Biology 107 Macromolecules III September 7, 2005 Proteins May Be Denatured and Renatured. When proteins are changed from one environment to another they usually change shape (denature). Return to the original environment commonly results in folding that is different than normally found under that condition. Protein “Partners” (Chaperones) Influence Folding Protein Chaperones Influence “Correct” Folding Macromolecules III Student Objectives: As a result of this lecture and the assigned reading, you should understand the following: 1. Nucleic Acids are polymers of nucleotides. There are two types of nucleic acids: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). 2. Nucleic acids function in information coding, storage and transfer. DNA does not directly control protein synthesis, instead it works through intermediates, RNA molecules. Macromolecules III 3. Each nucleotide monomer has three (3) parts: five carbon sugar phosphate group nitrogenous base Nucleic acids contain one of two 5-carbon sugars, either deoxyribose (in DNA) or ribose (in RNA). Linked to the one end of the sugar is a phosphate group, and linked to the other end of the pentose is one of the nitrogenous bases. DNA has the nitrogenous bases adenine (A), guanine (G), thymine (T), and cytosine (C). RNA has A, G, C and uracil (U) (instead of thymine). Macromolecules III 4. A nucleic acid polymer, a polynucleotide, forms from monomers covalently linked by dehydration synthesis. The phosphate group of one nucleotide bonds to the sugar of the next nucleotide, with the result a repeating sugar-phosphate backbone. 5. RNA is normally a single polynucleotide strand, while DNA is a double-stranded molecule. 6. Nucleic acids form complementary base pairs stabilized by hydrogen bonds, with guanine pairing with cytosine and adenine pairing with thymine or uracil. Functions of Nucleic Acids Information coding, storage, and transfer Synthesis of other nucleic acids or proteins Central Dogma DNA ↓ RNA ↓ Protein The Flow of Genetic Information (The Central Dogma) Mass Storage of Information We store lots of information using simple linear codes CTGGGTTCTGTTCGGGATCCCAGTCACAGGGACAATGGCGCATTCATATGTCACTTCCTTTACC TGCCTGGAGGAGGTGTGGCCACAGACTCTGGTGGCTGCGAACGGGGACTCTGACCCAGTCG ACTTTATCGCCTTGACGAAGGGTTGGTTAATCCGTGCATGTGAGCTCCTCAGGGTGGAATCCAG GAGGATCCACGAGGGTGAATTGGCGGCATTCTTGTCTTACGCCATCGCCTACCCCCAAAACTTC CTGTCTGTGATTGACAGCTACAGCGTAGGATGCGGTCTGTTGAACTTCTGCGCGGTGGCTCTG GCTCTCTGTGAACTGGGCTACAGGCCTGTGGGGGTGCGTTTGGACAGCGGTGACCTCTGCAG CCTGTCGGTGGATGTCCGCCAGGTCTTCAGACGCTGCAGCGAGCATTTCTCCGTCCCTGCCTT TGATTCGTTGATCATCGTCGGGACGAATAACATCTCAGAGAAAAGCTTGACGGAGCTCAGCCTG AAGGAGAACCAGATTGACGTTGTCGGAGTCGGAACTCACCTGGTCACCTGTACGACTCAGCCG TCGCTGGGTTGCGTTTACAAGCTGGTGGAGGTGAGGGGGAGGCCCCGGATGAAGATCAGCGA GGATCCGGAAAAGAGCACCGTTCCCGGGAGGAAGCAGGTGTACCGCCTGATGGACACTGATG CTCCTCCAGAACCTGGAGTCCCTCTGAGCTGCTTCCCTCTGTGCTCCGATCGCTCCTCCGTCT CCGTCACCCCGGCGCAGGTTCACCGTCTGCGGCAGGAAGTCTTTGTTGATGGACAGGTCACA GCCCGTCTGTGCAGCGCCACAGAGACCAGAACGGAGGTCCAGACCGCTCTCAAGACCCTCCA CCCTCGACACCAGAGGCTGCAGGAGCCAGACTCGTACACGGTGATTCACATTCTGAAGAAAAC AACATTGGATCGCGCTTTTCCGCTCTCTTCCCTTAGTTTCCCCTCCGAACTCCGCCGCTGGGCC GGAGGACTGAACCGGCCCCCGACGGTGTCCCAGCGGCGGTGCAATGTGGCCCGGGTCCGG GAGGAGTGCGTGACGCCAGAGCAGAATGGTTCGGTGGACGGGGGCGCACACGCTTCTCGCC GCGGCCGCTCCCCGCGGCCCACGGAACCGCGGGATCGGAGCTGTTTTGTGCCGCCTGAAGG ACTCGAAGGGGGACGGATAAATGCTGGATCCCCGAGTCCAGATCTGACCGTCTGCATTCCGCT GGTGAGCTGCCAGACGCATCTGGAAACGAGCGCCGACAGAAGCAGCTCCGGACCATGTCGCC GTCCGCGCACACAGGTCGCGTGTAAAGGGGACTTGGTCAGATCATCTTGCACCGGAACCAGG TCTCCCCTGGAGATGGGGACGGTCATGACCGTCTTCTACCAGAAGAAGTCCCAGCGGCCGGA GAGGAGAACCTTCCAGATCAAGCCTGACACGCGGCTCCTCGTGTGGAGCCGAAACCCCGACA AAAGCGAAGGAGAGAGTGAGTATGAGCAGGCGGGCCGTGCCGGGACCGGGCCCACGCCGC CCAGAACCTCATGTTCCTGGTGTTCCAGCACCGACCGGCCAGTTCTGGCTCAGCTCCACACAA CATCTGACAAACCCTCGTGGTTCCTGGTGGTCGACCACACGGCTGGTGAGGCGGCCTCAGGT AGCTCAGGTAGCTCAGGTTAGCGTAAAGGGAGTTTTAAGCATCACCTGGTGACGGGGCAGGTG Mass Storage of Information Another simple linear code, the DNA sequence, is the basis of life Dense Information Storage This image shows 1 gram of DNA on a CD that can hold 800 MB of data. The 1 gram of DNA can hold about 1x1014 MB of data. The number of CDs required to hold this amount of information, lined up edge to edge, would circle the Earth 375 times, and would take 163,000 centuries to listen to. DNA as Mass Storage Device If the DNA sequence from a single human sperm cell were typed on a continuous ribbon in ten-pitch type, that ribbon could be stretched from San Francisco to Chicago to Washington to Houston to Los Angeles, and back to San Francisco, with about 60 miles of ribbon left over. Structure of Nucleotides Structure of Nucleotides Pentose sugar Phosphate group Nitrogenous base Nitrogenous Bases Chargaff’s Rules Erwin Chargaff’s data indicated that in DNA the amount of adenine nearly always equaled the amount of thymine and the amount of cytosine nearly always equaled the amount of guanine. mol % of bases Ratios Source %GC A G C T A/T G/C Octopus 33.2 17.6 17.6 31.6 1.05 1.00 35.2 Chicken 28.0 22.0 21.6 28.4 0.99 1.02 43.7 Rat 28.6 21.4 20.5 28.4 1.01 1.00 42.9 Human 29.3 20.7 20.0 30.0 0.98 1.04 40.7 Double Helix Structure of DNA 1953 2003 Original Nature paper by Watson and Crick – 1953 Click to Open Thread of History Back in my rooms I lit the coal fire, knowing there was no chance that the sight of my breath would disappear before I was ready for bed. With my fingers too cold to write legibly I huddled next to the fireplace, daydreaming about how several DNA chains could fold together in a pretty and hopefully scientific way. Soon, however, I abandoned thinking at the molecular level and turned to the much easier job of reading biochemical papers on the interrelations of DNA, RNA and protein synthesis. from Chapter 21 of The Double Helix by James Dewey Watson. Thread of History Virtually all the evidence then available made me believe that DNA was the template upon which RNA chains were made. In turn, RNA chains were the likely candidates for the templates for protein synthesis. There was some fuzzy data using sea urchins, interpreted as a transformation of DNA into RNA, but I preferred to trust other experiments showing that DNA molecules, once synthesized, are very very stable. The idea of the genes' being immortal smelled right, and so on the wall above my desk I taped up a paper sheet saying DNA -> RNA -> protein. The arrows did not signify chemical transformations, but instead expressed the transfer of genetic information from the sequences of nucleotides in DNA molecules to the sequences of amino acids in proteins. from Chapter 21 of The Double Helix by James Dewey Watson. The Eagle Questions to Consider For Watson and Crick Paper 1. What was one of the reasons Watson and Crick did not expect the phosphate groups in DNA to be aligned along the axis of the DNA molecule? 2. What is the means by which the individual strands in DNA are joined together? 3. What is the consequence of knowing the base sequence of one strand? What is the implication for copying the genetic material? DNA Is Normally Double-Stranded Each strand has polarity (5’ and 3’ ends). In double-stranded DNA each strand is oriented “anti-parallel” to the other strand. The strands are normally held together by hydrogen bonds. The optimal hydrogen bonding is when A bonds with T and G bonds with C. Base Pairing in DNA G/C pairs have three hydrogen bonds A/T pairs have two hydrogen bonds Double Helix Nucleic Acid Gel Electrophoresis The Sequence of Nucleotides Encodes Information _ + The Double Helix Structure of Complementary Strands Explains The Mechanism of DNA Replication ATP Is a Nucleotide ATP Structure and Hydrolysis Summary of Adenine Phosphates 1. ATP (adenosine triphosphate) = 3 phosphate groups + adenine + ribose sugar a. This is the high energy form b. The energy is greatest in the bond holding the third phosphate - that bond is easily broken. 2. ADP (adenosine diphosphate) = 2 phosphate groups + adenine + ribose sugar a. This is the low energy form b. ADP can be recharged into ATP by addition of phosphate, if a phosphate source and enough energy are available. 3. AMP (adenosine monophosphate) = 1 phosphate group + adenine + ribose sugar a. Intracellular activator of processes Additional Resources http://www.nature.com/nature/dna50/ - Anniversary issue of Nature celebrating the 50th year following the original DNA structure articles. Interesting links. Article about Rosalind Franklin. http://www.genome.gov/10001772 - Federal Human Genome Project website. http://www.time.com/time/time100/scientist/profile/watsoncrick.html short recount of Watson and Crick at Cambridge. http://www.dnai.org/index.htm - Home page for DNA Interactive. Time lines and interesting historical information. Photos at: http://www.dnai.org/album/6/album.html.