Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2, 3, Working Group, 4, 5, 12 (UNM &LBERI), 25, 26, 33, 40, 41, 43,
46, 48, 49, 50
Completed milestones: 1, 16, 32, 39
Inactive milestones: 6-11, 13-24, 27-31, 34-38, 42, 44-45, 47, 51-54
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/1005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. NIAID is working on the IAA with USAMRIID and a legal liability review is pending.
b. Dr. Lyons and Barbara Griffith met with JoAnn Stringfield, UNM legal counsel, who
advised UNM as prime contractor, to be the primary contact with NIAID regarding the
LVS vaccinations. Ms Stringfield contacted legal counsel at USAMRIID to discuss
CRADA language used in the CRADA between UTSA and USAMRIID. USAMRIID and
UNM could modify the UTSA CRADA language and could establish a CRADA with UNM
within a 2 week period.
c. Dr. Ed Nuzum, Chief of the Product Development Section in the Office of Biodefense
Research Affairs at NIAID and Dr. Martin Crumrine, DMID coordinator for Special
Immunization Programs (SIP) are discussing options with Dr. Rick Lyons of UNM>
d. Nicole Banks of LBERI and Barbara Griffith are sharing information to support the
discussions with NIAID
4. Significant decisions made or pending
a. UNM and NIAID continue to wait for a change in the status of the IAA between NIAID
and USAMRIID.
b. UNM and LBERI will use their biobubbles as additional physical protective equipment, but
LBERI does not want to begin aerosolizations with SCHU S4, until their staff are
vaccinated with LVS.
c. NIAID will need to provide UNM access to human cells from other LVS vaccinated
individuals which are needed to develop in vitro immunoassays. For possibly another
year, UNM will not have access to a local source of human cells from LVS vaccinated
individuals
d. UNM EOHS has obtained many of the laboratory documents
i. Documents pending
1. Radiology Facility Accreditation Certificate
1 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
5. Problems or concerns and strategies to address
a. UNM will need an external source of human cells from LVS vaccinated individuals, in order to
develop the immunoassays in humans.
b. LBERI does not want to begin SCHU S4 aerosols until after their staff receive the LVS
vaccinations; Work stop has occurred on the SCHU S4 aerosols in primates, until the LBERI
scientists and staff receive the LVS vaccinations.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
16%- no change relative to 9/15/06 report
9. Work plan for upcoming 6 months
a. Ross Kelley will continue to monitor the progress of whether Martin Crumrine's IAA between
NIAID and USAMRIID will inform UNM when and whether the TVD Contractors can be
vaccinated under this IAA.
10. Anticipated travel
Travel could occur in September 2006 to September 2007, depending on the completion of the
IAA.
11. Upcoming Contract Authorization (COA) for subcontractors
UNM may request a COA to allow 1-2 UNM EOHS nurses to travel to USAMRIID for training on
LVS site vaccination evaluations. The timing of the COA request depends on the achievement of
the IAA.
Milestone 3
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. Began initial set up of sparging generator
b. Began evaluation of fresh LVS bioaerosol with Collison
c. Spray Factor vs. Spray Conc (Fresh LVS)
i. Used LVS after 48 hrs growth in shaker with Chamberlains
ii. Sprayed 4.0 to 4.5 logs, which give spray factors of -6 to -7 log which is good and
where we wish to see the spray factors.
iii. Data files for the following 4 graphs are found in \\Saturn\ABSL3\Study Data
(2005-2006)\Francisella tularensis\FY06-078 (Tul-03)\Bioaerosol Data
2 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Spray Conc vs. Spray Factor
-4.00
0.0
1.0
2.0
3.0
4.0
5.0
6.0
7.0
8.0
9.0
Log10 Spray Factor
-4.50
-5.00
-5.50
-6.00
-6.50
-7.00
-7.50
-8.00
Log10 Spray Conc (CFU/mL)
d. Fresh vs. Frozen- plot of spray concentration vs. spray factor
i. For spray in Log 4 range, fresh has slightly lower spray factor than frozen
material
Spray Conc. vs. Spray Factor
-4.00
2.0
3.0
4.0
5.0
6.0
7.0
8.0
9.0
Log10 Spray Factor
-4.50
-5.00
-5.50
Fresh
Frozen
-6.00
-6.50
-7.00
-7.50
Log10 Spray Conc
e. Target vs. Actual LVS Counts
i. The actual LVS count was close to the target count for these spray preparations,
but there was considerable variability, even though the spray suspensions were
made at the same.
3 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
ii. Need to repeat and possibly add sonication step to remove possibility of
clumping.
Target vs. Actual
6.00E+04
Target CFU/mL
5.00E+04
4.00E+04
3.00E+04
2.00E+04
1.00E+04
0.00E+00
0.00E+00
2.00E+04
4.00E+04
6.00E+04
8.00E+04
1.00E+05
1.20E+05
Actual CFU/mL
Spray Count vs. AGI Recovery
i. Though the trend is upward, the CFU/liter in the AGI is not increasing as much as the
CFU in spray. At 200 CFU/liter in the spray, LBERI detects 4 CFU/liter in the AGI
impinger
Spray vs. AGI
1200
1000
CFU/l in Spray

800
600
400
200
0
0
2
4
6
8
10
12
CFU/L in AGI
4 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
May need to add sonication step to eliminate possible clumping in sprays to reduce variability in
CFU detected.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
30%
9. Work plan for upcoming month
a. Perform additional bioaerosol experiments on vegetative LVS with Collison generator
i. Repeat of studies performed on frozen LVS, but now with fresh LVS
ii. Plan to grow LVS in CB
iii. Plan to quantitate LVS on CHAB
b. Perform bioaerosol experiments on frozen LVS with sparging generator
i. Repeat of studies performed on Collison
ii. Plan to quantitate LVS on CHAB
iii. Will continue doing frozen and fresh, not lyophilized.
10. Anticipated travel
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Working Group
Milestone description: Determine appropriate solid and liquid media for growth of tularemia for
project team
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions:
None
4. Significant decisions made or pending
5. Problems or concerns and strategies to address
None
6. Deliverables completed
Determined liquid and solid media for LVS growth
Determined that LVS grown on liquid or solid media was at least as virulent in mice as the LVS
lot#16 used directly from the DVC vials.
Protocol for LVS growth is undergoing format and minor revisions.
7. Quality of performance
Good
8. Percentage completed
100% scientific work completed; protocol under review
9. Work plan for upcoming month
Complete the protocol.
10. Anticipated travel
5 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone 4
Milestone description: Confirmation of aerosol in vivo in primates
Institution: LBERI
1. Date started: 11/1/06
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions:
a. Completed IACUC approval for LVS vaccination of NHP
b. Obtained 6 NHP for the protocol
c. Scheduled pre-bleeds and LVS vaccination- Julie is working on this
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
0%
9. Work plan for upcoming month
a. Obtain pre-bleed samples week of 11/13: for assay validation for milestone 12. Want to
know if the animals can be vaccinated and protected by an id or sc route, before use they
use aerosol route.
b. Vaccinate NHP on approximately Nov 20th and then post bleed on days 7, 14, 21, 28; will
harvest bloods for cells and plasma; 3 animals will be immunized by id and 3 will be
immunized by subcutaneous routes. Both routes have been used in literature.
c. Dose will be 105.
d. Julie will test fresh PBMC cells for proliferation vs. heat killed or formalin fixed LVS
antigens from Terry W\u (UNM). 1st priority for the primate cells is the proliferation assay
and the 2nd priority is ELISPOT for IFN gamma.
10. Anticipated travel
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone 5
Milestone description: Species tested for sensitivity to LVS & generation of immunity against a
pulmonary challenge of SCHU S4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
6 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Fischer 344 Rats
a. Experiment Ftc16, study 1 (notebook 85, pages 55-56), study 2 (notebook 85, page
90-93), study 3 (notebook 85, pages 75-77)
i. The purpose was to use small groups of animals to determine the i.t. LD50 of
SCHU S4 in naïve Fischer 344 rats
ii. Rats were infected using blunt-ended i.v. catheters following standard
operating procedure established previously in the lab
iii. The results of three separate experiments indicated that the i.t. LD50 of SCHU
S4 is between 104 and 105 CFU (Table 1)
b. Experiment Ftc20 (Notebook 94, pages 3-9)
i. The purpose was to determine whether i.d. and s.c. LVS vaccination protects
Fischer 344 rats from i.t. challenge with SCHU S4.
ii. Rats were vaccinated s.c. or i.d. with 4 x 104 CFU LVS
iii. 7 weeks after vaccination, no LVS was detected in the lungs, spleens, and
livers from two rats in each group, suggesting that both groups of vaccinated
rats had cleared LVS
iv. 9 weeks after vaccination, the rats were challenged with 104, 105, 106, or 107
CFU SCHU S4. We used a UNM SCHU S4 stock in this experiment
because 1) the DVC SCHU S4 stock was not concentrated enough and 2)
the DVC stock is toxic when used without dilution.
v. The results indicated that i.d. and s.c. LVS vaccination increased the
resistance of Fischer 344 rats by 10- and 100-fold (Table 1). A similar
pattern of resistance, i.e. i.d.<s.c., was observed in mice. Since intranasal
LVS vaccination provided even better protection than s.c. LVS vaccination in
mice, intranasal LVS vaccination may also offer the best protection in rats.
We will therefore include i.t. LVS vaccination in the next experiment in this
series
vi. The naturally high resistance of naïve Fischer 344 rats to SCHU provides an
opportunity to determine whether SCHU S4 vaccination provides better
protection than LVS vaccination to i.t. SCHU S4 challenge.
Table 1. Sensitivity of naïve and vaccinated Fischer 344 rats to i.t. SCHU S4
challenge
c.
Experiment Ftc22 (notebook 94 pages 10-12)
7 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
i. The purpose was to determine the i.t. LD50 of LVS in Fischer 344 rats. The
maximum sublethal dose found in this experiment will be used to vaccinate
Fischer 344 rats.
ii. The rats were inoculated with 105, 106, 107, or 108 CFU LVS
iii. The rats developed slightly ruffled fur one day after inoculation but the clinical
signs never progressed.
iv. As of this report, the rats have been monitored for 18 days and all of them
are alive without clinical signs of illness
v. We will determine when LVS is cleared and wait the determined length of
time before challenging vaccinated rats with SCHU S4 in future experiments
Guinea Pigs Hartley Strain
a. We have completed training on handling guinea pigs with the supervisor of the
Animal Resource Facility at The University of New Mexico
b. A literature search indicated:
i. CM Downs et al. (1947) J.Immunol. 56:217-228
1. The intranasal LD50 of SCHU is 5 CFU
ii. HT Eigelsbach et al. (1961) Proc. Soc. Exptl. Biol. Med. 108:732-734
1. Aerogenic LVS vaccination provides better protection than s.c. LVS
vaccination (Table 2)
2. Vaccine-induced protection is dose-dependent
3. Survival was monitored for only 15 days post infection
4. We will use these data to develop the guinea pig model
Table 2. Survival of vaccinated guinea pigs following respiratory challenge
with 4 x 103 CFU SCHU1
15 d survival (%) respiratory challenge
LVS vaccination
aerogenic
s.c.
dose (CFU)
vaccination
vaccination
105
60
5
103
45
0
10-20
0
0
1
HT Eigelsbach et al. (1961) Proc. Soc. Exptl. Biol. Med. 108:732-734
4. Significant decisions made or pending
a. DVC’s SCHU S4 stock must be expanded in Chamberlain’s broth for 48 hours to
increase concentration
b. Our plating results are consistently lower than those reported by the DVC team. This
may be attributed to the antibiotics (100 unit/ml of polymyxin B and penicillin G) in the
cystine heart agar plates from Remel. We have to decide if we have to discontinue
use of the antibiotics so that our results can be compared with those from the DVC
team.
5. Problems or concerns and strategies to address
a.
DVC’s SCHU S4 stock was not concentrated enough for the Fischer 344 rats and it
contains as yet unidentified substances that appears to be toxic for the Fischer 344
rats when used for intranasal infections without dilution. To resolve these problems,
we will expand DVC’s SCHU S4 in Chamberlain’s broth following the SOP for
propagating LVS established by the working group. Our target concentration is 10 9
CFU/m
8 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
6. Deliverables completed
Mouse model completed
7. Quality of performance
Good
8. Percentage completed
28%
9. Work plan for upcoming month
a. Vaccinate Fischer 344 rats with LVS by i.t., s.c., and i.d. routes
b. Develop guinea pig model, focusing on method of pulmonary delivery method
c. Start training on hamsters
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 12-UNM
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed
Institution: UNM
Date started: 7/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
1.
a. Ftc18 study 5 (Notebook 85, pages 1-2)
i. The purpose was to generate a working stock of heat-killed and formalinfixed LVS for use in immunoassay development at UNM and LRRI.
ii. LVS cultured in Chamberlain’s broth for 48 h was used as source of antigen
iii. Half of the culture was heat-killed at 70oC for 3 h and the remaining half was
fixed with 3% formalin/PBS for 30 min
iv. We produced 60 ml (5.83 x 107 CFU/ml) of heat-killed LVS and 25 ml (7.12 x
107 CFU/ml) of formalin-fixed LVS
v. A portion of each antigen preparation has been distributed to Julie Wilder at
LRRI for primate studies
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
10%
9. Work plan for upcoming month
a. We will determine the minimum number of splenocytes and amount of antigen
required to generate a detectable signal in T cell proliferation assay and IFN
production.
9 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
b. We will continue to develop the assay for macrophage killing of intracellular F.
tularensis.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
Milestone 12-LBERI
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions





Participated in the TVDC 2006 Annual Conference (Albuquerque, 9/27/06)
Ordered materials required for freezing and testing the activity of frozen PBMC
preparations.
Ordered materials required for intracellular staining of IFNγ in whole blood and PBMC
preparations.
Investigated whether phenomenon of CD20+ B cells disappearing from PBMC fraction
could be confirmed using other B cell markers – answer, no. Neither CD19 nor surface
immunoglobulin antibodies specifically tested for NHPs are available for purchase. We
will try to use anti-human CD19 and surface Ig.
In whole blood, could see CD20+ cells but couldn’t see CD20+ in the PBMCs.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
CD20 positive B cells have not been detected in the primate PBMC preparations. We will try to
used anti-human CD19 and surface Ig to detect B cells in the primate PBMC preparations.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
81% of scientific work has been completed
9. Work plan for upcoming month


Test whether NHP PBMCs stain positively for anti-human CD19 and anti-human IgM.looking for B cells
Set up a proliferation assay and IFNγ ELISPOT assay with fresh PBMCs and reserve a
portion for freezing down. Thaw at a pre-determined timepoint (4 – 8 weeks later) and
set up in the same assays to see what fraction of function can be recovered. Perform
with non-immunized primate cells (naïve primate) for these studies. Trying to do in the
next month, though will be processing bloods twice per week for several weeks. LBERI
will be staggering the primate vaccinations so that the number of bloods to process per
day is reasonable.
10. Anticipated travel
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None for this milestone.
10 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Milestone 25
Milestone description: Design a SCHU S4 library of genomically-complete and geneticallyimproved protein-fragments.
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Almost complete
3. Work performed and progress including data and preliminary conclusions
We have completed a new synthetic-gene design program called SynBuild. Pilot studies
for the evaluation of our new oligo prediction software and for the development a set of
useful new molecular assembly protocols have also been completed. The new protocols
uniquely enable us to take advantage of microfluidic-based synthesis technologies for
oligos. These oligonucleotides are parallel-synthesized in femtamole quantities and
therefore are significantly less expensive than standard individual-resin synthesized
ones. However, oligo production scale and quality is lower, and oligos are delivered in a
single tube as a complex mixture called an “oligomix” instead of being delivered
individually in separate wells. We now have working protocols for assembly of multiple
subgene “building blocks” into full genes with exceptionally high sequence fidelity. The
fidelity of the synthetically generated genes is 10 times greater than that possible with
existing gene assembly protocols.
The list of 500 synthetic peptides covering MHC Class I and Class II epitopes, reviewed
by Drs. Sykes, Johnston, Lyons, and Breen, have been received:
Files are stored at
R:\GeneVac\FTU\Contract\Proteome\Milestones\26\MHC\ftu_mhc_output.xls
These lyophilized peptides are ready to be shipped to UNM.
4. Significant decisions made or pending
Examine fidelity, biases, and yield of assembled genes generated with micro-chip versus
resin-based oligo-synthesis technologies. Fidelity will be assessed by cloning
representative ORFs and individually sequencing them. ORF assembling and/or
amplification biases will be assessed be comparing relative yields of sets of building
blocks derived from a single oligomix. ORF yields will be determined by nanodrop fluorimetry.
5. Problems or concerns and strategies to address
None.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
99% (Peptides need only to be mailed)
9. Work plan for upcoming month
Send lyophilized peptides to UNM for in vitro testing.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
11 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Milestone 26
Milestone description: Confirmation of gene expression (Design HTP SOPs, Test HTP SOPs,
ORF library production, confirm gene expression)
Institution: ASU-Sykes
1.
2.
3.
Date started: 3/02/2006
Date completed: Pending
Work performed and progress including data and preliminary conclusions
Figure 1. In vitro production
of protein from LEE
templates. In vitro translation
reaction products are shown.
In lanes 1 and 2, RNA
corresponding to FTU1695
and FTU1712 were separately
generated by uncoupled in
vitro transcription reactions. In
lanes 3 and 4 DNA linear
templates were added to
transcription/translation
coupled reactions. A positive
control DNA plasmid template
encoding - lactamase was
used in the sample shown in
lane 5. No template was
added to the lysate sample
shown in lane 6.
In vitro transcription of six Francisella tularensis (FTU) ORFs was performed using the
Maxiscript transcription kit (Ambion). The resulting RNA was visualized and quantified
on RNA 6000 Nano chips using the Agilent 2100 Bioanalyzer. Proteins were produced
from each of the RNA templates using Promega’s S30 E. coli extract system for linear
templates. This in vitro translation system is permissible to RNA as well as DNA
templates. Therefore, to compare protein yield levels and consistency from the RNA
templates to their DNA counterparts, two of the six DNA LEE templates were included in
the IVT reactions. To distinguish newly synthesized proteins from those of the lysate,
the amino acid mixture provided with the kit was supplemented with FluoroTect GreenLys
12 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
(Promega), a charged E. coli lysine tRNA labeled with the fluorophore BODIPY-FL. The
IVT reaction proceeded for 4 hours, at which time the lysate was precipitated with
acetone, resolved by gradient SDS-PAGE, and the proteins bands were visualized using
the Typhoon fluorescent imaging instrument with a 488 nm excitation and 520/40 nm
band pass.
These data suggest that separate preparation of RNA affords more control to the
translation reactions and consistency to output. A repeat and larger scale experiment is
underway. We are also reconstructing the template so as to apply an optimal promoter
spacing. Finally we are testing the refolding properties of ubiquitin-fusion proteins.
4. Significant decisions made or pending
These constructs are being functionally evaluated as per a number of relevant criteria
and compared so as to define optimal protein production templates, reagents, and
protocols. For example these constructs will discern alternative arrangements of ORF
promoters, and protein fusions and tags for the library of antigens. They are also being
used to consider E. coli coupled versus wheat germ uncoupled reaction lysates.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
64%
9. Work plan for upcoming month
Comparatively evaluate IVT constructs in several reaction mixes. Select the optimal construct and
IVT reactions based on ease of purification, yield and specificity of products and robustness of
the protocol.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 33
Milestone description: Microarrays constructed and confirmed; First printing of arrays,
Testing with DNA from Ft, Arrays GDPs validated at ASU
Institution: ASU-Johnston
1. Date started: 08-01-2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions

Images below are from the spotting test arrays comparing Alexa 647-labeled RNA from LVS
and Alexa 555-labeled RNA from Schu S4 strains of Francisella. The samples were dyeswapped and run on replicate arrays. For Alexa 647-labeled RNA the signal to noise ratio
average 7.2, but was 9.3 for Alexa 555-labeled RNA with background intensities < 1200 and
< 950 for Alexa 647, and Alexa 555, respectively. Using the Alexa 555-label results, the
comparison between spotting buffers showed a greater dynamic range of signal intensities of
ribosomal genes up to 65,000 for commercial spotting buffer while the SSC buffer maxima
13 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
were approximately 32,000 to 40,000. Data is located at
R:\GeneVac\FTU\Contract\Microarray\Milestones\33\FTU_Spotting_Test
LVS-(Alexa 647)



Schu S4 (Alexa 555)
Composite
One production run completed with on the full production of the arrays with 18 poly-L-Lysine
and 10 Corning ultragaps substrates.
Obtained application for TIGR Tularemia arrays from Pathogen Functional Genomics
Resource Center (PFGRC).
Obtained genomic sequence LVS strain and performed bioinformatic alignment of current
microarray probes based on the SCHU S4 genomic sequence and LVS genes (see Table 1).
Initial analyses show that after finding unique genes and cross-aligning the unique LVS and
unique SCHU4 sequences, 135 LVS genes would not be detected with the current probe set.
Of the remaining genes, up to 216 would have at least one nucleotide misaligned with the
current probed set. Thus, there may be up to 350 additional probes needed to cover gene
expression by both strains.
Table 1 Sequence comparison of SCHU4 to LVS
Genes
Protein coding genes
Structural RNA
Microarray probes designed
LVS genes missing/misaligned by >1 nucleotide
SCHU4
1852
1603
48
1804
LVS
2019
1754
52
~350
4. Significant decisions made or pending


Finalize substrate comparisons for next slide production run.
Determine the need to add probes for LVS genes not identified using the current design?
5. Problems or concerns and strategies to address
None
14 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
35%
9. Work plan for upcoming month
 Continue testing PLL coated slides versus Corning UltraGAPS slides, as the UltraGAPS are
much more expensive than the in house PLL coated slides
Will start with GDPs with purified RNA first
Submit TIGR Tularemia microarray application to PFGRC.


10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 40
Milestone description: Phenotyping of Ft novicida mutants; Measure degree of attenuation of
uvr mutants in macrophages and in mice
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
1) We previously demonstrated that the uvrB and uvrA single mutants (provided by Dr. Klose
at UTSA) had no detectable growth defect in Chamberlain’s medium or in J774 macrophages.
Here we report that the uvrAB double mutant has no growth defect in Chamberlain’s medium or
in J774 macrophages. The data confirm our earlier finding that the deletion of either the uvrA or
the uvrB gene does not render the bacteria more sensitive to macrophage-mediated killing, and
suggest that the nucleotide excision repair (NER) pathway is not required for replication in
macrophages.
Ft novicida Intracellular Growth in J774 Cells
Ft novicida Growth in Chamberlain's Media
1.E+10
10
1.E+09
1.E+08
OD600
1
U112
cfu/ml
1.E+07
uvrAB
1.E+06
0.1
1.E+05
1.E+04
0.01
0
5
10
15
Time (h)
20
25
30
1.E+03
0
10
20
Time (h)
30
NB920-p121-122
15 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
2) We next wanted to determine whether the nucleotide excision repair mutants were attenuated
for virulence in mice. Since mice are exquisitely sensitive to Ft novicida infection when
challenged by the intraperitoneal (IP) route, we determined the median lethal dose of U112,
uvrA, uvrB, and uvrA uvrB strains in Balb/c mice delivered IP. Five 5-fold serial dilutions of
seed stocks were prepared with calculated doses expected to be from 50 to 0.08 cfu/ml and
100µl was administered into the peritoneal cavity. CFU were determined empirically by plating
100µl of the first and second serial dilutions on CHAH plates. The median lethal dose was then
calculated based on the actual cfu enumerated. For U112, uvrA, and uvrB strains the LD50
was less than 1 CFU and for the uvrAuvrB double mutant the LD50 was calculated to be 2.7
cfu. Because it is difficult to ensure that any given animal was actually injected with an organism
when the concentration of bacteria is so low, it does not appear that that there are any significant
differences in the median lethal dose of the strains. Furthermore, all animal deaths were reported
within 3 or 4 days after injection of each strain, suggesting that the pathogenic capacity of each
mutant is the same in vivo. To verify that there is no significant difference in the LD50 of the
uvrAuvrB double mutant, the experiment will be repeated with this strain and compared to
U112.
Calculated LD50 (CFU)
U112
0.57
uvrA
0.82
uvrB
0.2
uvrAuvrB
2.72
AS06-090
4. Significant decisions made or pending
We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with
Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of Ft novicida.
5. Problems or concerns and strategies to address
Abrogation of the nucleotide excision repair pathway through uvrA and/or uvrB deletions
does not result in an intramacrophage growth defect or a significant loss in virulence. This
suggests that a secondary attenuating mutation will be required if the SCHU S4 strain were to
be used as the vaccine background. Since LVS is already attenuated in humans, it may not
require a secondary attenuating mutation. We will be screening attenuated Ft novicida
mutants that also have uvr mutations for immunogenicity in milestone 43, with the ultimate
goal of selecting an attenuating mutation to construct in SCHU S4.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
55%
9. Work plan for upcoming month
The ability of each strain to replicate in Balb/c mice will be evaluated by homogenization of livers,
spleens, and lungs and plating on CHAH over a 3-day period after infection. The LD50 of all four
strains following subcutaneous challenge will also be determined. Since this route is the least
permissive, it will allow us to determine whether the nucleotide excision repair machinery plays a
role in dissemination and virulence.
10. Anticipated travel
Dr. Skoble attended the TVDC pre-meeting and the international tularemia conference in Woods
Hole Oct. 30-Nov4.
11. Upcoming Contract Authorization (COA) for subcontractors
None
16 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Milestone 41
Milestone description: Optimization of psoralen treatment and characterization of KBMA F.
novicida; Determine the amount of S-59 and UVA required to inactivate uvr mutants, determine
extent of metabolic activity of uvr mutants after S-59 and UVA inactivation, determine the level
of virulence attenuation of KBMA uvr strains in mice
Institution: Cerus
1. Date started: 3/2/06
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
We previously identified the minimum dose of UVA required to achieve complete
photochemical inactivation was 4 J/cm 2. We found that minimum concentration of S-59
required to inactivate wild type Ft novicida U112 was 20M, which was only slightly higher
than the concentrations required to inactivate Ftn uvrB (5M), Ftn uvrA strain (15µM). We
also found that U112, uvrA, and uvrB strains were all capable of maintaining metabolic
activity for up to 12 hours, while heat killed bacteria were not.
1) This month we characterized the sensitivity of the uvrA uvrB double mutant to
photochemical inactivation and compared it to each of the other Ft novicida strains. Because
the differences between each of the strains was subtle, we increased the sensitivity of
detection by plating 1 ml of inactivated culture on 5 CHAH plates (thereby increasing the LOD
from 10cfu/ml to 1cfu/ml) and by performing the experiments at the same time with the same
reagents.
Two head-to-head experiments were then performed to determine whether the nucleotide
excision repair-deficient strains were more susceptible than the parental U112 strain to
photochemical inactivation. In both experiments the U112 strain was more resistant to S-59
and UVA killing than all of the NER mutants. The data were averaged and are presented
below. In contrast to our previous results, the wild type U112 strain had significant residual
colonies at 20µM S-59. These numbers were near the LOD of the previous method, but are
significant considering the LD50 in mice is less than 1. Each of the nucleotide excision repair
mutants was more sensitive than U112 to S-59 and each showed comparable inactivation
profiles. Complete inactivation was achieved at 20µM, and while this number is higher than
previously reported, the average number of cfu at 10µM and 15µM were below the previous
limits of detection.
Photochemical Inactivation of Ft novicida Strains
1.E+10
1.E+08
cfu/ml
U112
uvrA
1.E+06
uvrB
1.E+04
uvrAuvrB
1.E+02
1.E+00
0
10
20
[S-59] uM
30
40
17 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
NB963-010
Conclusions: These data suggest that the nucleotide excision repair mutants are indeed
more sensitive than the parental strain of Ft novicida (albeit modestly), and that the
phenotype of each mutant is identical, therefore there is no advantage of having a double
mutant.
4. Significant decisions made or pending
The minimum S-59 dose required for complete inactivation of U112 is 40 µM, the minimum S-59
concentration required for inactivation of uvrA, uvrB, and uvrA uvrB is 20 µM. The minimum
UVA dose required to achieve complete inactivation is 4 J/Cm 2.
5. Problems or concerns and strategies to address
The 2-fold difference in the concentration of S-59 required for complete inactivation of the
mutants compared to wild type is less than we have observed for other organisms, however
the high degree of metabolic activity retained between all strains tested (U112, urvA, urvB
mutants of Ft novicida) suggests that it is the wild-type that is highly sensitive to
photochemical inactivation and thus the KBMA strategy is still viable.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
35% of scientific work completed on the milestone
9. Work plan for upcoming month
We will compare (in head-to-head experiments) the metabolic activity of the uvrAuvrB
double mutant to the WT, uvrA, and uvrB mutant strains. We will begin to scale up the
inactivation process from 3.5 ml to 400 ml to allow for frozen stocks of KBMA strains to be
prepared. Additionally, we will begin development of a storage formulation for KBMA strains.
10. Anticipated travel
Dr. Skoble attended the TVDC pre-meeting and the international tularemia conference in Woods
Hole Oct. 30-Nov4.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 43
Milestone description: Create uvrA or uvrB mutants in LVS
Institution: UTSA
1 Date started: 5/01/2006
2 Date completed: In progress
3 Work performed and progress including data and preliminary conclusions
a) We have designed primers to insert multiple cloning sites into pDS132:
PDS132R ggatccctgcagacgcgttcgagtctagacatatggatatcagctctcccgggaattc
PDS132Fggatccctgcagtgctaatctgggcccgcggccgcgacgtcgtcgactggaagaagcagaccgctaaca
Unfortunately, it took 3 weeks for us to get one of the primers pDS132F from the
company, which considerably delayed the progress.
b) We have performed PCR with the primers, and tried to identify the new plasmid. But
the restriction enzyme pattern is not what expected.
All the data were documented in page 62-63, TVD UTSA notebook #2.
18 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
4
Significant decisions made or pending
We have to repeat the PCR procedure to make the new plasmid, which is essential for us to
replace the original promoter with GroEL promoter from francisella promoter.
5
Problems or concerns and strategies to address
The PCR will be repeated, and more colonies will be identified to make sure we get the correct
plasmid with replaced multiple cloning site.
6
Deliverables completed
7
Quality of performance
8
Percentage completed
None.
Good
Approximate 42% of scientific work completed on the milestone. There is no change relative to
the 10/7/06 report due to the 3 week delay in the primer receipt.
9
Work plan for upcoming month
a)
b)
c)
d)
e)
Modify the multiple cloning sites of pDS132 to make it suitable to insert the individual fragments;
Replace the promoter of pDS132 controlling SacB expression with GroEL promoter of
Francisella to make sure the SacB will be expressed in LVS strain, which will help to get rid of
plasmid backbone once mating is finished. Also we hope the GroEL promoter will drive the
expression of downstream chloramphenicol resistance gene, which will make it easy to develop
mutants in LVS as we might not to have another antibiotic resistance marker ;
If plasmid from step 9b is correct, UvrBLVSUpSeq and UvrBLVSDnSeq will be put into the new
plasmid;
If the plasmid from step 9c is correct, we can mate with LVS strain to select onto TSA
chloramphenicol plate;
If the mating process does not work, we can put the kanamycin cassette in the middle of the
plasmid from step 9c, and we can mate with LVS strain to select onto TSA kanamycin plate.
10 Anticipated travel
Dr. Klose will travel to Cerus in December 2006 to share knowledge of the genetics of Francisella
with Dr. Justin Skoble’s laboratory
11 Upcoming Contract Authorization (COA) for subcontractors
No COA is required for domestic travel between UNM and subcontractors.
Milestone 46
Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale
Francisella tularensis culture conditions, Establish 3L culture scale purification conditions,
Optimize 3L scale photochemical inactivation process, Verify protective immunogenicity of
vaccine candidates produced by optimized large-scale process
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
We have demonstrated previously that LVS grows robustly in Chamberlain’s defined medium
(CDM) and have prepared a working cell bank of DVC lot# 16 LVS cultures grown in CDM for
36 hours, harvested at an OD of 1.0 and stored at –80oC. We have determined that the
minimum concentration of S-59 required for complete inactivation of DVC LVS is 5µM. We
have determined that S-59 and UVA photochemically inactivated LVS maintain metabolic
activity for at least 12 hours. The sensitivity of the uvr mutants of LVS will be determined
when the mutants are constructed by UTSA.
19 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
1) While LVS grows robustly in CDM in shaker flasks, we were unable to achieve growth of
LVS in our fermentor. We have recently established that the main factor responsible for this
lack of growth is the use of Sigma antifoam 204 (a propylene based polyether antifoam) in
our media. During last month’s technical call Rick suggested that we evaluate the anitfoam
used by LBERI for their aerosolization experiments. Barbara notified us that LBERI uses
Sigma antifoam A (which is silicone based) and we were also able to get a sample of
Industrol DF 204 from BASF (proprietary composition) which is the antifoam used by DVC in
their fermentation of LVS (at a concentration of ~0.001%). LVS cultures were diluted into
CDM or CDM containing 0.01% BASF or Sigma antifoam A concentrate and the cultures
were monitored by optical density and for cfu on CHAH. The graphs below demonstrate that
the Sigma antifoam A concentrate has no effect on the growth of LVS whereas the BASF
antifoam has a marked inhibitory effect on the ability of LVS to grow.
NB 948-112: Effect of 0.01% antifoam (SIGMA A Concentrate vs. BASF
INDUSTROL DF 204) on DVC F. tularensis holarctica LVS growth curve
10.0
OD (600nm) Arm-1 (BASF)
OD (600nm) Arm-2 (SIGMA A Concentrate)
OD (600nm)
OD (600nm) Arm-3 (Control, no antifoam)
1.0
0.1
0
1
2
3
Time, hrs
4
5
6
NB 948-112: Effect of 0.01% antifoam (SIGMA A Concentrate vs. BASF
INDUSTROL DF 204) on DVC F. tularensis holarctica LVS growth curve
1.E+10
cfu/mL Arm-1 (BASF)
cfu/mL
cfu/mL Arm-2 (SIGMA A Concentrate)
cfu/mL Arm-3 (Control)
1.E+09
1.E+08
0
1
2
3
Time, hrs
4
5
6
NB948-112
4. Significant decisions made or pending
We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with
Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of LVS. We have
determined the minimum concentration of S-59 psoralen required for complete inactivation of
DVC LVS is 5µM. We have switched to using Sigma Antifoam A concentrate as our antifoam
agent for large-scale propagation of LVS.
20 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
17% of scientific work completed on the milestone
9. Work plan for upcoming month
We will modify the large-scale propagation procedure to include no more than 0.01% Sigma
antifoam A in the protocol. We will perform a fermentor run with DVC Lot16 LVS and monitor
the pH, dissolved oxygen concentration, and optical density of the bacteria and determine the
number of colony forming units at various time points. The cultures will be suspended in
various cryopreservation agents and the viability and stability of each will be evaluated. We
will determine the LD50 of LVS in Balb/c mice by the SC and IP routes of administration and
compare the virulence of the frozen product to LVS directly form the lyophilized vial .
10. Anticipated travel
Dr. Skoble attended the TVDC pre-meeting and the international tularemia conference in Woods
Hole Oct. 30-Nov .4.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 48
Milestone description: Characterize the uvrA or uvrB mutants in Ft subsp. novicida for
intramacrophage growth/virulence.
Institution: UTSA
1. Date started: 9/01/2006
2. Date completed: 10/29/06
3. Work performed and progress including data and preliminary conclusions
a. U112 Francisella novicida, KKF71 (uvrB), KKF72 (uvrA) and KKF100 (uvrAB) were
grown overnight in TSB + 0.1% cysteine. Overnight cultures were diluted in glycerol and
frozen at –80 degrees Celsius. These frozen stocks were used to infect J774
Macrophages, in triplicate (SOP 50 – intramac#1B2CC1.doc) Bacterial survival was
determined by comparing the plated CFU numbers at 24 hours post infection. The
results are shown in Fig. 1 (saved as uvrAB.jpg). The results indicate that insertions in
uvrA, uvrB and uvrAB do not affect ability of U112 Francisella novicida to survive and
grow in macrophages. The data location is Book #1, pages 8-9
21 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
FIG. 1
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
100%
9. Work plan for upcoming month
Since this milestone is listed as 100% completed, work for the next month needs to include
writing the Milestone Completion report. Please see UTSA’s strategic work plan (~7/3/06) for
details on writing the Milestone Completion report. Karl and I discussed receiving the milestone
completion reports on December 1, for the currently completed milestones.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
22 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
I. Cloning of igLC:
I.
The iglC deletion generated from the new oligos was used in ligation reaction
with the new vector pDS132 as described in last month’s report. This ligation
was used in transformation reaction with SM10λpir cells and we did not get very
many colonies with two attempts.
II.
The resulting clones here were screen and found to be only plasmid without the
insert (iglC deletion).
III.
We decided to generate another primer for the up oligo; the only difference is that
the restriction site will be Sal I instead of SphI. Therefore, we will cut only with
one enzyme with both the plasmid (pDS132) and the PCR product.
i. iglC schu4 deletion up Sal I
5´ -gcg gcg gtc gac gaa gaa tct cca cca gaa gc- 3´
IV.
We were able to generate another iglC deletion PCR product with the KEK906
plasmid as the template in the reaction (Figure 1).
Figure 1.
This represents the PCR products generated using the HiFi KOD DNA Polymerase enzyme
with the KEK906 plasmid as the template and the iglC schu4 deletion down Sal I and iglC
schu4 deletion up Sal I (new oligo) primers. Lanes 2, 3 and 4 are identical individual
reactions run at the same time.
23 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
V.
II.
Data located in TVD UTSA Notebook 3, page 28-30
Experiments to generate deletions in Schu4:
a. Ligations were set with plasmids KEK1023, 1025, 964 and 965 which were
cut with BamHI then alkaline phosphatase treated and gel purified. These
plasmids were used with the new PCR product SacB which was cut with Bgl
II and BamHI.
i.
KEK1023 is the pUC118 with MglA deletion construct containing the
Francisella (Fn) promoter driving the Kan gene expression.
ii.
KEK 1024 is also pUC118 with MglA deletion construct containing
the Fn promoter driving the Erythromycin gene expression.
iii.
KEK964 and KEK965 is the pUC118 vector containing only the Fn
promoter driving the Kan gene expression. The difference between
these two is the orientation of the promoter and selective gene
relative to the multiple cloning site of pUC118.
b. Transformations were done into DH10B cells (Invitrogen) with the ligation
reactions above. These resulted in high background of religation product. I
have screened only 10 clones from each set of transformants and found only
religation vectors by restriction endonuclease screening. However, there are
several hundred clones for each transformation to continue screening.
c. Since there is a high background of religation vector; I will try screening by
PCR using the SacB oligos mentioned in last month’s report in the II.a.
section. Pools of 10 colonies per set of PCR will be made for each set of
transformation clones. This will be done for coming month report.
d. Ligations were set up with pUC118 and KEK964 XbaI/BamHI digested;
combined with the new SacB PCR product cut with XbaI/BamHI.
e. Transformations were done into DH10B cells and the results also yielded
high religation vector. Ten clones from each transformation were screened
by EcoRI digestions and found all to be the vector. I will set up pools of 10
colonies to run PCR screens to find the correct construct; this will be done for
coming month report.
f. KEK964 was cut with KpnI then T4 DNA Polymerase treated to create a Blunt
end; then subsequently digested with BamHI. KEK 965 was cut with Sal I
then DNA Polymerase I (Large Klenow Fragment) treated to create blunt end;
then subsequently digested with BamHI.
g. The prepared KEK964 and 965 vectors were used in ligation reactions with
the new PCR SacB product that was cut with BamHI only. These were then
used to transform DH10B cells and the result was a lawn of cells. The
isolated colonies that I was able to pick were screened by restriction digestion
and found to be religation (less than 10 from each transformation was done).
Will redo this transformation and make serial dilutions to generate a better
separation of clones; in addition, will use PCR screening with SacB oligos
since here to the religation reaction did yield almost a lawn of colonies. This
is in progress and will continue to report on in the coming month.
h. Data located in TVD UTSA Notebook 3, page 41-45.
i. Placed order for supplies.
24 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
The high background in these transformation reactions is not uncommon and I believe
we can overcome this by using the PCR screen to find the correct construct. This
background is due to partial digestion or action of a particular enzyme; or the fact that
blunt end ligations make it more difficult to get the desired gene into the vector but it is
not impossible.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
27%
9. Work plan for upcoming month
a. Will phenol:Chloroform extract the new iglC product produced in I.d. then ethanol
precipitate this DNA and start the Sal I digestion of the product to prepare for
cloning into the pDS132 plasmid.
b. The pDS132 plasmid will also be digested with Sal I enzyme; and both plasmid
and PCR product will be gel extracted using the previously described Qiagen Kit.
The ligation reactions will be done and then subsequently used to transform
SM10λpir cells.
c. The resulting transformants above will be screened by restriction endonuclease
digestions.
d. If we get the correct construct of pDS132 containing the iglC deletion we will then
clone just upstream of this gene the Fn promoter driving the Kan gene.
e. Will continue with the screen of the various constructs to achieve the SacB gene
into a vector. This will be done by PCR with the SacB oligos.
f. Will need to prepare more competent cells for future transformations.
g. Will set up new transformations of the pKEK964 and pKEK965 ligations
mentioned in II. g. section above with the new competent cells. Will prepare
serial dilutions of the transformation and plate on selective plates to generate
single colonies. And the correct construct will be screened by PCR using the
SacB oligos
h. The confirmation of the correct constructs will be done by restriction
endonuclease digestions and sequencing
i. Order more supplies as needed
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
25 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS
uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD,
iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA,
iglB strains
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
a. Determine the LD50 of Ft subsp. novicida uvrAuvrB double mutant (Note book #4 page
44-46): LD50 of uvrAuvrB in the intranasal infection model (BALB/c mice) is calculated to
be less than 10 CFU (Fig.1). The LD50 of the parental strain of Ft novicida has previously
determined to be less than 10 CFU in the same i.n. infection model. The virulence of
uvrAuvrB is not significantly reduced.
Measure intramacrophage (J774) survival of uvrAuvrB (Note book #4 page 47-49): This was performed
to confirm the in vivo infection results seen with this mutation. Results are reported in Milestone #48 .
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
26 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2006 to 10/31/2006
Due Date: 11/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Justin
Skoble, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder,
Karl Klose, Bernard Arulanandam
7. Quality of performance
Good
8. Percentage completed
20% of scientific work completed on the milestone
9. Work plan for upcoming month
a. Monitor Ft subsp. novicida uvrAuvrB double mutant replication and dissemination in mice.
b. Further characterization of the Ft novicida Δiglc mutant. Prior to the TVDC, we
demonstrated that vaccination with the iglc mutant of F. novicida protects mice from
subsequent challenge with wild-type F. novicida strain. We will determine the efficacy of
Ft novicida Δiglc vaccination + LVS LPS in protection against Schu S4 intranasal
challenge.
10. Anticipated Travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
27 of 27