Non-tumorigenic epithelial cells secrete MCP-1 and other cytokines that
promote cell division in breast cancer cells by activating ERα via
PI3K/Akt/mTOR signaling
Maria Riverso1, Andreas Kortenkamp2 and Elisabete Silva2*
1
UCL School of Pharmacy, 20-39 Brunswick Square, WC1N 1AX, London (UK),
2
Brunel University, Institute for the Environment, Kingston Lane, UB8 3PH,
Uxbridge Middlesex (UK).
CORRESPONDENCE TO: Elisabete Silva, Brunel University, Institute for the
Environment, Kingston Lane, UB8 3PH, Uxbridge Middlesex (UK). Tel: +44 (0)1895
265330; E-mail: elisabete.silva@brunel.ac.uk
KEYWORDS: Tumor microenvironment, breast cancer, estrogen receptor, MCP-1
1
ABSTRACT
Efforts in understanding the role of the microenvironment in the development of
breast cancer have focused on tumor-stroma cross-talk, but the possibility that normal
epithelial cells might also play a role in tumor progression has received little
attention. Here, we show that non-tumorigenic human mammary epithelial cells
(MCF10A and HMEC) secrete factors able to enhance the proliferation of estrogen
receptor alpha (ERα) positive breast cancer cells (MCF7 and T47D) and suppress
their ability to undergo apoptosis. Conditioned medium (CM) derived from MCF10A
and HMEC cells was capable of activating ERα in a hormone-independent way, by
phosphorylating ERα on Ser167. Co-exposure with PI3K and mTORC1 inhibitors
significantly reduced the ERα Ser167 phosphorylation and suppressed the
proliferation-enhancing effects of both 10A-CM and HMEC-CM on MCF7 cells. We
show that MCF10A and HMEC secrete numerous cytokines, among them MCP-1,
which was one of the most prevalent. MCP-1 was shown to have a role in the effects
elicited by the 10A-CM. It activated the ERα by phosphorylating Ser167 via the
PI3K/Akt/mTORC1 signaling pathway, an effect which was further confirmed by
silencing the MCP-1 receptors, CCR2 and CCR4. To our knowledge, this is the first
time MCP-1 has been shown to contribute to ERα signaling activation.
These data suggest that normal mammary cells could have the capability of
supporting the proliferation of breast cancer cells via paracrine interactions. As this
communication occurs within the terminal ductal lobular units, before the cross-talk
between tumor and stroma takes place, a better understanding of the role of these cells
may be useful for designing strategies for the prevention of tumor progression at early
stages.
2
INTRODUCTION
For decades, breast cancer development has been viewed with a focus on the tumor
cell and its progression to malignancy through the accumulation of numerous genetic
and epigenetic alterations. However, more recent studies have highlighted the role of
the microenvironment in cancer initiation and progression [1] and the tumor
microenvironment is now recognized as one of the hallmarks of cancer [2].
To date, efforts to understand the role of the tumor microenvironment in breast cancer
have concentrated on the paracrine interactions between tumor cells and the
surrounding stroma. Normal fibroblasts can delay or prevent mammary
tumorigenesis, while cancer-associated fibroblasts can promote tumor growth [3].
Bone marrow-derived mesenchymal stem cells have a role in promoting distant
metastases [4], and most primary and metastatic tumors are influenced by paracrine
factors secreted by immune cells [5].
In contrast, the possibility that interactions between breast cancer and normal
epithelial cells might also play a role in tumor development has received little
attention. However, such interactions might be of importance, since most breast
tumors arise from the hollow lumen of the terminal ductal lobular units (TDLUs). As
a result of the breast tissue architecture, the tumor microenvironment is largely
composed of normal epithelial and myoepithelial cells during the early phases of
breast carcinogenesis. This is especially relevant for the ductal carcinoma in situ
(DCIS) phase, when the tumor is still confined to the TDLU. It therefore appears
likely that communication between normal epithelial cells and the neighboring
malignant cells might contribute to determining the fate of the tumor, even before
cross-talk with the stroma can occur.
The few available reports about these interactions have produced varied results.
Toillon and colleagues showed that conditioned medium (CM) derived from primary
cultures of normal epithelial breast cells inhibited the growth of breast cancer cell
lines in monolayer and in three-dimensional cultures [6]. Spink and colleagues [7]
observed that non-tumorigenic epithelial MCF10A cells induced growth inhibitory
effects on co-cultured MCF7 mammary cancer cells exposed to 17-estradiol (E2). In
contrast, Carpenter et al. reported that CM derived from immortalized mammary
epithelial cells induced dose-dependent motility in MCF7 cells [8]. Additionally,
Poczobutt et al. found enhanced colony growth in soft agar and clonogenicity of
breast cancer cells in response to the presence of normal mammary epithelial cells [9].
In the present study, we have investigated interactions between mammary epithelial
cells by evaluating the impact of non-tumorigenic breast cells on the proliferation and
the malignant phenotype of estrogen receptor α positive (ERα+) breast cancer cells.
For the first time, we show that non-tumorigenic mammary epithelial cells (MCF10A
and HMEC) secrete factors capable of inducing the proliferation of ERα+ breast
cancer cells (MCF7 and T47D). These factors activate ERα independently of
estrogens, via the PI3K/Akt/mTORC1 signaling pathway. Finally, analysis of the
conditioned media derived from these normal epithelial cells using a cytokine
antibody array revealed that these cells secrete numerous cytokines. Several lines of
evidence have emphasized the role played by cytokines and chemokines in the
initiation and progression of many types of tumors. Studies suggest that, in addition to
immune cells, these factors are also secreted by tumor cells and cells from the
microenvironment. Therefore, together with their protective role during cancer-related
inflammation, they can also promote cell proliferation, angiogenesis, metastasis and
3
cell survival (reviewed in [10]). Here, we demonstrate that the monocyte chemotactic
protein 1 (MCP-1) is the most abundant factor in the conditioned media of normal
epithelial cells and that it represents an important mediator of their pro-tumorigenic
effects. Our observations highlight the role of this chemokine within the tumor
microenvironment.
RESULTS
Non-tumorigenic epithelial cells enhance cell proliferation and inhibit apoptosis in
ERα+ breast cancer cells via paracrine factors
To test whether non-tumorigenic mammary epithelial cells could influence the
proliferation of ERα+ MCF7 breast cancer cells, we first performed transwell coculture experiments in which the two cell lines communicate via secreted factors, but
not by physical contact. The presence of MCF10A cells induced a 1.7-fold increase in
MCF7 cell numbers when compared to MCF7 cells cultured alone (Fig. 1A). This
effect was not restricted to the MCF10A cell line, as co-cultures between primary
HMEC cells and MCF7 cells increased MCF7 cell numbers by 1.7-fold (Fig. 1B). The
increase in MCF7 cell numbers in the presence of normal epithelial cells, but in the
absence of direct cell-cell contact, suggests that the effects exerted by the normal cells
are mediated by the secretion of soluble factor(s).
To determine whether the secretion of factors by normal epithelial cells was, in turn,
influenced by factors emanating from MCF7 cells through bilateral interactions
between the two cell types, we next treated MCF7 cells with CM derived from
MCF10A and HMEC. 10A-CM and HMEC-CM increased MCF7 cell numbers by
1.8-fold (Fig. 1C) and 1.9-fold (Fig. 1D), respectively. CM of an additional nontumorigenic epithelial cell line MCF12A (12A-CM) was also tested and revealed a
1.8-fold increase in MCF7 cell numbers (Supplementary Fig. 1). To exclude the
possibility that the effect of 10A-CM was due to factors secreted by “stressed”
MCF10A cells following the starvation process, we also tested the conditioned media
derived from cells cultured in medium containing 5% of serum. Treatment of MCF7
cells with these conditioned media produced results similar to those described above
(data not shown).
We next assessed whether the effects of 10A-CM were specific to MCF7 cells or
whether they also occurred with other breast cancer cell lines. 10A-CM increased cell
numbers by 1.3-fold in T47D ERα+ cells (Fig. 1E), but not in ERα- MDA-MB231
cells (Fig. 1F), suggesting that the effects of 10A-CM are specific to ERα+ breast
cancer cells.
It is well established that E2 increases cell proliferation and reduces apoptosis in
ERα+ breast cancer cells [11]. To determine whether the enhanced cell proliferation
induced by 10A-CM was also associated with a reduction in apoptosis of MCF7 cells,
we performed a Caspase 3/7 activity assay. MCF-7 cells were treated with Mitomycin
C, a known apoptotic chemotherapy agent (positive control), and with E2 (antiapoptotic negative control). No effect on Caspase 3/7 activity was observed upon
treatment with 10A-CM alone. However, in a similar way to E2, 10A-CM
dramatically reduced the Caspase 3/7 activity induced by Mitomycin C (Fig. 1G),
which confirms its anti-apoptotic effect. The anti-apoptotic effect of 10A-CM was
further confirmed by real-time PCR, where the anti-apoptotic genes BCL-2 and BCL4
XL were up-regulated, while the pro-apoptotic genes BAX and BAD were downregulated upon 10A-CM treatment (Fig. 1H).
The effects of the factors secreted by non-tumorigenic epithelial mammary cells are
mediated by ERα
As ERα+ breast cancer cells depend on ERα signaling for their growth and survival
[12], it appeared plausible that ERα signaling was also involved in the effects
produced by the MCF10A secreted factors. To test this idea, MCF7 cells were
exposed to 10A-CM in the presence of the pure ER antagonist ICI 182,780, which
blocks the activation of the receptor by binding both its activation function domains
(AF-1 and AF-2). ICI 182,780 significantly reduced the cell proliferation induced by
10A-CM, suggesting an involvement of ERα in the responses elicited by 10A-CM
(Fig. 2A). To further confirm that ERα activation was required for the 10A-CMincreased cell division, the same work was carried out in T47D cells. These cells are
known to express lower levels of ERα compared to MCF7 [13] and thus, higher
concentrations of ICI 182,780 (1 μM) together with prolonged treatment durations
(six days) were used in these experiments. ICI 182,780 significantly reduced 10A-CM
induced proliferation in T47D cells (Fig. 2B). Similar to the observations with 10ACM, treatment of MCF7 cells with HMEC-CM in combination with ICI 182,780 led
to a significant reduction in cell numbers. This indicates that HMEC cells also
secreted factors which activate the ERα (Fig. 2C).
10A-CM phosphorylates ERα and increases its transcriptional activity
One possible explanation for the activation of ERα induced by 10A-CM could be the
presence of steroidal estrogens and other estrogenic agents in the medium. This was
carefully avoided by using phenol-red free media and CD-FBS in all experiments.
The absence of any residual steroidal estrogens was also confirmed by radio-immune
assay (data not shown). This strongly suggested that agents other than estrogens were
responsible for the observed ERα-mediated effects. It has been demonstrated that, in
the absence of hormones, the ERα can be activated by phosphorylation of key serine
residues within the AF1 domain via upstream activated signaling pathways [14]. We
therefore sought to clarify whether such processes occurred after exposure of MCF7
cells to 10A-CM, subsequent to estrogen deprivation of the cells for 3 days. This
treatment regimen induced robust phosphorylation of the ERα at Ser167, while
phosphorylation at Ser118, which is the major phosphorylation site in response to
estrogens [15], was not observed (Fig. 3A). Phosphorylation of the ERα at Ser167
was also observed in MCF7 cells treated with HMEC-CM (Fig. 3B). These data not
only confirmed that the growth-promoting effects produced by 10A-CM and HMECCM on ERα+ MCF7 cells involve activation of the ERα, but further demonstrate that
ERα activation by conditioned media is hormone-independent and may be the result
of cross-talk with other signaling cascades.
One way in which ERα can stimulate (or repress) gene transcription is by binding to
the estrogen response element (ERE) in the promoter region of specific target genes.
To analyze whether the 10A-CM-induced ERα phosphorylation rendered the receptor
transcriptionally active, we employed a luciferase reporter gene assay based on ERα+
T47D K-Bluc breast cancer cells. Adequate assay performance was confirmed by
including a positive control (E2 1nM) whose effect on ERα transcriptional activity (6fold increase) was completely abrogated by ICI 182,780 (Supplementary Fig. 2).
10A-CM significantly induced ERα transcriptional activity, producing a 1.5-fold
5
increase in luciferase expression relative to solvent control. This up-regulation was
blocked by ICI 182,780 co-treatment (Fig. 3C). To further substantiate the
involvement of the activated receptor, we investigated the expression of the ERαdependent genes TFF1 and BRCA1 [16] after 10A-CM exposure in estrogen deprived
MCF7 cells. We found that 10A-CM significantly enhanced TFF1 and BRCA1
transcription. Crucially, this activation was reduced when MCF7 cells were pretreated with the ER antagonist ICI 182,780, further supporting the involvement of
ERα in the reported effects (Fig. 3D and 3E).
PI3K/Akt/mTORC1 mediates the phosphorylation of ERα induced by 10A-CM
Next, we investigated which second messenger signaling cascades could be involved
in the hormone-independent activation of ERα that occurred in response to 10A-CM
[17]. 10A-CM administration markedly increased the phosphorylation of the kinases
ERK1/2 on Thr202/Tyr204 (MAPK/ERK cascade), Akt on Ser473 (PI3K/Akt
cascade), and p70S6K on Thr389 (PI3K/mTORC1 cascade) in MCF7 cells (Fig. 4A).
To delineate which of these pathways might link 10A-CM signaling to the activation
of ERα, MCF7 cells exposed to 10A-CM were co-treated with inhibitors of these
specific kinases. We first ascertained that all the three chosen inhibitors: PI3K
inhibitor (LY294002), MAPK inhibitor (PD98059) and mTORC1 inhibitor
(Rapamycin) were functional in MCF7 cells (Supplementary Fig. 3). We then studied
their effects on the phosphorylation of the ERα. LY294002 completely blocked 10ACM-induced ERα phosphorylation on Ser167. Rapamycin had a comparatively minor
effect, while no significant reductions were observed with PD98059 (Fig. 4B). This
data suggests that the pathway responsible for phosphorylating the ERα at Ser167 was
PI3K/Akt, via mTORC1. To further substantiate the involvement of this pathway in
the observed increase in MCF7 cell numbers, we investigated whether coadministration of the above three inhibitors with 10A-CM would influence MCF7 cell
proliferation. 10A-CM-induced cell proliferation was significantly inhibited by both
LY294002 and Rapamycin, but PD98059 failed to have any significant effect (Fig.
4C). Comparable results were observed when MCF7 were exposed to HMEC-CM in
combination with the above inhibitors (Fig. 4D). In order to test whether the
activation of the PI3K pathway by 10A-CM was relevant to other ERα+ breast cancer
cell lines, the same experiments were performed using T47D cells. Inhibition patterns
similar to MCF7 cells occurred in T47D cells (Fig. 4E). At the concentrations tested,
none of the inhibitors on their own affected the proliferation of MCF7 or T47D cells
as levels similar to the ones obtained with solvent control were observed (data not
shown).
Angiogenin and MCP-1 are the cytokines present at the highest levels in the 10A-CM
By using a cytokine antibody array, we screened whether 10A-CM contained
cytokines and growth factors that differed from those present in fresh, unconditioned
medium (UM). Visual and densitometric analyses revealed that several factors were
present in 10A-CM at levels considerably higher than those in UM. The most
prevalent factor in 10A-CM was Angiogenin. 10A-CM also showed high levels of
monocyte chemotactic protein 1 (MCP-1), growth-regulated oncogene (GRO) (reacts
with chemokine (C-X-C motif) ligand 1/2/3 (CXCL-1, CXCL-2 and CXCL-3)),
growth-regulated oncogene alpha (GROα) (react with CXCL-1 only), interleukin-8
(IL-8) and interleukin-10 (IL-10). A weak signal was detected for other cytokines,
such as Oncostatin M and interleukin-6 (IL-6) (Fig. 5A). Significantly, the factors
6
present at the highest levels in the 10A-CM where also found in HMEC-CM,
although at different levels, when cytokine array analysis was performed
(Supplementary Fig. 4).
MCP-1 induces MCF7 cell proliferation and ERα activation
The striking differences in the prevalence of cytokines in 10A-CM when compared to
UM motivated us to assess whether the effects observed with 10A-CM in MCF7 cells
could be attributed to any specific factors. Considering that Angiogenin was the most
prominent factor secreted by MCF10A cells, this protein would have been a good
candidate for such studies. However, Angiogenin is also secreted by MCF7 cells
(Supplementary Fig. 5). Despite the fact that MCF7 cells do not produce any of the
other factors identified in 10A-CM, we were concerned that studies with Angiogenin
would not allow us to attribute any of the 10A-CM effects to a specific component
present in that medium. We, therefore, sought a factor present at sufficiently high
levels (Fig. 5B) solely in the CM of epithelial non-tumorigenic cells (e.g. MCF10A,
HMEC), and selected MCP-1, the second most prevalent factor in 10A-CM, for
further studies. It has been previously reported that the MCP-1 receptors, CCR2 and
CCR4, are expressed in MCF7 cells [18] and this was confirmed in our experiments
by Western blotting (Supplementary Fig. 6).
By using a neutralizing antibody against MCP-1, whose functionality was assessed by
Western blotting (Supplementary Fig. 7), we first observed that blocking MCP-1 in
the 10A-CM induced a modest, but significant reduction in MCF7 cell proliferation,
while no effect was seen with the IgG control (Fig. 6A). This result indicated that
although MCP-1 might not be the only factor responsible for the effects elicited by
the 10A-CM, it plays a role by contributing to the increase in cell numbers. To further
evaluate the potential role of MCP-1 in the effects of 10A-CM, we examined the
impact of the recombinant human standard protein (rhMCP-1) on the activation of
signaling cascades in MCF7 cells. Treatment of MCF7 cells with rhMCP-1 induced
sustained phosphorylation of the ERα on Ser167 and a stable phosphorylation of
ERK1/2, AKT and p70S6K (Fig. 6B). To further confirm the functional significance
of MCP-1 in phosphorylating the ERα, silencing of its two receptors, CCR2 and
CCR4, was performed by siRNA (Supplementary Fig. 8). Compared to cells
expressing control siRNA, CCR2/CCR4 knockdown strongly reduced MCP-1induced phosphorylation of ERα on Ser167 (Fig. 6C). This decrease in ERα Ser167
phosphorylation was also observed in experiments were MCP-1 was blocked by Ab
anti-MCP-1 (Supplementary Fig. 9). Further analysis showed that ICI 182,780,
LY294002 and Rapamycin completely blocked MCP-1-induced phosphorylation of
ERα. In contrast, blocking the activity of ERK1/2 had only a small effect (Fig. 6D).
Taken together, these results indicate that the PI3K/Akt/mTORC1 pathway mediates
MCP-1-induced ERα phosphorylation. To evaluate whether the phosphorylation of
the ERα induced by MCP-1 rendered the receptor transcriptionally active, we
performed the luciferase assay in T47D K-Bluc cells, as described above. Our results
demonstrate that MCP-1 significantly increased the transcriptional activity of ERα
and that ICI 182,780 reverted this effect (Fig. 6E).
Next, we analyzed whether MCP-1 was able to increase MCF7 cell proliferation in a
fashion similar to 10A-CM. In our first experiments, we used the same treatment
regimen as for 10A-CM and treated MCF7 cells for 48 hours with rhMCP-1. Under
these conditions, however, only a relatively low, albeit statistically significant, change
in cell numbers was detected (data not shown). We, therefore, decided to maximize
7
the chances of detection by extending the treatment with rhMCP-1 to six days. MCF7
cell numbers increased significantly in response to rhMCP-1, under these conditions
(Fig. 6F).
In order to investigate the main pathways responsible for the MCP-1 increased cell
numbers, and to substantiate the observations made with the protein phosphorylation
analysis, we pre-incubated MCF7 cells with the inhibitors mentioned before and
exposed to rhMCP-1. ICI 182,780, LY294002 and Rapamycin significantly reduced
the MCP-1-mediated increases in MCF7 cell proliferation, while PD98059 did not
have any effect (Fig. 6G).
8
DISCUSSION
Several reports have described the role of paracrine factors on tumor growth,
focusing, particularly, on the effects elicited by cells from the stromal compartment,
such as immune cells, fibroblasts and adipocytes [19-21]. The possibility that tumor
initiation and development could be affected by communication with epithelial cells is
still poorly understood. In this study we demonstrate for the first time that nontumorigenic epithelial cells can promote ERα+ breast cancer cell proliferation.
Our data contrast with those reported by Spink and colleagues who observed growth
inhibitory effects when MCF10A cells were co-cultured with MCF7 cells [7]. Instead,
we observed that MCF10A secreted factors enhanced the proliferation and reduced
the propensity of ERα+ breast cancer cells to undergo apoptosis. This discrepancy
could be attributed to differences in experimental set up, as Spink et al. used a direct
co-culture approach, where both cell types were cultivated in direct contact. In this
scenario, the reduction in cell number seen by Spink et al. could be due to a
competition of the two cell types for limited substratum and surface area, a factor
which was highlighted by the authors. This competition does not occur in our
experiments, as we performed indirect co-cultures with both cell lines grown on
separate surfaces.
Our results are also not in agreement with those reported by Toillon and colleagues,
who did not see increases in cell proliferation, when breast cancer cells were
incubated with conditioned media derived from normal mammary epithelial cells.
However, our findings are in line with data reported by Carpenter et al. who observed
increases in MCF7 motility induced by CM from immortalized mammary cells, and
with those communicated by Poczobutt et al. who found enhanced clonogenicity and
tumorigenicity of breast cancer cells in response to MECs [8, 9]. The reasons behind
the lack of agreement with Toillon et al. are unclear. However, it is widely
acknowledged that there are considerable differences between different stocks of
immortalized cancer cells, such as MCF7 [22], as well as primary human cells [23].
Such differences have been shown to account for varied responses to the same stimuli
[24] and could explain the discrepancies between the reports above. In our work, the
issue of variations in the response of different cell lines was addressed by confirming
the results obtained with MCF10A in the MCF12A cell line and by using primary
HMEC cells. Overall, our data with all the different cell types are consistent and
strongly indicate that normal epithelial cells can stimulate cell division in ERα+
mammary cells derived from malignancies (MCF7 and T47D). Furthermore, these
effects are produced via secretion of soluble factors and paracrine interactions
between normal and cancer cells.
Our work shows that the increased cell division induced by 10A-CM is mediated by
the ERα, as blocking the receptor with the pure antagonist ICI 182,780 significantly
reduced this proliferative response and no effect was seen in ERα- breast cancer cells.
In further support of this interpretation, reporter gene assays as well as gene
expression analyses indicated an involvement of the ERα in the effects elicited by the
10A-CM.
It is important to note that the ER antagonist ICI 182,780 did not completely abrogate
the effect of the conditioned media to control levels. It has been extensively reported
that resistance to anti-oestrogens is linked to elevated signalling of receptor tyrosine
kinases (RTKs), such as epidermal growth factor receptor (EGFR) and Human
Epidermal Growth Factor Receptor 2 (HER2), which can lead to the transcription of
9
genes involved in cell proliferation without recruitment of the ERα [14, 25, 26].
Similarly, our observations indicate that pathways that cannot be inhibited by ICI
182,780, such as growth factor signalling cascades, may also contribute to the
proliferative effect of the conditioned media independently of the activation of the
receptor.
Moreover, we showed that the activation of the ERα by factors secreted by normal
epithelial mammary cells occurred in a hormone-independent manner and did not
require the binding of a ligand to the receptor. The estrogen-independent activation of
ERα has been extensively investigated and several reports have shown that ERα can
be activated independently of hormone binding by a variety of intracellular signaling
transduction pathways [17, 27]. Many of these have been shown to cross-talk with the
ERα, to the extent that modulations of the ERα pathway influence the effects of
growth factors and vice-versa [28]. The observed activation of the ERα by 10A-CM
and HMEC-CM in the absence of E2 prompted us to better define the signaling
pathways activated by the factors secreted by these normal mammary epithelial cells.
Phosphorylation of ERα on Ser118, which typically occurs after binding of E2, was
not observed; instead 10A-CM induced phosphorylation on Ser167, a well reported
target for extranuclear signaling cascades [14]. Our experiments with a reporter gene
assay based on T47D K-Bluc cells and gene expression analysis of MCF7 cells
showed that these phosphorylation events rendered the ERα transcriptionally active.
We were able to trace the signals leading to Ser167 phosphorylation to the
PI3K/Akt/mTORC1 pathway, as inhibition of PI3K and mTORC1 significantly
reduced the phosphorylation on this site.
Disruption of PI3K/Akt/mTORC1 signaling also suppressed the effects of 10A-CM
and HMEC-CM on MCF7 cell proliferation, suggesting a significant role of this
pathway on these effects. It will be interesting to investigate whether increased
proliferation of cancer cells via estrogen-independent activation of the ER by
signaling cascades plays a role in endocrine resistance, as was previously
demonstrated for growth factor receptors, such as EGFR, HER2 and insulin growth
factor receptor 1 (IGF1R) (reviewed in [29]). Underlining the potential relevance of
such signaling, in vitro studies have shown that Ser167, phosphorylated by the
PI3K/Akt signaling pathway, is associated with increased tamoxifen resistance [3032}.
Our findings of communications between normal and tumor mammary epithelial cells
point to a role for the microenvironment within TDLUs, which had not been
previously considered. As the normal epithelial cells within the TDLUs are the first
point of contact for epithelial tumors, it is conceivable that they interact with
malignant cells at an early stage of carcinogenesis and are able to influence tumor
development and progression. Further experimental studies will be needed to
substantiate this idea.
With the aim of pinpointing factors responsible for those interactions, we performed a
cytokine array of the 10A-CM and found MCP-1 to be one of the most abundant
factors. MCP-1 is secreted by a variety of tumors and has been shown to regulate the
migration and proliferation of breast cancer, multiple myeloma and prostate cancer
[33-35]. As reported previously and supported by our own data, normal mammary
epithelial cells are capable of producing MCP-1 at low levels [36]. Both MCF10A
and HMEC cells can secrete this cytokine at detectable levels. In contrast, MCF7 cells
do not secrete MCP-1, as was established by others [37, 38] and confirmed in our
experiments. We demonstrate for the first time that there is cross-talk between MCP-1
10
and ERα signaling and these findings are in agreement with previous studies showing
that several chemokines, such as tumor necrosis factor 1 (TNFα) and stromal cellderived factor 1 (SDF-1), can activate E2 signaling pathways via phosphorylation of
the ERα [39-41]. Independently of the presence of an ER ligand, MCP-1 is capable of
phosphorylating the ERα on Ser167 via its two cognate receptors CCR2 and CCR4 as
shown by our gene knock-down experiments. Similar to the studies with 10A-CM,
disruption of PI3K/Akt/mTORC1 signaling by kinase inhibitors diminished
phosphorylation of Ser167 by MCP-1, suggesting a role for this pathway in the
activation of ERα by MCP-1. Considering that MCF7 cells express CCR2 and CCR4
and that activated CCR2 is capable of inducing the phosphorylation of key elements
of the PI3K/Akt pathway [42], this is entirely conceivable. As with 10A-CM,
inhibition of ERK1/2 signaling by PD98059 had only a small effect on the MCP-1–
induced ERα Ser167 phosphorylation, which suggests that this pathway was not
significantly involved in mediating the effects of the cytokine. In addition to inducing
ERα activation, MCP-1 also promoted MCF7 cell division. As with 10A-CM, the
PI3K/Akt/mTORC1 pathway was shown to be involved in this effect, as the presence
of specific inhibitors diminished cell proliferation. MCP-1-induced cell proliferation
was less pronounced than observed with 10A-CM. This smaller effect compared to
10A-CM was not surprising, since 10A-CM contains other factors known to be
involved in tumor progression and metastasis, such as IL-8 and [43, 44]. Future
experiments will have to establish the function and role of other cytokines also
identified in 10A-CM, and the ways in which these act together with MCP-1.
Taken together, our observations highlight two important aspects: that normal
epithelial cells can promote the proliferation of epithelial breast cancer cells, and that
cytokines derived from 10A-CM, and particularly MCP-1, are able to induce ERα
signaling. This suggests that normal epithelial cells play a role in breast
carcinogenesis by promoting cell proliferation of cancer cells via the ERα. As in the
study conducted by Hu and colleagues [45], we consider that co-administration of
normal epithelial cells with tumor cells in an experimental mouse model are important
to determine whether the pro-tumorigenic effects of these cells are reproducible under
in vivo conditions.
In light of evidence that phosphorylation of ERα on Ser167 via PI3K/Akt signaling
increases the likelihood of acquired tamoxifen resistance [46], our discovery of the
novel role of MCP-1 in inducing ERα signaling via PI3K/Akt/mTORC1 raises the
possibility that this chemokine may contribute to the process of acquired resistance to
endocrine therapy. If that turns out to be the case, disrupting the cytokine-mediated
communication between normal and cancerous mammary cells may be one avenue to
improve response to therapeutic regimes.
11
MATERIALS AND METHODS
Chemicals
E2 98% (Sigma-Aldrich, UK) and ICI 182,780 (Sigma-Aldrich) were dissolved in
ethanol (Et-OH) to give 1 mM stocks. PD98059, LY294002 (Promega, UK) and
Rapamycin (Cell Signaling Technology, Beverly, MA) were prepared as 20 mM, 50
mM and 100 μM stock solutions, respectively, in dimethylsulphoxide (DMSO). The
final Et-OH and DMSO concentrations did not exceed 0.5% (v/v) and 0.2% (v/v)
respectively. Recombinant human MCP-1 (rhMCP-1) (R&D Systems, Minneapolis,
MN) was prepared as a 100 μg/ml stock. All reagents were purchased from SigmaAldrich unless stated otherwise.
Cell culture
MCF7 cells were grown in MEM-α (Invitrogen, UK) supplemented with 5% fetal
bovine serum (FBS) (Invitrogen) (MCF7 medium); MCF10A cells were maintained
as previously described in DMEM/F12 (Invitrogen) with 100 µg/ml penicillinstreptomycin, 5% Horse Serum (HS) (Invitrogen), 0.5 µg/ml hydrocortisone, 10
µg/ml insulin, 20 ng/ml epidermal growth factor (EGF) (Sigma-Aldrich), 2 mM Lglutamine and 100 ng/ml cholera toxin (MCF10A medium). MCF12A cells were
maintained in the same medium of MCF10A without L-Glutamine (MCF12A
medium). T47D were maintained in RPMI (Invitrogen) containing 10% FBS and
2mM L-glutamine (T47D medium); MDA-MB231 were cultured in DMEM +
Glutamax (Invitrogen) supplemented with 10% FBS (MDA-MB231 medium). Human
mammary epithelial cells (HMEC) (Lonza, UK) were cultured in mammary epithelial
Cell Basal Medium (MEMB) (Lonza) supplemented with mammary Epithelial
Growth Medium SingleQuots (Lonza) (HMEC medium). All cells were subcultured at
approximately 70% confluence over a maximum of 10 passages and regularly tested
for Mycoplasma contamination.
All media used to support the growth of two cell lines simultaneously were optimized
in order to guarantee the survival and healthy growth of both cell types in the same
conditions. Consequently, media containing 80% of MCF7, T47D or MDA-MB231
medium and 20% of MCF10A or MCF12A medium was used. These media are
referred to as “80:20 medium”. An overview of all the media composition is
described in Table 1. For all experiments involving HMEC cells, HMEC medium was
used throughout.
Preparation of conditioned medium
MCF10A, MCF12A, HMEC or MCF7 cells were plated in 75 cm2 flasks in their
medium, respectively. At 70% confluence, media were removed and cells washed
twice with Hank’s Balanced Salt Solution (HBSS) (Invitrogen). Fresh 80:20 assay
medium or phenol red-free MEMB was then added and cells incubated for 48 hours.
The resulting conditioned media (referred to as 10A-CM, 12A-CM, HMEC-CM or 7CM) were collected and centrifuged at 1000 rpm for 5 minutes to remove cell debris,
and aliquots were stored at -80°C.
12
Cell proliferation assay
In mono-cultures, MCF7 (1.5x104 cells), MDA-MB231 (1x104 cells) and T47D
(2x103 cells) were seeded into 24-well plates in their medium and allowed to adhere
overnight. On the next day, media were removed, cells washed once with HBSS and
serum starved for 24 hours. Media were then replaced with 80:20 assay medium or
phenol red-free MEMB containing the test compounds and cells incubated for the
indicated period of times. The following test compounds and test conditions were
used: solvent control (Et-OH or Et-OH/DMSO), E2 (1 nM), 10A-CM/12ACM/HMEC-CM (50% v/v), and rhMCP1 (100 ng/ml). For incubation with inhibitors,
the concentrations used were: ICI 182,780 (100 nM - 1 µM), PD98059 (25 µM),
LY294002 (10 µM) and Rapamycin (10 nM). For incubation with blocking antibody:
Ab anti-CCL2 or IgG Isotype Control (R&D System) 3 μg/ml was added to 10A-CM
and incubated for 1 hour at 37°C.
In the co-culture experiments, MCF7 cells were plated in 6-well plates at a density of
1.5x104 cells per well and left to adhere overnight. On the following day, transwell
inserts (0.4 μm; BD Falcon, San Jose, CA) were placed into each well with either
medium alone or containing 1.7x104 MCF10A or 104 HMEC cells per insert and cocultures incubated for 48 hours. Following the incubation period, mono- and cocultured cells were fixed in ice-cold 10% trichloroacetic acid for 20 minutes. SRB
staining was then carried out as previously described [47].
Caspase-Glo® 3/7 assay
MCF7 cells were seeded in 96-well white plates (5x103 cells/well) in MCF7 medium
and left to adhere overnight. Cells were then washed with HBSS and medium
replaced with starvation medium. After 24 hours, fresh 80:20 assay medium
containing the indicated test compounds: Et-OH (solvent control), Mytomicin C
(Calbiochem, UK) 15 μM (positive control), E2 (1 nM) and 10A-CM alone or in
combination with Mytomicin C, was added for 18 hours. The Caspase-3/7 activity
was determined using the Caspase-Glo® 3/7 Assay Kit (Promega) following the
manufacturer’s protocol using a plate-reading luminometer (FLUOstar Optima, BMG
Labtech GmbH).
Luciferase gene reporter assay
T47D-Kbluc cells were maintained following the protocol described by Wilson and
colleagues [48]. The ER-LUX assay was performed as previously described [49].
Controls used were as follows: solvent control (Et-OH), Et-OH + ICI 182, 780 (1
μM), positive control E2 (1 nM), E2 (1 nM) + ICI 182,780 (1 μM). As test
compounds/conditions, 10A-CM (50% v/v) and rhMCP-1 (500 ng/ml) were tested
alone and in combination with ICI 182,780 (1 μM). Results were normalized against
negative control (Et-OH) and data were expressed as fold increase over control.
Quantitative Real-Time PCR
After three days in estrogen-deprived medium, MCF7 cells were serum starved for 24
hours and then treated with medium containing Et-OH (solvent control), E2 (10 nM)
and 10A-CM (50% v/v) with or without ICI 182, 780 (100 nM) for the indicated
periods of time (see figure legends). After total RNA extraction from cell suspensions
with the NucleoSpin Kit (Macherery-Nagel, Dueren, Germany) following the
manufacturer’s protocol, RNA was submitted to reverse transcription as previously
13
described [50]. Real-time quantitative PCR was performed using iQ SYBR Green
Supermix (Bio-Rad) on the CFX96 Touch Real-Time PCR Detection System (BioRad) as described in [51]. β-Actin was used as internal control (reference gene) and
the relative gene expression levels were normalised against this gene and calculated
using the comparative 2-ΔΔcT method [52]. Primer sequences and concentrations
(Eurogentec LTD, UK) are included in Table 2.
Immunoblotting
After three days in estrogen-deprived medium (phenol red-free DMEM supplemented
with 5% CD-FBS), MCF7 were starved for 24 hours and for treatments with
inhibitors, cells were pre-incubated for 2 hours with ICI 182,780 (100 nM),
LY294002 (10 μM), Rapamycin (10 nM), PD98059 (25 μM). Cells were subjected to
the following treatments: solvent control (Et-OH or Et-OH/DMSO), 10A-CM (50%
v/v), E2 (10 nM) or MCP-1 (100 ng/ml) with or without the above inhibitors for the
indicated time periods. Protein lysates and western blotting analysis were performed
as described previously [51]. Antibodies are described in Table 3.
Cytokine array
The conditioned media were analyzed using Human Cytokine Antibody Array 3
(RayBiotech, Norcross, GA) according to the manufacturer’s protocol. Signals were
recorded on an X-ray film using the reagents provided by the manufacturer. Signals
were quantified by densitometric analysis and data normalized to the average of
positive controls.
ELISA analysis
The levels of MCP-1 were assessed in conditioned media using the Human MCP-1
mini ELISA development kit, following the manufacturer’s protocol (Propetech, UK).
Signals were read at 405 nm with wavelength correction at 650 nm, using a Spectra
MAX 340PC plate reader.
Transient siRNA transfection
Estrogen-deprived MCF7 cells (4x104) were seeded in 6 well plates and left to adhere
overnight. Cells were then transfected with a complex of DharmaFECT 4 transfection
reagent (Thermo-Scientific, Waltham, MA, USA) and 100 nM of negative control
siRNA, siRNA targeting CCR2 or CCR4 (Thermo-Scientific), following the
manufacturer’s protocol. After 24 hours, medium containing siRNA/transfection
reagent was removed and replaced with phenol red-free DMEM + 5% CD-FBS. 48
hours after transfection, cells were serum starved for 24 hours and stimulated with
solvent control (Et-OH) or MCP-1 (100 ng/ml) for 30 minutes.
Statistical analysis
Statistical analysis was performed using Prism software (GraphPad Software, La
Jolla, CA, USA). Unless otherwise stated, numerical data were expressed as the mean
± SEM (standard error of the mean). Experiments were either analyzed by using
Student’s t-test, One-way ANOVA followed by Dunnett’s post-hoc test when
comparing with solvent controls and Bonferroni’s post-hoc test for multiple
comparisons. All data were from three or four independent experiments run in
14
duplicates or triplicates. p values: *<0.05, **<0.01, ***<0.001 were considered
statistically significant.
ACNOWLDGEMENTS
The authors would like to thank Prof. Rob Newbold and Dr. Hemad Yasaei (Brunel
University) for kindly providing the HMEC primary cells and Dr Andrea Morandi
(University of Florence) for the valuable comments and suggestions on the
manuscript. MR was funded by a UCL School of Pharmacy part-funded studentship.
The authors declare no conflict of interest.
15
REFERENCES
1.
Bissell MJ, Radisky D. Putting tumours in context. Nat Rev Cancer.
2001;1(1):46-54.
2.
Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell.
2011;144(5):646-74.
3.
Holliday DL, Brouilette KT, Markert A, Gordon LA, Jones JL. Novel
multicellular organotypic models of normal and malignant breast: tools for dissecting
the role of the microenvironment in breast cancer progression. Breast Cancer Res.
2009;11(1):R3.
4.
Karnoub AE, Dash AB, Vo AP, Sullivan A, Brooks MW, Bell GW, et al.
Mesenchymal stem cells within tumour stroma promote breast cancer metastasis.
Nature. 2007;449(7162):557-63.
5.
Coussens LM, Werb Z. Inflammation and cancer. Nature.
2002;420(6917):860-7.
6.
Toillon RA, Chopin V, Jouy N, Fauquette W, Boilly B, Le Bourhis X. Normal
breast epithelial cells induce p53-dependent apoptosis and p53-independent cell cycle
arrest of breast cancer cells. Breast Cancer Res Treat. 2002;71(3):269-80.
7.
Spink BC, Cole RW, Katz BH, Gierthy JF, Bradley LM, Spink DC. Inhibition
of MCF-7 breast cancer cell proliferation by MCF-10A breast epithelial cells in
coculture. Cell Biol Int. 2006;30(3):227-38.
8.
Carpenter PM, Dao AV, Arain ZS, Chang MK, Nguyen HP, Arain S, et al.
Motility induction in breast carcinoma by mammary epithelial laminin 332 (laminin
5). Mol Cancer Res. 2009;7(4):462-75.
9.
Poczobutt JM, Tentler J, Lu X, Schedin PJ, Gutierrez-Hartmann A. Benign
mammary epithelial cells enhance the transformed phenotype of human breast cancer
cells. BMC Cancer. 2010;10:373.
10.
Lazennec G, Richmond A. Chemokines and chemokine receptors: new
insights into cancer-related inflammation. Trends in Molecular Medicine.
2010;16(3):133-44.
11.
Gompel A, Somaï S, Chaouat M, Kazem A, Kloosterboer HJ, Beusman I, et
al. Hormonal regulation of apoptosis in breast cells and tissues. Steroids. 2000;65(1011):593-8.
12.
Deroo BJ, Korach KS. Estrogen receptors and human disease. J Clin Invest.
2006;116(3):561-70.
13.
Aka JA, Adjo Aka J, Lin SX. Comparison of functional proteomic analyses of
human breast cancer cell lines T47D and MCF7. PLoS One. 2012;7(2):e31532.
14.
Musgrove EA, Sutherland RL. Biological determinants of endocrine resistance
in breast cancer. Nat Rev Cancer. 2009;9(9):631-43.
15.
Joel PB, Traish AM, Lannigan DA. Estradiol and phorbol ester cause
phosphorylation of serine 118 in the human estrogen receptor. Mol Endocrinol.
1995;9(8):1041-52.
16.
O'Lone R, Frith MC, Karlsson EK, Hansen U. Genomic targets of nuclear
estrogen receptors. Mol Endocrinol. 2004;18(8):1859-75.
17.
Schiff R, Massarweh SA, Shou J, Bharwani L, Arpino G, Rimawi M, et al.
Advanced concepts in estrogen receptor biology and breast cancer endocrine
resistance: implicated role of growth factor signaling and estrogen receptor
coregulators. Cancer Chemother Pharmacol. 2005;56 Suppl 1:10-20.
16
18.
Tsuyada A, Chow A, Wu J, Somlo G, Chu P, Loera S, et al. CCL2 mediates
cross-talk between cancer cells and stromal fibroblasts that regulates breast cancer
stem cells. Cancer Res. 2012;72(11):2768-79.
19.
Mueller MM, Fusenig NE. Friends or foes - bipolar effects of the tumour
stroma in cancer. Nat Rev Cancer. 2004;4(11):839-49.
20.
Le Bitoux MA, Stamenkovic I. Tumor-host interactions: the role of
inflammation. Histochem Cell Biol. 2008;130(6):1079-90.
21.
Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer. 2006;6(5):392401.
22.
Jones C, Payne J, Wells D, Delhanty JD, Lakhani SR, Kortenkamp A.
Comparative genomic hybridization reveals extensive variation among different
MCF-7 cell stocks. Cancer Genet Cytogenet. 2000;117(2):153-8.
23.
Guo S, Russo I, Russo J. Difference in gene expression profile in breast
epithelial cells from women with different reproductive history. International Journal
of Oncology. 2003;23(4):933-41.
24.
Villalobos M, Olea N, Brotons JA, Olea-Serrano MF, Ruiz de Almodovar JM,
Pedraza V. The E-screen assay: a comparison of different MCF7 cell stocks. Environ
Health Perspect. 1995;103(9):844-50.
25.
Dawood S, Cristofanilli M. Endocrine resistance in breast cancer: what really
matters? Annals of Oncology. 2007;18(8):1289-91.
26.
Zilli M, Grassadonia A, Tinari N, Di Giacobbe A, Gildetti S, Giampietro J, et
al. Molecular mechanisms of endocrine resistance and their implication in the therapy
of breast cancer. Biochimica Et Biophysica Acta-Reviews on Cancer.
2009;1795(1):62-81.
27.
Coleman KM, Smith CL. Intracellular signaling pathways: nongenomic
actions of estrogens and ligand-independent activation of estrogen receptors. Front
Biosci. 2001;6:D1379-91.
28.
Osborne CK, Schiff R. Mechanisms of endocrine resistance in breast cancer.
Annu Rev Med. 2011;62:233-47.
29.
Schiff R, Massarweh SA, Shou J, Bharwani L, Mohsin SK, Osborne CK.
Cross-talk between estrogen receptor and growth factor pathways as a molecular
target for overcoming endocrine resistance. Clin Cancer Res. 2004;10(1 Pt 2):331S6S.
30.
Ali S, Coombes RC. Endocrine-responsive breast cancer and strategies for
combating resistance. Nat Rev Cancer. 2002;2(2):101-12.
31.
Likhite VS, Stossi F, Kim K, Katzenellenbogen BS, Katzenellenbogen JA.
Kinase-specific phosphorylation of the estrogen receptor changes receptor
interactions with ligand, deoxyribonucleic acid, and coregulators associated with
alterations in estrogen and tamoxifen activity. Mol Endocrinol. 2006;20(12):3120-32.
32.
Riggins R, Schrecengost R, Guerrero M, Bouton A. Pathways to tamoxifen
resistance. Cancer Letters. 2007;256(1):1-24.
33.
Saji H, Koike M, Yamori T, Saji S, Seiki M, Matsushima K, et al. Significant
correlation of monocyte chemoattractant protein-1 expression with neovascularization
and progression of breast carcinoma. Cancer. 2001;92(5):1085-91.
34.
Ohta M, Kitadai Y, Tanaka S, Yoshihara M, Yasui W, Mukaida N, et al.
Monocyte chemoattractant protein-1 expression correlates with macrophage
infiltration and tumor vascularity in human esophageal squamous cell carcinomas. Int
J Cancer. 2002;102(3):220-4.
17
35.
Vanderkerken K, Vande Broek I, Eizirik DL, Van Valckenborgh E, Asosingh
K, Van Riet I, et al. Monocyte chemoattractant protein-1 (MCP-1), secreted by bone
marrow endothelial cells, induces chemoattraction of 5T multiple myeloma cells. Clin
Exp Metastasis. 2002;19(1):87-90.
36.
Soria G, Ofri-Shahak M, Haas I, Yaal-Hahoshen N, Leider-Trejo L,
Leibovich-Rivkin T, et al. Inflammatory mediators in breast cancer: coordinated
expression of TNFα & IL-1β with CCL2 & CCL5 and effects on epithelial-tomesenchymal transition. BMC Cancer. 2011;11:130.
37.
Mestdagt M, Polette M, Buttice G, Noël A, Ueda A, Foidart JM, et al.
Transactivation of MCP-1/CCL2 by beta-catenin/TCF-4 in human breast cancer cells.
Int J Cancer. 2006;118(1):35-42.
38.
Inadera H, Sekiya T, Yoshimura T, Matsushima K. Molecular analysis of the
inhibition of monocyte chemoattractant protein-1 gene expression by estrogens and
xenoestrogens in MCF-7 cells. Endocrinology. 2000;141(1):50-9.
39.
Gori I, Pellegrini C, Staedler D, Russell R, Jan C, Canny GO. Tumor necrosis
factor-α activates estrogen signaling pathways in endometrial epithelial cells via
estrogen receptor α. Mol Cell Endocrinol. 2011;345(1-2):27-37.
40.
Rhodes LV, Short SP, Neel NF, Salvo VA, Zhu Y, Elliott S, et al. Cytokine
receptor CXCR4 mediates estrogen-independent tumorigenesis, metastasis, and
resistance to endocrine therapy in human breast cancer. Cancer Res. 2011;71(2):60313.
41.
Sauvé K, Lepage J, Sanchez M, Heveker N, Tremblay A. Positive feedback
activation of estrogen receptors by the CXCL12-CXCR4 pathway. Cancer Res.
2009;69(14):5793-800.
42.
Loberg RD, Day LL, Harwood J, Ying C, St John LN, Giles R, et al. CCL2 is
a potent regulator of prostate cancer cell migration and proliferation. Neoplasia.
2006;8(7):578-86.
43.
Gabellini C, Trisciuoglio D, Desideri M, Candiloro A, Ragazzoni Y, Orlandi
A, et al. Functional activity of CXCL8 receptors, CXCR1 and CXCR2, on human
malignant melanoma progression. Eur J Cancer. 2009;45(14):2618-27.
44.
Lu Z, Jiang G, Blume-Jensen P, Hunter T. Epidermal growth factor-induced
tumor cell invasion and metastasis initiated by dephosphorylation and downregulation
of focal adhesion kinase. Mol Cell Biol. 2001;21(12):4016-31.
45.
Hu M, Yao J, Carroll D, Weremowicz S, Chen H, Carrasco D, et al.
Regulation of in situ to invasive breast carcinoma transition. Cancer Cell.
2008;13(5):394-406.
46.
Shah YM, Rowan BG. The Src kinase pathway promotes tamoxifen agonist
action in Ishikawa endometrial cells through phosphorylation-dependent stabilization
of estrogen receptor (alpha) promoter interaction and elevated steroid receptor
coactivator 1 activity. Mol Endocrinol. 2005;19(3):732-48.
47.
Silva E, Lopez-Espinosa MJ, Molina-Molina JM, Fernández M, Olea N,
Kortenkamp A. Lack of activity of cadmium in in vitro estrogenicity assays. Toxicol
Appl Pharmacol. 2006;216(1):20-8.
48.
Wilson VS, Bobseine K, Gray LE. Development and characterization of a cell
line that stably expresses an estrogen-responsive luciferase reporter for the detection
of estrogen receptor agonist and antagonists. Toxicol Sci. 2004;81(1):69-77.
49.
Evans RM, Rahte S, Kortenkamp A. Inability to confirm estrogenicity of the
heterocyclic amine PhIP in two in vitro assays. Toxicol In Vitro. 2010;24(6):1757-63.
18
50.
Silva E, Scholze M, Kortenkamp A. Activity of xenoestrogens at nanomolar
concentrations in the E-Screen assay. Environ Health Perspect. 2007;115 Suppl 1:917.
51.
Marchese S, Silva E. Disruption of 3D MCF-12A breast cell cultures by
estrogens--an in vitro model for ER-mediated changes indicative of hormonal
carcinogenesis. PLoS One. 2012;7(10):e45767.
52.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods.
2001;25(4):402-8.
19
FIGURE LEGENDS
Figure 1. Non-tumorigenic epithelial cells promote ERα+ breast cancer cell
proliferation. (A, B) MCF7 cells were co-cultured with MCF10A or HMEC cells and
treated with Et-OH (solvent control) for 48 hours. (C, D, E, F) MCF7, T47D and
MDA-MB231 were treated for 48 hours with medium containing vehicle (Et-OH),
10A-CM or HMEC-CM (50% v/v). Changes in cell numbers were analyzed by SRB
staining. Data were normalised to negative controls (solvent control). Bars refer to the
mean ± SEM of three independent experiments performed in duplicate. Statistical
analysis was performed by Student’s t-test. *p<0.05, **p<0.01, ***p<0.001. (G)
MCF7 cells were treated with solvent control (Et-OH), Mitomycin C (15 μM) and
with 10A-CM (50% v/v) or E2 (1 nM) alone or in combination with Mitomycin C for
18 hours and analyzed for changes in Caspase 3/7 activity. Data represent the mean ±
SEM and are from three independent experiments performed in triplicates. Controls
values were set to 0 (X axis). Statistical analysis was performed by one-way ANOVA
followed by Dunnett’s and Bonferroni’s post-hoc test. *p<0.05. (H) Estrogendeprived MCF7 cells were serum-starved overnight and the following day cells were
stimulated with medium containing Et-OH (solvent control), E2 (10 nM) and 10ACM (50% v/v) for 4 hours. Quantitative PCR analysis was performed for the genes
BAD, BAX, BCL-2 and BCL-XL. Expression of each gene was normalized to -Actin
(reference gene) and compared to the control group, according to the 2−ΔΔCt model.
Control values (Et-OH) were set to 1 (dashed black line), so values higher than 1 are
indicative of up-regulation and values lower than 1 reveal down-regulation. Data
represent the mean ± SEM of four independent experiments, run in duplicate.
Statistical analysis was performed by one-way ANOVA followed by Dunnett’s posthoc test. *p<0.05, **p<0.01.
Figure 2. 10A-CM and HMEC-CM induce cell proliferation via ERα. ERα+ breast
cancer cells MCF7 (A, C) and T47D (B) were treated with Et-OH (solvent control)
and 10A-CM o HMEC-CM (50% v/v) with and without ICI 182,780 (100 nM or 1
μM) for 48 hours. Changes in cell numbers were analyzed by SRB staining. Data
represent the mean ± SEM and are from three independent experiments run in
duplicate. Data were analysed by one-way ANOVA followed by Dunnett’s and
Bonferroni’s post-hoc test. ** p<0.01, *** p<0.001.
Figure 3. Activation of ERα by 10A-CM and HMEC-CM. (A, B) Estrogen-deprived
ERα+ breast cancer MCF7 cells were serum-starved overnight and stimulated with
Et-OH (solvent control), 10A-CM, HMEC-CM (50% v/v) and E2 (10 nM) for 30
minutes. Cells were analyzed for expression of indicated proteins by Western blotting.
Data shown are representative of three independent experiments. (C) T47D K-Bluc
cells were treated with Et-OH (solvent control), ICI 182,780 (1 μM), 10A-CM (50%
v/v), and a combination of 10A-CM (50% v/v) and ICI 182,780 (1 μM). EREluciferase reporter activity was measured after 24 hours. Data were normalized versus
negative control (Et-OH). Data are the mean ± SEM and are from three independent
experiments run in duplicate. Statistical analysis was performed by one-way ANOVA
followed by Dunnett’s and Bonferroni’s post-hoc test. ** p<0.01, *** p<0.001. (D, E)
Estrogen-deprived MCF7 were serum starved overnight and treated with Et-OH
(solvent control), E2 (10 nM) and 10A-CM (50% v/v) with or without ICI 182, 780
(100 nM) for 18 hours. Quantitative PCR analysis was performed for the genes
BRCA1 and TFF1. Expression of each gene was normalized to -Actin (reference
20
gene) and compared to the control group, according to the 2−ΔΔCt model. Horizontal
dashed line corresponds to the negative controls (Et-OH), set to 1. Data are shown as
the mean ± SEM and are from four independent experiments, run in duplicate.
Statistical analysis was performed by one-way ANOVA followed by Bonferroni’s
post-hoc test. *p<0.05, **p<0.01.
Figure 4. PI3K/Akt/mTORC1 pathway mediates the effects of 10A-CM and HMECCM. (A) Estrogen-deprived MCF7 were serum-starved overnight and stimulated with
Et-OH (solvent control), E2 (10 nM) and 10A-CM (50% v/v) for 30 minutes and then
analyzed for the indicated proteins by Western blotting. (B) MCF7 cells were preincubated for 2 hours with the kinase inhibitors PD98059 (25 μM), LY29405 (10 μM)
and Rapamycin (10 nM) followed by stimulation with Et-OH (solvent control), E2
(10 nM) and 10A-CM (50% v/v) with or without the above inhibitors for 30 minutes.
Cells were then analyzed for the expression of the indicated proteins by Western
blotting. Data shown are representative of three independent experiments. (C, D)
MCF7 cells or (E) T47D cells were pre-incubated with the kinase inhibitors exactly as
in (B), followed by treatment with Et-OH (solvent control), 10A-CM or HMEC-CM
(50% v/v) with or without the above inhibitors for 48 hours (MCF7) and 6 days
(T47D). Changes in cell numbers were analyzed by SRB staining. Data in (C), (D)
and (E) represent the mean ± SEM and are from three independent experiments run in
duplicate Statistical analysis was performed by one-way ANOVA followed by
Dunnett’s and Bonferroni’s post-hoc test. * p<0.05, ** p<0.01, *** p<0.001.
Figure 5. MCP-1 is secreted by non-tumorigenic epithelial cells. (A) Fresh
unconditioned medium (UM) and conditioned medium derived from MCF10A cells
(10A-CM) was collected and analyzed by using a cytokine antibody array. + and – are
positive and negative controls, respectively. Densitometric analysis of the cytokine
array was conducted by normalization against the average of positive control. 1) GRO
(CXCL1-2-3), 2) GRO-α (CXCL-1), 3) IL-6, 4) IL-8, 5) IL-10, 6) MCP-1, 7) EGF, 8)
Angiogenin, 9) Oncostatin M. (B) Total MCP-1 concentration was mesaured in 10ACM, HMEC-CM and 7-CM by Elisa assay. Data represent the mean ± SEM and are
from three independent experiments run in duplicate.
Figure 6. MCP-1 promotes MCF7 cell proliferation and activates ERα. (A) MCF7
cells were serum starved overnight and treated with Et-OH (solvent control) and 10ACM pre-incubated with 3 μg/ml of Ab anti-MCP-1 or control IgG for 48 hours.
Changes in cell numbers were measured by SRB staining. Data were normalised
against negative control (Et-OH). Data represent the mean ± SEM and are from six
independent experiments, run in duplicate. Statistical analysis was performed by oneway ANOVA followed by Dunnets’s and Bonferroni’s post-hoc test. * p<0.05, ***
p<0.001. (B) Estrogen-deprived MCF7 cells were serum-starved overnight and treated
with Et-OH (solvent control) and MCP-1 (100 ng/ml) for the indicated time points;
(C) Estrogen deprived MCF7 cells were transfected with control or CCR2 and CCR4
siRNA oligonucleotides. 48 hours post-transfection, cells were serum starved for 24
hours and treated with MCP-1 (100 ng/ml) for 30 minutes. (D) Estrogen deprived
MCF7 cells were serum-starved overnight and treated with Et-OH (solvent control)
and MCP-1 (100 ng/ml) for 30 minutes or pre-incubated for 2 hours with the kinase
inhibitors: PD98059 (25 μM), LY29405 (10 μM) and Rapamycin (10 nM) and then
exposed to MCP-1 (100 ng/ml) for 30 minutes. Cells were analyzed for expression of
the indicated proteins by Western blotting. Data shown are representative of three
21
independent experiments. (E) T47D K-Bluc cells were treated with Et-OH (solvent
control), ICI 182,780 (1 μM), MCP-1 (500 ng/ml), or a combination of MCP-1 (500
ng/ml) and ICI 182,780 (1 μM). ERE-luciferase reporter activity was measured after
24 hours. Data were normalized versus negative controls (Et-OH). Data represent the
mean ± SEM and are from four independent experiments run in triplicate. Statistical
analysis was performed by one-way ANOVA followed by Dunnett’s and Bonferroni’s
post-hoc test. p*<0.05, ** p<0.01. (F) Serum starved MCF7 cells were treated with
Et-OH (solvent control), 10A-CM (50%v/v) and MCP-1 (100 ng/ml) or (G) preincubated for two hours with the kinase inhibitors as in (B) and exposed to MCP-1
(100 ng/ml) with or without the above inhibitors for 6 days. Changes in cell numbers
were measured by SRB staining. Data were normalized against negative controls (EtOH). Data represent the mean ± SEM and are from four independent experiments run
in duplicate. Statistical analysis was performed by one-way ANOVA followed by
Dunnett’s and Bonferroni’s post-hoc test. * p<0.05, ** p<0.01, ***p<0.001.
22
Table 1. Composition of the media.
Name
Composition
DMEM assay medium
phenol
red-free
DMEM
(Invitrogen)
supplemented with 0.5% Charcoal-Dextran
treated FBS (CD-FBS);
RPMI assay medium
phenol red-free RPMI (invitrogen) supplemented
with 0.5% Charcoal-Dextran treated FBS (CDFBS);
DMEM/F12 assay medium
phenol red-free-Dulbecco’s modified Eagle’s
medium and F12 medium (DMEM/F12)
(Invitrogen) with 0.5% Charcoal-Dextran treated
HS (DC-HS);
80:20 MCF7 full medium
80% of MEM-α + supplemented with 5% FBS +
20% DMEM/F12 with 100 µg/ml penicillinstreptomycin, 5% HS, 0.5 µg/ml hydrocortisone,
10 µg/ml insulin, 20 ng/ml EGF, 2 mM Lglutamine and 100 ng/ml cholera toxin;
80:20 assay medium
80% of DMEM or RPMI assay medium + 20% of
DMEM/F12 assay medium;
80:20 starvation medium
80% of phenol red-free DMEM or RPMI + 20% of
phenol red-free DMEM/F12;
23
Table 2. Primers for real-time PCR.
Name
β-Actin
Primer sense
Primer Sequence (5’-3’)
Concentration M
Forward
TCAGCAAGCAGGAGTATG
300
Reverse
GTCAAGAAAGGGTGTAACG
300
Forward
ACATACCATCTTCAACCTCTG
300
Reverse
CGATGGTATTAGGATAGAAG
300
Forward
CCGTGAAAGACAGAATTG
200
Reverse
CGATGGTATTAGGATAGAAG
200
Forward
CCTGGTGGACAACATC
100
Reverse
GAGCAGAGTCTTCAGAG
100
Forward
TGAACAGGTAGTGAATGAAC
100
Reverse
TCCTTGTCTACGCTTTCC
100
Forward
CCTCCTCTCCTACTTTGG
150
Reverse
GCCTCAGCCCATCTTC
150
Forward
GATGAGTGACGAGTTTGTG
150
Reverse
GCCCAAGTTCCGATCC
150
BRCA1
TFF1
BCL-2
BCL-XL
BAX
BAD
24
Table 3. Primary Antibodies.
Antibody
Dilution
Supplier
Akt
1:1000 in 5% Milk/T-TBS
Cell Signaling
phospho-Ser473 Akt
1:1000 in 5% BSA/T-TBS
Cell Signaling
p44/42 MAPK (ERK1/2)
1:1000 in 5% BSA/T-TBS
Cell Signaling
phospho-hr202/Tyr204
1:1000 in 5% BSA/T-TBS
Cell Signaling
ERα
1:1000 in 5% BSA/T-TBS
Epitomics
phospho-Ser118 ERα
1:1000 in 5% Milk/T-TBS
Cell Signaling
phospho-Ser167 ERα
1:1000 in 5% BSA/T-TBS
Cell Signaling
p70S6K
1:1000 in 5% BSA/T-TBS
Cell Signaling
phospho-Thr388 p70S6K
1:1000 in 5% Milk/T-TBS
Cell Signaling
β-Actin
1:1000 in 5% BSA/T-TBS
Cell Signaling
CCR2
1:1000 in 5% BSA/T-TBS
Sigma
CCR4
1:1000 in 5% BSA/T-TBS
Sigma
p44/42 MAPK (ERK1/2)
25
Figure 1
A
C
E
G
Co-culture
MCF7
T47D
MCF7
B
Co-culture
D
MCF7
F
MDA-MB231
H
MCF7
26
Bad
Bax
Bcl-2
Bcl-
Figure 2
A
B
C
MCF7
T47D
MCF7
27
28
Figure 3
A
C
B
D
Alternative
BRCA1
E
TFF1
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44