glycosylation, first
in the ER and then in the Golgi apparatus. In the ER, a branched 14-unit oligosaccharide
is added at asparagine residues 894 and 900 in the fourth extracellular loop in a process
called N-glycosylation or core-glycosylation[30], which stabilizes the CFTR folding
directly[28]. This high-mannose oligosaccharide core is then processed by glucosidases
and the resulting monoglucosylated intermediate can be recognised by luminal
chaperones that prevent unwanted interactions and aggregation with other molecules.
The protein then dissociates from calnexin/calreticulin and has its last glucose residue
removed.
Less than 30% of newly synthesized immature CFTR molecules ever acquire complex
oligosaccharides indicative of maturation to post-ER compartments, which indicates a
relatively high inefficiency in this process[31].
If the folding is incorrect the chaperone–CFTR interaction triggers the ubiquitinationdependent endoplasmic-reticulum-associated protein degradation (ERAD). Distinct E3
Ub ligases are responsible for the co- and post-translational ubiquitination of non-native
CFTRs that recognize misfolding of the N- and C-terminal CFTR regions[28].
Most of the CFTR bearing the F508del mutation is degraded before evading the ER
into the Golgi by the endoplasmic reticulum quality control (ERQC) system[32].
On the other hand, if the folding is successful CFTR is released from the ER, loaded
into COP II-coated vesicles that traffic to the Golgi, where the major glycan processing
occurs. Other nonconventional trafficking pathways have also been described for
CFTR[33].
In the Golgi complex, CFTR is processed by multiple Golgi glycosyltransferases,
creating the fully mature form of CFTR that is incorporated into secretory vesicles and
delivered to the apical membrane where these bulky glycans are exposed to the
extracellular space.
While at the PM, CFTR can be recycled from early endosomes back to the PM, via
Rab11/ Myo5b-driven recycling endosomes[34], or driven away from the recycling
pathway into late endosomes, by Rab7, followed by degradation[35].
The CFTR internalization into the PM is a rapid process compared with CFTR
biosynthesis and maturation, which suggests that is this last step of recycling of
internalized channels the key process in maintaining a functional pool of CFTR at the
PM[33].
1.6 CFTR and Anoctamins
1.6.1 Crosstalk between cAMP and Ca2+ signalling
16
Introduction
CFTR is not only a regulator of multiple transport proteins controlled by numerous
kinases but also participates in many signalling pathways that are disrupted in CF[10].
cAMP activation pathway and Ca2+ signalling were, for a long time, considered
independent entities. However, lately crosstalk between cAMP (involved in CFTR
activation) and Ca2+ dependent secretion has been suggested and may occur at different
levels. There is evidence for at least five Ca2+-dependent mechanisms of CFTR
activation: 1) through P2Y2 receptors (G-protein coupled purinergic nucleotide
receptors) and phospholipase C (PLC), 2) upregulation of adenylyl cyclase by Ca2+
leading to conventional PKA-mediated phosphorylation of CFTR, 3) stimulation of
PYK2/Src, which inhibits protein phosphatase 2 (PP2A) and thus increases serine
phosphorylation on CFTR, 4) direct tyrosine phosphorylation of CFTR by the PYK2/Src
complex, and 5) interaction with inositol triphosphate (IP3) receptor-binding protein
(IRBIT) released with IP3.
Kunzelman and coworkers showed that stimulation of P2Y2 receptors leads to
activation of CFTR Cl- currents but once PLC (or calmodulin-dependent kinase (CAMK))
is inhibited, both CaCC and CFTR activation are completely abolished[36].
There is also evidence for CFTR activation through calcium-stimulated adenylyl
cyclases. Verkman and colleagues showed that most chloride current elicited by Ca2+
agonists in primary cultures of human bronchial epithelial cells is mediated by CFTR
through a mechanism involving Ca2+ activation of adenylyl cyclase I (AC1) and
cAMP/PKA signalling[37].
Some other data supporting the cAMP/Ca2+ crosstalk suggest the involvement of
tyrosine kinases in CFTR activation. In cells expressing the M3 muscarinic acetylcholine
receptor (known to mobilize Ca2+ when activated), the agonist carbachol (Cch) caused
strong activation of CFTR through two pathways; the canonical PKA-dependent
mechanism and a second mechanism that involves tyrosine phosphorylation by Src[38].
The Proline-rich tyrosine kinase 2 (PYK2) is another tyrosine kinase involved in this
activation process. It was found that the inhibition of PYK2 notably reduced the ability of
spiperone to increase intracellular Ca2+ and Cl- secretion, playing a crucial role in the
activation of CaCC and CFTR[39].
This tyrosine kinase pathway can still influence CFTR activation through the activity
of a protein phosphatase. PP2A, known to cause CFTR dephosphorylation, is strongly
inhibited when phosphorylated by Src. Therefore, Ca2+-dependent activation of Src can
enhance channel activity by inhibiting the dephosphorylation of PKA sites on CFTR[40].
cAMP can also enhance Ca2+ release from intracellular stores by stimulating PKA
phosphorylation of the IP3 receptor. The IP3 receptor normally interacts with a protein
called IRBIT, which inhibits IP3 receptor channel function and it is released when the
receptor binds IP3. After dissociation from the endoplasmic reticulum, IRBIT can interact
and regulate the activity of several transporters at the PM, including the sodium
bicarbonate co-transporter and CFTR[41, 42].
The ultimate crosstalk between cAMP and Ca2+ is the one during transepithelial
transport, where a potential relationship between CFTR and CaCCs is suggested.
Notably enhanced Ca2+ activated Cl− currents have been detected in the airways of
CFTR-knockout mice, in numerous studies with primary or permanent human airway
epithelial cell lines and in native CF tissues[10, 43]. On the other hand, some results show
that CFTR has an inhibitory effect on CaCCs[44]. Nonetheless, an interaction between
these two entities is suggested.
1.6.2 Calcium-activated Chloride Channels
CaCCs are widely expressed and can be found in neurons; various epithelial cells;
olfactory and photo-receptors; cardiac, smooth, and skeletal muscles; Sertoli cells; mast
cells; neutrophils; lymphocytes; uterine muscle; brown fat adipocytes; hepatocytes;
insulin-secreting beta cells; mammary glands; sweat glands; and Vicia faba guard cells.
17
Introduction
They are involved in several physiologic processes as membrane excitability in cardiac
muscle and neurons[45, 46], olfactory transduction[46], regulation of vascular tone[47],
modulation of photoreceptor light responses[48] and, most importantly for this thesis, in
epithelial secretion[19, 49–51].
The primary function of Cl− channels in secretory cells is transepithelial ion transport.
Three factors dictate the direction of Cl− movement through CaCCs: the membrane
potential, the Cl− concentration gradient and the concentration of intracellular calcium in
the 0.2–1.0 µM range[48]. Firstly, Cl− is taken up by the basolateral Na+/2Cl−/K+ cotransporter NKCC1. Na+ is pumped out by the basolateral Na+/K+-ATPase and
basolateral K+ channels recycle K+ to the basolateral side leading to hyperpolarization of
the membrane voltage (Vm) and supplying the necessary driving force for luminal Cl−
exit. The activation of CaCC by intracellular Ca2+ signals is elicited through ATP
stimulation of luminal Gq-coupled P2Y purinergic receptors inducing the increase of IP3
production, or through basolateral hormonal stimulation[43] (Figure 1.2).
When compared with cAMP/CFTR dependent Cl− secretion, Ca2+/CaCC-dependent
secretion is much less sustained, due to the transient nature of the intracellular Ca2+
signal.
These channels are also characterized to
have the halide selectivity of SCN- > NO3- >
I- >Br- > Cl- > F-, whereas the high
permeable ions influence the channel
activation accelerating it and slowing down
deactivation[48].
It is believed that CaCCs act as an acute
regulator of the airway liquid layer. Their
contribution to the liquid layer homeostasis
in murine airway epithelium probably
explains the lack of a lung phenotype in
mouse models of cystic fibrosis[52].
Given that both CFTR and CaCCs are
apical Cl− channels and a functional
Figure 1.2 - Model for cAMP and Ca2+
interaction seems to be present, it has been dependent Cl− secretion in airways. Retrieved
proposed that the activation of CaCCs could from Kunzelmann (2012)[43]
serve as a bypass therapy for cystic fibrosis,
but until recently this line has been hampered by the lack of specific activators of CaCCs
and by the uncertainty about the molecular identity of these channels. In 2008, the search
for the identity of these CaCCs came to a conclusion with the identification of anoctamin
1 (Ano1; TMEM16A) and anoctamin 2 (Ano2; TMEM16B)[22, 23, 53].
1.6.3 Anoctamins
Anoctamins are a family of ten different proteins, Anoctamin 1-10 (Ano1-10;
TMEM16A-K), being Anoctamin 1 the one studied in more detail.
Anoctamins tissue expression has a big overlay with CaCCs. They can be found in
sensory receptors, different types of smooth muscles, heart, endothelium, neuronal
tissues, and epithelial organs[54].
Anoctamins have eight putative TMs with both NH2 and COOH termini protruding into
the intracellular medium. Based on mutagenesis experiments that resulted in altered ion
selectivity, it has been proposed that TM5-TM6 flank a re-entrant loop thought to form
the pore. It is because of these eight transmembrane segments structure and the anion
selectivity that these proteins have been called Anoctamins[55, 56]. Specifically for Ano1 it
is suggested the presence of several cysteine (C) and charged amino acids (like arginine
(R) and lysine (K)) on the pore loop region, at least one glycosylation site at the last
18
Introduction
extracellular loop, the existence of non-canonical calcium-modulated protein (CAM)
binding sites in the N-terminus and two putative extracellular signal-regulated protein
kinase 1 and 2 (Erk1, 2) phosphorylation sites in the C-terminus (Figure 1.3).
This protein family is also known to
be a target for cell alternative splicing.
For Ano1 this process involves the
skipping/inclusion of at least three
alternative segments, called b, c, and
d, corresponding to exons 6b, 13, and
15 and the possibility of a fourth
region (segment a), located on the
NH2 terminus, to be skipped when an
alternative promoter is used (Figure
1.3)[54, 55]. Four splicing isoforms of
the olfactory Ca2+-activated Clchannel Ano2 were detected, with
Figure 1.3 - Model for Ano 1 topology. Retrieved from
two alternative starting exons and
Kunzelmann (2011)[54]
alternative splicing of exon 4[57]. On
intracellular membranes in muscle,
Ano5 suffers an extensive alternative splicing generating 14 different isoforms[58]. For
Ano6 four isoforms are known[59] and two for Ano7[60].
Even if the sequence homology within the putative pore region is considerable,
Anoctamins overall homology is only moderate[54]. Mammalian subfamilies 1 and 2 are
closely related, with about 60% amino acid identity, as are 3 and 4, and 8 and 10[58],
although these only demonstrate an identity around 30% or below (Figure 1.4). The Ano
family is now the second largest of the five known Cl− channel families (CLC, CFTR,
ligand-gated GABA and glycine receptors[61], bestrophins[62] and anoctamins), being
ligand-gated GABA and glycine receptors the largest.
19
Introduction
Figure 1.4 – Phylogeny of the Anoctamin family. Retrieved from Hartzell 2009[58]
This molecular heterogeneity can be seen in the phenotypic diversity of CaCC
currents. There appear to be at least four different types of CaCCs in different cell types
and the channels may have multiple conductance states. Within the low conductance (13 pS) CaCCs class, the channels can exhibit either linear or outwardly rectifying I-V
curves, equilibrium dissociation constant (KD) values for Ca2+ over a 500-fold range,
variable voltage sensitivity, and different susceptibility to rundown after excision of the
patch. Rundown after patch excision has been interpreted to suggest that the channels
are regulated by a factor which is lost upon excision[48].
CaCCs channels with higher conductances (8 pS) can exhibit linear I–V relationships
(the case of Ano1 in HEK cells[22]).
The highest conductance channels (40–50 pS), seen in airway epithelial cells[63]
among other tissues, are outwardly rectifying. Whether these variances are explained by
20
Introduction
different Ano members or different heteromeric combinations of Anos remains to be
seen.
Until now, Cl− channel activity has been clearly identified for Ano 1 and Ano 2[23, 64]
and some Ca2+-activated Cl− currents generated by Ano 6 and Ano 7 were found, while
Ano 5, 8, 9, and 10 did not produce any measureable currents[65], and Ano 7, -8, -9 and
-10 were even detected mostly intracellular and not on the cell surface[66]. Ano1 was
actually identified as the essential component for Ca2+-dependent Cl-secretion in several
epithelial tissues and mucociliary clearance of mouse airways by studies of Cl- transport
in Ano1 null mice[67].
On the other hand, Ano6 showed to induce Ca2+-dependent translocalization of
phosphatidylserine (PS) from the inner leaflet of the PM to the outer leaflet (scramblase
activity) and is therefore essential for platelet aggregation[68]. Ano6 also presents
properties of an ORCC[24]. These channels are known to: 1) be activated upon excision
of the cell membrane from the intact cell and after strong depolarization[69], 2) have
single-channel conductance between 30-70 pS, 3) have the halide sequence of I- > Cl- >
Br-, 4) have a outwardly rectifying current/voltage (I/V) relation and 5) be activated by
cAMP and PKA and through extracellular UTP[70–72].
Interestingly, anoctamins are even able to interact with each other influencing their
function. Ano 9 and Ano 10 both suppress baseline Cl- conductance (maintained by Ano
6 among other proteins) as well as ATP-induced and ionomycin-induced (produced by
Ano 1) anion conductances. Also co-expression of Ano 9 with Ano 1 showed to inhibit
Ano 1 activity [66, 73].
Another difference between anoctamins is cell localization. Ano 1, 2, and 6 are well
expressed in the PM, while Ano 5, 7, 8, 9, and 10 were much less membrane localized,
which probably has a substantial impact on the current size[65, 74].
1.6.4 Interaction between CFTR and Anoctamins
As previously referred CFTR can interact with several proteins, among them are
Anoctamins.
In bovine pulmonary artery endothelial (CPAE) cells[17], Xenopus oocytes[44], and
mouse parotid acinar cells[18] expression of CFTR reduces calcium-activated chloride
currents. Even more interesting, was found that these currents were increased in airway
epithelial cells from CF patients and CF mouse models[19, 75, 76].
Being Ano1 the major component of CaCC is the anoctamin that showed more
relation with CFTR. While studying the effects of variations of the extracellular pH on
CFTR, Kunzelmann and co-workers observed that endogenous Ca2+- dependent Ano1
Cl- currents present in Xenopus oocytes are activated by extracellular protons, however,
only when CFTR is expressed[13].
Other recent data suggests that Ano1 currents are attenuated by additional
expression of CFTR and totally abrogated when additional CFTR is activated. CFTR
currents also revealed to be attenuated by overexpression of Anoctamin 1[16], revealing
an inverse relationship.
On experiments performed on Ano1 knockout mice models was found a reduced
particle transport in their tracheas, suggesting impaired mucociliary lung clearance in
these animals[43, 67]. In fact, they may develop a lung phenotype that is similar to that of
CF patients[43, 77].
Although CaCCs appear enhanced in CF, it is nevertheless not able to compensate
for defective CFTR. This is explained by an only small contribution of CaCC to human
airway Cl− secretion and by the fact that activation of CaCC is largely transient, in
contrast to the permanent CFTR-dependent Cl− secretion. So a deeper knowledge of
CaCC function, activation and mechanism of interaction with CFTR is absolutely
necessary.
21
Introduction
Another anoctamin that seems to interact with CFTR is Ano6 (TMEM16F). Recently
was found that TMEM16F is the crucial component of ORCC single-channel and wholecell currents in airway epithelial cells and Jurkat T lymphocytes, being activated during
membrane depolarization or apoptosis[24]. For a long time now ORCC is known to be
regulated by CFTR, such that in CF ORCC is unresponsive to cAMP-dependent stimuli[69,
70]
. Schwiebert and colleagues proposed that CFTR regulates ORCCs by triggering the
transport of ATP out of the cell, stimulating ORCCs afterwards through a purinergic
receptor-dependent signaling mechanism[21], though this model is not fully accepted and
the ATP transport through CFTR has not been well proven.
However, just now the molecular identity of ORCC came to light with the discovery of
Anoctamins and Ano6 whose ORCC currents showed to be augmented by CFTR in A549
airway epithelial cells[24].
It was also proposed that cAMP/PKA-dependent activation of chloride transport by
CFTR and ORCC requires mobilization of a multi-protein complex involving the calcium
binding proteins annexin 2, S100A10 and the immune suppression target and
phosphatase calcineurin A. Disruption of the annexin A2-S100A10/CFTR complex in wild
type cells significantly attenuates CFTR function and obtunds CFTR- regulated ORCCs
that generate ORCC-mediated currents[78].
These data suggest a possible interaction between CFTR and Ano6, whether physical
or purely functional is still unknown.
It’s possible that CFTR and TMEM16A/F may interact directly or through scaffold
proteins such as NHERF1 or other PDZ-domain proteins. NHERFs are majorly localized
at the cell surface, so it is normal that most of NHERF targets are membrane proteins,
ion transporters, and receptors, specifically G protein-coupled receptors (GPCRs). The
interaction between CFTR and other ion channels/transporters and NHERF1 is already
well established, and is known that NHERF-1-bound CFTR is more efficiently
phosphorylated by an ezrin-bound PKA leading to the increasing of chloride transport[79–
81]
. Some recent studies demonstrating that CFTR translocates Gq-coupled receptors to
the PM of Xenopus oocytes allowing for Ca2+ increase and activation of TMEM16A[13, 43]
are a reinforcement of the CFTR/Anoctamins interaction through PDZ binding proteins
hypothesis. Nonetheless, more studies need to be performed to confirm or discard this
assumption.
Summarizing, in the presence of wild-type CFTR, parallel activation of CFTR and
outwardly rectifying anoctamin 6 Cl- channels is observed, while the Ca2+-activated
anoctamin 1 Cl- channel is inhibited. In contrast, in CF cells, CFTR is
missing/mislocalized and the outwardly rectifying chloride channel is attenuated while
anoctamin 1 currents appear upregulated.
These evidence for CFTR/Anoctamins interaction allow us to think in terms of possible
alternative pharmacological targets for cystic fibrosis that lead to a more sustained Clsecretion in the patients. However a more detailed knowledge about the relationship
between these two protein families is needed.
22
Objectives
2 Objectives
The aim of the present work was to study the type of interaction between CFTR and
Anoctamins, more specifically Ano1 and Ano6 as well as to assess the significance of
both WT- and F508del-CFTR on these two anoctamins genesis, trafficking and function.
There were already some evidences of a functional relationship, however the extent of
this interaction and the possibility of communication on other levels are still unknown.
In order to achieve this goal several milestones were elaborated, namely:
- To evaluate Ano1, -6, -9 and -10 endogenous expression on cells expressing
either WT-CFTR or F508del-CFTR by semi-quantitative PCR;
- To evaluate Ano1 and Ano6 cell localization by immunofluorescence assays,
when co-expressed with WT- and F508del-CFTR;
- To evaluate direct interaction between CFTR/Ano1 and CFTR/Ano6 using coimmunoprecipitation technique;
- To evaluate the role of PDZ BD on CFTR/Ano1 possible physical interaction
through co-immunoprecipitation of CFTR/Ano1 PDZ BD mutant;
- To study the influence of WT-CFTR and F508del-CFTR on Ano1 and Ano6
currents and compare with previously existent data.
23
Materials and Methods
3 Materials and Methods
3.1 Cell Culture
3.1.1 Mammalian Cell Lines and Culture Conditions
Cystic Fibrosis Bronchial Epithelial (CFBE41o-) cells[82], from now on referred as just
CFBE cells, overexpressing WT-CFTR or F508del-CFTR with an mCherry tag and under
tet-on promoter induction. Cells were cultured in MEM, GlutaMAXTM (Life Technologies
- Gibco®, 41090-036) media supplemented with 10% fetal bovine serum (FBS; Life
Technologies - Gibco®, 10437-028) and 1% Penicillin-Streptomycin (Life-Technologies,
15140148), in plastic flasks or plates coated with LHC basal medium (Life Technologies,
12677-019), 0.1mg/mL bovine serum albumin, fraction V (Roche Applied Science,
10735078001), 29μg/mL collagen from rat tail (Roche Applied Science, 11179179001)
and 10μg/mL fibronectin (Roche Applied Science, 10838039001).
HeLa Kyoto cells[83, 84] and Human Embryonic Kidney (HEK293) cells were cultured in
DMEM, GlutaMAXTM (Life Technologies - Gibco®, 10566-016) media supplemented with
5% FBS and 1% Penicillin-Streptomycin.
Baby hamster kidney (BHK) cells[85] stably expressing either WT- or F508del-CFTR
proteins were cultured in DMEM/F-12, GlutaMAXTM (Life Technologies - Gibco®, 10565018) supplemented with 5% FBS and 500 µM methotrexate (Merck Millipore, 454126100MG or Sigma-Aldrich, M8407-100MG).
All cell lines were cultured in an incubator with humidified atmosphere of 5% CO 2 at
37°C.
3.1.2 Transfections
All transfections were performed using LipofectamineTM2000 transfection reagent
(Invitrogen, 11668-019) according to the manufacture’s guidelines. All experiments were
executed after 48 to 72 hours transfection.
3.2 Molecular Biology
3.2.1 Plasmid vectors
The FLAG-tag was inserted into Ano1, 6 and 9 which were already fused with yellow
fluorescent protein (YFP), cyan fluorescent protein (CFP) and green fluorescent protein
(GFP) at the C-terminus and cloned into pcDNA3.1 vectors. See cloning details on
section 3.2.5. Afterwards, these vectors were transfected into HeLa Kyoto and HEK293
cells in order to evaluate the mutagenesis success.
For the immunocytochemistry and patch clamp techniques BHK WT- and F508delCFTR cells were transfected with the bicistronic pIRES vectors encoding for human
Anoctamin 1 and 6 fused with GFP at the C-terminus and for CD8
24
Materials and Methods
pcDNA3.1 vectors carrying cDNA for human Ano1 and Ano6 GFP at the C-terminus
and bicistronic pIRES vector encoding for human Anoctamin 1 single-mutated on the
PDZ BD (L982A) and for CD8 were transfected into BHK cells overexpressing WT- and
F508del-CFTR for the co-immunoprecipitation assays.
Maps and cloning schemes can be found on section 8 Appendices.
3.2.2 Competent bacteria production and transformation
The bacterial strain used for cloning and DNA amplification was XL1-Blue
(Stratagene, La Jolla, CA, USA), which is tetracycline resistant.
Bacteria were plated in LB-agar medium supplemented with tetracycline and a single
colony was used to inoculate a small volume of LB medium overnight at 37°C with
vigorous shaking (220 rpm). This pre-culture was then used to inoculate at 1/100 dilution
a larger volume of LB medium, typically 100 ml, which was also grown at 37°C (220 rpm)
to final concentration of 5 × 107 bacteria/ml (corresponding to an absorbance of 0.3 at
600 nm). Bacteria were transferred to ice and pelleted by centrifugation (1000xg for 15
minutes at 4°C). The bacterial pellet was then ressuspended, incubated on ice for 15
minutes in 33mL RF1 buffer (100 mM RbCl, 50mM MnCl2, 30 mM KCH3COO pH 7.5, 10
mM CaCl2, 15% (w/v) glycerol, pH 5.8; all from Sigma-Aldrich, St. Louis, MO, USA) and
re-pelleted by centrifugation (1000xg for 15 minutes at 4°C). This second pellet was
ressuspended and incubated on ice for 15 minutes in 8.3mL RF2 buffer (10 mM MOPS,
10mM RbCl, 75mM CaCl2, 15% (w/v) glycerol, pH 6.8; all from Sigma-Aldrich). 200 μl
aliquots were then rapidly frozen with liquid nitrogen and stored at -80°C.
To perform bacteria transformation, an aliquot of competent bacteria was incubated
with 5-20 ng of plasmid DNA for 30 minutes on ice. Afterwards they were submitted to
heat shock, 1 minute 30 seconds at 42°C followed by 2 minutes on ice, and grown in LBmedia without antibiotic for 1h at 37°C with shaking (300 rpm), in order to allow antibiotic
resistance to be expressed.
The bacteria were then centrifuged for 2 minutes at 6000 rpm, the pellet was
ressuspended in the few rests of supernatant and plated on LB-agar plates with
100µg/mL of selection antibiotic (ampicillin; Sigma-Aldrich, A0166-5G) which were
incubated overnight at 37°C.
Finally, the transformed bacteria were grown in LB-media supplemented with
100µg/mL of selection antibiotic (ampicillin) and plasmid DNA was extracted. Clones
were stored in liquid LB-media supplemented with 15 % (w/v) glycerol (Sigma-Aldrich,
G5516-500ML) at -20°C.
3.2.3 DNA extraction
Small, medium and big scale plasmid DNA were purified with NZYMiniprep kit
(NZYtech, MB01001), NucleoBond® Xtra Midi kit (Macherey-Nagel, 740412.50) and
NZYMaxiprep kit (NZYtech, MB0510), respectively accordingly with manufacturer’s
guidelines.
DNA concentration was afterwards determined by measurement of absorbance at
260nm using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA,
USA) and its purity was evaluated by assessment of the ratio A260/A280. Only DNA with
a ratio above 1.8 was considered pure enough for further use.
3.2.4 DNA sequencing
25
Materials and Methods
The sequencing reactions were outsourced to StabVida, by Sanger method and using
BigDye Terminator 3 (Applied Biosystems) and analysed in an ABI 3730XL sequencer
(Applied Biosystems). Sequencing primers used for Ano1 plasmids sequencing were
ANO1 seq1_F (forward primer, sequence 5’-GTGGCTGAGCACAGGC-3’), ANO1
seq2_F (forward primer, sequence 5’-CTTCATGGAGCACTGG-3’), ANO1 seq3_F
(forward primer, sequence 5’-CTGAAGCTGAAGCAGC-3’), ANO1 seq4_FP_F (forward
primer, sequence 5’-GGAGCGGCAGAAGG-3’); for Ano6 the primers used were ANO6
seq1_F (forward primer, sequence 5’-GGGATCAACAGAC-3’), ANO6 seq2_F (forward
primer, sequence 5’-GGCTCTCGGTGTTC-3’), ANO6 seq3_F (forward primer,
sequence 5’-GAGCATGGCAGCCC-3’) and ANO6 seq4_F (forward primer, sequence
5’-CATGAGAATCACC-3’); for Ano9 the primers used were ANO9 seq1_F (forward
primer, sequence 5’-CTGAGCGGATTCTC-3’), ANO9 seq2_F (forward primer,
sequence 5’-GAGTGCCACGCCAG-3’) and ANO9 seq3_F (forward primer, sequence
5’-GCCATCCGCCTG-3’). All sequencing primers were obtained through StabVida.
The resulting sequences were analysed using the software Geneious
(http://www.geneious.com/) by comparison with the reference human Ano1, Ano6 and
Ano9 sequences (NCBI reference sequence NM_018043.5, NM_001025356.2 and
NM_001012302.2, respectively).
3.2.5 Mutagenesis
FLAG tag (5’-GATTACAAGGATGACGACGATAAG-3’) was introduced in frame into
Ano1, Ano6 and Ano9, already fused with fluorescent proteins and cloned into pcDNA3.1
(see templates on section 8 Appendices), using KOD Hot Start DNA Polymerase Kit
(Novagene, 71086-3) with partially complementary pairs of mutagenic primers presented
on Table 3.2. Primers were designed with the software PrimerX
(http://www.bioinformatics.org/primerx). The mutagenesis reaction is a regular PCR
reaction with the programs described on Table 3.1.
After confirming the DNA amplification by agarose gel electrophoresis, the PCR
products were incubated, for 1h, with DpnI (Invitrogen, 15242-019), a restriction
enzyme that specifically hydrolyzes methylated and semi-methylated DNA, therefor
degrading the non-amplified DNA.
The resulting non-degraded DNA was used to transform competent bacteria (see
section 3.2.2) and then the DNA was extracted as described on section 3.2.3.
To assess for correct DNA content, 1 µg of each plasmid was digested by the
restriction enzymes PstI (New England Biolabs, R0140) and SspI (New England Biolabs,
R0132) for 1 hour at 37°C and also sent for DNA sequencing as described on section
3.2.4.
All the plasmid maps can be found on section 8.
Table 3.1 – PCR programs for mutagenesis
Template
Ano1 eGFP
Ano1 YFP
Ano1 CFP
Ano6 eGFP
Ano9 eGFP
Temperature
(°C)
95
95
56
70
95
95
48
70
95
Time
2min
20sec
10sec
4min
2min
20sec
10sec
4min
2min
Number
cycles
of
23
23
23
26
Materials and Methods
95
53
70
20sec
10sec
4min 30sec
Table 3.2 – Primers for FLAG-tag cloning
Template
FLAG-tag insertion primers
Forward
Reverse
*Ano1
eGFP
*Ano1 YFP
5’-GAGATGTGTGACCAGAGACAC
GATTACAAGGATGACGACGATAAG
AATATTACCATGTGCCCGCTTTG-3’
5’-CAAAGCGGGCACATGGTAATATT
CTTATCGTCGTCATCCTTGTAATC
GTGTCTCTGGTCACACATCTC-3’
*Ano1 CFP
**Ano6
eGFP
5’-CTGATATTGGTGGCAAGATC
GATTACAAGGATGACGACGATAAG
ATAATGTGTCCTCAGTGTG-3’
5’-CACACTGAGGACACATTAT
CTTATCGTCGTCATCCTTGTAATC
GATCTTGCCACCAATATCAG-3’
5’-GGAGATCTGTGAGGCCCAC
5’-CGCCGAGGGGACACATGAG
GACGATTACAAGGATGACGACGAT
GATCTTATCGTCGTCATCCTTGTAAT
AAGATCCTCATGTGTCCCCTCGGC
CGTCGTGGGCCTCACAGATCTCC-3’
G-3’
* Primers provided by Dr. Rainer Schreiber (University of Regensburg)
** Primers obtained by HPLC-purification through Thermo Scientific
**Ano9
eGFP
3.2.6 RNA extraction, DNaseI treatment, reverse transcription and semiquantitative PCR
CFBE mCherry-WT- and mCherry-F508del-CFTR expressing cells were culture on
p35mm dishes (Greiner bio-one, 627160), induced to express CFTR with 1 µg/mL
doxycycline for 24 hours and stimulated for channel activation with 100 µM IBMX
(competitive nonselective phosphodiesterase inhibitor that leads to reduction of cAMP
degradation) and 2 µM FSK (activates adenylyl cyclase which leads to higher cAMP
levels). Total RNA was extracted by adding 1ml / dish of Trizol (Invitrogen, 15596-026).
The cells were then lysed directly in the culture dishes by pipetting them up and down
several times and collected. Following homogenization, the lysates were centrifuged at
12,000xg for 10 minutes at 4°C, the clear supernatants were transferred to a new tube
and incubated at room temperature for 5 minutes. Afterwards 0.2mL of chloroform were
added to each sample and they were vigorously shaken by hand for 15 seconds and left
to incubate at room temperature for 3 minutes. After centrifuge at 12000xg for 15 minutes
at 4°C, the colorless upper aqueous phase formed, containing the RNA, was collected
and incubated with 0.5 mL of 100% isopropanol per sample, at room temperature for 10
minutes. Another centrifugation at 12000xg for 10 minutes at 4°C was performed to
obtain the RNA pellet. Finally, the pellets were washed with 1mL of 75% ethanol per
sample, vortexed briefly, centrifuged at 7500xg for 5 minutes at 4°C and the RNA pellets
were left to air dry for 5-10 minutes. After drying the pellets were ressuspended in 10µL
of RNase-free water and quantified using the Nanodrop 2000 spectrophotometer
(Thermo Scientific, Waltham, MA, USA).
The samples were then submitted to a DNaseI treatment to degrade any DNA
contamination in a procedure executed all on ice. 500 ng of RNA from each sample were
added to a tube previously filled with RNase-free water and 0.5 µL of (10x) Reaction
27
Materials and Methods
Buffer (Invitrogen, 18068015) and afterwards 0.5 µL of DNaseI (1U/µL; Invitrogen,
18068015) was added (final volume of 5 µL). The mixtures were subsequently incubated
at 37ºC for 15 minutes, to be at the enzyme optimal temperature condition, and then the
reaction was stopped by adding 0.5 µL of the enzyme inhibitor EDTA (25 mM; Invitrogen,
AM9260G) and incubating the samples at 65°C for 15 minutes, to heat inactivate DNaseI.
Finally, the samples were placed on ice for 1 minute and used to generate cDNA by
reverse transcription.
In order to obtain cDNA, the previous samples (5.5 µL) were mixed, on ice, with 0.5
µL of a random hexamer primer (Invitrogen, N8080127), 0.5 µL of a dNTP mix (final
concentration 0.5 mM; Invitrogen, 18427-013) and 1.5 µL of RNase-free water. The mix
was incubated at 65 °C for 5 minutes, next chilled on ice for at least 1 minute and finally
the reverse transcriptase mixture (1µL of 10x Reaction Buffer (NZYtech, MB0830); 0.5µL
of NZY Ribonuclease Inhibitor (NZYtech, MB0840) and 0.5µL of NZY M-MuLV Reverse
Transcriptase (200U; NZYtech, MB0830)) was added. After gently mixing and briefly
centrifuge, the samples were incubate first at 25°C for 10 minutes and second at 37 °C
for 50 minutes. The reaction was inactivated by heating at 70 °C for 15 minutes.
CFBE WT- and F508del-CFTR cDNAs were used to quantify for Ano1, Ano6, Ano9
and Ano10 endogenous expression by semi-quantitative PCR. A standard PCR was
performed using the programs and the primers displayed on Tables 3.3 and 3.4,
respectively. Samples were retrieved at specific cycles in order to determine the log
phase (and avoid saturation) of cDNA amplification for all the anoctamins studied and
after compare their expression by performing another standard PCR with the same
number of cycles for each, inside the log phase. The detection of actin confirmed the
sample viability and success of RNA extraction and cDNA production.
After running all the PCR products on a 2% agarose DNA gel, using Red Safe
(Chembio, 21141) to stain the DNA, the samples were quantified using the software FIJI
(http://fiji.sc/Fiji).
Table 3.3 – Standard PCR program
Template
Ano1
Ano6
Ano9
Ano10
Temperature
(°C)
94
94
60
72
72
94
94
60
72
72
94
94
56
72
72
94
94
60
72
72
Table 3.4 – Primers to test for anoctamin expression
Anoctamin expression testing primers
Template
Forward
Ano1
5’-CGACTACGTGTACATTTTCCG-3’
Number
cycles
Time
5min
30sec
30sec
1min
5min
5min
30sec
30sec
1min
5min
5min
30sec
30sec
1min
5min
5min
30sec
30sec
1min
5min
of
Samples
retrieved at 29,
31, 33, 35, 37
and 39
Samples
retrieved at 27,
29, 31, 33, 35
and 39
Samples
retrieved at 29,
31, 33, 35, 37
and 39
35
Reverse
5’- GATTCCGATGTCTTTGGCTC-3’
28
Materials and Methods
Ano6
5’- GGAGTTTTGGAAGCGACGC-3’
5’- GTATTTCTGGATTGGGTCTG-3’
Ano9
5’- GCAGCCAGTTGATGAAATC-3’
5’- GCTGCGTAGGTAGGAGTGC-3’
Ano10
5’-GTGAAGAGGAAGGTGCAGG-3’
5’-TCATCGTTTCAAAAGCCAACT-3’
All primers were provided by Dr. Rainer Schreiber (University of Regensburg).
3.3 Protein Analysis
3.3.1 Immunocytochemistry
For the live-cell imaging microscopy, BHK parental, WT- and F508del-CFTR were
grown on cover-slips and transfected with pIRES Ano1 eGFP CD8 and pIRES Ano6
eGFP CD8. After two days, cells were incubated, for 10 minutes in the dark at room
temperature, with a lipid marker (lissamine rhodamine B sulfonyl (ammonium salt)), with
emission frequency in the red area of the visible spectrum (Avanti Polar Lipids, Inc,
810150C), diluted to 1µM in Ringer solution (145mM NaCl, 0.4mM KH2PO4, 1.6mM
KH2PO4·3H2O, 5mM glucose; 1mM MgCl2·6H2O, 1.3mM Calcium-D gluconate
anhydrous) and examined under an ApoTome Axiovert 200M fluorescence microscope
(Zeiss, Göttingen, Germany). Previously to incubation some cells were trypsinized and
seeded on Poly-L-Lysine cover slips in order to reduce lipid marker attachment to the
cover slip between the cells (referred when was the case).
The fluorescence intensities were quantified by the software Axiovision from Zeiss
(http://microscopy.zeiss.com/microscopy/en_de/products/microscopesoftware/axiovision-for-biology.html) using images taken with the same exposure time to
allow the comparison and using ApoTome.
HeLa Kyoto cells were grown on 8-well Lab-tek® chamber slide (Sigma-Aldrich,
C7057) and transfected with pcDNA3.1 Ano1 FLAG eGFP, YFP and pcDNA3.1 Ano9
FLAG eGFP and further tested for recognition of the FLAG sequence inserted into the
anoctamins (see section 3.2.5) by performing the immunostaining with anti-FLAG mouse
IgG1 Ab (Sigma-Aldrich, F3165).
For cell immunostaining, the Lab-tek was rinse three times with cold Phosphate Buffer
Saline (PBS) and cells were incubated with the primary antibody anti-flag mouse in a
1:500 dilution using PBS supplemented with 1% bovine serum albumin (BSA) for 1 hour
at 4°C. The Lab-tek was once again washed three times with cold PBS and cells were
fixed with 2% paraformaldehyde for 15 minutes at room temperature. Cells were
thoroughly washed with PBS to remove any leftover of the fixing solution and afterwards
incubated with the secondary antibody Alexa Fluor 568 Donkey Anti-Mouse IgG (Life
Techologies, A10037) in a 1:500 dilution for 1 hour. The cells were again rinsed three
times with PBS and Lab-teks were mounted with Vectashield mounting medium (Vector
Laboratories, H-1000) containing DAPI (Sigma-Aldrich, D9542) and sealed.
The stainings were observed in a Zeiss Axiovert 200M microscope (Zeiss, Jena,
Germany) orin a Leica DMI4000B confocal microscope (Leica Microsystems, Wetzlar,
Germany).
3.3.2 Immunoprecipitation and Western Blot
Cell lysis and protein collection:
29
Materials and Methods
Cells were grown on four 6-well plates and then lysed and protein was collected. They
were washed twice with cold PBS and collected with the help of a scraper. Then a
centrifugation at 5000 rpm for 5 minutes was executed and the resulting pellet was
ressuspended in 150uL of Pierce IP Lysis Buffer (25mM Tris-HCL, 150mM NaCl, 1mM
EDTA, 0.5% NP-40, 5% Glycerol; pH 7.4). Cell lysis was performed by using the
mechanical strength of syringes (Disposable needles Sterican®, 24G violet and 27G
grey). The lysate was centrifuged at 14000 rpm for 10 minutes at 4°C and the
supernatant was collected.
Protein quantification:
The amount of protein in each lysate was quantified by the Bio-Rad Protein Assay
Dye Reagent Concentrate kit (Bio-Rad, 500-0006EDU). The reagent was diluted 1:5 in
distilled water and 1 mL was added to 8 BSA (Sigma-Aldrich, A4737) standards and to
the samples to be measured (2 µL each sample). The solutions were incubated in the
dark for 15 minutes and afterwards the absorbance was measured at 595 nm using the
Novostar plate reader (BMG Labtech, Germany).
Sample preparation:
Pierce IP Lysis Buffer (25mM Tris-HCL, 150mM NaCl, 1mM EDTA, 0.5% NP-40, 5%
Glycerol; pH 7.4) plus Protease Inhibitor (25x) (cOmplete, EDTA-free Roche,11873580001) were added to 300-500 µg of protein samples up to 300 µL. Each
sample was after incubated with antibody to immunoprecipitate either CFTR, Ano1 or
Ano6 (1:200 dilution), overnight at 4°C with gentle shaking (antibodies are displayed on
Table 3.5). Then 50µL of Protein G Agarose 50% slurry (Pierce, 20398) were added to
each sample, followed by 3 hours incubation at room temperature, with gentle mixing.
After incubation the samples were centrifuged for 3 minutes at 2500xg and the
supernatant was discarded. The immune complexes were ressuspended with 500µL of
IP Buffer (25mM Tris-HCl (pH 7.4), 150 mM NaCl - final pH 7.2) and gently mixed for 5
minutes. This process was repeated two times more. To elute the immune complex the
compound-bound resin was washed with 500µL of distilled water and the samples were
centrifuged for 3 minutes at 2500xg. The complex-bound resin was after ressuspended
in 30µL of Electrophoresis Loading Buffer (1x) (1.5M Tris-HCL (pH 6.8), 1.5% SDS, 5%
Glycerol, 0.01% Bromophenol Blue). The samples were incubated for 30 minutes at
room temperature and centrifuged for 3 minutes at 2500xg. The supernatant was
collected to load into the SDS-Page gel.
SDS-Page:
The samples (50ug protein for input and 30uL for immunoprecipitation (IP) samples)
were loaded into a 7.5% polyacrylamide stacking gel and 4% polyacrylamide separating
gel and ran for 90 minutes at 110V
Membrane Transfer:
The proteins were transferred into a PVDF membrane (Merck Millipore, ISEQ00010)
by performing a wet-transfer for 3 hours at 100V and 4º C.
Immunoblotting:
The membranes were blocked with 5% Non fat milk (NFM; Applichem, A0830,1000)
in PBS-T (54mM NaCl, 2.7mM KCl, 8.1mM Na2HPO4, 1.5mM KH2PO4, 0.1% Tween
20 - pH 7.4) or TBS-T (50mM Tris, 150mM NaCl, 0.1% Tween 20), depending on which
are the antibodies diluted, for 1 hour at room temperature followed by incubation with the
primary antibody overnight at 4º C, with gentle shaking (see antibodies on Table 3.5).
After washing the membranes with PBS-T or TBS-T they were incubated with the
secondary antibody for 2 hours at room temperature (for the anti-goat Ab the incubation
period is just 1 hour; see antibodies on Table 3.5). After washing, the signal for HRP
30
Materials and Methods
(horseradish peroxidase) was detected with Supersignal West Pico Chemiluminescent
Substrate (1:1 proportion) (Thermo Scientific, 34077).
Table 3.5 – Immunoprecipitation and western blot antibodies
Immunoprecipitation
Antibodies
Antibodies
dilution
anti-DOG1 (SP31) rabbit IgG monoclonal
Ab (Cell Marque, CMC 24431031)
anti-DOG1/TMEM16A
rabbit
IgG
monoclonal Ab (Novus Biologicals,
NB110-90601)
anti-CFTR 596 NBD2 domain mouse
IgG2b monoclonal Ab (UNC Chapel Hill,
A4)
Anti-GFP goat IgG polyclonal Ab
(Rockland, 600-101-215)
1:200
Anti-GFP goat IgG polyclonal Ab
1:3000
Dilution
solution
1% NFM
*TBS-T
3% NFM
TBS-T
1% NFM
**PBS-T
1% NFM
***PBS-T
2nd Antibody
1st Antibody
anti-DOG1 (SP31) rabbit IgG monoclonal
1:500
Ab
anti-CFTR 596 NBD2 domain mouse
1:2000
IgG2b monoclonal Ab
anti-actin rabbit polyclonal Ab (SigmaWestern Blot
1:1000
Aldrich, A2066)
anti-mouse IgG HRP goat (Leinco
1:5000
1% NFM
Technologies, M114)
anti-rabbit IgG HRP goat (Acris,
1:10000
1% NFM
R1364HRP)
anti-goat IgG1, F(ab’)2 HRP donkey
1:5000
5% NFM
(Santa-Cruz, sc:3851)
* TBS-T (50mM Tris, 150mM NaCl, 0.1% Tween 20)
** PBS-T (8.1mM Na2HPO4, 1.5mM KH2PO4, 54mM NaCl, 2.7mM KCl, 0.1% Tween 20, pH 7.4)
*** PBS-T (8.1mM Na2HPO4, 1.76mM KH2PO4, 137mM NaCl, 2.78mM KCl, 0.1% Tween 20)
3.4 Functional Analysis
3.4.1 Patch clamp
To evaluate Ano6 functionality after FLAG-tag cloning patch clamp assay was
performed. HEK293 were grown on glass coverslips and transfected with pcDNA3.1
Ano6 FLAG eGFP and pIRES CD8. The membrane receptor CD8 allows for the
identification of the transfected cells by binding to Dynabeads CD8 (Invitrogen, 11147D).
After 48 hours cells were patched on the stage of an inverted microscope (IM35, Zeiss)
in a continuously perfused bath with Ringer solution (145mM NaCl, 0.4mM KH2PO4,
1.6mM K2HPO4, 5mM glucose, 1mM MgCl2, 1.3mM Ca-gluconat, pH 7.4). Patch pipettes
were filled with a solution containing 95mM K-gluconat, 30mM KCl, 1.2mM NaH2PO4,
4.8mM Na2HPO4, 5mM glucose, 2.38mM MgCl2, 1mM EGTA, 0.726mM Ca-gluconat,
with freshly added ATP (3 mM) and pH adjusted to 7.2. Patch clamp experiments were
done in the fast whole-cell configuration. HEK cells’ Vm were clamped in steps of 20 mV,
1s each, from -100 mV to +100 mV relative to the resting potential. Currents and voltages
were recorded using a patch clamp amplifier EPC 9 and PULSE software (HEKA,
Lambrecht, Germany) as well as Chart software (AD-Instruments, Spechbach,
Germany).
31
Materials and Methods
BHK WT- and F508del-CFTR cells were grown on coverslips and transfected with
pIRES Ano1 eGFP CD8 and pIRES Ano1 L982A CD8. After 48 hours cells were used
for patch clamping. The cells grown on coverslips were then mounted on the stage of an
inverted microscope (IM35, Zeiss). The bath was perfused continuously with Ringer
solution (145mM NaCl, 0.4mM KH2PO4, 1.6mM K2HPO4, 5mM glucose, 1mM MgCl2,
1.3mM Ca-gluconat, pH 7.4) warmed at 37°C. Patch pipettes were filled with a solution
containing 95mM K-gluconat, 30mM KCl, 1.2mM NaH2PO4, 4.8mM Na2HPO4, 5mM
glucose, 2.38mM MgCl2, 1mM EGTA, 0.726mM Ca-gluconat, and pH adjusted to 7.2.
When referred extracellular chloride concentration was reduced to 5 mM (5Cl-) and
replaced by gluconate. CFTR channel stimulation was achieved by applying 100 µM
IBMX plus 2 µM forskolin. Patch clamp experiments were done in the fast whole-cell
configuration. BHK cells’ Vm were clamped in steps of 20 mV, 1s each, from -100 mV to
+100 mV relative to the resting potential. Currents and voltages were recorded using a
patch clamp amplifier EPC 9 and PULSE software as well as Chart software.
Experiments performed by Lalida Sirianant.
3.5 Statistical Analysis
Student’s t-test for paired or unpaired samples as appropriate. P<0.05 was accepted
as significant.
32
Results
4 Results
4.1 Endogenous expression of Anoctamins in CFBE cells overexpressing
WT-CFTR and F508del-CFTR
The basic aim of this work is to assess the influence of CFTR, both WT and F508del
on the expression and trafficking of Anoctamins in order to better understand their
relationship and the potential of Anoctamins as alternative pharmacological targets in
CF. Hereupon, the first step was to study the endogenous expression of Ano1, -6, -9 and
-10 in CFBE cells stably expressing either WT- or F508del-CFTR. This cell line was
chosen because, being isolated from the bronchial epithelium of CF patients, these cells
mimic very well the processes that occur in CF, although being an immortalized cell line.
To achieve this goal, a semi-quantitative PCR was performed for the referred
anoctamins, using cDNA obtained from CFBE mCherry-WT- and F508del-CFTR cells.
In order to compare gene expression/mRNA levels, the log phase of cDNA
amplification was determined by performing a standard PCR and collecting samples at
different amplification cycles (Figure 4.1).
a) Ano1
b) Ano6
33
Results
c) Ano9
d) Actin
e) Ano10
(+) (-)
Ano10
(301 bp)
Figure 4.1 – PCR for detection of endogenous expression of a) Ano1, b) Ano6, c) Ano9, d) actin and e)
Ano10 in CFBE mCherry-WT- and F508del-CFTR cell lines. M stands for marker, (+) for positive control and
(-) for negative control.
The first observation was that Ano10 is not expressed in these cells (Figure 4.1 e)
and because of this the semi-quantitative procedure was not executed for its detection.
After doing the PCR it was possible to infer right away that anoctamins are not express
at the same level since they started to be detected at different cycles of amplification.
However to be more precise and compare them at a non-saturated phase the band
intensities were quantified by the software FIJI (Figure 4.2) and was concluded that Ano1
log phase is between 33 and 38 cycles, for Ano6 is between 28 and 32 and Ano9 shows
very different expressions between WT- and F508del-CFTR expressing cells,
demonstrating a shared log phase between 34 and 36 cycles. This conclusion made it
very difficult to compare between anoctamins’ expression inside the same cell line at the
same cycle. However, it is possible to suggest that Ano6 is clearly the more expressed
anoctamin on both CFTR expressing cell lines, reaching the amplification plateau much
sooner than the others. Ano1 and Ano9 expression seems to be similar on WT-CFTR
expressing cells but on ΔF cells Ano1 appears to be more expressed than Ano9.
Nonetheless, the most important thing was to compare each anoctamin’s expression
between cells lines and for that a PCR was performed for each anoctamin at a cycle
inside the amplification log phase and the same for both CFBE WT-CFTR and CFBE
F508del-CFTR cDNA templates (Figure 4.3).
34
Results
Figure 4.2 – Assessment of log phase of anoctamins’ PCR amplification.
a)
b)
#
Figure 4.3 – PCR for quantification of anoctamins endogenously expressed in CFBE mCherry-WT- and
F508del-CFTR cells. a) DNA agarose gel with the PCR products resulting from the amplification of Ano1 (33
cycles), -6 (29 cycles), -9 (36 cycles) and -10 (40 cycles), using as template the cDNA from CFBE WT- (WT)
and F508del-CFTR (ΔF) expressing cells. c) Quantification of PCR product by assessment of band intensity.
Mean + SEM, n = number of semi-quantitative PCRs performed. *significant difference in gene expression
(paired t-test) with p<0.05, # with p<0.01.
Both Ano1 and Ano6 appear to be significantly more express in WT-CFTR expressing
cells than in ΔF cells. Also Ano9 is much more express in WT than in F508del-CFTR
cells, however here the statistically significant level was not reached (Figure 4.3). ΔFCFTR expressing cells showed a very consistent low level of Ano9 expression, but CFBE
WT-CFTR cells, although always presenting a much higher expression level, the mRNA
levels per se were not so similar in the compared cells (maybe a higher n would soften
this difference).
The obtained results suggest a CFTR influence on anoctamins’ expression, because
the presence of its WT form seems to correlate with higher mRNA levels of Ano1, -6 and
-9 through a process that appears to be impaired in CF.
However, to completely discard any doubt about the suggested role of CFTR the
anoctamins’ mRNA levels need to be fully quantified on both cell lines through, for
example, a much more potent real-time PCR assay.
35
Results
4.2 Cell localization of Ano1 and Ano6 on BHK WT- and F508del-CFTR
overexpressing cells
After assessing for CFTR influence on anoctamins’ expression the effect of this
proteins on anoctamins’ trafficking was studied. From now on this work will only focus on
anoctamin 1 and anoctamin 6 because they are the ones which already showed some
evidence of interaction with CFTR at a functional level. Therefore, cell localization of
Ano1 and Ano6 was evaluated in presence of either WT- or F508del-CFTR. To
accomplish this, BHK cell lines were used instead of CFBE cells because the last ones
are very difficult to transfect allowing only very low transfection yields, as it happens for
all epithelial cell lines[86]. Parental BHK and the ones overexpressing the CFTR forms,
were transfected with either Ano1 or Ano6 tagged with eGFP and their cell localization
was appraised through the fused fluorescent protein.
a) Parental BHK cell line
Ano1 (eGFP)
Lipid marker
Merge
b) BHK WT-CFTR cell line
Ano1 (eGFP)
Lipid marker
Lipid marker
Merge
Merge
Merge
c) BHK F508del-CFTR cell line
Ano1 (eGFP)
Lipid marker
Merge
Figure 4.2 – Immunocytochemistry (live imaging) of eGFP tagged Ano1 (green) when transiently
overexpressed in a) parental BHK cells, b) BHK WT-CFTR and c) BHK F508del-CFTR after 10 minutes
stimulation with 100 µM IBMX / 2 µM Forskolin. Scale=10 µm
Ano1 was majorly detected on the cell surface for all the transfected cell lines,
demonstrating an overlapping signal with the PM marker (lipid marker; Figure 4.2). Cell
localization of Ano1 does not appear to be affected by the presence of CFTR since its
localization is similar on parental and overexpressing CFTR cells. Also the expression of
36
Results
both WT- and F508del-CFTR does not seem to interfere with Ano1 cell localization which
shows to be identical on the two cell lines. Analogous results were obtained when CFTR
was not stimulated with IBMX/F for channel activation (see section Appendix 8.10),
suggesting that the activation process of CFTR has also no impact on Ano1 localization.
Although the cell localization is similar, Ano1 fluorescence intensity on the cell
membrane is notoriously different depending on cell line. It was observed that on cells
co-expressing WT-CFTR and Ano1 the cell surface fluorescent signal was significantly
higher than on F508del-CFTR expressing cells (Figure 4.3). This may suggest that CFTR
has some influence on Ano1 cell surface expression but not localization since that it was
similar on all cell lines.
However, because this study is being executed on an overexpressing system we may
be facing a variance in plasmid uptake and consequent
expression. Being impossible to determine the number
of plasmid copies incorporated by each cell, the
possibility that BHK WT-CFTR are expressing more
Ano1 because they integrated a higher number of
plasmid copies cannot be discarded. So, to better
understand and trust this result more experiments
need to be performed. In order to lower this probability,
double tagged anoctamin constructs were created by
cloning a FLAG-tag into the anoctamins already fused
with fluorescent proteins (for plasmid maps see section
8). These constructs allow the quantification of the
protein localized only on the cell surface (by detecting
Figure 4.3 – Ano1 cell surface
expression
in
transiently
the FLAG-tag on the extracellular loop) which can after
transfected BHK cells stably
be normalized to the total amount of expressed protein
expressing WT- and F508del(by
measuring the eGFP signal), then eliminating the
CFTR and parental CFTR. Mean
variance
associated to these overexpressing systems.
+ SEM, n = number of cells
measured. *significant membrane Some of these plasmids were already tested for antiexpression (paired t-test; p<0.05). FLAG antibody binding (anoctamins’ topology is not yet
certain, being necessary to confirm if the FLAG
sequence was actually cloned on an extracellular segment) and protein functionality after
cloning (see appendix 8.10), but the experiments on CFTR expressing cell lines need
yet to be done.
The same experiments were performed in BHK cells, transiently expressing ANO6,
as shown in the following images.
a) Parental BHK cell line
Ano6 (eGFP)
Lipid marker
Merge
37
Results
b) BHK WT-CFTR cell line
Ano6 (eGFP)
Lipid marker
Merge
Lipid marker
Merge
c) BHK F508del-CFTR cell line
Ano6 (eGFP)
Figure 4.4 – Immunocytochemistry (live imaging) of eGFP tagged Ano6 (green) when transiently
overexpressed in a) parental BHK cells, b) BHK WT-CFTR and c) BHK F508del-CFTR after 10 minutes
stimulation with 100 µM IBMX / 2 µM Forskolin. Scale=10 µm
Ano6 cell distribution is not as clear as for Ano1. It seems that is not only membrane
localized but can also be found intracellular for all cell lines. Nevertheless, Ano6 appears
to be more cell surface localized in the presence of F508del-CFTR than WT-CFTR. It
was observed as well that cells co-expressing WT-CFTR and Ano6 had the tendency to
die much more than cells expressing F508del-CFTR instead. This tendency still needs
to be quantified by an apoptosis assay to allow further conclusions.
Similar results were obtained when cells were not previously stimulated with the CFTR
activators IBMX/F (see appendix 8.9).
4.3 Interaction of Ano1 and Ano6 with CFTR
The next step was to assess for a direct and physical interaction between CFTR-Ano1
and -Ano6. To attain this a co-immunoprecipitation assay was performed for the referred
proteins using lysates from BHK cells stably expressing either WT- or F508del-CFTR
which were transiently expressing GFP tagged Ano1 and Ano6.
a)
M
(kDa)
M
(kDa)
170
CFTR
Band C (160 kDa)
170
130
Band B (140 kDa)
130
Ano1 eGFP (141 kDa)
38
Results
b)
M
(kDa)
M
(kDa)
170
170
130
CFTR
Band B (140 kDa)
Ano1 eGFP (141 kDa)
130
Figure 4.5 – Co-immunoprecipitation of CFTR and Ano1 eGFP. Ano1 eGFP and CFTR were detected using
a GFP-antibody and the CFTR-antibody 596, respectively (input). Immunoprecipitation of beads only (no
conjugated antibody) served as a negative control. a) Ano1 eGFP was co-immunoprecipitated after pulldown of WT-CFTR using CFTR-Antibody 596 (right panel), and WT-CFTR was also detected in Ano1 eGFP
pull-down, obtained using the GFP-antibody (left panel). b) No co-immunoprecipitation of Ano1 eGFP and
F508del-CFTR was detected when pulling-down defective CFTR (right panel) or Ano1 eGFP (left panel).
It was observed that Ano1 co-immunoprecipitate with WT-CFTR when pulling-down
one or the other (Figure 4.5 a) and after comparing this result with the negative control
lane (beads) sample contamination can be discarded, since it is completely clean. This
outcome suggests that a direct and physical interaction between Ano1 and WT-CFTR is
occurring. However, the same doesn´t appear to be true for F508del-CFTR. When the
co-immunoprecipitation assay was performed for Ano1 and defective CFTR no coimmunoprecipitation was observed in neither of the pull-downs (Figure 4.5 b). This may
indicate that against what happens for WT, when F508del-CFTR is present it does not
directly interact with Ano1, as expected, because the defective CFTR form is retained at
the ER and does not migrate to the PM, where Ano1 is majorly localized.
After noticing this result it was proposed that WT-CFTR and Ano1 may interact
through a scaffold protein which binds to their PDZ binding domain. In order to test this
hypothesis BHK cells expressing WT- and F508del-CFTR were transiently transfected
with an Ano1 mutant on the PDZ domain (Ano1 L982A) and a co-immunoprecipitation
assay was again performed. In order to fully compare the results and eliminate any
possibility of GFP interfering with PDZ binding motif, this assay was also repeated for
CFTR and Ano1 without the GFP tag.
a)
M
(kDa)
170
M
(kDa)
CFTR
Band C (160 kDa)
130
Ano1 (114 kDa)
130
100
M
(kDa)
170
M
(kDa)
b)
130
CFTR
Band B (140 kDa)
130
Ano1 (114 kDa) ?
100
39
Results
Figure 4.6 – Co-immunoprecipitation of CFTR and Ano1. Ano1 and CFTR were detected using the
TMEM16A (DOG1)-antibody and the CFTR-antibody 596, respectively (input). Immunoprecipitation of beads
only (no conjugated antibody) served as a negative control. a) Ano1 was co-immunoprecipitated after pulldown of WT-CFTR using CFTR-Antibody 596 (right panel), and WT-CFTR was also detected in Ano1 pulldown, obtained using the TMEM16A-antibody (left panel). b) No co-immunoprecipitation of Ano1 and
F508del-CFTR was detected when pulling-down Ano1 (left panel) but a signal was detected when F508delCFTR was pulled-down (right panel).
a)
M
(kDa)
M
(kDa)
170
CFTR
Band C (160 kDa)
130
Ano1 L982A (114 kDa)
130
Band B (140 kDa)
100
b)
M
(kDa)
M
(kDa)
170
130
130
CFTR
Band B (140 kDa)
Ano1 L982A ? (114 kDa)
100
Figure 4.7 – Co-immunoprecipitation of CFTR and Ano1 L982A. Ano1 L982A and CFTR were detected using
the TMEM16A (DOG1)-antibody and the CFTR-antibody 596, respectively (input). Immunoprecipitation of
beads only (no conjugated antibody) served as a negative control. a) Ano1 L982A was coimmunoprecipitated after pull-down of WT-CFTR using CFTR-Antibody 596 (right panel), and WT-CFTR
was also detected in Ano1 L982A pull-down, obtained using the TMEM16A-antibody (left panel). b) No coimmunoprecipitation of Ano1 mutant and F508del-CFTR was detected when pulling-down Ano1 L982A (left
panel) but a signal was detected when F508del-CFTR was pulled-down (right panel).
As observed for Ano1 eGFP, Ano1 also seems to co-immunoprecipitate with WTCFTR (Figure 4.6 a). However anti-TMEM16A (DOG1) antibody appears to be detecting
different maturation forms of Ano1 (Ano1 has 5 putative N-glycosylation sites) or is not
specific for Ano1. The lower band is the one corresponding to the non-glycosylated form
which is detected in the WT-CFTR pull down. When the Ano1 PDZ binding domain is
single mutated both proteins still co-immunoprecipitate (Figure 4.7 a), suggesting that
the interaction established between them is not achieved through their PDZ binding
domains.
The result obtained for Ano1 and F508del-CFTR is different from the one with Ano1
eGFP instead. A signal was detected in the pull-down F508del-CFTR sample at the
same level as the previously referred upper band on the Ano1 input (Figure 4.6 b, right
panel), but when Ano1 is pulled-down no co-immunoprecipitation with CFTR is detected
(Figure 4.6 b, left panel). An analogous situation was observed for coimmunoprecipitation of Ano1 mutant and defective CFTR (Figure 4.7 b). After these
observations it can be considered that the anti-TMEM16A antibody is not specific for
Ano1 and it might be binding to other proteins.
Ano6 interaction with CFTR was also assessed and the results suggest a direct
interaction between the two since WT-CFTR co-immunoprecipitate with Ano6 and viceversa (Figure 4.8 a). Interestingly Ano6 appears to be present in two different levels of
40
Results
maturation, the non-glycosylated form around 133 kDa and probably a glycosylated form
detected at ≈160 kDa, and It seems that WT-CFTR interacts with both because similar
to the input two bands for Ano6 were detected in the pull-down WT-CFTR sample (Figure
4.8 a, right panel). This glycosylation hypothesis can be tested by previously digesting
the sample with enzymes that cleave the glucose chains and then compare the western
blot result for this sample with one not previously digested. No co-immunoprecipitation
was detected between Ano6 and ΔF-CFTR.
a)
M
(kDa)
170
M
(kDa)
170
130
CFTR
130
Band C (160 kDa)
Ano6 eGFP
glycosylated form ?
Ano6 eGFP (133 kDa)
b)
M
(kDa)
M
(kDa)
170
170
130
CFTR
130
Band B (140 kDa)
Ano6 eGFP (133 kDa)
Figure 4.8 – Co-immunoprecipitation of CFTR and Ano6 eGFP. Ano6 eGFP and CFTR were detected using
a GFP-antibody and the CFTR-antibody 596, respectively (input). Immunoprecipitation of beads only (no
conjugated antibody) served as a negative control. a) Ano6 eGFP was co-immunoprecipitated after pulldown of WT-CFTR using CFTR-Antibody 596 (right panel), and WT-CFTR was also detected in Ano6 eGFP
pull-down, obtained using the GFP-antibody (left panel). b) No co-immunoprecipitation of Ano6 eGFP and
F508del-CFTR was detected when pulling-down defective CFTR (right panel) or Ano6 eGFP (left panel).
4.4 CFTR influence on Ano1 and Ano6 function
The last goal was to evaluate the effect of WT- and F508del-CFTR on Ano1 and Ano6
function. To achieve this BHK cells stably expressing WT- and F508del-CFTR were
transiently transfected with Ano1 eGFP CD8 and whole-cell currents were measured by
patch clamp. The experiments with Ano6 are still in progress.
a) BHK WT-CFTR Ano1
n=4
41
Results
b) BHK F508del-CFTR Ano1
n=5
Figure 4.9 – BHK WT- and F508del-CFTR stably expressing cells were transfected with Ano1 eGFP CD8
and whole-cell currents were measured by patch clamp before and after replacement of extracellular chloride
with impermeable gluconate (except of 5 mM; 5Cl-), using a voltage ramp protocol (-100mV – 100mV). a)
BHK WT-CFTR Ano1 average whole-cell current density at 100 mV (on left) and current–voltage (I/V)
relationships of resting currents and inhibited by 5Cl- (on right). b) The same as in a) but on BHK F508delCFTR cells. Mean ± SEM, n = number of cells measured, *statistically significant current inhibition (paired ttest; p<0.05).
Ano1 transiently expressing cells displayed a large conductance, that was inhibited
when chloride was reduced to a 5 mM extracellular concentration and replaced by
impermeable gluconate (5Cl-), indicating constitutively active Ano1 on both WT- and ΔFCFTR stably expressing cells (Figure 4.9). It remained unclear why Ano1 was
spontaneously active when expressed in either WT-CFTR or ΔF-CFTR expressing BHK
cells, without stimulation by Ca2+-increasing
n=4-10
ionomycin. Further activation of cell currents by
stimulation with ionomycin was not observed
(data not shown). Due to this, activation of Ano1
current depending on the stimulation of CFTR
could not really be assessed in these cell lines.
Moreover, cAMP (IBMX/FSK) dependent
activation of WT-CFTR was largely reduced in
Ano1-expressing cells (Figure 4.10). This,
however, is probably because total whole cell
currents were so large that they reached the
limit of resolution which is due to technical
reasons: when whole cell currents reach 10 nA,
the impact of the serial pipette resistance
becomes so large that the cells are no longer
adequately voltage clamped.
Moreover, an Ano1 mutant lacking the PDZ
Figure 4.10 – Average current density of
domain
produced similar currents and similarly
cells response to 100 µM IBMX and 2 µM
reduced IBMX/FSK induced WT-CFTR
forskolin stimulation. BHK WT- and
F508del-CFTR stably expressing cells
currents in WT-CFTR co-expressing BHK cells,
were transiently transfected with either
suggesting that the PDZ domain of Ano1 is not
Ano1 eGFP or Ano1 L982A (PDZ mutant)
required for proper membrane expression of
and whole-cell currents were measured by
Ano1 (Figure 4.10).
patch clamp before and after CFTR
channel stimulation with IBMX/F, using a
As for Ano6 expression in WT-CFTR or
voltage ramp protocol (-100mV – 100mV).
F508del-CFTR expressing BHK cells, these
Mean ± SEM, n = number of cells
experiments could not be finished within the
measured, # statistically significant lower
given time. Moreover and as outlined above,
current activation when compared with
Ano6 expression in WT-CFTR expressing BHK
WT-CFTR expressing cells (paired t-test;
p<0.01).
cells induced a strong apoptosis so that cells
co-expressing both ion channels typically got
42
Results
lost during transfection. Subsequent experiments will now examine those cells at earlier
time points after transfection.
43
Discussion
5 Discussion
This work follows the evidence on the literature about the calcium-activated chloride
channel Ano1 and the outwardly rectifying chloride channel Ano6 functional relationship
with CFTR.
Ano1 function showed to be inhibited by the activation of both WT- and F508delCFTR, in more extent by the first than the second, when expressed in Xenopus
oocytes[44]. Also endogenous CaCC currents were significantly reduced after expression
of WT CFTR and activation of endogenous CFTR[16, 17]. On the other hand, whole-cell
currents activated by IBMX and forskolin were significantly reduced in cells expressing
both Ano1 and CFTR when compared with cells expressing only CFTR[16]. This negative
relationship between these two proteins was already demonstrated in Xenopus oocytes,
bovine pulmonary artery endothelium, and isolated parotid acinar cells, although the
mechanism that leads to this is yet unknown[17, 18, 44, 54].
CFTR displays a regulatory effect on Ano6 as well. For a long time now CFTR has
been implicated in the regulation of ORCC currents[21, 69], however only recently these
ORCC were identified as Ano6 or at least majorly composed by it[24]. The ORCC currents
produced by Ano6 showed to be significantly larger in cells expressing CFTR than in
non-expressing cells[24].
Then, the main goals of this thesis were to understand CFTR influence on Anoctamin
1 and -6 expression, trafficking and function always comparing these processes on WTCFTR expressing cell lines and on cells mimicking the CF environment by expressing
the most common CFTR mutation, F508del-CFTR.
5.1 CFTR influence on Anoctamins’ expression
The first objective consisted on comparing the anoctamins’ endogenous expression
on WT- and F508del-CFTR expressing cells. This study was performed on CFBE cells
to better mimic the processes which occur in the lungs / bronchus in the presence of CF
(when F508del-CFTR is expressed).
The semi-quantitative PCR revealed Ano6 as the most expressed anoctamin between
the ones tested (Ano1, -6, -9 and -10) and the non-expression of Ano10 by CFBE cells.
It is known that Ano6, -1 and -9 are much expressed in human airways tissues[43],
however in this human airway cell line there is a clear difference among expression
levels, specially between Ano6 and the others on WT-CFTR cells and between all of
them on F508del-CFTR cells. It would be interesting to see how this expression disparity
is reflected on the cell currents and compare the function of the different anoctamins, for
example by performing an Ussing Chamber assay.
When comparing the anoctamins’ expression level between WT- and ΔF-CFTR stably
expressing cell lines it was noticeable that WT cells express more Ano1 and Ano6 than
F508del cells, although Ano9 also showed a big difference in mRNA levels, they were
not statistically significantly higher when WT-CFTR was present, but this issue seems to
be due to the low number of samples measured (3) and a higher n would probably reveal
a significant difference among Ano9 expression levels. The next step should be to
perform a real-time PCR to fully quantify these genes expression and to see if this
stronger assay can also statistically distinguish anoctamins’ expression between WTand F508del-CFTR expressing cells and then it will be possible to conclude with
complete certainty that WT-CFTR regulates or is a component of the regulator machine
that is behind anoctamins’s expression which is impaired in CF.
44
Discussion
Thinking in terms of the already observed functional relationship between CFTR and
anoctamins, the expression measured for Ano6 suggests that CFTR enhances its
expression which is somehow in agreement with what was already seen for the functional
relationship between them meaning that the bigger Ano6 function detected when CFTR
is present can be due to its higher expression.
Ano1 mRNA levels contradict a bit the negative functional interaction shared with
CFTR, since it seems that WT cells are expressing more Ano1 than ΔF. This evidence
may lead to the belief that because Ano1 mRNA levels are higher when WT-CFTR is
present so the protein amount will be greater and currents will also be bigger than in
F508del expressing cells. Nonetheless, it is proven that mRNA levels do not always
completely correlate with the protein abundance and subsequent function. Regulatory
processes play a substantial role after mRNA is made — like post-transcriptional,
translational and protein degradation regulation —, controlling the steady-state protein
abundances[87].
Ano9 relationship with CFTR is completely unknown, but as a protein that is mostly
intracellular localized[66] the obtained results may suggest that the higher levels of
defective CFTR that is imprisoned in the reticulum and therefor intracellular localized can
be inhibiting Ano9 production and compensating its function. So it would be interesting
to follow this with an immunofluorescence assay on cells either expressing WT- or
F508del-CFTR and quantify the associated fluorescence to see the difference in terms
of protein amount among WT and ΔF-CFTR expressing cells.
5.2 CFTR effect on Ano1 and Ano6 cell localization
Ano1 was mainly detected on the cell surface of overexpressing BHK cells, similar to
what was previously observed in HEK293 cells[16]. The cell localization was the same in
all WT- and ΔF-CFTR stably expressing cell lines as well as for parental whether
stimulated with IBMX and forskolin or not, which suggests that CFTR is not influencing
Ano1 trafficking to the cell membrane. However the membrane expression of Ano1,
assessed through GFP-tag fluorescence intensity, is statistically different in cells
expressing the two CFTR forms. In WT-CFTR expressing BHK cells the amount of Ano1
at the cell surface is significantly higher than in F508del expressing ones. This result is
in agreement with the one obtained by semi-quantitative PCR where it was seen a
greater Ano1 gene expression in the presence of WT-CFTR than in F508del. So it can
be proposed that Ano1 enhanced gene expression is reflected into a higher protein level
which is majorly localized at cell surface in a process regulated through or by WT-CFTR.
Nonetheless, this conclusion must be drawn with careful since the higher Ano1 PM
expression in WT expressing cells may not only be due to CFTR but also because of
artefacts caused by the working model. The experiments were done in an
overexpressing system which carries a variance related with plasmid uptake and
consequent expression. Being impossible to determine the number of plasmid copies
incorporated by each cell, the possibility that BHK WT-CFTR are expressing more Ano1
because they integrated a higher number of plasmid copies cannot be discarded. To go
around this problem anoctamins’ double tagged constructs started already to be cloned
and they will allow to normalize the protein expressed at the cell surface to the total
amount that is being expressed eliminating the problem of plasmid uptake variance.
On the other hand, Ano6 exhibit a more intracellular localization than Ano1 for all cell
lines. Although it seems that Ano6 has a higher propensity to migrate to the cell surface
in F508del-CFTR expressing cells that cannot be said for sure. It was observed that
Ano6 transfected WT-CFTR cells had a bigger tendency to die than ΔF cells after 24
hours of transfection. This is not unreasonable since that besides the recognised proapoptotic role of CFTR[88], also Ano6 / ORCC are reported to be involved in the Fasligand (FasL)-induced apoptotic cell death[24, 89] and by overexpressing Ano6 in WT45
Discussion
CFTR presence a synergistic process can be occurring enhancing cell death. Having this
in mind, it’s possible that the cells expressing Ano6 preferentially localized at the cell
surface are the ones that more easily die complicating the detection of Ano6 on this
location. It would be interesting to assess the amount of cell death by a caspase 3 activity
assay, when WT-CFTR and Ano6 are co-expressed and comparing it when Ano6 is coexpressed with F508del-CFTR instead.
5.3 Co-immunoprecipitation of CFTR with Ano1 and Ano6
The co-immunoprecipitation assay revealed that Ano1 and WT-CFTR share a direct
interaction but it seems that it’s not established through their PDZ binding domains since
co-immunoprecipitation of both proteins was also observed when Ano1 PDZ binding
domain was disrupted. The same does not occur with ΔF-CFTR because no coimmunoprecipitation was detected with Ano1 eGFP. Comparing with the
immunofluorescence results this is expected since Ano1 was mainly detected at the cell
surface on both WT- (cell surface localized) and F508del-CFTR (intracellular localized)
expressing cells.
Still, when TMEM16A antibody was used instead of anti-GFP to detect Ano1 without
the GFP tag a double band was detected on the input sample suggesting that two forms
of Ano1 maturation are present, however if this was the case the same should have been
seen with the anti-GFP Ab, which was not the case. More interestingly, the antiTMEM16A is able to detected a potential co-immunoprecipitation of Ano1 when ΔFCFTR is pulled-down, but this signal is at the same level as the upper band of the input
while the one detected in the WT pull-down, using the same antibody, matches the size
of the input lower band (near of Ano1 known size, ≈114 kDa). Even though this
TMEM16A Ab is advertised as monoclonal it appears that it is recognising a protein other
than Ano1. The epitope sequence recognized by the antibody has not been disclosed so
there is no way to be sure if the antibody can be detecting for example another anoctamin
(even though anoctamins sequence has not a high homology some similarity is present).
Nonetheless it is possible to speculate that maybe TMEM16A Ab is binding to Ano8 since
the band size is similar to the one expected to this protein (≈133 kDa) and being an
intracellular protein[66] it cannot be discarded that co-immunoprecipitates with F508delCFTR.
Ano6 eGFP showed similar results to Ano1 eGFP, co-immunoprecipitating with WTCFTR but not with ΔF. A double band was detected for Ano6 both in the input as in the
WT-CFTR pull-down, suggesting the presence of a glycosylated and non-glycosylated
form since Ano6 has six potential N-glycosylation sites. These results suggest that
probably Ano6 is also express at the cell surface and interacts with CFTR, although we
were unable to clearly detect it on that location maybe because of the previously
proposed reasons. Another hypothesis is that a cross-talking phenomena between the
endoplasmic reticulum and the PM may be occurring, similar to the one observed on
yeast cells for Ist2 proteins which are related with the TMEM16 family on mammals[90, 91].
Ano6 and WT-CFTR do not interact through the PDZ binding domain because Ano6 has
no predicted PDZ motif.
5.4 CFTR influence on Ano1 and Ano6 function
At any rate, the experiments demonstrate that expression of either Ano1 or Ano6 has
large impact on whole cell conductances. The fact that Ano1 was spontaneously active
46
Discussion
in BHK cells and that Ano6 expression in WT-CFTR expressing cells induced strong
apoptosis made a functional analysis rather difficult.
Therefor was not possible to infer about CFTR influence on Ano1 activation since both
WT- and F508del-CFTR stably expressing cells that were transiently transfected with
Ano1 demonstrated an extremely large conductance that didn’t allow to distinguish a
possible effect of CFTR on further Ano1 activation since the measured values were
already near the maximum detected by the set-up. This issue can possibly be circumvent
by generating inducible Ano1 cell lines that stably express the tetracycline repressor
protein, allowing for inducible expression of Ano1 gene upon the addition of doxycycline,
enabling the regulation of gene expression level[92], therefor avoiding saturating levels
and maybe reducing the overwhelming whole cell currents produced.
On the other hand it was observed that Ano1 exerted an effect on CFTR activation,
partially inhibiting WT-CFTR response to IBMX/FSK. This observation is probably due to
the total whole cell currents which were so large that reached the limit of resolution of
the patch clamp set-up. Although this Ano1 influence on CFTR activation should not be
as pronounced as what it was seen, the results are actually in agreement with what was
previously described in Ousingsawat and colleagues’ paper[16] where IBMX/FSK
activated currents were reduced in HEK293 cells co-expressing CFTR and Ano1 when
compared with cells only expressing CFTR. This interaction may suggest a mechanism
of CFTR regulation to prevent an over-activation of the channel which could explain the
higher Ano1 expression and cell surface localization when WT-CFTR is present instead
of ΔF-CFTR, since the absence of the WT form would no longer require this regulatory
function of Ano1.
The functional assay for Ano1 mutant on the PDZ binding domain corroborates the
results obtained by co-immunoprecipitation which suggested that CFTR and Ano1 do not
physically interact through the PDZ domain, since CFTR response to IBMX/F stimulation
is similar on cells co-expressing Ano1 and on cells co-expressing Ano1 L982A (PDZ
binding domain mutant).
47
Future Perspectives
6 Future Perspectives
The obtained results are not only a stimulus to continue the pursuit for the cross-talk
between anoctamins and CFTR, looking deeper to their regulatory pathways trying to
find common points that will allow to understand the mechanism underneath this
relationship, but also allow the establishment of other experimental procedures which
will help to clarify some of the results observed.
One of the first observations that we want to confirm is the difference in Ano1, -6 and
-9 gene expression apparently influenced by CFTR. In order to do that we propose to
perform a real-time PCR to fully quantify the endogenous mRNA levels of the referred
anoctamins, using as template the cDNA from parental CFBE and stably expressing WTand F508del-CFTR. Following this, it would also be interesting to study if the disparity in
anoctamins’ expression is reflected on the size of current produced. This could be
accomplished by an Ussing chamber assay.
After observing the differential expression of Ano1 on the cell surface of WT- and
F508del-CFTR expressing cells it makes sense to follow up this study with a more
elegant immunofluorescence assay, in order to reduce the problems related with the
plasmid uptake variance which are characteristic of the over-expressing systems. We
propose to assess Ano1 and Ano6 cell localization, using double tagged constructs
which will allow to detect the total protein amount and the one localized only on the cell
surface. The constructs were already created with the cloning of a FLAG tag into Ano1,
-6 and -9 already fused with fluorescent proteins (for plasmid maps see appendices
section).
The major cell death witnessed when cells co-express WT-CFTR and Ano6 raises the
question if these two proteins are involved in a synergistic pro-apoptotic mechanism. In
order to better clarify this possible effect, cell apoptosis can be quantified by a caspase
3 activity assay when co-expressing co-expressing either WT-CFTR / Ano6 or F508delCFTR / Ano6.
The observation of direct interaction between CFTR and Ano1 and Ano6 lifts up the
question of how are they communicating, through which domains is this interaction
established? After discarding the PDZ binding domain hypothesis which other domains
can be involved?
It was not possible to accomplish all the proposed objectives in time for this thesis
submission, namely the ones related with the functional assays. The effect of CFTR on
Ano6 function still remains unclear as the effect on Ano1. Possibly a new system with
inducible protein expression can be generated to avoid the major cell death and the large
constitutive currents observed, respectively, which hampered the functional analysis.
The understanding of CFTR and anoctamins interaction, regulation pathways and
their cross-talk is very important since we may be in the presence of a potential
alternative pharmacological target for CF disease. If this relationship between these two
protein families is disclosed new drugs can be designed in order to enhance chloride
secretion maybe by overstimulating anoctamins (because their expression / activity in
the airways is much lower than CFTR’s) and restore this process which is impaired in
CF.
48
References
7 References
[1]
F. S. Collins, “Cystic fibrosis: molecular biology and therapeutic implications.,” Science,
vol. 256, no. 5058, pp. 774–9, May 1992.
[2]
J. R. Riordan, J. M. Rommens, B. Kerem, N. Alon, R. Rozmahel, Z. Grzelczak, J.
Zielenski, S. Lok, N. Plavsic, and J. L. Chou, “Identification of the cystic fibrosis gene: cloning and
characterization of complementary DNA.,” Science, vol. 245, no. 4922, pp. 1066–73, Sep. 1989.
[3]
“Cystic Fibrosis Mutation Database.” Available: http://www.genet.sickkids.on.ca/app.
[4]
J. Zielenski, “Genotype and phenotype in cystic fibrosis.,” Respiration., vol. 67, no. 2, pp.
117–33, Jan. 2000.
[5]
J. C. Davies, E. W. F. W. Alton, and A. Bush, “Cystic fibrosis.,” BMJ, vol. 335, no. 7632,
pp. 1255–9, Dec. 2007.
[6]
S. M. Rowe, S. Miller, and E. J. Sorscher, “Cystic fibrosis.,” N. Engl. J. Med., vol. 352, no.
19, pp. 1992–2001, May 2005.
[7]
M. D. Amaral and K. Kunzelmann, “Molecular targeting of CFTR as a therapeutic
approach to cystic fibrosis.,” Trends Pharmacol. Sci., vol. 28, no. 7, pp. 334–41, Jul. 2007.
[8]
“Cystic
Fibrosis
Foundation:
Drug
Development
http://www.cff.org/research/drugdevelopmentpipeline/.
Pipeline.”
Available:
[9]
D. N. Sheppard and M. J. Welsh, “Structure and function of the CFTR chloride channel.,”
Physiol. Rev., vol. 79, no. 1 Suppl, pp. S23–45, Jan. 1999.
[10]
K. Kunzelmann and A. Mehta, “CFTR: a hub for kinases and cross-talk of cAMP and
Ca(2+),” FEBS J., Jul. 2013.
[11]
C. Li and A. P. Naren, “Macromolecular complexes of cystic fibrosis transmembrane
conductance regulator and its interacting partners.,” Pharmacol. Ther., vol. 108, no. 2, pp. 208–
23, Nov. 2005.
[12]
M. D. Amaral and C. M. Farinha, “Novel therapeutic approaches addressing the basic
defect in cystic fibrosis,” Hospital Pharmacy Europe, pp. 55–57, 2013.
[13]
P. Kongsuphol, R. Schreiber, K. Kraidith, and K. Kunzelmann, “CFTR induces
extracellular acid sensing in Xenopus oocytes which activates endogenous Ca 2+-activated Cl−
conductance.,” Pflugers Arch., vol. 462, no. 3, pp. 479–87, Sep. 2011.
[14]
M. G. Lee, “Cystic Fibrosis Transmembrane Conductance Regulator Regulates Luminal
Cl-/HCO3- Exchange in Mouse Submandibular and Pancreatic Ducts,” J. Biol. Chem., vol. 274,
no. 21, pp. 14670–14677, May 1999.
[15]
P. Linsdell and J. W. Hanrahan, “Glutathione permeability of CFTR.,” Am. J. Physiol., vol.
275, no. 1 Pt 1, pp. C323–6, Jul. 1998.
[16]
J. Ousingsawat, P. Kongsuphol, R. Schreiber, and K. Kunzelmann, “CFTR and
TMEM16A are Separate but Functionally Related Cl- Channels,” Cell. Physiol. Biochem., vol. 49,
no. 0, pp. 715–724, 2011.
[17]
L. Wei, A. Vankeerberghen, H. Cuppens, J. Eggermont, J. J. Cassiman, G. Droogmans,
and B. Nilius, “Interaction between calcium-activated chloride channels and the cystic fibrosis
transmembrane conductance regulator.,” Pflugers Arch., vol. 438, no. 5, pp. 635–41, Oct. 1999.
[18]
P. Perez-Cornejo and J. Arreola, “Regulation of Ca(2+)-activated chloride channels by
cAMP and CFTR in parotid acinar cells.,” Biochem. Biophys. Res. Commun., vol. 316, no. 3, pp.
612–7, Apr. 2004.
49
References
[19]
M. Mall, T. Gonska, J. Thomas, R. Schreiber, H. H. Seydewitz, J. Kuehr, M. Brandis, and
K. Kunzelmann, “Modulation of Ca2+-activated Cl- secretion by basolateral K+ channels in human
normal and cystic fibrosis airway epithelia.,” Pediatr. Res., vol. 53, no. 4, pp. 608–18, Apr. 2003.
[20]
M. Egan, T. Flotte, S. Afione, R. Solow, P. L. Zeitlin, B. J. Carter, and W. B. Guggino,
“Defective regulation of outwardly rectifying Cl- channels by protein kinase A corrected by
insertion of CFTR.,” Nature, vol. 358, no. 6387, pp. 581–4, Aug. 1992.
[21]
E. M. Schwiebert, M. E. Egan, T. Hwang, S. B. Fulmer, S. S. Allen, G. R. Cutting, and W.
B. Guggino, “CFTR Regulates Outwardly Rectifying Chloride Channels through an Autocrine
Mechanism Involving ATP,” Cell, vol. 81, pp. 1063–1073, 1995.
[22]
Y. D. Yang, H. Cho, J. Y. Koo, M. H. Tak, Y. Cho, W.-S. Shim, S. P. Park, J. Lee, B. Lee,
B.-M. Kim, R. Raouf, Y. K. Shin, and U. Oh, “TMEM16A confers receptor-activated calciumdependent chloride conductance.,” Nature, vol. 455, no. 7217, pp. 1210–5, Oct. 2008.
[23]
A. Caputo, E. Caci, L. Ferrera, N. Pedemonte, C. Barsanti, E. Sondo, U. Pfeffer, R.
Ravazzolo, O. Zegarra-Moran, and L. J. V Galietta, “TMEM16A, a membrane protein associated
with calcium-dependent chloride channel activity.,” Science, vol. 322, no. 5901, pp. 590–4, Oct.
2008.
[24]
J. R. Martins, D. Faria, P. Kongsuphol, B. Reisch, R. Schreiber, and K. Kunzelmann,
“Anoctamin 6 is an essential component of the outwardly rectifying chloride channel.,” Proc. Natl.
Acad. Sci. U. S. A., vol. 108, no. 44, pp. 18168–72, Nov. 2011.
[25]
K. Kunzelmann and R. Schreiber, “Membrane Biology CFTR , A Regulator of Channels,”
J. Membr. Biol., vol. 168, pp. 1–8, 1999.
[26]
S. J. Kim and W. R. Skach, “Mechanisms of CFTR Folding at the Endoplasmic
Reticulum.,” Front. Pharmacol., vol. 3, no. December, p. 201, Jan. 2012.
[27]
T. S. Cohen and A. Prince, “Cystic fibrosis: a mucosal immunodeficiency syndrome.,”
Nat. Med., vol. 18, no. 4, pp. 509–19, Apr. 2012.
[28]
G. L. Lukacs and A. S. Verkman, “CFTR : folding , misfolding and correcting the D F508
conformational defect,” Trends Mol. Med., vol. 18, no. 2, pp. 81–91, Feb. 2012.
[29]
M. D. Amaral, “CFTR and chaperones: processing and degradation.,” J. Mol. Neurosci.,
vol. 23, no. 1–2, pp. 41–8, Jan. 2004.
[30]
R. Glozman, T. Okiyoneda, C. M. Mulvihill, J. M. Rini, H. Barriere, and G. L. Lukacs, “Nglycans are direct determinants of CFTR folding and stability in secretory and endocytic
membrane traffic.,” J. Cell Biol., vol. 184, no. 6, pp. 847–62, Mar. 2009.
[31]
R. R. Kopito, “Biosynthesis and degradation of CFTR.,” Physiol. Rev., vol. 79, no. 1 Suppl,
pp. S167–73, Jan. 1999.
[32]
C. M. Farinha and M. D. Amaral, “Most F508del-CFTR is targeted to degradation at an
early folding checkpoint and independently of calnexin.,” Mol. Cell. Biol., vol. 25, no. 12, pp. 5242–
52, Jun. 2005.
[33]
C. M. Farinha, P. Matos, and M. D. Amaral, “Control of cystic fibrosis transmembrane
conductance regulator membrane trafficking: not just from the endoplasmic reticulum to the
Golgi.,” FEBS J., vol. 280, pp. 4396–4406, Jun. 2013.
[34]
A. Swiatecka-Urban, L. Talebian, E. Kanno, S. Moreau-Marquis, B. Coutermarsh, K.
Hansen, K. H. Karlson, R. Barnaby, R. E. Cheney, G. M. Langford, M. Fukuda, and B. A. Stanton,
“Myosin Vb is required for trafficking of the cystic fibrosis transmembrane conductance regulator
in Rab11a-specific apical recycling endosomes in polarized human airway epithelial cells.,” J.
Biol. Chem., vol. 282, no. 32, pp. 23725–36, Aug. 2007.
[35]
M. Gentzsch, X.-B. Chang, L. Cui, Y. Wu, V. V Ozols, A. Choudhury, R. E. Pagano, and
J. R. Riordan, “Endocytic trafficking routes of wild type and DeltaF508 cystic fibrosis
transmembrane conductance regulator.,” Mol. Biol. Cell, vol. 15, no. 6, pp. 2684–96, Jun. 2004.
50
References
[36]
D. Faria, R. Schreiber, and K. Kunzelmann, “CFTR is activated through stimulation of
purinergic P2Y2 receptors.,” Pflugers Arch., vol. 457, no. 6, pp. 1373–80, Apr. 2009.
[37]
W. Namkung, W. E. Finkbeiner, and A. S. Verkman, “CFTR-adenylyl cyclase I association
responsible for UTP activation of CFTR in well-differentiated primary human bronchial cell
cultures.,” Mol. Biol. Cell, vol. 21, no. 15, pp. 2639–48, Aug. 2010.
[38]
A. Billet, Y. Luo, H. Balghi, and J. W. Hanrahan, “Role of Tyrosine Phosphorylation in the
Muscarinic Activation of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR).,”
J. Biol. Chem., vol. 288, no. 30, pp. 21815–23, Jul. 2013.
[39]
L. Liang, O. M. Woodward, Z. Chen, R. Cotter, and W. B. Guggino, “A novel role of protein
tyrosine kinase2 in mediating chloride secretion in human airway epithelial cells.,” PLoS One, vol.
6, no. 7, p. e21991, Jan. 2011.
[40]
A. Billet and J. W. Hanrahan, “The secret life of CFTR as a calcium-activated chloride
channel.,” J. Physiol., Aug. 2013.
[41]
H. Ando, A. Mizutani, T. Matsu-ura, and K. Mikoshiba, “IRBIT, a novel inositol 1,4,5trisphosphate (IP3) receptor-binding protein, is released from the IP3 receptor upon IP3 binding
to the receptor.,” J. Biol. Chem., vol. 278, no. 12, pp. 10602–12, Mar. 2003.
[42]
D. Yang, N. Shcheynikov, and S. Muallem, “IRBIT: it is everywhere.,” Neurochem. Res.,
vol. 36, no. 7, pp. 1166–74, Jul. 2011.
[43]
K. Kunzelmann, Y. Tian, J. R. Martins, D. Faria, P. Kongsuphol, J. Ousingsawat, L. Wolf,
and R. Schreiber, “Airway epithelial cells-functional links between CFTR and anoctamin
dependent Cl- secretion.,” Int. J. Biochem. Cell Biol., vol. 44, no. 11, pp. 1897–900, Nov. 2012.
[44]
K. Kunzelmann, M. Mall, M. Briel, A. Hipper, R. Nitschke, S. Ricken, and R. Greger, “The
cystic fibrosis transmembrane conductance regulator attenuates the endogenous Ca 2+ activated
Cl- conductance of Xenopus oocytes.,” Pflugers Arch., vol. 435, no. 1, pp. 178–81, Dec. 1997.
[45]
S. Kawano, Y. Hirayama, and M. Hiraoka, “Activation mechanism of Ca(2+)-sensitive
transient outward current in rabbit ventricular myocytes.,” J. Physiol., vol. 486 ( Pt 3, pp. 593–604,
Aug. 1995.
[46]
S. Frings, D. Reuter, and S. J. Kleene, “Neuronal Ca2+ -activated Cl- channels-homing in
on an elusive channel species.,” Prog. Neurobiol., vol. 60, no. 3, pp. 247–89, Feb. 2000.
[47]
W. A. Large and Q. Wang, “Characteristics and physiological role of the Ca(2+)-activated
Cl- conductance in smooth muscle.,” Am. J. Physiol., vol. 271, no. 2 Pt 1, pp. C435–54, Aug.
1996.
[48]
C. Hartzell, I. Putzier, and J. Arreola, “Calcium-activated chloride channels.,” Annu. Rev.
Physiol., vol. 67, pp. 719–58, Jan. 2005.
[49]
B. R. Grubb and S. E. Gabriel, “Intestinal physiology and pathology in gene-targeted
mouse models of cystic fibrosis.,” Am. J. Physiol., vol. 273, no. 2 Pt 1, pp. G258–66, Aug. 1997.
[50]
J. A. Wagner, A. L. Cozens, H. Schulman, D. C. Gruenert, L. Stryer, and P. Gardner,
“Activation of chloride channels in normal and cystic fibrosis airway epithelial cells by
multifunctional calcium/calmodulin-dependent protein kinase.,” Nature, vol. 349, no. 6312, pp.
793–6, Feb. 1991.
[51]
K. Kunzelmann, P. Kongsuphol, K. Chootip, C. Toledo, J. R. Martins, J. Almaca, Y. Tian,
R. Witzgall, J. Ousingsawat, and R. Schreiber, “Role of the Ca2+ -activated Cl- channels
bestrophin and anoctamin in epithelial cells.,” Biol. Chem., vol. 392, no. 1–2, pp. 125–34, Jan.
2011.
[52]
M. Wilke, R. M. Buijs-Offerman, J. Aarbiou, W. H. Colledge, D. N. Sheppard, L. Touqui,
A. Bot, H. Jorna, H. R. de Jonge, and B. J. Scholte, “Mouse models of cystic fibrosis: phenotypic
analysis and research applications.,” J. Cyst. Fibros., vol. 10 Suppl 2, pp. S152–71, Jun. 2011.
[53]
B. C. Schroeder, T. Cheng, Y. N. Jan, and L. Y. Jan, “Expression cloning of TMEM16A
as a calcium-activated chloride channel subunit.,” Cell, vol. 134, no. 6, pp. 1019–29, Sep. 2008.
51
References
[54]
K. Kunzelmann, Y. Tian, J. R. Martins, D. Faria, P. Kongsuphol, J. Ousingsawat, F.
Thevenod, E. Roussa, J. Rock, and R. Schreiber, “Anoctamins.,” Pflugers Arch., vol. 462, no. 2,
pp. 195–208, Aug. 2011.
[55]
L. Ferrera, A. Caputo, and L. J. V Galietta, “TMEM16A protein: a new identity for Ca(2+)dependent Cl− channels.,” Physiology (Bethesda)., vol. 25, no. 6, pp. 357–63, Dec. 2010.
[56]
A. Adomaviciene, K. J. Smith, H. Garnett, and P. Tammaro, “Putative pore-loops of
TMEM16/anoctamin channels affect channel density in cell membranes.,” J. Physiol., vol. 591,
no. Pt 14, pp. 3487–505, Jul. 2013.
[57]
S. Ponissery Saidu, A. B. Stephan, A. K. Talaga, H. Zhao, and J. Reisert, “Channel
properties of the splicing isoforms of the olfactory calcium-activated chloride channel Anoctamin
2.,” J. Gen. Physiol., vol. 141, no. 6, pp. 691–703, Jun. 2013.
[58]
H. C. Hartzell, K. Yu, Q. Xiao, L.-T. Chien, and Z. Qu, “Anoctamin/TMEM16 family
members are Ca2+-activated Cl- channels.,” J. Physiol., vol. 587, no. Pt 10, pp. 2127–39, May
2009.
[59]
“UniProt.” Available: http://www.uniprot.org/uniprot/Q4KMQ2.
[60]
C. Duran and H. C. Hartzell, “Physiological roles and diseases of Tmem16/Anoctamin
proteins: are they all chloride channels?,” Acta Pharmacol. Sin., vol. 32, no. 6, pp. 685–92, Jun.
2011.
[61]
T. J. Jentsch, V. Stein, F. Weinreich, and A. A. Zdebik, “Molecular Structure and
Physiological Function of Chloride Channels,” Physiol Rev, vol. 82, no. 2, pp. 503–568, Apr. 2002.
[62]
Z. Qu, L.-T. Chien, Y. Cui, and H. C. Hartzell, “The anion-selective pore of the
bestrophins, a family of chloride channels associated with retinal degeneration.,” J. Neurosci., vol.
26, no. 20, pp. 5411–9, May 2006.
[63]
R. A. Frizzell, G. Rechkemmer, and R. L. Shoemaker, “Altered regulation of airway
epithelial cell chloride channels in cystic fibrosis.,” Science, vol. 233, no. 4763, pp. 558–60, Aug.
1986.
[64]
H. Stöhr, J. B. Heisig, P. M. Benz, S. Schöberl, V. M. Milenkovic, O. Strauss, W. M.
Aartsen, J. Wijnholds, B. H. F. Weber, and H. L. Schulz, “TMEM16B, a novel protein with calciumdependent chloride channel activity, associates with a presynaptic protein complex in
photoreceptor terminals.,” J. Neurosci., vol. 29, no. 21, pp. 6809–18, May 2009.
[65]
K. Kunzelmann, R. Schreiber, A. Kmit, W. Jantarajit, J. R. Martins, D. Faria, P.
Kongsuphol, J. Ousingsawat, and Y. Tian, “Expression and function of epithelial anoctamins.,”
Exp. Physiol., vol. 97, no. 2, pp. 184–92, Feb. 2012.
[66]
R. Schreiber, I. Uliyakina, P. Kongsuphol, R. Warth, M. Mirza, J. R. Martins, and K.
Kunzelmann, “Expression and function of epithelial anoctamins.,” J. Biol. Chem., vol. 285, no. 10,
pp. 7838–45, Mar. 2010.
[67]
J. Ousingsawat, J. R. Martins, R. Schreiber, J. R. Rock, B. D. Harfe, and K. Kunzelmann,
“Loss of TMEM16A causes a defect in epithelial Ca 2+-dependent chloride transport.,” J. Biol.
Chem., vol. 284, no. 42, pp. 28698–703, Oct. 2009.
[68]
J. Suzuki, M. Umeda, P. J. Sims, and S. Nagata, “Calcium-dependent phospholipid
scrambling by TMEM16F.,” Nature, vol. 468, no. 7325, pp. 834–8, Dec. 2010.
[69]
G. SE, C. LL, B. RC, S. MJ, S. E. Gabriel, L. L. Clarke, R. C. Boucher, and M. J. Stutts,
“CFTR and outward rectifying chloride channels are distinct proteins with a regulatory
relationship.,” Nature, vol. 363, no. 6426, pp. 263–8, May 1993.
[70]
A. J. Szkotak, S. F. P. Man, and M. Duszyk, “The role of the basolateral outwardly
rectifying chloride channel in human airway epithelial anion secretion.,” Am. J. Respir. Cell Mol.
Biol., vol. 29, no. 6, pp. 710–20, Dec. 2003.
[71]
F. M. Ashcroft, Ion Channels and Disease. Academic Press, 1999, p. 481.
52
References
[72]
T. Ishikawa and D. I. Cook, “Characterization of an outwardly rectifying chloride channel
in a human submandibular gland duct cell line (HSG).,” Pflugers Arch., vol. 427, no. 3–4, pp. 203–
9, Jun. 1994.
[73]
V. M. Milenkovic, M. Brockmann, H. Stöhr, B. H. Weber, and O. Strauss, “Evolution and
functional divergence of the anoctamin family of membrane proteins.,” BMC Evol. Biol., vol. 10,
no. 1, p. 319, Jan. 2010.
[74]
Y. Tian, P. Kongsuphol, M. Hug, J. Ousingsawat, R. Witzgall, R. Schreiber, and K.
Kunzelmann, “Calmodulin-dependent activation of the epithelial calcium-dependent chloride
channel TMEM16A.,” FASEB J., vol. 25, no. 3, pp. 1058–68, Mar. 2011.
[75]
B. R. Grubb, R. N. Vick, and R. C. Boucher, “Hyperabsorption of Na+ and raised Ca(2+)mediated Cl- secretion in nasal epithelia of CF mice.,” Am. J. Physiol., vol. 266, no. 5 Pt 1, pp.
C1478–83, May 1994.
[76]
L. L. Clarke and R. C. Boucher, “Chloride secretory response to extracellular ATP in
human normal and cystic fibrosis nasal epithelia.,” Am. J. Physiol., vol. 263, no. 2 Pt 1, pp. C348–
56, Aug. 1992.
[77]
J. R. Rock, W. K. O’Neal, S. E. Gabriel, S. H. Randell, B. D. Harfe, R. C. Boucher, and B.
R. Grubb, “Transmembrane protein 16A (TMEM16A) is a Ca2+-regulated Cl- secretory channel in
mouse airways.,” J. Biol. Chem., vol. 284, no. 22, pp. 14875–80, May 2009.
[78]
R. Muimo, “Regulation of CFTR function by annexin A2-S100A10 complex in health and
disease.,” Gen. Physiol. Biophys., vol. 28 Spec No, pp. F14–9, Jan. 2009.
[79]
D. B. Short, K. W. Trotter, D. Reczek, S. M. Kreda, A. Bretscher, R. C. Boucher, M. J.
Stutts, and S. L. Milgram, “An apical PDZ protein anchors the cystic fibrosis transmembrane
conductance regulator to the cytoskeleton.,” J. Biol. Chem., vol. 273, no. 31, pp. 19797–801, Jul.
1998.
[80]
R. Schreiber, A. Boucherot, B. Mürle, J. Sun, and K. Kunzelmann, “Control of epithelial
ion transport by Cl- and PDZ proteins.,” J. Membr. Biol., vol. 199, no. 2, pp. 85–98, May 2004.
[81]
S. Shenolikar, J. W. Voltz, R. Cunningham, and E. J. Weinman, “Regulation of ion
transport by the NHERF family of PDZ proteins.,” Physiology (Bethesda)., vol. 19, pp. 362–9,
Dec. 2004.
[82]
C. Ehrhardt, E.-M. Collnot, C. Baldes, U. Becker, M. Laue, K.-J. Kim, and C.-M. Lehr,
“Towards an in vitro model of cystic fibrosis small airway epithelium: characterisation of the human
bronchial epithelial cell line CFBE41o-.,” Cell Tissue Res., vol. 323, no. 3, pp. 405–15, Mar. 2006.
[83]
J. J. M. Landry, P. T. Pyl, T. Rausch, T. Zichner, M. M. Tekkedil, A. M. Stütz, A. Jauch,
R. S. Aiyar, G. Pau, N. Delhomme, J. Gagneur, J. O. Korbel, W. Huber, and L. M. Steinmetz, “The
Genomic and Transcriptomic Landscape of a HeLa Cell Line.,” G3 (Bethesda)., vol. 3, no. 8, pp.
1213–24, Jan. 2013.
[84]
S. H. Hsu, B. Z. Schacter, N. L. Delaney, T. B. Miller, V. A. McKusick, R. H. Kennett, J.
G. Bodmer, D. Young, and W. F. Bodmer, “Genetic characteristics of the HeLa cell.,” Science,
vol. 191, no. 4225, pp. 392–4, Jan. 1976.
[85]
A. Stacey, G. Stacey, and S. I. Gürhan, An Indepth Characterization of BHK Cell Lines.
Boston, MA: Springer US, 1998, pp. 117–121.
[86]
H. Matsui, L. G. Johnson, S. H. Randell, and R. C. Boucher, “Loss of binding and entry
of liposome-DNA complexes decreases transfection efficiency in differentiated airway epithelial
cells.,” J. Biol. Chem., vol. 272, no. 2, pp. 1117–26, Jan. 1997.
[87]
C. Vogel and E. M. Marcotte, “Insights into the regulation of protein abundance from
proteomic and transcriptomic analyses.,” Nat. Rev. Genet., vol. 13, no. 4, pp. 227–32, Apr. 2012.
[88]
J. Noe, D. Petrusca, N. Rush, P. Deng, M. VanDemark, E. Berdyshev, Y. Gu, P. Smith,
K. Schweitzer, J. Pilewsky, V. Natarajan, Z. Xu, A. G. Obukhov, and I. Petrache, “CFTR regulation
53
References
of intracellular pH and ceramides is required for lung endothelial cell apoptosis.,” Am. J. Respir.
Cell Mol. Biol., vol. 41, no. 3, pp. 314–23, Sep. 2009.
[89]
I. Szabò, A. Lepple-Wienhues, K. N. Kaba, M. Zoratti, E. Gulbins, and F. Lang, “Tyrosine
kinase-dependent activation of a chloride channel in CD95-induced apoptosis in T lymphocytes.,”
Proc. Natl. Acad. Sci. U. S. A., vol. 95, no. 11, pp. 6169–74, May 1998.
[90]
A. G. Manford, C. J. Stefan, H. L. Yuan, J. a Macgurn, and S. D. Emr, “ER-to-plasma
membrane tethering proteins regulate cell signaling and ER morphology.,” Dev. Cell, vol. 23, no.
6, pp. 1129–40, Dec. 2012.
[91]
C. J. Stefan, A. G. Manford, and S. D. Emr, “ER-PM connections: sites of information
transfer and inter-organelle communication.,” Curr. Opin. Cell Biol., Mar. 2013.
[92]
“Tet-Off
Advanced
http://www.clontech.com/.
Inducible
Gene
Expression
Systems.”
Available:
54
Appendices
8 Appendices
8.1 Appendix I – pcDNA3.1 Ano1 eGFP plasmid map
55
Appendices
FLAG-tag was cloned between positions 2128/2129, into Ano1’s first extracellular
loop:
56
Appendices
8.2 Appendix II – pcDNA3.1 Ano1 FLAG eYFP plasmid map
57
Appendices
FLAG-tag was cloned between positions 2128/2129, into Ano1’s first extracellular
loop:
58
Appendices
8.3 Appendix III – pcDNA3.1 Ano1 FLAG CFP plasmid map
59
Appendices
FLAG-tag was cloned between positions 2128/2129, into Ano1’s first extracellular
loop:
60
Appendices
8.4 Appendix IV – pIRES Ano1 eGFP CD8 plasmid map
61
Appendices
62
Appendices
8.5 Appendix V – pIRES Ano1 L982A CD8 plasmid map
CD8
63
Appendices
64
Appendices
8.6 Appendix VI - pcDNA3.1 Ano6 FLAG eGFP plasmid map
65
Appendices
FLAG-tag was cloned between positions 2012/2013, into Ano6’s first extracellular
loop:
66
Appendices
8.7 Appendix VII – pIRES Ano6 eGFP CD8 plasmid map
67
Appendices
68
Appendices
8.8 Appendix VIII – pcDNA3.1 Ano9 FLAG eGFP plasmid map
69
Appendices
FLAG-tag was cloned between positions 1638/1639, into Ano9’s first extracellular
loop:
70
Appendices
8.9 Appendix X – Live-cell imaging of Ano1 and Ano6 eGFP tagged
a) Parental BHK cell line
Ano1 (eGFP)
Lipid marker
Merge
Lipid marker
Merge
Lipid marker
Merge
b) BHK WT-CFTR cell line
Ano1 (eGFP)
c) BHK F508del-CFTR cell line
Ano1 (eGFP)
Figure 8.1 – Immunocytochemistry (live imaging) of eGFP tagged Ano1 (green) when transiently
overexpressed in non-stimulated a) parental BHK cells, b) BHK WT-CFTR (cells were firstly tripsinized and
then seeded on Poly-L-Lysine cover slips) and c) BHK F508del-CFTR. Scale=10 µm.
a) Parental BHK cells
Ano6 (eGFP)
Lipid marker
Merge
71
Appendices
b) BHK WT-CFTR cells
Ano6 (eGFP)
Lipid marker
Merge
Lipid marker
Merge
c) BHK F508del-CFTR cells
Ano6 (eGFP)
Figure 8.2 – Immunocytochemistry (live imaging) of eGFP tagged Ano6 (green) when transiently
overexpressed in non-stimulated a) parental BHK cells, b) BHK WT-CFTR (cells were firstly tripsinized and
then seeded on Poly-L-Lysine cover slips) and c) BHK F508del-CFTR. Scale=10 µm.
72
Appendices
8.10 Appendix XI – Anoctamin constructs testing
Ano1 FLAG
Pst I
Ssp I
Pst I
3000
500
Figure 8.3 – Digestion of pcDNA3.1 Ano1 FLAG eGFP, YFP and CFP, Ano6 FLAG eGFP and Ano9 FLAG
eGFP with Pst I and Ssp I. The expected fragments were obtained for all the plasmids.
a)
Total Ano1 (eGFP)
Membrane Ano1 (FLAG)
Merge
Membrane Ano1 (FLAG)
Merge
b)
Total Ano1 (YFP)
73
Appendices
c)
Total Ano9 (eGFP)
Ano9 (FLAG)
Merge
Ano9 (FLAG)
Merge
d)
Total Ano9 (eGFP)
Figure 8.4 – Immunocytochemistry of FLAG on HeLa Kyoto transiently transfected with a) Ano1 FLAG eGFP,
b) Ano1 FLAG YFP, c) Ano9 FLAG eGFP and permeabilized with 0.1% Triton-X and d) Ano9 FLAG eGFP
but not permeabilized. The FLAG staining worked well for all the plasmids except in Ano9 case for which
cells needed to be permeabilized, however this was expected since Ano9 is known to be intracellular
localized[66].Scale=100 µm
a)
b)
Figure 8.5 – HEK293 cells were transfected with Ano6 FLAG eGFP and whole-cell currents were measured
by patch clamp before and after stimulation with 1µM ionomycin, using a voltage ramp protocol (-100mV –
100mV). a) Average whole-cell current density at 100 mV and b) current–voltage (I/V) relationships of resting
currents and activated by 1 µM ionomycin in Ano6 FLAG eGFP-overexpressing and non-transfected HEK
cells. Ano6 didn’t show any signal of activation when cells were stimulated with ionomycin, however when
currents in transfected cells are compared with the ones in non-transfected it’s possible to see a bigger
outwardly rectifying behaviour and resting cell current on the first ones. This suggests that although Ano6 is
producing currents the FLAG insertion seems to have desensitized Ano6 for calcium activation. These tests
are still in progress. Mean ± SEM, n = number of cells measured.
74