Tularemia Vaccine Development Contract: Technical Report

Tularemia Vaccine Development Contract: Technical Report

Period: 11/01/2006 to 11/30/2006

Due Date: 12/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin

Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Julie Wilder, Karl Klose, Bernard

Arulanandam

Contract No. HHSN266200500040-C

ADB Contract No. N01-AI-50040

Section I: Purpose and Scope of Effort

The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal models and cellular assays vital for testing vaccine efficacy.

Sections II and III: Progress and Planning Presented by Milestone

Active milestones: 2, 3, Working Group, 4, 5, 12

(UNM &LBERI)

, 13, 25, 26, 27, 33, 40,

41, 43, 46, 49, 50, 51

Completed milestones:

1

,

16

,

32

,

39, 48

Inactive milestones: 6-11, 14-24, 28-31, 34-38, 42, 44-45, 47, 52-54

Milestone 2

Milestone description: Vaccinations performed on relevant personnel

Institution: UNM / LRRI

1. Date started: 11/01/1005

2. Date completed: pending

3. Work performed and progress including data and preliminary conclusions a. NIAID is working on the IAA with USAMRIID and a legal liability review is pending. b. Dr. Lyons has submitted a request for programmatic support to Dr. Ed Nuzum, Chief of the Product Development Section in the Office of Biodefense Research Affairs at NIAID

4. Significant decisions made or pending a. UNM and NIAID continue to wait for a change in the status of the IAA between NIAID and USAMRIID. b. UNM and LBERI will use their biobubbles as additional physical protective equipment, but a work stoppage has occurred for SCHU S4 aerosols until LBERI staff is vaccinated with

LVS.

c. NIAID will need to provide UNM access to human cells from other LVS vaccinated individuals which are needed to develop in vitro immunoassays. For possibly another year, UNM will not have access to a local source of human cells from LVS vaccinated individuals d. UNM EOHS has obtained many of the laboratory documents i. Documents pending

1. Radiology Facility Accreditation Certificate

5. Problems or concerns and strategies to address a. UNM will need an external source of human cells from LVS vaccinated individuals, in order to develop the immunoassays in humans. b. LBERI does not want to begin SCHU S4 aerosols until after their staff receive the LVS vaccinations; Work stop has occurred on the SCHU S4 aerosols in primates, until the LBERI scientists and staff receive the LVS vaccinations.

6. Deliverables completed

None

1 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

7. Quality of performance

Good

8. Percentage completed

16%- no change relative to 11/15/06 report

9. Work plan for upcoming 6 months

Ross Kelley will continue to monitor the progress of the IAA between NIAID and USAMRIID and will inform UNM when and whether the TVD Contractors can be vaccinated under this IAA.

10. Anticipated travel

Travel could occur in Spring 2007 to Fall 2007, depending on the completion of the IAA.

11. Upcoming Contract Authorization (COA) for subcontractors

UNM may request a COA to allow 1-2 UNM EOHS nurses to travel to USAMRIID for training on

LVS site vaccination evaluations. The timing of the COA request depends on the achievement of the IAA.

Milestone 3

Milestone description: Bioaerosol technique selected and optimized

Institution: LBERI


2. Date completed: in progress

3. Work performed and progress including data and preliminary conclusions

4. Significant decisions made or pending

None

5. Problems or concerns and strategies to address

May need to add sonication step to eliminate possible clumping in sprays to reduce variability in

CFU detected.


None


Poor for November Period as no new data has been shared on this milestone


30%- no change since 11/14/06 report

9. Work plan for upcoming months a. Perform additional bioaerosol experiments on vegetative LVS with Collison generator i. Repeat of studies performed on frozen LVS, but now with fresh LVS ii. Plan to grow LVS in CB iii. Plan to quantitate LVS on CHAB b. Perform bioaerosol experiments on frozen LVS with sparging generator i. Repeat of studies performed on Collison ii. Plan to quantitate LVS on CHAB iii. Will continue doing frozen and fresh, not lyophilized.


None anticipated at the present time


None anticipated

2 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Working Group

Milestone description: Determine appropriate solid and liquid media for growth of tularemia for project team

Institution: LBERI



3. Work performed and progress including data and preliminary conclusions:

None



None


Determined liquid and solid media for LVS growth


Good


100%

9. Work plan for upcoming months

Finalize the protocol for the growth of LVS in liquid and on solid media.




None anticipated

Milestone 4

Milestone description: Confirmation of aerosol in vivo in primates

Institution: LBERI



3. Work performed and progress including data and preliminary conclusions: a. Vaccinated 3 NHPs with 1 x 10 7 CFU LVS by intradermal route on 11/20/06 = TUL 8 b. Vaccinated 3 NHPs with 3 x 10 6 CFU LVS by subcutaneous route on 11/29/06 = TUL 9 c. Schedule of blood collection for PBMC preparation is in Table below d. Study protocol was written and can be found stored in C:\Documents and

Settings\jwilder.LOBOS\My Documents\Tularemia Contract\LVS study protocol

111406.doc; Data on LVS vaccinations and dose preparation is stored in:

C:\Documents and Settings\jwilder.LOBOS\My Documents\Tularemia Contract\ TUL 8\

Dose prep form and in C:\Documents and Settings\jwilder.LOBOS\My

Documents\Tularemia Contract\TUL 9\Dose prep form; hard copies can be found in

Binder TVDC 1 in the Wilder Lab under the headings TUL 8 and TUL 9

3 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Experiment Animal

IDs

Date of Prevaccination

Bleed

Date of

Vaccination

Dose of Route of Vaccination Dates of

LVS Bleeds

Tul-8 A00896

(male);

A00908

(male);

A00937

(female)

11/16/06 (Day -4) 11/20/06 (Day 0) 1 x 10 7 Intradermal 11/27 (D7),

12/4 (D14),

12/11 (D21),

12/18 (D28)

Tul-9 A00868

(male);

A00902

(male);

A00659

(female)

11/29/06 (Day 0) 11/29/06 (Day 0) 3 x 10 6 Subcutaneous 12/6 (D7),

12/13 (D14),

12/20 (D21),

12/27 (D28)


None

5. Problems or concerns and strategies to address a. Misunderstanding of dose desired (1 x 10 6 /ml) resulted in a 10-fold higher dose prepared on 11/20 for intradermal vaccination (1 x 10 7 /ml) b. LVS titer from previously frozen vials is variable and not as predicted, resulting in a 10fold higher dose given on 11/20 intradermally than originally planned (combined with the

10-fold mistake in dose preparation = 100 fold error in actual vaccination dose; i.e. desired dose was 10,000 CFU LVS, but NHPs received 1 x 10 7 CFU LVS) c. Dose preparation for subcutaneous vaccination on 11/29 was made to replicate the dose given on 11/20 by intradermal route (1 x 10 7 CFU LVS) and conducted assuming that titer of LVS in freezer was 10 fold higher than previously titered (based on 11/20 results), however, actual dose given was 3 x 10 6 suggesting that the frozen LVS vials are not consistently giving the same titer as previously suspected, nor do they contain equivalent amounts of LVS


None


Good


5%

9. Work plan for upcoming month a. Plate 3 vials of LVS from frozen stock to re-titer and use the average CFU as the assumed titer of the remaining vials b. Continue to collect blood from vaccinated NHPs each week according to the schedule outlined in Table above (see Milestone 13 for assays conducted with PBMCs isolated from blood)




None anticipated

4 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Milestone 5

Milestone description: Species tested for sensitivity to LVS & generation of immunity against a pulmonary challenge of SCHU S4

Institution: UNM




Fischer 344 Rats a. Experiment Ftc22 study 1 (notebook 94 pages 10-12) i. The purpose was to determine:

1. The sensitivity of naïve Fischer 344 rats to i.t. LVS vaccination

2. The LVS clearance kinetics after i.t. vaccination ii. Used four rats per group and dose range of 10 5 -10 8 LVS iii. Rats were resistant to i.t. inoculation with greater than 10 8 LVS iv. No detectable LVS in lungs, spleen or liver after four weeks, suggesting that

LVS was cleared by this time b. Experiment Ftc22 study 2 (notebook 94, in progress) i. The purpose was to determine the resistance LVS-vaccinated rats to i.t.

SCHU S4 challenge ii. Vaccinated rats from Ftc22 study 1 were divided into groups of 2 rats and challenged i.t. with 10 6 -10 8 SCHU S4 iii. We are monitoring clinical symptoms and survival daily c. Experiment Ftc23 (notebook 94, in progress) i. The purpose was to compare the protection induced by:

1. LVS vaccination through s.c., i.d., or i.t. routes

2. i.t. vaccination with LVS or SCHU S4 ii. Rats were vaccinated s.c., i.d., or i.t. with LVS, i.t. with SCHU S4, or left unvaccinated iii. We are waiting 4-weeks to check for clearance

Guinea Pigs Hartley Strain a. Experiments Ftc24 study 1 (Notebook 94 pages 10-11) and Ftc24 study 2 (Notebook

94 pages 13-15) i. The purpose was to develop a SOP for intranasal infection of guinea pigs ii. Guinea pigs were anesthetized with 5% isoflurane at a flow rate of 2 liter/min iii. Intranasal inoculation was carried out by slowly instilling the inoculum onto the anterior opening of each naris iv. Two experiments were performed to optimize bacterial deposition in lungs v. PBS wash did not increase lung deposition when the inoculum was delivered in 100

 l (Table 1) vi. Lung deposition increased with inoculation volume and reached 60% with

400

 l inoculum (Table 1)

5 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Table 1. Optimization of intranasal inoculation of guinea pigs

Experiment LVS dose

(CFU/animal)

Lung

Deposition

(%)

Ftc24 study 1

Ftc24 study 2

10 5

10 5

Inoculum

Volume

(

 l/naris)

50

50

50

100

150

200

PBS wash

(

 l/naris)

-

50

-

-

-

-

Total volume

(

 l/animal

100

200

100

200

300

400

13

10

0

0

23

60

SCHU S4 expansion b. Experiments Ftc21 (Notebook 85, pages 94-95) and Ftc25 (Notebook 94 page 12) i. The purpose was to develop a SOP for expanding DVC’s SCHU S4 stock in

Chamberlain’s broth ii. 0.5 or 1 ml of DVC’s SCHU S4 stock were inoculated into 30 ml

Chamberlain’s broth and cultured for 48 h at 37 o C and 150 rpm iii. Under these conditions, the cultures grew to approximately 3 x 10 9 CFU/ml

(Table 2)

Table 2. Conditions used to expand DVC’s SCHU S4 stock in Chamberlain’s medium

Experiment

Vol of

Inoculum

(ml) *

Vol of

Chamberlain’s broth (ml)

¶

OD

600nm

#

Conc.

(CFU/ml) #

Ftc21 0.5 30 1.404

Ftc25 1 30

* DVC SCHU S4 Sublot 1 (10

¶

7

CFU/ml)

24.2 g Chamberlain’s powder/L, pH 6.25

1.048

# OD

600nm

and concentration after 48 h culture at 37 o C and 150 rpm

3.55 x 10 9

2.48 x 10 9


We decided at the November 11, 2006 Prime tech call to continue using pulmonary LVS vaccination as part of our animal model screen. We were concerned about the usefulness of a pulmonary vaccination model because at the annual meeting at Woods

Hole it was suggested that a pulmonary vaccination strategy may not receive FDA approval. However, Ann Sutton and Kristin DeBord indicated that pulmonary vaccination has been used for several peptide subunit vaccines and may be very relevant for our contract.


NA


Mouse model completed


Good


35%

6 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

9. Work plan for upcoming month a. Rats i. Check vaccinated rats for clearance of LVS ii. Challenge i.t. vaccinated rats with SCHU S4 b. Guinea Pigs i. Optimize i.n. inoculation ii. Determine sensitivity to LVS and SCHU S4 iii. Vaccinate with LVS by i.n., s.c., or i.d. routes c. Hamster – training


NA


None

Milestone 12-UNM

Milestone description: Assays for detecting relevant immune responses in animals & humans developed

Institution: UNM


2. Date completed: Pending


NA


NA


Our effort to develop relevant assays was delayed because we did not have vaccinated mice available. The long lead time required for vaccinated mice prompted us to start a pipeline for vaccinated mice by vaccinating small groups of mice every two weeks.


NA


Good


11%

9. Work plan for upcoming month a. We will determine the minimum number of splenocytes and amount of antigen required to generate a detectable signal in T cell proliferation assay and IFN

 production. b. We will develop a SOP for generating macrophages for measuring intracellular killing of F. tularensis. The macrophages will be either bone-marrow derived macrophages, or thioglycollate or proteose peptone-induced macrophages


NA


7 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Milestone 12-LBERI

Milestone description: Assays for detecting relevant immune responses in animals & humans developed

Institution: LBERI






Received materials required for freezing and testing the activity of frozen PBMC preparations



Received protocols for freezing PBMCs from Cerus and from CTL



Froze extra PBMCs from 11/16/06 TUL 8 pre-bleed samples using the Cerus protocol



- Cells are frozen at 10 x 10 6 /ml in RPMI + 10% FBS in 0.5 ml aliquots



- A00896, 5 vials; A00908, 8 vials; A00937, 5 vials



- Cells are stored at LRRI, in Cryofreezer in Room 313 North Building 14A, Tower C,

Box 2



- Details on procedure can be found in the binder TVDC 1 under Tab for TUL 8



Received materials required for intracellular stai ning of IFNγ in whole blood and PBMC preparations.



Ordered and received anti-human CD19 and anti-human IgM which we will used to

Investigate whether phenomenon of CD20+ B cells disappearing from PBMC fraction (but present in whole blood) can be confirmed using these other B cell markers


None


None


None


Good


85% of scientific work has been completed

9. Work plan for upcoming month



Test whether NHP PBMCs stain positively for anti-human CD19 and anti-human IgM.- looking for B cells



Set u p a proliferation assay and IFNγ ELISPOT assay with frozen PBMCs and compare to values obtained with fresh cells. Thaw at a pre-determined timepoint in January (1/11 would be 8 weeks) and set up in the same assays to see what fraction of function can be recovered




None for this milestone.

8 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Milestone 13-LBERI

Milestone description: Compare assays in animal models (sensitivity)

Institution: LBERI






Processed blood from NHPs before and after LVS vaccination according to schedule shown in Table above under Milestone 4



PBMCs are enumerated and an aliquot stained on a cytospin for differential cell typing ;

Data is shown below in Table x



Vaccination by either route appears to increase the numbers of neutrophils and macrophages in the blood



Plasma is being saved for future anti-LVS immunoglobulin ELISA



PBMCs are set up at various cell concentrations (1, 0.25 and 0.0625 x 10 6 /ml) and stimulated to proliferate with Con A (positive control), heat-killed and formalin-fixed and formalin-fixed LVS (at 1, 0.0625 and 0.0156 x 10 5 /ml)



PBMCs (if extra are available) are set up at 20,000 cells/well and stimulated to secrete

-killed and formalin-fixed LVS (at 1, 0.0625 and

0.0156 x 10 5 /ml)



Data on proliferation and IFN



ELISPOT is pending



No immediate skin reaction to LVS inoculation by either route



One Tul 8 monkey (A00937) noted to have 3 cm lump at the injection site (I.D.) when anesthetized for D14 bleed (12/4/06)



Monkeys are healthy, normal activity



All data is stored in binder TVDC 1 in the Wilder laboratory as well as in C:\Documents and Settings\jwilder.LOBOS\My Documents\Tularemia Contract\ TUL 8 or TUL 9

9 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Experiment Animal

ID

Day post-

LVS

Cell yield % Mononuclear

(x 106) Cells

(Lymphs/Monos)

%

Macrophages

%

PMNs

Tul 8 (ID) A00896 - 4 30.8

A00908 - 4 44.1

81.0

90.3

16.7

9.5

1.7

0.25

A00937 - 4 29.0

86.8

5.3

2.5

A00896

A00908

7

7

1.63

3.08

13.2

36.3

60.4

52.4

26.1

11.1

A00937

A00896

A00908

7

14

14

7.50

3.68

2.78

A00937 14 0.6

Tul 9 (SC) A00659 0 1.3

A00868 0 3.98

A00902 0 1.7

A00659 7 2.75

34.0

25.5

40.25

51.0

53.5

43.2

38.6

17.75

54.1

53.5

33.75

42.25

43.7

56.0

58.2

66.5

11.5

21

26

7.0

2.7

2.4

3.6

15.75

A00868 7 6.23 42.5 51 7.0

A00902 7 1.58 10.5 82.25 7.25


None


Day -4 blood draw for TUL 8 produced unusually high numbers of PBMCs; this blood was drawn by a different animal care taker than all the other blood draws; need to investigate whether different procedures were used


None

10 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam


Good


5% of scientific work has been completed




Continue to process blood from vaccinated NHPs through 12/27



Analyze all proliferation and IFN



ELISPOT data to determine if NHPs are becoming immune to LVS



Develop anti-LVS immunoglobulin ELISA for testing plasma (compare formalin-fixed and heat-killed LVS as antigen)




None for this milestone.

Milestone 25

Milestone description: Design a SCHU S4 library of genomically-complete and geneticallyimproved protein-fragments.

Institution: ASU-Sykes


2. Date completed: Almost complete


 The ORF designs are complete .



We added an addendum to this aim which involved designing synthetic peptides for testing alongside the protein fragments in the preliminary T cell assay workups.



The 500 designed 20-mers have been sent from ASU to UNM as lyophilized samples (~4 mg) in microtiter plates. These peptides correspond to tularemia protein sequences that have been predicted to be MHC Class I or Class II epitopes.

The 2 groups held a conference call to plan use, testing, and storage of the peptides.


Terry and Rick will test peptides individually and as pools at different dilutions and complexities.


None.


The ORF and peptide designs are complete .


Good


100%


Write milestone completion report by 1/15/2007


None


None

11 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Milestone 26

Milestone description: Design of ORF expression templates and testing by evaluating protein production (Design HTP SOPs, Test HTP SOPs for making protein from ORFs)

Institution: ASU-Sykes




Now that the optimal ORF designs have been determined, and optimal lysate type has been decided, we are testing the ORFs in expression templates. The SDS-PAGE gel shown below displays the protein yields obtained from coupled in vitro transcription/translation reactions (Roche, Inc) using a set of different templates. To distinguish newly synthesized proteins from those of the lysate, the amino acid mixture provided with the kit was supplemented with FluoroTect Green

Lys

(Promega), a charged

E. coli lysine tRNA labeled with the fluorophore BODIPY-FL. The IVT reaction proceeded for 4 hours, at which time the lysate was precipitated with acetone, resolved by gradient SDS-PAGE, and the proteins bands were visualized using the Typhoon fluorescent imaging instrument with a 488 nm excitation and 520/40 nm band pass.

Templates for in vitro ORF expression are evaluated. Lanes 1) molecular weight ladder, 2) green fluorescent protein (GFP) expressed with plasmid template, 3) calmodulin expressed with plasmid template, 4) calmodulin expressed with covalent LEE template, 5) calmodulin expressed with linked LEE template, 6) calmodulin expressed with linked LEE template, short promoter, 7) calmodulin expressed with linked LEE template, short promoter (no G10 enhancer sequence) and biotin attachment site, 8) calmodulin expressed with plasmid template, short promoter, 9) calmodulin expressed plasmid template, short promoter and

12 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam biotin attachment site. The arrow at left indicates the migration position expected of GFP product; the arrow at right indicates the position of the calmodulin polypeptide.

These results show that similar amounts of product are generated under all conditions tested in fig 1. Therefore, we conclude that our recombinant LEE attachment protocol works, that we can include a biotin binding site to use for high efficiency purification, and a streamlined T7 promoter can be used.

The results are located on CIM’s internal R server: peptide\Research\CIM\Mol_Biol_Tech\IVT\Hetal's IVTs


We have shown that for optimal production of polypeptide from an ORF that: LEE construction protocol is functional and efficient, the T7 enhancer (G10) sequence is not necessary, the biotin attachment site does not adversely affect expression levels, and therefore should be a useful purification anchor.


None


None


Good


70%


Evaluate the advantages of an ubiquitin fusion with regard to purification.


None


None

Milestone 27

Milestone description: Vaccine candidates

Institution: UNM




We received from ASU approximately 300 ovelapping peptides derived from known F. tularensis proteins. The peptides were synthesized on a 2 micromole scale peptides in 96well plates and shipped to us in lyophilized form


The peptides will be resuspended at ~ 5 mg/ml in 100% DMSO before use. 1 and 10 nM peptides will be used to stimulate splenocytes from vaccinated BALB/c mice. Unused peptides will be stored at –20 o C.


NA


13 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

NA

7. Quality of performance good


1%

9. Work plan for upcoming month a. Determine the minimum amount of peptides and number of vaccinated splenocytes required to induce measurable T cell proliferation b. Establish and optimize an SOP for measuring peptide-induced T cell proliferation


NA


Milestone 33

Milestone description: Microarrays constructed and confirmed; First printing of arrays,

Testing with DNA from Ft, Arrays GDPs validated at ASU

Institution: ASU-Johnston

1. Date started: 08-01-2006



Hybridization studies have been performed to compare the data generated from the complete

SCHU S4 printed arrays. The first generation arrays have each of the ~1800probes and controls printed in quintuplet on each array. In separate labelings and hybridizations utilizing both SCHU

S4 as well as LVS cDNA prepared using random primers (See Figure 1 at end), the arrays prepared on Poly-L-Lysine-(PLL) coated slides perform equally to the Corning Ultragaps based upon normalized median signal intensity. The average spot size on PLL is nearly 50% larger in diameter. By using the median signal intensities of the spots ASU minimizes the hybridization effects such as variations in spot morphology. In one array set, there was an increase in dynamic range observed on the PLL slides over the Corning slides




Poly-L-Lysine coated slides are comparable to Corning Ultragaps for providing an acceptable dynamic range of hybridization utilizing both SCHU S4 and LVS cDNA.


None


None


Good


40%




Prepare full-deck print (55-60 slides) of the SCHU S4 microarray probe set on PLL slides.



Need additional RNA and DNA to perform amplification testing for the genome-directed primers. UNM will be providing the RNA and DNA to ASU.



Finish and submit TIGR Tularemia microarray application to Pathogen Fungal Genomics

Center.


None


None

14 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

False-color image of microarrays

LVS

Corning

PLL

Schu S4

Corning

PLL

Figure 1. False color images of microarrays of both SCHU S4 and LVS cDNA on SCHU

S4 probes printed on either in-house prepared Poly-L-Lysine coated slides or Corning

15 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Ultragaps. For each strain comparison, array images were acquired at the same laser and PMT settings.

Milestone 40

Milestone description: Phenotyping of Ft novicida nucleotide excision repair mutants; Measure degree of attenuation of uvr mutants in macrophages and in mice

Institution: Cerus




We previously demonstrated that the

 uvrB and

 uvrA single mutants and the

 uvrA

 uvrB double mutant has no growth defect in Chamberlain’s defined medium (CDM) or in J774 macrophages and that all of the mutants are fully virulent in BALB/c mice when administered by the intraperitoneal (IP) route of administration.

1) In published reports LVS is approximately 9 logs less virulent when administered by the subcutaneous (SC) route and 4 logs less virulent by the intravenous (IV) route. We wanted to determine whether the nucleotide excision repair mutants of Ft novicida were attenuated for virulence in mice when delivered via an alternate route of administration, so we compared the virulence of U112 to

 uvrA ,

 uvrB , and

 uvrA

 uvrB mutants in BALB/c mice delivered IV. Five

10-fold serial dilutions of frozen seed stocks were prepared with calculated doses expected to be from 1x10 6 to 1x10 2 cfu administered by IV injection. CFU were determined empirically by plating serial dilutions of the inoculum on CHAH plates. All of the mice injected with the Ft novicida strains died within 4 days of injection, thus the LD

50

could not be calculated and is less than 100

CFU. The results suggest that Ft novicida is not dramatically reduced in virulence when administered IV. In order to determine the LD

50

of the ft novicida strains the experiment will be repeated with doses ranging from 100 cfu to 1 cfu.

U112  uvrA

 uvrB

 uvrA

 uvrB

Calculated LD

50

(cfu) <100 <100 <100 <100

AS06-108




We have selected CDM and cystine heart agar with hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of Ft novicida .



Ft novicida nucleotide excision repair mutants are not attenuated in vitro.


Abrogation of the nucleotide excision repair pathway through

 uvrA and/or

 uvrB deletions does not result in a significant loss in virulence. This suggests that a secondary attenuating mutation will be required if the SCHU S4 strain were to be used as the vaccine background.

Since LVS is already attenuated in humans, it may not require a secondary attenuating mutation. We will be screening attenuated Ft novicida mutants that also have uvr mutations for immunogenicity in milestone 43, with the ultimate goal of selecting an attenuating mutation to construct in SCHU S4. One possible interpretation of our results suggests that the virulence of Ft novicida is not as route dependent as LVS.


None


16 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Good progress


60%


IV LD50 will be repeated using doses between 100 and 1 cfu.


None


None

Milestone 41

Milestone description: Optimization of photochemical inactivation and characterization of

KBMA F. novicida ; determine the amount of S-59 and UVA required to inactivate uvr mutants; determine extent of metabolic activity of uvr mutants after S-59 and UVA inactivation; determine the level of virulence attenuation of KBMA uvr strains in mice

Institution: Cerus




Using a small-scale (3.5mL) procedure we previously identified the minimum dose of UVA required to achieve complete photochemical inactivation was 4 J/cm 2 . We found that minimum concentration of S-59 required to inactivate wild type

Ftn

 uvrA , and

 uvrA

 uvrB double mutant strains.

Ft novicida U112 was 40



M, which was only slightly higher than the 20



M concentration required to inactivate Ftn

 uvrB ,

1) This month we attempted to scale-up the inactivation process from 3.5mL to 400mL using the Ftn

 uvrB strain. Ftn

 uvrB was grown in CDM in shaker flasks to early stationary phase in the presence of 40 or 80



M S-59. 400mL of culture were transferred to a UV-transparent container and illuminated with 4 J/cm 2 of UVA. The inactivated bacteria were then washed twice with buffer and suspended at a final concentration of approximately 5x10 10 particles/mL.

1 mL of inactivated culture was plated using 10 CHAH plates and incubated at 37 o C. Aliquots were also stored frozen at -80 o C.

[S-59]

948-136 Arm-1 40



M

948-136 Arm-2 80



M

400ml scale photochemical inactivation results

UVA

4J/CM 2

4J/CM 2

Particles/mL

4.8 x10 10

4.84 x10 10 cfu/mL

3

13

NB948-136

The results from the plating demonstrate that complete inactivation was not fully achieved. It is not clear why the arm with higher S-59 concentration had higher residual cfu and suggests that the UVA dose may need to be increased. 10 logs of inactivation was achieved with the

40



M

S-59 treatment group, but given that a single cfu can be lethal to a mouse, the inactivation process needs to be optimized so that it is complete and reproducible. Thus the 400ml scale inactivation process will be repeated using 40



M and 120



M S-59 with UVA doses ranging from 2-8 J/cm 2 .


The nucleotide excision repair mutants (

 uvrA,

 uvrB , and

 uvrA

 uvrB ) were all approximately

2-fold more sensitive to S-59 than wild-type U112. Since there was no benefit to having both

17 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam genes deleted, we have chosen to use the

 uvrB single mutant for optimization of an increasedscale photochemical inactivation process


The 2-fold difference in the concentration of S-59 required for complete inactivation of the mutants compared to wild type is less than we have observed for other organisms, however the high degree of metabolic activity retained between all strains tested to date (U112,

 urvA ,

 urvB ) suggests that it is the wild-type that is highly sensitive to photochemical inactivation and thus the KBMA strategy is still viable. We were unable to achieve complete inactivation upon the first attempt to scale up the process using 2x and 4x the minimum S-59 concentration required for inactivation at the 3.5mL scale. We will repeat the experiment using higher S-59 and UVA doses.


None


Good progress


40% of scientific work completed on the milestone


We will optimize the 400mL photochemical inactivation process by assessing the degree of inactivation at 40



M and 120



M S-59 with doses of UVA delivered at 2, 4, 6, and 8 J/cm 2 .

We will perform a final head-to-head evaluation of metabolic activity all KBMA Ft novicida strains.


None


None

Milestone 43

Milestone description: Create uvrA or uvrB mutants in LVS

Institution: UTSA

1 Date started: 5/01/2006

2 Date completed: In progress

3 Work performed and progress including data and preliminary conclusions

The plasmid pDS132 is being modified for use in F. tularensis. This is a conditionally-replicative plasmid that has a counterselectable marker (sacB), we are adapting for use in F.t. by first altering the multiple cloning site, then inserting a Ft promoter (groELp) to facilitate expression of sacB and the antibiotic resistance marker (cat)

3.1 PCR primers used for amplifying pDS132 are:

PDS132R ggatccctgcagacgcgttcgagtctagacatatggatatcagctctcccgggaattc

PDS132F ggatccctgcagtgctaatctgggcccgcggccgcgacgtcgtcgactggaagaa gcag

Accgctaaca

We are amplifying pDS132 and modifying multiple cloning sites to make it suitable to insert other fragments such as the SAC B gene and GroEL promoter to drive chloramphenical resistance gene

3.2 Set up following PCR reaction:

18 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

10 X PfuTurbo Buffer dNTP 2mM pDS132F 2uM pDS132R 2uM pDS132 10 ng/ul dH20

PfuTurbo 2.5 u/ul

5.0 ul

5.0 ul

5.0 ul

5.0 ul

5.0 ul

24.0 ul

1.0 ul

Then at 94C for 2 min, and

94C 15 seconds

55C 15 seconds

72C 6 minutes

For 20 cycles.

3.3 The PCR product was cut with PstI and DpnI, and self- ligated with T4 DNA ligase. The ligated product was precipitated with ethanol and washed with 70% ethanol, and dissolved in 10 ul of sterile water.

3.4 The ligated product was electroporated into DAPA / λpir strain, and grown onto

3.5

DAPA(diaminopimelic acid)/chloramphenicol LB plate.

Plasmids were prepared from single colony, and cut with NcoI and XhoI with original pDS132 as control. Two fragments were released from correct plasmid.

3.6 pKEK842 was cut with NotI and SalI to release GroEL promoter, and the recovered fragment from gel was ligated to new pDS132 from step 3.5. After electroporation into

DAPA /λpir strain, and grown onto DAPA/ Chloramphenicol LB plate.

3.7 Colony PCR was performed with GroELPDn and SacBCDSR:

The sequences for the primers are:

GroELPDn: gca gat ctc tcg agt gaa aaa taa act taa tta ta ta

SacBCDS R gga aga tct tta ttt gtt aac tgt taa ttg tcc:

Set up following reaction:

10 X ThermoPol Buffer 2.5 ul dNTP 2mM

GroELPDn

SacBCDSR

2.5 ul

2.5 ul

2.5 ul

DNA dH2O

10.0 ul

Taq DNA polymerase 5u/ul

4.8 ul

0.2 ul

3.8

Then at 94C for 2 min, and

94C 15 seconds

55C 15 seconds

72C 1 minute

For 35 cycles.

One colony was positive with primers of step 3.7 indicating the presence of the GroEL promoter properly inserted to facilitate sacB/cat expression, and designated as pKEK1090.

4 Significant decisions made or pending

UvrB deletion with Kanamycin cassette has to be inserted into pKEK1090 so the uvrB gene can be inactivated in LVS

5 Problems or concerns and strategies to address

As UvrB upstream and downstream fragments from LVS plus kanamycin cassette are too big to make overlapping PCR work, we will try to ligate the three fragments together and then insert it into pKEK1090; 2 nd strategy will subclone the UvrBFpKan fragment from pGEM-T (pKEK1006)

19 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam into pKEK1090, as mating process is very efficient to get DNA fragment into LVS strain, therefore smaller fragment might work.

6 Deliverables completed

PKEK 1090

7 Quality of performance

Good

8 Percentage completed

Approximate 45% of scientific work completed on the milestone

9 Work plan for upcoming month a) Ligate UvrB upstream and downstream fragments from LVS plus kanamycin cassette together, and recover the fragment from gel. Cut with appropriate restriction enzymes and ligate into pKEK1090. If works, the new plasmid will be mated into LVS strain; b) UvrBFpKan fragment will be released with NotI from pKEK1006, and ligated with pKEK1090 treated with same enzyme. The ligated product will be electroporated into DAPA / λ pir strain, and grown onto DAPA/ Chloramphenicol LB plate. c) The colonies will be restreaked onto DAPA/Kanamycin LB plate, and any resistant colony from

DAPA/Kanamycin LB plate will be identified, and if correct, mated into LVS strain.

10 Anticipated travel

D r. Klose will travel to Cerus Corporation in December to meet with Dr. Skoble’s lab regarding

Francisella mutants. No COA is required for domestic travel between subcontractor sites and

UNM.

11 Upcoming Contract Authorization (COA) for subcontractors

None.

Milestone 46

Milestone description: Scale up of KBMA LVS vaccine production; Optimize large –scale LVS culture conditions, Establish 3L culture scale purification conditions, Optimize 3L scale photochemical inactivation process, Verify protective immunogenicity of vaccine candidates produced by optimized large-scale process

Institution: Cerus




We have demonstrated that LVS grows robustly in CDM and have prepared a working cell bank of DVC lot# 16 LVS cultures grown in CDM for 36 hours, harvested at an OD of 1.0 and stored at -80 o C. We have determined that the minimum concentration of S-59 required for complete inactivation of DVC LVS is 5µM. We have determined that S-59 and UVA photochemically inactivated LVS maintain metabolic activity for at least 12 hours. The sensitivity of the uvr mutants of LVS will be determined when the mutants are constructed by

UTSA. We recently identified an antifoam agent that does not inhibit growth of LVS.

1) We were able to achieve growth of LVS at a 3L scale in our fermentor using .001% Sigma antifoam A in CDM. The bacteria replicated with a doubling time of approximately 2h which is similar to the optimal doubling time we have reported in shaker flasks. The maximal titer of the culture was 2.8x10

9 cfu/mL. Of note: while the optical density did not increase between 7 and 7.5 hours,the cfu/mL increased by 2-fold. This is consistent with our observations in shaker flask experiments where we found that the ratio of cfu to OD

600

increases at high culture density.

20 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

1.000

0.100

NB 948-119: 3L Fermentor Growth of DVC LVS in CDM with SIGMA A Concentrate Antifoam at 0.001%

LVS

0.010

0 1 2 3 4 time (h)

5 6 7 8

NB 948-119: 3L Fermentor Growth of DVC LVS in CDM with SIGMA A Concentrate Antifoam at 0.001%

1.00E+10

1.00E+09

1.00E+08

0 2 4 time (h)

6 8

LVS

2) The dissolved oxygen content during the fermentation of LVS decreased with increasing bacterial density from nearly 100% to 50% when the culture reached stationary phase (at approximately t=7h) at which time the dissolved oxygen content began to increase. This suggests that the bacteria were decreasing their aerobic metabolism as they entered stationary phase. The pH was also monitored and rose gradually from 6.3 to 6.7 throughout the run.

21 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

3) Samples of LVS culture were harvested after 7.5 hours, washed 2x in HBSS and suspended in 2 different freezing solutions. One solution contained “freeze buffer” (HBSS

+1% sucrose + 8% DMSO) the other solution contained HBSS +10% sucrose. The titer of each suspension was determined by plating on CHAH plates before (pre-freeze) and just after freezing (T

0

) and will continue to be monitored on a monthly basis for stability at -80 o C.

The preliminary results demonstrate that there was no decrease in cfu after freezing when bacteria were frozen in “freeze buffer and only a two-fold decrease in cfu when frozen in 10% sucrose. This apparent decrease may in-fact be due to the initial titer of 4.47x10

9 being an outlier relative to the other values despite the fact that the cfu determination was based on 2 independent series of dilutions for each vial plated on 5 plates, for an average of average of

10 plates per time point per vial.

6.00E+09

5.00E+09

4.00E+09

3.00E+09

2.00E+09

1.00E+09

0.00E+00

Fermentor-Grown LVS Viability Count

Pre-Freeze and T=0 Month Stability Time Point

Lot: 948-119 Arm-1 (Freeze

Buffer)

Lot: 948-119 Arm-2 (10%

Sucrose)

Pre-Freeze

T=0

NB948-119

4) We have attempted to determine the LD

50

of LVS via the intraperitoneal (IP) route. LVS has a historical LD

50

of approximately 4 cfu in BALB/c mice when administered IP. In our initial experiment we used our frozen cell bank of expanded DVC LVS lot 16 and injected mice IP with five 5-fold-serial dilutions of LVS starting with 100 cfu as the top dose. All animals survived. We were concerned that our frozen cell banks of expanded DVC LVS lot

#16 had been attenuated, so in our second experiment we compared the virulence of our frozen cell bank with freshly reconstituted lot # 16 DVC LVS. We prepared six 10-fold serial dilutions starting at approximately 5x10 5 and plated the inoculum on CHAH plates to determine the number of cfu injected. The LD

50

for the Cerus frozen cell bank of expanded

DVC LVS lot#16 was 3.4 x 10 4 , but despite being injected IP with 450,000 cfu of freshly resuspended DVC lot 16 LVS, only 1 mouse of 4 died. Thus, the cerus frozen cell bank of expanded DVC LVS lot#16 was at least 10-fold more virulent than the freshly resuspended

DVC lot # 16. These results are inconsistent with reported level of LVS virulence in the literature and by the TVDC members.

The only obvious difference in our methods compared to those used by UNM was the buffer used for the serial dilutions and injections. We use hanks balanced salt solution (HBSS) and

UNM uses PBS. The main difference between these solutions is that HBSS contains glucose. So it is possible that IP injection of LVS in buffer containing glucose reduces the virulence of LVS. We will determine the IP LD

50

of LVS diluted in PBS or HBSS.

22 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

IP LVS LD

50 in BALB/c mice

>100 3.4x10

4 LD

50

Frozen cell bank

(expanded DVC lot#16?)

LD

50

DVC Lot16 (freshly resuspended)

Study Number

ND

AS06-090

>4.5x10

5

AS06-106

4. Significant decisions made or pending a. We have selected CDM and CHAH as liquid and plate medias for cultivation and enumeration of LVS.

b. We have determined the minimum concentration of S-59 psoralen required for complete inactivation of DVC LVS is 5µM. c. We have switched to using Sigma Antifoam A concentrate as our antifoam agent for large-scale propagation of LVS.


Following standard Cerus protocols, LVS is highly attenuated when compared to historical reports. Since the only obvious point of difference between the Cerus LD

50 protocol and UNM protocol is the buffer used, we will determine if switching to PBS restores the virulence of LVS. It is important to note that Ft novicida remains highly virulent following our protocol, suggesting that this problem is specific to LVS.


None


Good progress




The stability of LVS stored at -80 o C in various cryopreservation agents will be evaluated by MTS assay and plating monthly on CHAH plates. We will compare the virulence LVS in injected IP into

BALB/c mice using HBSS or PBS as the injection vehicle.


None


None

Milestone 49

Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)

(iglC, pdpD, iglD, iglA, iglB)

49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)

49.2

: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis subsp. tularensis (SCHU S4)

49.3

: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis subsp. tularensis (SCHU S4)

Institution: UTSA

1. Date started: April 1, 2006

23 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam



I. Cloning of igLC: a. Phenol:Chloroform extracted the new iglC product produced with new oligos mentioned in previous report; then ethanol precipitated this DNA and started the Sal I digestion ; followed with alkaline phosphase (CIP) treatment. b. The pDS132 plasmid was also digested with Sal I enzyme; and both plasmid and PCR product were gel extracted using the previously described Qiagen Kit. The ligation reaction was done and then subsequently used to transform SM10 λpir cells. c. The result of two transformation attempts was only one colony which was not correct as it did not contain the iglC product It is unclear why more clones were not obtained, nor why the clone obtained did not contain the iglC construct. d. Decided to use other restriction sites to clone in the iglC into pDS132; frequently, changing restriction sites facilitates cloning due to some restriction enzymes working more efficiently than others. In milestone 43, we designed a more useful pDS132 plasmid containing more cloning sites to use. The details of this vector will be described in milestone 43. This new vector, KEK1090, was digested with Xho I then subsequently with Not I. e. The iglC deletion sequence was obtained from KEK906 by digesting with Sal I then subsequently with Not I. This resulted in two fragments, the vector portion and the desired iglC deletion fragment (Figure 1.)

Figure 1.

This represents the digested plasmids: lane 2 is KEK906 digested with Sal I/ NotI and lane 3 is

KEK1090 digested with Xho I / Not I. The 3 Kb fragment in KEK 906 is the iglC deletion fragment which along with the KEK1090 plasmid was gel isolated to be used in a ligation reaction. Lane 1 is the 1 Kb ladder (N3232S Biolabs) f. Both KEK1090 and the iglC deletion fragment from KEK906 were gel extracted using the previously described Qiagen Kit. The ligation reaction was set up with KEK1090 XhoI

/Not I vector and IglC Sal I/Not I fragment. g. Proceeded with a transformation into DH5 αλpir with the above ligations and plated onto chloroamphenicol plates, but did not get any colonies. This likely indicates insufficient

DNA during transformation, since no background colonies were obtained either, this experiment will be repeated. h. Will prepare more plasmid KEK1090 for a new ligation reaction reaction for the coming month since once the digested plasmid in photo above was gel isolated the yield was very low. i. Data located in TVD UTSA Notebook 3, page 67-69

II. Experiments to generate deletions in Schu4:

24 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam a. Set up new transformations of the II c. ii. and iii. ligations listed below into DH5 α competent cells and prepared serial dilutions then plated on Kanamycin plates.

These resulted in hundreds of single colonies. b. Used the previously mentioned KEK 1023 BamHI(BHI)/CIP + SacB Bgl II/BHI transformants to begin screening the PCR products for the correct construct. c. The first sets patched out from single colonies onto selective Kanamycin (35 ug/ml) were from the following ligation transformants: i. ii. iii.

KEK1023 BHI/CIP + SacB Bgl II/BHI -- patched 20

KEK964 XbaI/BHI + SacB XbaI/BHI – patched 30

KEK964 BHI/CIP + SacB Bgl II / BHI – patched 50 d. Created a cell suspension with pools of 10 from the patched colonies mentioned above: Used 100 ul sterile water and with sterile toothpick touched the patched colony then submerged tip into sterile water to rinse cells; repeated until all 10 colonies were picked for each pool preparation. These tubes were then boiled for 5 minutes; quick spun at 12K rpms and 2 ul of this pool was used in a PCR reaction. e. Using the previously described SacB oligos: SacBdownXbaIBHInew and

SacBupBgl2new – to set up PCR screens of the various transformants mentioned in c. above. Used HiFi KOD DNA polymerase reaction, as described earlier, only with the pool samples we used 2 microliters instead of 1 ul of DNA as template in reaction. f. We were able to get some positive results (see figure 2) in the KEK964 + SacB Bgl II

/ BHI set of transformants indicating the presence of the sacB gene. Decided to concentrate on these for the remainder of this month. I will still pursue the others with more screening in next month.

Figure 2.

This figure illustrates SacB PCR products resulting from the first pooled suspensions prepared from transformants resulting from KEK1023 BHI /CIP + SacB Bgl II/ BHI (lanes 5, 6); KEK964 Xba I /BHI

+ SacB Xba I / BHI (lanes 7, 8 and 9); and KEK964 BHI / CIP + SacB Bgl II /BHI (lanes 10 thru

14). The controls are KEK964 and KEK 1024 plasmids which should have not product; and pCVD422 vector which contains the SacB which we are trying to clone into the mentioned plasmids. The resulting PCR fragment from the positive control pCVD422 does match with some of the pools prepared in the KEK964 BHI / CIP + Bgl II / BHI.

g. Took the individual colonies patched from the KEK964SacB Bgl II/BHI from the first positive pool (clones 1 thru 10; lane 10 above) and prepared mini plasmid

25 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam preparations from each of the 10 clones using the Qiagen Kit mentioned in an earlier report. These were screened with the same SacB oligos to check for correct constructs (Figure 3).

Figure 3.

This represents PCR product profiles of ten plasmid preparations from pool1 colonies resulting from

KEK964 BHI/CIP + SacB Bgl II/BHI ligation. The reaction was set up using SacBdownXbaIBHInew and

SacBupBgl2new oligos with HiFi KOD DNA Polymerase enzyme. Lane 2 is the pCVD422 plasmid from which the SacB was derived from for cloning; lane 3 and 14 is the KEK964 plasmid. Lanes 4 thru 13 are the various test plasmids used in PCR reaction. Lanes 4, 5, 6, 7. 8 and 11 yielded a product at the correct size compared with the control, Lane 2. h. Continued with the PCR screen by checking the desired orientation of the SacB fragment. The correct orientation is required for the sacB gene product to be expressed by the Ft promoter, so both presence of the SacB fragment and its correct orientation are required. The KEK964 BHI /CIP ligation with the SacB Bgl II /BHI will result in two orientations because the Bgl II and BHI generate compatible cohesive ends relative to one another. i. Therefore, took some of the plasmids and some of the pooled suspensions and checked for this orientation by initiating PCR with an oligo which binds to the 5' end of the Fn promoter (Fn Bgl II forward) and one that binds to the 3' end of the SacB gene fragment (SacBupBglIInew). The correct PCR product should be approximately

2500 bp in size (Figure 4), if the SacB fragment is in the correct orientation.

26 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Figure 4.

This represents PCR products resulting from a screen using oligos Fn Bgl II forward and

SacBupBglII new. Lane 2, is the pCVD422 plasmid where the SacB was derived . Lane

3, is the pKEK964 cloning vector. Lanes 4 thru 10 are plasmids prepared from KEK964

BHI/CIP + SacB Bgl II/ BHI colony pool set 1; and lanes 11-14 are the colony pool sets 2,

3, 4 and 5 from the same transformation group. Lanes 4, 11, 12 and 14 appear to have the desired orientation of the SacB gene based on the approximately 2.5 kbp band detected. j. Took C1 plasmid ( from lane 4 above) and digested it with EcoRI to confirm orientation. The expected fragments based on the sequence of vector and Sac B should have yielded two fragments of 4 Kb and the other at 1300 bp. The resulting digestion yielded a second band closer to 2000 bp (Data not shown), which is not the correct size.

Therefore, prepared another 10 plasmid preparation from colony pool set 3 (from lane 12 above) and screened these with Fn Bgl II forward and SacB up Bgl II new and found more candidates. Will set up restriction digestions with EcoRI to obtain the correct clone and subsequently will sequence for confirmation in the coming month. j. Order more supplies as needed k. Data located in TVD UTSA Notebook 3, page 46-49.


None


No significant problems aside from typical cloning issues —we have found that multiple strategies are typically necessary to obtain desired clones, and we have a lot of experience with various strategies necessary to obtain clones. We anticipate that we likely already have the clone with sacB inserted, and that further screening will result in this clone being identified.

6.

Deliverables completed

None

27 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam


Good


30%

9. Work plan for upcoming month j. Will need to prepare more competent E. coli cells (DH5



, Top10) for future transformations. k. Will continue to clone iglC deletion into KEK1090 by preparing more plasmid and digesting the vector again as described earlier, since no colonies were obtained previously, to prepare for new ligation with the iglC deletion fragment. l. Will continue with KEK964 constructs containing the SacB genes by screening more colony pools and by preparing plasmids preparations to prove the presence of the SacB gene. Also, will look at more colony pools for the KEK1023 BHI/CIP + SacB Bgl II/BHI transformants mentioned in earlier report. m. The confirmation of the correct constructs will be done by restriction endonuclease digestions and sequencing. n. Order more supplies as needed


None


None

Milestone 50

Milestone description: Phenotyping and confirmation of single gene mutants;

50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB ; LVS uvrA or uvrB , and Ft subsp. tularensis (SCHU S4) iglC strains,

50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD, iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,

50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA, iglB strains

Institution: UTSA


2. Date completed: provide date when milestone is completed

3. Work performed and progress including data and preliminary conclusions a. Monitor Ft subsp. novicida uvrAuvrB double mutant replication and dissemination in mice

(Note book #4 page 50-51): Bacterial burdens were determined in the lungs, liver and spleen from the uvrAuvrB -infected BALB/c mice (200 CFU, intranasal challenge) 24h-, 48h-, and

72h- post-infection by dilution plating. The uvrAuvrB double mutant replicated rapidly in the infection site and quickly disseminated to the liver and spleen (Fig.1). The rapid replication and dissemination of uvrAuvrB in BALB/c mice suggests that this mutant is not attenuated.

28 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Lung

Liver

Spleen

Fig.1. Replication and dissemination of uvrAuvrB double mutant in mice. BALB/c mice were challenged with 200 CFU of uvrAuvrB intra-nasally. Bacterial burdens in lungs, liver, and spleen were measured at 24h-, 48h- and 72h-postinfection.

b. Evaluation of the efficacy of Ft novicida Δiglc + LVS LPS vaccination in protection against

Schu S4 challenge (Note book #4 page52,54): Groups of BALB/c mice (6 mice per group) were vaccinated with Δiglc (10 6 CFU per mouse via intranasal (i.n.) route) and purified LVS

LPS (50μg per mouse via Intraperitoneal injection). These mice received an additional boost with Δiglc (10 6 CFU, i.n.) + LVS LPS (25µg, i.p.) two weeks after the first immunization and rested for three weeks before being challenged i.n. with either 300 CFU or 3000 CFU of the

Schu S4 strain. This experiment did not show any measurable degree of protection or extended time to death (Fig. 2). These results provide a baseline to establish the efficacy of using attenuated novicida strains to protect against Schu S4. It would definitely be beneficial to gauge the efficacy of other promising attenuated strains. The idea of using LPS was to examine if boosting the antibody response at the time of vaccination would induce a noticeable difference in protection. In this case, with the dose we had to work with, there was no measurable effect, It would be beneficial to try other doses of LPS, however we obtained

LVS LPS from Dr. John Gunn for these studies and the quantity that he can supply for in vivo studies is limited.

29 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Days post-challenge

Fig.2. Efficacy of Δiglc + LVS LPS vaccination. Groups of mice were received two dosages of Δiglc+ LVS LPS or PBS as mock control and were challenged with 300 or 3000 CFU of Schu S4 three weeks after final immunization.


With the current dose of LVS LPS used, we have not noticed any efficiency against subsequent challenge with SCHU S4.


None


None


Good



9. Work plan for upcoming month a. Isotyping of antiΔiglc antibodies in sera of mice immunized with Δiglc + LVS LPS. b. Even if this vaccination regimen was not successful, we should get an idea on the isotypes elicited from this experiment as a baseline for future characterization of defined vaccine strains. c. Determine the kinetic growth and clearance of the Ft novicida Δiglc mutant in target organs after i.n. vaccination.

10. Anticipated Travel

None


None

30 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam

Milestone 51

Milestone description: Construction and delivery of Ft. subsp. Novicida urvA or UvrB plus pdpD, iglA, iglB, iglC or iglD double mutants

Institution: UTSA


2. Date completed: In progress


Creation of Ft novicida mutants:

We intend to create all ten permutations of mutants: uvrA + pdpD, iglA, iglB, iglC, and iglD, and uvrB + pdpD, iglA, iglB, iglC, and iglD. Within the Klose laboratory, we already have the constructs to make pdpD, iglA, iglC, and iglD mutants, which will be combined with the two constructs to make uvrA and uvrB mutants. However, we do not yet have the construct to make the iglB mutation, so our first goal of this milestone is to construct this particular mutation. Once we have this mutation, we will then make the entire set of double mutant strains listed.

3.1 Primers were designed to make IglB mutant.

IglBSac2Up: 5’GGA ATT CCC GCG GAC CTT ACA GAG TCC TAG TTG TTG GCG 3’

IglBPET15b Dn: 5’ ACT ACT GGG CTG CTT CCT AAT GCA TTG TAG CGC CAT AAG GTT

TCT AGC ATT 3’

IglBPET15bUp1: 5’ GCT GCT AAC AAA GCC CGA AAG GAA ATC GAG GTT GAA ACC ATA

CCG GGT 3’

IglBSac2Dn1: 5’ GGA ATT CCC GCG GGC GCA ACA TAC TGG CAA ACT TTC T 3’

3.2 Set up following PCR reactions:

For IglBUpSeq:

10 X KOD XL Buffer dNTP 2mM

IglBSac2Up 2uM

IglBPET15bDn 2uM

U112 Chromosomal DNA 10 ng/ul

KOD XL DNA polymerase dH2O and IglBDnSeq:

5.0 ul

5.0 ul

5.0 ul

5.0 ul

5.0 ul

0.4 ul

24.6 ul

10 X KOD XL Buffer dNTP 2mM

IglBPET15bUp1 2uM

IglBSac2Dn1 2uM

5.0 ul

5.0 ul

5.0 ul

5.0 ul

112 Chromosomal DNA 10 ng/ul

KOD XL DNA polymerase

5.0 ul

0.4 ul dH2O 24.6 ul at 94C 2’ then

94C 30”, 55C 30”, 72C 30” for 35 cycles, and at 72C for 10’.

3.3 The IglBUpSeq and IglBDnSeq were recovered from gel and were ready for overlapping

PCR.

All data were entered into page 100-101, TVD UTSA notebook #2.

31 of 32


Period: 11/01/2006 to 11/30/2006



Arulanandam


None


None


None.


Good


Approximate 5% of scientific work completed on the milestone

9. Work plan for upcoming month a) Perform overlapping PCR to create the IglB mutation b) Subclone the fragment into pGEMT vector c) If plasmid is correct, perform cryotransformation to construct iglB mutant.


None.


None.

32 of 32

Tularemia Vaccine Development Contract: Technical Report

Section I: Purpose and Scope of Effort

Sections II and III: Progress and Planning Presented by Milestone

Active milestones: 2, 3, Working Group, 4, 5, 12

, 13, 25, 26, 27, 33, 40,

41, 43, 46, 49, 50, 51

Completed milestones:

,

,

,

Inactive milestones: 6-11, 14-24, 28-31, 34-38, 42, 44-45, 47, 52-54

Milestone 2

Milestone 3

Working Group

Milestone 4

Milestone 5

Milestone 12-UNM

Milestone 12-LBERI

Milestone 13-LBERI

Milestone 25

Milestone 26

Milestone 27

Milestone 33

Figure 1. False color images of microarrays of both SCHU S4 and LVS cDNA on SCHU

S4 probes printed on either in-house prepared Poly-L-Lysine coated slides or Corning

Ultragaps. For each strain comparison, array images were acquired at the same laser and PMT settings.

Milestone 40

Milestone 41

Milestone 43

Milestone 46

Milestone 49

Milestone 50

Milestone 51

Related documents

Products

Support

Tularemia Vaccine Development Contract: Technical Report

Section I: Purpose and Scope of Effort

Sections II and III: Progress and Planning Presented by Milestone

Active milestones: 2, 3, Working Group, 4, 5, 12

, 13, 25, 26, 27, 33, 40,

41, 43, 46, 49, 50, 51

Completed milestones:

,

,

,

Inactive milestones: 6-11, 14-24, 28-31, 34-38, 42, 44-45, 47, 52-54

Milestone 2

Milestone 3

Working Group

Milestone 4

Milestone 5

Milestone 12-UNM

Milestone 12-LBERI

Milestone 13-LBERI

Milestone 25

Milestone 26

Milestone 27

Milestone 33

Figure 1. False color images of microarrays of both SCHU S4 and LVS cDNA on SCHU

S4 probes printed on either in-house prepared Poly-L-Lysine coated slides or Corning

Ultragaps. For each strain comparison, array images were acquired at the same laser and PMT settings.

Milestone 40

Milestone 41

Milestone 43

Milestone 46

Milestone 49

Milestone 50

Milestone 51

Related documents

Add this document to collection(s)

Add this document to saved

Suggest us how to improve StudyLib