Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 1 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 1. Introduction Francisella tularensis (FTU) is an intracellular pathogen that can be posed as a bioterrorism agent. The search for a vaccine against the pathogen is still under research investigation since its intracellular lifestyle and the mechanism of virulence are not well understood. Although a live attenuated vaccine (LVS; “live vaccine strain”) has been developed and used for years in the USA at USAMRIID, it does not provide a strong protection against respiratory related symptoms in humans. The high throughput protein production system developed here using by in vitro translation can provides a complete proteome of the pathogen which can be used for immunome mapping and identifying specific antigen selections for testing in protection assays. Unlike LVS, these candidates would be well defined formulations. 2. Purpose The purpose of this SOP is to describe generation of open reading frame (ORF) expression library, construction of the proteomic library and arrangement of synthetically produced protein fragments into pools for T-cell stimulation assays. 3. Responsibility This SOP will be performed by a laboratory technician and the results will be reviewed by a principal investigator. 4. Scope This protocol can be used for generation of a proteomic library of 2,229 protein fragments which can be used for antigen screening and vaccine development. This SOP may be used in the laboratory (room B229) of Dr. Kathryn Sykes, a principal investigator at the ASU Biodesign Institute. 5. Precautions General lab safety such as laboratory attire (lab coats, gloves, eye goggles etc.) and regulations should be reinforced at all time. In vitro translation procedure involves using 35S radioactive material. Personal need to be properly trained in handling radioactive material by certified radiation safety officer. 6. Materials 6.1. Building ORF Expression Library 6.1.1. Supplies Linear Prokaryotic Promoter and Terminator with universal adapters Primers: o Gene specific primers with universal adapters, o Universal Adapter Forward primer (5-Univ-F): ATAGGCGGAAGCGGATTG o T7 Thio Forward promoter primer (T7-Thio-F) GCGAAATTAATACGACTCACTATAGGG 1 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 2 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Author: Kathryn Sykes Kathryn Sykes ASU PI: Kathryn Sykes Date: 3/4/09 o T7 Thio Promoter Reverse primer (Thio-R): CAATCCGCTTCCGCCTATGGCCAGGTTAGCGTCGAGG o T7-Term-His-Univ-F ACCCAACCTCCCTCCCACCATCATCATCATCATTAATAAAAGGGCG o T7 Reverse Terminator primer (T7-Term-R) : ATCCGGATATAGTTCCTCCTTTCAG iProof HighFidelity DNA Polymerase (Bio-Rad 1725302) DyNazyme II polymerase (Finnzymes F-50BL) pEXP5-NT expression vector (Invitrogen, V960-05), pET32b vector (Novagen, 69016-3) FTU wild type genomic DNA (SCHU S4 DNA from UNM) o SCHU S4 Submaster Project 110419.2 (March 9, 2006 from Fisher Biosciences) SCHU S4 Sublot#1 was received at UNM March 9, 2006. Per Dynport Vaccine Company, SCHU S4 Sublot#1 (NOV 05 to FEB 06, Midwest Research Institute) to Fisher Per Dynport Vaccine Company, SCHU S4 parent strain originated from the Salk Institute in Swiftwater, PA, Lot 623-42 (6SEP86) Per Dynport Vaccine Company, The Salk Institute received the seed stock from Fort Detrick, MD. QIAquick Gel extraction kit (Qiagen 28704) PCR Plate (Eppendorf Twin.tec PCR Plate 96, skirted 951020486) 96-well agarose electrophoresis gel, (Invitrogen E-gel 2% Agarose, cat# G7008-02) E-gel Low Range DNA Ladder (Invitrogen, 12373-031) PureLink 96 PCR Purification Kit (Invitrogen K3 100-96) UV Half Area Plate 96 Well (Corning 3679) dNTP Mix (Promega U1515) Agarose (RPI Research Products International Corporation, cat # A20090-500.0) 100 bp DNA ladder (New England Biolabs N3231L) Molecular grade water(Gibco, cat# 10977-015) 6.1.2. Equipment Biomek® FX Laboratory Automation Workstation (Beckman Coulter) PCR machine: Mastercycler epGradient S (Eppendorf ) NanoDrop (Thermo Fisher Scientific, ND-100) 200ul12-channel pipette (Rainin, Cat# L12-200) 2 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 3 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Author: Kathryn Sykes Kathryn Sykes ASU PI: Kathryn Sykes Date: 3/4/09 20μl 12-channel pipette (Rainin, L12-20) Power supply for running E-Gel, E-base (Invitrogen, cat# EB-M03) Software for editing E-gel image, E-editor (Invitrogen) Molecular Imager ChemiDoc XRS System (Bio-Rad 170-8070) Plate vacuum manifold (Eppendorf, Perfect Vac Manifold, single Basic, Cat# 0032 007.708) SpectraMax 190 (Molecular Devices) Softmaxpro V5 program to operate the SpectraMax 190 instrument SpeedVac Concentrator ( Thermo Electron Corporation ISS 110) 6.2. aTrx Antibody Magnetic Bead Preparation: 6.2.1. Supplies 15-mL presterilised centrifuge tubes (VWR cat# 89004-368) Mouse Anti Trx-Tag Monoclonal Antibody. (Genescript Corp. Cat# A00180) Dynal beads M-280 Tosylactivated. (Magnetic beads) (Invitrogen Cat# 142.04) Boric Acid (H3BO3) (Fisher Chemicals Cat# A78-500) Ammonium Sulfate (NH4)2SO4 (JT Baker Cat# 0792-05) Phosphate Buffer Saline (PBS) 1x Sterile 1L (Cellegro, cat# 21-040-CM) Bovine Serum Albumin (BSA) Fraction V (Sigma cat# A7906-500G) Buffer A: 1M Boric Acid ( Fisher Chemicals cat#A78-500), 3M Ammonium Sulfate pH 9.5 (JT Baker cat#0792-05) Buffer B: 1X PBS pH 7.4 (Cellegro, cat#21-040), 0.5% BSA(Sigma cat#A7906500G) (w/v) Buffer C: 1X PBS pH 7.4 (Cellegro, cat#21-040),, 0.1% BSA (Sigma cat#A7906500G) (w/v) 6.2.2. Equipment: Thermomixer R Eppendorf (cat#022670107) Plate Magnet: Promega Magna Blot 96 Magnetic Separation Device (Promega, cat # V8151) 15ml Dynal MPC-6 magnetic separator, (Invitrogen, cat# 120-02D) 200ul 12-channel pipette (Rainin, L12-200 ) 6.3. High throughput In vitro Translation 6.3.1. Supplies: PURExpress In Vitro Protein Synthesis Kit (New England Biolabs Cat# E6800S) 3 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 4 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 EasyTag™ L-[35S]-Methionine, 5mCi (185MBq), Stabilized Aqueous Solution, Shipped in Lead (PerkinElmer Life and Analytical Sciences, NEG709A005MC) FTU LEE from LEE construction step 7. 1.2ml square-well deep-well 96well plates (ABgene AB-1127) 96-well square-well plate mats (ABgene AB-0675) Repeater Pipette Tips (Eppendorf Combitips Plus Cat# 022266403 ) TCA assay plates: Multiscreen HTS, FC (Millipore Cat# MSFCN6B50) 6.3.2. Equipment Repeater pipette ( Eppendorf Combitips Plus Cat# 022266403) 200ul 12-channel pipette (Rainin, L12-200) 20μl 12-channel pipette (Rainin, L12-20) Plate vacuum manifold (Eppendorf, Perfect Vac Manifold, single Basic, Cat# 0032 007.708) Tri-Carb 2900TR liquid scintillation counter (PerkinElmer A290000) Gel box (Criterion dodeca cell Bio-Rad) Gel Dryer (Bio-Rad Model 583) Storage Phosphor Screen (Amersham Biosciences) Typhoon TRIO+ variable mode imager (Amersham Biosciences) Gene Machines HiGro Orbital Incubator 6.4. Array protein fragments into pools 6.4.1. Supplies Phosphate Buffer Saline (PBS) 1x Sterile 1L Cellegro, cat# 21-040-CM 1.2ml square-well deep-well 96well plates (ABgene AB-1127) 96-well square-well plate mats (ABgene AB-0675) 6.4.2. Equipments 200ul 12-channel pipette(Rainin, L12-200) Eppendorf MixMate® (cat# 2008-08-20) 6.5. Quality control: 6.5.1. Supplies TCA Assay Plates (Millipore, Multiscreen HTS, FC cat# MSFCN6B50) Glass Rod 10% TCA (VWR cat#VW3372-2) 95% Ethanol 4 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 5 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Author: Kathryn Sykes Kathryn Sykes ASU PI: Kathryn Sykes Date: 3/4/09 6ml Scintillation Vial (Research Products International Corp. #125514) Scintillation Fluid (Ultima Gold PerkinElmer) 4X gel loading buffer (Bio-Rad cat#161-0791) 10X gel loading reducing agent (Bio-Rad cat#161-0792) 26-well Criterion XT Bis-Tris Gel, 4-12%, 1mm (Bio-Rad cat#345-0125) Precision Plus protein Kaleidoscope molecular marker (Bio-Rad cat#161-0375) Gel running buffer (Criterion XT, MES Bio-Rad cat#161-0789) Gel fixation solution (40% methanol, 10% acetic acid) Storage Phosphor Screen (Amersham Biosciences) 6.5.2. Equipment: Repeater pipette (, Eppendorf Combitips Plus Cat#022266403 ) Gene Machines HiGro Orbital Incubator 20μl 12-channel pipette (Rainin, L12-20) 200μl 12-channel pipette (Rainin, L12-200) Plate vacuum manifold (Eppendorf, Perfect Vac Manifold, single Basic, Cat# 0032 007.708) Tri-Carb 2900TR liquid scintillation counter (PerkinElmer A290000) Gel box (Criterion dodeca cell Bio-Rad) Gel Dryer (Bio-Rad Model 583) Typhoon TRIO+ variable mode imager (Amersham Biosciences) 7. Procedures 7.1. LEE Construction 7.1.1. Promoter and Terminator with N-Terminal Thioredoxin fusion and C-terminal His tag preparation (prepare in bulk the Promoter and Terminator sufficient for the entire set of 2,229 ORFs). 7.1.1.1. PCR Amplification of Promoter is from pET32b vector which contains Thioredoxin (Trx) at the N-terminus. PCR amplification of the Terminator is from pEXP5-NT vector. The forward primer contains the His-tag sequence. PCR conditions for amplifying the promoter and terminator are same.(See Table 1 for the PCR conditions) The primers for each are as follows: PCR Primers for Promoter : o Forward Primer = T7-Thio-F (GCGAAATTAATACGACTCACTATAGGG) 5 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 6 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Author: Kathryn Sykes Kathryn Sykes ASU PI: Kathryn Sykes Date: 3/4/09 o Reverse Primer = Thio-R (CAATCCGCTTCCGCCTATGGCCAGGTTAGCGTCGAGG) PCR Primers for Terminator: o Forward Primer= T7-Term-His-Univ-F (ACCCAACCTCCCTCCCACCATCATCATCATCATTAATAAAAGG GCG) o Reverse Primer= T7-Term-R (ATCCGGATATAGTTCCTCCTTTCAG) 7.1.1.2.The PCR conditions are as follows: Table 1. Elaboration of ORF PCR conditions 1 2 3 4 5 6 7 PCR Master Mix H2O iproof 5x dNTP (10 mM) F Prim (10uM) R Prim (10uM) Templ (5 ng/μl) Iproof Poly Total No. of Rxn 1X (µL) MM1 (µL) 36.5 10 1 0.5 0.5 1 0.5 3854.4 1056 105.6 52.8 52.8 105.6 52.8 50 1 5280 96 PCR Cycler Protocol Temp (OC) Time (Min) Step 1 Step 2 Step 3 Step 4 Step 5 Step 6 98 2 98 0.75 50 0.5 72 1 34X Goto step 2 72 5 Step 7 4 Hold 7.1.1.3. Run the entire reaction on 1.2% agarose gel with Ethidium bromide at 200V for 30 minutes in 1/2X TBE buffer ( 0.05M Tris, 0.05M Boric acid, 1mM EDTA) 7.1.1.4. Image the gel on Chemidoc imager. 7.1.1.5. Cut the appropriate size band from the gel using a new razor blade which is clean but not sterilized. 7.1.1.6. Weigh the gel slice on a balance in a pre-scaled 15 ml conical tube approximated of 7.065 gram. 7.1.1.7. Follow the Qiagen gel purification kit protocol for purifying the Promoter. 7.1.1.8. Quantitate the yield by Nanodrop using absorbance at 260nm. (See calculations section 10) 7.1.1.9. Dilute to 0.05ng/μl, aliquot 105μl to 0.5 polypropylene micro centrifuge tube, and store at -20°C. 7.1.2. Overlap PCR 7.1.2.1. Note: The master mix and the PCR conditions are listed in the table 2 and 3 6 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 7 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 7.1.2.2. Schu 4 Wild type DNA provided by the University of New Mexico is diluted to 5ng/uL and used for ORF amplifications 7.1.2.3. Mix the gene specific forward and reverse FTU primers for the individual ORFs in individual wells of a 384-well plate and dilute to 0.8μM primer mix concentration using the FX Robot. The total volume in each well is 75uL.These plates are labeled as “FTU R1 IVT 384 PrimerMix Rearray Short 1, 10/9/2007 0.8uM 75uL” 7.1.2.4. Transfer 12.5μl of each gene specific PCR primer mix prepared from step 7.1.2.3 to 96-well PCR plate using robot. 7.1.2.5. Into each well of the 96-well PCR plate containing PCR primer mixes, add 12.5μl of wild type PCR master mix prepared as shown in table 2. 7.1.2.6. Carry out the “wild type” PCR in Eppendorf PCR machine according to conditions in the table 3. This plate is labeled as “FTU R1 PrimerMix Rearray Long ORF 1 WT 09/04/08” 7.1.2.7. Add 5μl of the wild type PCR product from step 7.1.2.6 to another 96-well PCR plate using robot, then add 20μl of the master mix for Overlap step 1 (as shown in table 2) for each reaction in the plate with the repeater pipette. 7.1.2.8. Carry out the second PCR (“Overlap PCR Step 1”) in Eppendorf PCR machine according to overlap PCR conditions as shown in the table 3. 7.1.2.9. Add 5μl of the Overlap PCR step 1 product from step 7.1.2.8 to another 96 well PCR plate using robot, and then add 20μl of master mix for overlap PCR step 2 prepared as shown in table 2 with the repeater pipette. 7.1.2.10. Carry out the third PCR (“Overlap PCR Step 2”) in Eppendorf PCR machine according to conditions in the table 3. 7.1.2.11. Add 5ul of the Overlap PCR step 2 product from step 7.1.2.10 to another 96 well PCR plate using robot, and then add 95μl of the master mix for overlap PCR amplification prepared as shown in table 2 with the repeater pipette. 7.1.2.12. Carryout the fourth PCR (“LEE amplification”) in Eppendorf PCR machine according to conditions shown in the table below: 7.1.3. LEE construction Quality Control 7.1.3.1. Run10 μl of the PCR reaction from step 7.1.2.15 on 96 well E-Gel of Invitrogen using the protocol specified by the company. 7.1.3.2. Image the gel on the Chemidoc instrument. 7.1.3.3. Using E-editor software from Invitrogen, the expected size products of LEEs can be detected and analyzed. If the PCR products of LEEs have correct sizes, they will be purified using Invitrogen 96-well PCR purification kit. 7 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 8 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Author: Kathryn Sykes Kathryn Sykes ASU PI: Kathryn Sykes Date: 3/4/09 7.1.3.4. Store the images in the database (R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU proteomic library\E-gel). Table 2. ORF PCR 1 2 3 4 5 6 H2O iproof 5x buffer dNTP (10 mM) Sp F + R Primer Mix (0.8uM) Wt DNA iProof Pol (2U/uL) Total No. of Rxn Overlap PCR step 1 1 2 3 4 5 6 7 8 H2O iproof 5x dNTP (10 mM) Univ F Primer(10uM) T7 Term R Primer (10uM) Terminator (0.05ng/ul) ORF (Wt PCR) iProof Polymerase (2U/uL) Total No. of Rxn Overlap PCR step 2 1X HTP MM1 4.25 1481.6 5 1743.0 0.5 174.3 12.5 4357.5 2.5 871.5 0.25 87.2 25 8715.0 1 332.0 1X HTP MM1 12.75 4444.7 5 1743.0 0.5 174.3 0.25 87.2 0.25 87.2 1 348.6 5 1743.0 0.25 87.2 25 8715.0 1 332.0 1 2 3 4 5 7 8 10 H2O iproof 5x dNTP (10 mM) T7-Thio-F Prim (10uM) T7 Terminator R Primer (10uM) Promoter (0.05ng/ul) ORF + Term PCR iProof Polymerase (2U/uL) Total No. of Rxn LEE Production 1 2 3 4 5 6 7 H2O Dnazyme 10x dNTP (10 mM) T7-Thio-F Primer (10uM) T7 Terminator R Primer (10uM) Template (5ng/ul) Dynazyme Polymerase (2U/uL) Total No. of Rxn 1X HTP MM1 12.75 4444.7 5 1743.0 0.5 174.3 0.25 87.2 0.25 87.2 1 348.6 5 1743.0 0.25 87.2 25 8715.0 1 332.0 1X 80 10 2 1 1 5 1 100 1 HTP MM1 27091.2 3386.4 677.3 338.6 338.6 1693.2 338.6 33864.0 332.0 Thus ASU used 2.5uL at 5.0ng/uL FTU genomic DNA concentration in each ORF PCR 8 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 9 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Author: Kathryn Sykes Kathryn Sykes ASU PI: Kathryn Sykes Date: 3/4/09 Table 3: Thermal cycler programs set up for ORF, Overlap 1 and Overlap 2, and LEE generation PCR reactions ORF PCR Temp Time (OC) (sec) Overlap PCRs Temp Time (OC) (sec) LEE generation PCR Temp (OC) Time (sec) 1 98 30 98 120 98 120 2 98 10 98 45 98 45 3 50 30 55 30 55 30 4 72 15 72 60 72 60 5 4X Goto step 2 19X Goto step 2 14X Goto step 2 6 98 10 72 300 72 300 7 62 30 4 Hold 4 Hold 8 72 15 9 19X Goto step 6 10 72 60 11 4 Hold 7.1.4. PCR Cleanup 7.1.4.1. Remove residual excess primers and dNTPs in the overlap PCR amplification reaction from step 7.1.2.15 using the PureLink 96 PCR Purification Kit, according to the specifications of the company. 7.1.4.2. Elute overlap PCR product with 100ul of Molecular grade RNase and DNase free water, directly into the half volume Corning UV plate. This should yield 83-85ul of final purified PCR products. 7.1.5. DNA Quantification 7.1.5.1. The half volume Corning UV plate can be used for the spectrophotometer (SpectraMax 190). 83-85ul is sufficient volume to get good absorbance. It is necessary for the spectrophotometer to have at least 50ul of volume for reliable reading. 7.1.5.2. Softmaxpro V5 is used as the program to operate the SpectraMax 190 instrument. Specifically, to collect the data and calculate the yield, preset protocol of DNA RNA & PathCheck is used with the following alterations. 7.1.5.2.1. Under Plate then under Setting and then under Pathcheck- unselect the plate background constants. 9 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 10 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 7.1.5.2.2. Under the Plate then under the Template: Assign cells H10, H11 and H12 as blank (83ul water is used as blank in these 3 wells). Assign the rest as Group 01 unknowns. 7.1.5.2.3. Under the Samples7.1.5.2.3.1. Assign the Concentration Factor as 38.1 7.1.5.2.3.2. Create a new column with heading total μg DNA, and the formula is “Conc*83” 7.1.5.2.4. A template of the protocol with the alterations can be made for ease of use. 7.1.5.3. The Softmaxpro can generate a text file for the table of calculations. 7.1.5.4. Ensure that all of the samples have DNA amount of at least 0.5μg. If the amount of any of the samples is lower, repeat the amplification reaction in step 7.1.2.15 and carry out individually PCR clean up as in step 7.1.4. 7.1.6. DNA Preparation for IVT 7.1.6.1. Transfer 250ng of each DNA template into an individual well of the Thermo Scientific 1.2 ml 96 Deep-well plates. 7.1.6.2. Evaporate the liquid completely using speed vacuum. Plates can be stored at -20oC and each should be used as soon as possible. The maximum storage time at 20oC has not been determined. 7.2. aTrx-Tag Magnetic Beads generation: 7.2.1. Buffers 7.2.1.1. Buffer A: dissolve 6.18g Boric Acid (H3BO3), 31.71g Ammonium Sulfate (NH4)2SO4 in 95 ml of ultra pure water and adjust the pH to 9.5 with NaOH tablets, bring the final volume to 100ml with ultra pure water. 7.2.1.2.Buffer B: Dissolve 0.5g of BSA fraction V, in 100ml of 1X PBS. 7.2.1.3.Buffer C: Dissolve 0.1g of BSA fraction V, in 100ml of 1X PBS. 7.2.2. Bead Preparation. 7.2.2.1.Use the ratio of 25ul beads per reaction to calculate the amount of beads to be prepared. (Following example will be for 100 reactions) 7.2.2.2.The beads settle fast in less than a minute therefore it is very important to mix the magnetic beads stock very thoroughly by pipetting up and down. After mixing, immediately pipette appropriate amount of beads into low protein binding 15ml tube. (2.5ml of beads for 100rxn) 7.2.2.3.Place the tube on the magnet for 2 min. 10 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 11 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 7.2.2.4.The magnetic beads should have travelled to the wall adjacent to the magnet and stay there. If the solution seems cloudy and still has beads floating, wait for a minute so the liquid becomes clear. Pipette the liquid out and discard it. 7.2.2.5.Quickly add the same volume of 0.5X Buffer A. (2.5ml for 100rxn) within a minute 7.2.2.6.Take the tube out of the magnet. 7.2.2.7.Mix the beads thoroughly to suspend and wash all of the beads. 7.2.2.8.Place the tube on the magnet for 2 min. 7.2.2.9.The magnetic beads should have travelled to the wall adjacent to the magnet and stay there. If the solution seems cloudy and still has beads floating, wait until the liquid clears. Pipette the liquid out and discard it. 7.2.2.10. Repeat steps 7.2.2.5 to 7.2.2.9 7.2.2.11. The beads are now washed and ready for the antibody. Do not wait more than 1 minute before adding the Antibody. 7.2.3. Anti-Trx tag antibody binding to beads. 7.2.3.1. Use the ratio 3ug antibody to 5ul starting volume of beads from Step7.2.2.11. Be sure that the antibody is in buffer that does not contain an amine group. PBS is the tested buffer for this protocol 7.2.3.2.Add an appropriate volume of Anti-Trx-tag antibody to the washed beads from step 7.2.2.11. (Anti-Trx-tag antibody comes in 1ug/ul concentration. For the example, if we used 2.5 ml beads, the volume of anti-thioredoxin antibody is 1.5mL) 7.2.3.3.Immediately add the same volume of Buffer A as the volume of the antibody. (1.5ml above example) 7.2.3.4.Mix well by flicking the tube to resuspend all of the beads. 7.2.3.5.Set the Thermo mixer R to 37 OC, and 1100 rpm 7.2.3.6.Place the suspended beads with antibodies in the incubator and incubate with shaking for 24 hours. 7.2.4. Blocking and preparation of beads for IVT 7.2.4.1.After 24-hour incubation with antibody, the antibody should have bound to the magnetic beads. Place the tube on the magnet and allow the beads to separate for 2min. Be sure the solution has become clear. 7.2.4.2.Remove supernatant with a pipettor 7.2.4.3.Add the same volume of Buffer B (3ml for above example) to the beads and incubate on the Thermo mixer R at 37 OC, and 1100 rpm for 1 hour. 7.2.4.4.Place the tube on magnet and allow the beads to separate for 2min. Be sure the solution is clear. 11 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 12 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 7.2.4.5.Remove supernatant with a pipettor 7.2.4.6.Add the same volume of Buffer C (3ml for above example). Take tube off of the magnet and suspend the beads completely. 7.2.4.7.Place the tube on magnet and allow the beads to separate for 2min. Be sure the solution is clear. 7.2.4.8.Remove supernatant 7.2.4.9.Repeat steps 7.2.4.6 to 7.2.4.8 7.2.4.10. Add the same volume of Buffer C as the original volume of beads taken. (2.5ml for 100rxn) This is critical because originally 2.5mL of beads was used prior to washing, equilibrating, and antibody conjugating, so the final volume of the bead must be the same as its original volume 7.2.4.11. The beads are now ready for the IVT reaction. Store the antiTrx-tag magnetic beads at 4 OC. Use these beads as early as possible. If these beads are to be used after 2 weeks, test their performance before use. Each reaction will get 5ul of beads. 7.3. In vitro Translation 7.3.1. Use the PURExpress In Vitro Protein Synthesis Kit from New England Biolabs for generation of FTU proteins in vitro. The protocol specified by the company is used except antibody conjugated magnetic beads are added to the reaction mixture. 7.3.2. Add 7.0 ul of RNase DNase free molecular grade water to each well in IVT reaction plate and the QC plate containing dried DNA LEE template (produced in step 7.1.6.2 above). 7.3.3. Briefly spin the covered plate in swing bucket centrifuge at 1,500rpm for 2 minutes to bring the water to the bottom of the well. 7.3.4. Allow the DNA to dissolve over night at 4 OC. Once dissolved, use the plate within 24 hours. 7.3.5. IVT Master Mix: Prepare the IVT master mix as follows. 7.3.5.1.Turn on the Gene Machines Higro incubator, and set the temperature to 37 OC 15 minutes to equilibrate the temperature prior to running IVT reactions 7.3.5.2.Add the appropriate volume of beads with anti-Trx antibody prepared in section 7.2. to a 15 mL centrifuge tube. 7.3.5.3.Place the tube on magnet. Allow 2 min for the beads to adhere to the magnet. 7.3.5.4.The magnetic beads should have travelled to the wall adjacent to the magnet and stay there. If the solution seems cloudy and still has beads floating, wait until the liquid clears. Pipette the liquid out and discard it. 7.3.5.5.Add the appropriate amount of Solution A and B to the tube. 12.5ul of Soln A and 5ul of Soln B per reaction. 12 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 13 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 7.3.5.6.Mix well by pipetting up and down gently. Be sure to suspend the antiTrx-tag magnetic beads thoroughly. Do not mix too roughly to avoid foaming. 7.3.5.7.Aliquot out appropriate amount of IVT Master mix for the QC Plate. 17ul per reaction. Each plate will have 12 reactions run as QC. 7.3.5.8.Add 3.3μCi of 35S labeled methionine to the master mix. 1ul per QC reaction. This will be referred to as Hot IVT Master mix. 7.3.5.9.Add 17.5ul of IVT master mix to each well of dissolved DNA template plate. Make sure to keep the antiTrx-tag magnetic beads well suspended while distributing to ensure that each well receives the same amount of beads. 7.3.5.10. Similarly add 18ul of Hot IVT Master mix to the QC plate with dissolved DNA Template. 7.3.5.11. Place the seal matt on the plate and secure it well. 7.3.5.12. Place the IVT reaction plates in the Higro incubator. 7.3.5.13. Shake at 650 rpm for 1 hour at 37OC. 7.3.6. An example of calculation for 1 plate of 84 IVT reactions is given below in Table 4. Here 84 proteins are made in one plate. Another set of FTU LEE and GFP templates are placed into another separate 96-well plate due to radioactive 35S labeled methionine added for TCA counts and PAGE gel for quality control. 13 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 14 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Author: Kathryn Sykes Kathryn Sykes ASU PI: Kathryn Sykes Date: 3/4/09 Table 4. HTP FTU IVT protein production Antibody Calculator Rxns 1 84 1 Magnetic Beads 25 2310 2 aTrx Antibody 15 1386 3 Buffer A 15 1386 0 0 0 0 Plate Preparation Add 7.0 ul of RNase Free H2O to each well to dissolve the DNA template. 1 2 3 IVT set up Master Mix aTrx Beads 25 2310 Remove the supernatant Soln A 12.5 1155 Soln B 5 462 Add 17.5ul of IVT Master Mix to ea well 0 0 0 Hot Master Mix 1 12 0 1 IVT MMX 17 214.2 0 2 35S Met(3.3μC/μL) 1 12.6 0 Add 18ul Hot IVT MMX to ea QC Well Table 4; all volumes are in microliters (ul) 7.4. Anti Trx-tag magnetic beads purification 7.4.1. As the IVT reaction proceeds, the newly synthesized protein gets captured by the aTrxtag beads. 14 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 15 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 7.4.2. Once the IVT reaction has completed the 1 hr incubation, place the 96 well plate on to the plate magnet. 7.4.2.1.Allow the beads to migrate to the magnet for 2min. 7.4.2.2.The magnetic beads should have travelled to the wall adjacent to the magnet and stay there. If the solution seems cloudy and still has beads floating, wait until the liquid clears. 7.4.2.3.Pipette the liquid out and save it in a fresh clean plate. ASU saves the supernatant just in case losses have occurred and can go back to the supernatant to troubleshoot losses, if necessary. 7.4.2.4.Immediately proceed to wash step. Do not allow the beads to dry. 7.4.3. Wash of protein-bound magnetic beads: 7.4.3.1.Add 100ul of PBS, pH 7.4 7.4.3.2.Mix well by pipetting up and down gently to suspend all of the beads. 7.4.3.3.Place the plate on the magnet for 2 min. 7.4.3.4.The magnetic beads should have travelled to the wall adjacent to the magnet and stay there. If the solution seems cloudy and still has beads floating, wait until the liquid clears. Pipette the liquid out and discard it. 7.4.3.5.Repeat steps 7.4.3.1 to 7.4.3.4 two more times. For final storage before shipment, add 100ul of 1X PBS and store at -20oC. 7.5. Array protein fragments into pools for T-cell stimulation assay 7.5.1. There are 28 96-well plates containing bead bound protein fragments prepared from step 7.1-7.3. (28x84=2352 ivt products; 2229 FTU polypeptides for UNM and 123 controls) 7.5.2. Next, these proteins are pooled into groups of 7 protein fragments by column since there are 7 rows per column in a 96-well plate. 7.5.3. IVT proteins bound on the magnetic beads in100 ul of 1X PBS of 96-well plate must be thawed overnight at 4oC if they were previously frozen. 7.5.4. Mix plates well with Eppendorf MixMate® at 900 rpm for 2 minutes. 7.5.5. Immediately using 12-channel pipette transfer half of IVT reaction (50 ul) in row A (12 samples) of the first 96-well plate containing protein fragments bound on magnetic beads into row A of a new 96-well plate column by column accordingly. This new 96-well plate contains IVT protein pools and is called FTU IVT pool 1. 7.5.6. Repeat transferring samples from row B, C, D, E, F, and G into row A of FTU IVT pool plate 1 in the same manner as step 7.5.4. 7.5.7. The total volume of each well in row A of FTU IVT pool plate 1 after pooling all samples from the first 96-well plate, column by column, is 350ul (7 x 50ul/individual IVT). 15 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 16 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 7.5.8. Each row of the FTU IVT pool plate 1 consists of 12 pools (12 columns from a single original plate become row A of FTU IVT pool plate 1) from a single 96-well plate containing IVT proteins bound on magnetic beads. 7.5.9. Store the other half of IVT reactions in the original 96-well plate at -20oC. Each well contains 50ul of IVT reaction resuspended PBS and then frozen. 7.5.10. Continue to transfer samples from the second 96-well plate containing bead bound proteins fragments into row B of FTU IVT pool plate 1 as step 7.5.4-7.5.6. 7.5.11. Similarly fill row C, D, E, F, G, and H of FTU IVT pool plate 1 with 96-well plate #3, 4, 5, 6, 7, and 8 accordingly. 7.5.12. Each FTU IVT pool plate is filled with protein fragment pools from eight of the 96-well plates. 7.5.13. Repeat pooling for the remaining plates into the FTU IVT pool plate 2, FTU IVT pool plate 3, and FTU IVT pool plate 4. 7.5.14. Four FTU IVT pool plates are needed for pooling 2,229 FTU IVT protein fragments from the proteomic library. 7.5.15. Into each well of FTU IVT pool plate 1 add 50ul of 1X PBS so that the total volume is 400uL. Using the volume of 400ul provides a 10% pipetting margin. Mix plate well using Eppendorf MixMate® at 900 rpm for 1 minute. 7.5.16. Transfer 90ul of sample from FTU IVT pool plate 1 after dilution into a daughter 96-well plate; label this plate as FTU IVT pool plate 1-1. 7.5.17. Repeat step 7.5.14 for FTU IVT pool plate 1-2, 1-3, and 1-4. 7.5.18. Repeat step 7.5.13-7.5.15 for FTU IVT pool plate 2, FTU IVT pool plate 3, and FTU IVT pool plate 4. 7.5.19. Store FTU IVT pool plates at -20oC. The FTU IVT pooled plates 1, 2, 3, and 4 are ready for transfer to UNM for usage in cellular assays. 8. Quality control 8.1. Sample preparation: 8.1.1. Follow the bead washing procedure in 7.4.1 to 7.4.3 for the QC plate. This work should be done in designated area for using radioactive material. 8.1.2. Add 20 μl of loading buffer with 5% b-mercaptoethanol final. 8.1.3. Heat the samples at 95OC for 10min. 8.1.4. Mix well by pipetting up and down or on plate shaker. 8.1.5. Place the plate on to the plate magnet. 8.1.6. Allow the beads to migrate to the magnet for 2min. 8.1.7. The protein should have released from the beads and be dissolved into the loading buffer. 16 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 17 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 8.2. TCA Assay: 8.2.1. Spot 5ul of loading buffer directly onto glass fiber filter of TCA Assay plate from each well using multichannel pipette and aerosol barrier tips. Allow to dry. 8.2.2. Place the TCA Assay Plate onto the Eppendorf plate vacuum manifold as directed by the manufacture. 8.2.3. Pipette 200ul of 10% TCA into each well with multi channel pipette, and using aerosol barrier tips. 8.2.4. Incubate for 5min. 8.2.5. Turn the vacuum on and allow all of the TCA volume to slowly pass through the filter. 8.2.6. Turn the vacuum off. 8.2.7. Pipette 200ul of 10% TCA into each well with multi channel pipette, and using aerosol barrier tips. 8.2.8. Turn the vacuum on and allow all of the TCA to slowly pass through the filter. 8.2.9. Turn the vacuum off. 8.2.10. Repeat steps 8.2.7 to 8.2.9 two times. 8.2.11. Pipette 200ul of 95% ethanol into each well with multi channel pipette, and using aerosol barrier tips. 8.2.12. Turn the vacuum on and allow all of the ethanol to slowly pass through the filter. 8.2.13. Turn the vacuum off. 8.2.14. Repeat steps 8.1.11 to 8.1.13 two times. 8.2.15. With the vacuum on, allow the filters to dry for 5min. 8.2.16. Turn the vacuum off. Remove the plate from the manifold. 8.2.17. Taping the plate forcefully on a stack of paper towels having the bottom face down to remove excess liquid from the bottom of the plate. Repeat this as many times as needed to dislodge the excess liquid. Approximately 2 times generally is used. 8.2.18. Place plate back on the vacuum manifold. Turn the vacuum on and allow the filter to dry for 5 min. 8.2.19. Once dry, transfer the Glass filter from plate to scintillation vial as follows. 8.2.20. Hold the plate such that a well is directly above the scintillation vial. 8.2.21. Push the Glass filter through the well from the top with a glass rod directly into a scintillation vial. Be sure that the support membrane below the glass fiber filter is detached from the glass fiber filter. 8.2.22. Repeat 8.1.16 and 8.1.17 for the entire plate. 8.2.23. Place enough scintillation fluid in each scintillation vial with glass filter to complete cover the filter. The filter should be soaked with the scintillation fluid, and become transparent. (Approximate 1ml of Ultima Gold per scintillation vial). 8.2.24. Place the vial into scintillation counter and record CPMs for each sample. 17 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 18 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 8.2.25. Calculate the total ug of protein produced from CPMs using the formula provided in the PURExpress™ In Vitro Protein Synthesis kit user manual P.10. 8.3. Gel Electrophoresis: 8.3.1. Prepare Criterion electrophoresis unit as specified by the company, using 24-well Criterion XT Bis-Tris Gel, 4-12%, 1mm, Gel Electrophoresis Buffer (Criterion XT, MES Bio-Rad) in the Gel Electrophoresis box (Criterion dodeca cell Bio-Rad). 8.3.2. Load the rest of the radioactive quality control samples (approximate 15ul) prepared in step 8.1 into the gel. 8.3.3. Use Precision Plus protein Kaleidoscope as the molecular marker (Bio-Rad) 8.3.4. Run the gel for at 150V for 55 minutes. 8.3.5. Proceed to fix the gel with Gel fixation Solution (40% Methanol, 10% Acetic Acid) for 30 minutes. 8.3.6. Wash the gel with water for 10 minutes after fixing. Repeat twice. 8.3.7. Transfer the gel onto a filter paper. 8.3.8. Dry the gel using Bio-Rad Gel dryer (80OC constant temperature for 20 min for one gel). 8.3.9. Ensure the gel is completely dry. Remove the gel from the dryer. 8.3.10. Spot 0.1ul of radioactive feed buffer mixed with blue loading buffer upon each band of the visible protein marker. Allow to dry. 8.3.11. Ensure the gel is completely dry since any moisture will damage the phosphor screen. Place the dry gel into the phosphor screen cartridge assembly. Allow to expose overnight. 8.3.12. Image the exposed phosphor screen in Typhoon using the phosphor screen setting with minimum resolution of 100μm. 8.3.13. Analyze the gel and compare the sizes of the proteins made with the expected sizes. 9. References: 9.1. The manuals for the equipment are contained in the following server folderR:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU Manuals 9.1.1. HiGro 9.1.2. Beckman Coulter benchtop centrifuge manual 9.1.3. Biomek Software User's Manual 9.1.4. Biorad Gel dryer 9.1.5. Chemidodoc manual 9.1.6. Criterion dodeca cell gel box 9.1.7. Eppendorf MixMate operating manual 18 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 19 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 9.1.8. Eppendorf plate vacuum manifold 9.1.9. Eppendorf, Perfect Vac Manifold, single Basic 9.1.10. Mastercycler 9.1.11. Molecular Imager ChemiDoc XRS System 9.1.12. Perkinelmer Tri-Carb 2900TR liquid scintillation counter 9.1.13. QIAquick_Spin_Handbook 9.1.14. Rainin multichannel pipette 9.1.15. Typhoon TRIO+ imager 9.2. E-Gel® Technical Guide. General information and protocols for using E-Gel® pre-cast agarose gels. Version J July 10, 2007 25-0645 9.3. PureLink™ 96 PCR Purification Kit For rapid, high-throughput purification of PCR Catalog no. K3100-96 Version B 21 April 2004 25-0716 9.4. Expressway™ Cell-Free E. coli Expression System Cell-free protein synthesis system for expression of recombinant protein Catalog nos. K9901-00, K9900-96, K9900-97 Version A 15 February 2006 25-0890 9.5. QIAquick® Spin Handbook For QIAquick Gel Extraction Kit, November 2006. 9.6. Specific Activity is calculated using the following website: http://www.ehs.uiuc.edu/rss/toolscalcs/raddecay.aspx 10. Calculations and formulas 10.1. Determine quantity of protein produced. 10.1.1. pmoles of protein: = [(TCA ppt cpm-background cpm) x (total reaction volume)]/ [10 x (# of met residues in target) protein) x (specific activity of the 35S Methionine)] 10.1.2. Specific activity of the IVT synthesized quality control protein: = (total counts)/ number of labeled and unlabeled pmoles methionine in the protein 10.1.3. Microgram of protein: = (pmoles of protein x molecular weight of protein in grams/mole)/106 10.2. DNA concentration in mg/ml using absorbance at 260nm. Concentration in mg/ml = A260/ (ε x l) with ε=40 mg/ml and l=10 mm path length 11. Glossary 11.1. 11.2. 11.3. 11.4. 11.5. USAMRIID United States Army Medical Research Institute for Infectious Disease LVS live vaccine strain FTU Francisella tularensis IVT In vitro Translation LEE Linear Expression Element 19 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 20 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes 11.6. 11.7. 11.8. 11.9. 11.10. 11.11. 11.12. 11.13. 11.14. 11.15. 11.16. 11.17. 11.18. 11.19. 11.20. 11.21. 11.22. 11.23. Author: Kathryn Sykes Date: 3/4/09 PCR polymerase Chain Reaction UV Ultra Violet Light. dNTP deoxy Nucleotide TriPhosphate TCA Tri Chloro Acetic Acid MES 2-(N-morpholino) ethanesulfonic acid. PBS Phosphate Buffered Saline GEMS Genetic Experimental Management System. DNA Deoxy Ribonucleic Acid RNA Ribonucleic acid E.coli Escherichia coli TRIS trishydroxymethylaminomethane EDTA ethylene diamine tetraacetic acid TBE Tris Boric acid EDTA CPM counts per minute BSA Bovine Serum Albumin Trx Thioredoxin MAb Monoclonal Antibody PPT precipitation 12. Appendices T7-Thio-F: GCGAAATTAATACGACTCACTATAGGG Thio R: CAATCCGCTTCCGCCTATGGCCAGGTTAGCGTCGAGG 5’-Univ-F: ATAGGCGGAAGCGGATTG T7-Term-His-Univ-F: ACCCAACCTCCCTCCCACCATCATCATCATCATTAATAAAAGGGCG T7-Term-R: ATCCGGATATAGTTCCTCCTTTCAG R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU proteomic library ASU has an entire electronic management system (GEMS) for all of the data tracking and all data is linked in GEMS. 20 Arizona State University: Biodesign Institute SOP No.: Proteome_3.v 2.0 Effective Date: 3/4/2009 Page 21 of 21 Title: High Throughput Construction and Purification of Polypeptides Approved: Kathryn Sykes ASU PI: Kathryn Sykes Author: Kathryn Sykes Date: 3/4/09 21
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )