Document 16059106

CONNECTIVITY OF TWO URBAN COYOTE ( CANIS LATRANS ) POPULATIONS

(SACRAMENTO AND SAN FRANCISCO) TO SURROUNDING RURAL POPULATIONS

Katherine Frances Marquez

B.S. University of California, Davis, 2004

THESIS

Submitted in partial satisfaction of the requirements for the degree of

MASTER OF SCIENCE in

BIOLOGICAL SCIENCES

(Biological Conservation) at

CALIFORNIA STATE UNIVERSITY, SACRAMENTO

SPRING

2011

© 2011

Katherine Frances Marquez

ALL RIGHTS RESERVED ii

CONNECTIVITY OF TWO URBAN COYOTE ( CANIS LATRANS ) POPULATIONS

(SACRAMENTO AND SAN FRANCISCO) TO SURROUNDING RURAL POPULATIONS

A Thesis by

Katherine Frances Marquez

Approved by :

__________________________________, Committee Chair

Jamie M. Kneitel, Ph.D.

__________________________________, Second Reader

Shannon L. Datwyler, Ph.D.

__________________________________, Third Reader

Benjamin N. Sacks, Ph.D.

Date: ____________________________ iii

Student: Katherine Frances Marquez

I certify that this student has met the requirements for format contained in the University format manual, and that this thesis is suitable for shelving in the Library and credit is to be awarded for the thesis.

__________________________, Graduate Coordinator ___________________

Susanne W. Lindgren, Ph.D.

Department of Biological Sciences

Date iv

Abstract of

CONNECTIVITY OF TWO URBAN COYOTE ( CANIS LATRANS ) POPULATIONS

(SACRAMENTO AND SAN FRANCISCO) TO SURROUNDING RURAL POPULATIONS by

Katherine Frances Marquez

The total land-mass of urban areas is rapidly increasing, forcing wildlife species to respond either by reductions in their distribution and abundance or acclimation to urban and otherwise modified habitats. Coyotes ( Canis latrans ) are found in the heart of some major cities within their range but relegated to the fringes of others. I examined two urban coyote populations. One population, San Francisco, is relatively new, having become established in patches of habitat within the city only within the last several years, providing a window into the process of colonization. The other, Sacramento, is linear and provides a natural connection between the valley and the foothills. The goal of my research is to investigate genetic connectivity between these two urban coyote populations and surrounding rural populations and to assess the possibility of a single founder pair origin for the San Francisco population.

Recent research in provides evidence for natal habitat preference in California coyotes.

Using genetic assignment methods, at least four genetic subdivisions, corresponding to bioregions, were found: Great Valley, Cascades/Sierra Nevada/Modoc (hereafter referred to as

Sierra Nevada), Northwestern, and Central Western.

Coyote DNA from scat and some opportunistically collected blood and tissue samples from our two study sites were genotyped at 14 microsatellite loci. Those genotypes were ran in v

STRUCTURE along with reference genotypes from previously establish clusters in order to determine assignment.

The American River Parkway results indicate both a high level of assignment to the

Sierra Nevada cluster and no assignment to the Great Valley cluster. The elevational change along the American River Parkway did not appear to have an effect on the results. When the data were analyzed in STUCTURE with K = 3, most coyotes assigned to a cluster distinct from the

Great Valley or Sierra Nevada, which indicates high genetic similarity among the American River

Parkway coyotes relative to the surrounding populations.

The San Francisco population, having allele counts of greater than four for half of our loci, does not support the single founder pair hypothesis but these counts could have been skewed due to genotyping error. The significant difference between the number of loci with allele counts greater than four in the sample population and the Northwestern reference population provides support for a small founding population. We did not see a strong clustering of the San Francisco genotypes with either the Northwestern or Central Western cluster. The single individual that did assign to the Central Western cluster was from the most southern park sampled, indicating that there is some immigration from the Central Western population.

The high relatedness among San Francisco individuals does not support a hypothesis of high immigration from either/or both the Northwestern or Central Western populations. The

Central Western displayed high levels of within cluster relatedness, similar to within San

Francisco, but Northwestern displayed low levels of relatedness within its cluster.

When assessing relatedness among populations we found some error due to probability.

This error is evident in relationship levels between the Northwestern cluster and the Central

Western cluster, which are geographically isolated from each other. When assessing relationships by park, high relatedness was seen within the Presidio. Among the different parks, the pairs of vi

parks that showed the three highest number of relationships were between Glen Park and each of the other three parks. This shows both evidence of the willingness of coyotes to traverse urban landscapes and the inability of small parks to sustain many individuals.

I used noninvasive genetic sampling, which has inherent limitations to for genetic analysis because it yields low quality and quantity DNA. For this reason, genotypic error due to allelic dropout is common. Lack of detection can produce null alleles that may result in false homozygotes. In addition, season/weather, age of feces at collection, and time between preservation and DNA extraction all greatly affect PCR amplification success.

Both the American River Parkway and the San Francisco study sites offer insight from a wildlife management perspective. This information can be used, either for the development of corridors and wildlife areas to promote urban wildlife and/or for strategies in managing the population size of current urban coyote populations. Both strategies meet the purpose of limiting the human-wildlife interface within urban areas and thus limiting the opportunity for conflict.

_______________________, Committee Chair

Jamie M. Kneitel, Ph.D. vii

ACKNOWLEDGMENTS

The following thesis could not have been completed without the help of many people. One of those people is Janet Kessler, who volunteered to collect all of the coyote scat samples within San

Francisco. Without her efforts I would not have been able to make an assessment of the San

Francisco Coyote population. Aiding me in the processing of those samples was Sarah Brown, a former UCDavis Ph.D. student. Thank you Sarah for being so willing to help and so patient as I learned the laboratory techniques. I would also like to thank my committee for providing input and support when needed, especially Dr. Jamie Knietel, who was willing to step in as my advisor when Dr. Ben Sacks was no longer faculty at CSUS. Most importantly, I would like to thank Dr.

Sacks for always being there to pick up and start right where we left off no matter how many life breaks I took. Without such a great advisor I would never have made it through this. Thank you. viii

TABLE OF CONTENTS

Page

Acknowledgements ................................................................................................................ viii

List of Tables ............................................................................................................................ xi

List of Figures ......................................................................................................................... xii

INTRODUCTION ..................................................................................................................... 1

Objectives and Hypotheses ........................................................................................... 9

METHODS .............................................................................................................................. 11

Study Sites .................................................................................................................. 11

The American River Parkway ........................................................................ 11

San Francisco ................................................................................................. 12

Genetic Sampling ........................................................................................................ 13

Laboratory Methods .................................................................................................... 14

Data Analysis .............................................................................................................. 15

RESULTS ................................................................................................................................ 18

DISCUSSION .......................................................................................................................... 27

CONCLUSION ........................................................................................................................ 34

Appendices ............................................................................................................................... 35

Appendix A. Collection and extraction data for samples collected in the American

River Parkway study site ............................................................................................. 36

Appendix B. Collection and extraction data for samples collected in the San Francisco

study site ...................................................................................................................... 41 ix

Appendix C. Matrix of San Francisco individuals showing the relationship between

each pair that has the highest likelihood ..................................................................... 44

Literature Cited ........................................................................................................................ 45 x

LIST OF TABLES

Page

Table 1. Allele counts for San Francisco and adjacent rural populations ............................... 21

Table 2. Number and type of relationships within and among the San Francisco

population and adjacent rural populations. ............................................................... 25

Table 3. Number and type of relationships within and among the San Francisco parks ........ 26 xi

LIST OF FIGURES

Page

Figure 1. Land use map of Sacramento County illustrating the beginning and end of the

American River Parkway .......................................................................................... 4

Figure 2. Map of study area and coyote genetic clusters corresponding to bioregions:(1)

Great Valley, (2) Cascades, Sierra Nevada, Modoc, (3) Northwestern, (4)

Central Western. (Sacks et al. 2004, figure reprinted from Sacks et al. 2005) .......... 6

Figure 3. Satellite image of the San Francisco Area, depicting locations of the 2003 coyote

sightings (Bernal Heights and the Presidio) in correlation with the general

locations of the Northwestern (NW) and Central Western (CW) bioregions .

........... 8

Figure 4. Map depicting location and genetic assignment of samples collected along the

American River Parkway (ARP) ............................................................................. 19

Figure 5. Map depicting locations of parks and genetic assignment of samples

collected in San Francisco......................................................................................... 22 xii

1

INTRODUCTION

The total land-mass of urban areas is rapidly increasing. Wildlife species generally respond to the corresponding loss of natural habitat either by reductions in their distribution and abundance or acclimation to urban and otherwise modified habitats.

Indeed, habitat loss and fragmentation caused by the rapid expansion of urban regions is the primary threat to endangered species in the United States (Wilcove et al. 1998).

Wide-ranging and low-density species such as mammalian carnivores tend to be especially vulnerable to habitat conversion (Noss et al. 1996). However, some carnivores appear to have acclimated to, and in some cases even thrived in, urban landscapes.

Understanding how this happens can help us better manage urban landscapes to promote coexistence with wildlife.

Urban-accommodating species clearly vary in their affinity for the urban landscape. For example, raccoons ( Procyon lotor ) are a component of the fauna of every major city within their geographic range (Hoffmann and Gottschang 1977, Rosatte et al.

1991, Feigley 1992, Riley et al. 1998), whereas coyotes ( Canis latrans ) occupy the hearts of some major cities but are relegated to the fringes of others. This inconsistency in coyotes is fascinating and prompts several interesting questions. What proximate factors cause or prevent the colonization of urban habitats by coyotes from rural surroundings?

Once coyotes establish populations in an urban environment, do individuals freely move between urban and rural landscapes or do urban populations become relatively insular?

The goal of my research is to investigate connectivity with surrounding rural coyote populations of two urban populations. One of these populations (San Francisco) is

2 relatively new, having become established only within the last several years, providing a window into the process of colonization (Sacks et al. 2006). The other population

(Sacramento) is set in a novel configuration of natural and urban landscape patches providing an opportunity to understand how coyotes move from particular types of rural habitat into and out of an urban habitat.

As a species, coyotes are widely distributed in North America and are able to utilize a large variety of habitats (Gese and Beckoff 2004). The utilization of urban habitat by coyotes has been observed in Southern California (Gill and Bonnet 1973;

Crooks 2002; Riley et al. 2003), Seattle, Washington (Quinn 1997a, Quinn 1997b),

Tucson, Arizona, (McClure et al. 1995; Bounds and Shaw 1997; Grinder and Krausman

2001a, 2001b), Chicago, Illinois (Morey et al. 2007), and British Columbia (Atkinson and Shackleton 1991), among others. Studies of these populations primarily investigated habitat use (Bounds and Shaw 1997; Gill and Bonnet 1973; Grinder and Krausman

2001a; Quinn 1997a), diet (McClure et al. 1995; Quinn 1997b, Morey et al. 2007) and diel activity patterns (Grinder and Krausman 2001a; Riley et al. 2003, Morey et al. 2007).

However, studies have not documented the colonization process or the relationship between urban and surrounding rural populations.

Despite their ability to inhabit urban areas, coyotes apparently prefer more natural habitat (i.e., including urban woodlots, canyons, open parks and golf courses; Crooks

2002, Riley et al. 2003). Most of 40 radio-collared coyotes in the Los Angeles area retained some portion of natural habitat in their home range (Riley et al. 2003). Coyotes in urban areas were more nocturnal than those in more natural habitat, likely due to

3 higher human presence during daytime in urban habitats. In San Diego County, habitat fragment area and isolation were the two strongest landscape predictors of coyote distribution and abundance, suggesting a minimum size requirement for natural areas and an aversion to crossing or roaming through concrete portions of the urban landscape

(Crooks 2002). Thus, in contrast to species, such as the raccoon, which commonly take up residence in sewer drains (Schinner and Cauley 1974, Hoffmann and Gottschang

1977, Hadidian et al. 1991), coyotes appear only marginally able to utilize urban habitats.

While previous studies provide insight into relative habitat affinities of coyotes once in the urban landscape, it is unclear what factors have prompted coyotes to colonize these cities in the first place, while in other cases coyotes have remained on the periphery of cities. For example, San Francisco, historically and presently, has been bordered to the south by a dense population of coyotes that have never colonized the city. Yet within a few years of the Marin Headlands (a natural area north of the city) being colonized by coyotes from the north, individuals from this Marin population moved into the city, likely, across the Golden Gate bridge (Sacks et al. 2006).

A second question is the extent to which coyotes in the urban areas may be reproductively isolated from rural populations. Recent research suggests that California coyotes tend to remain in the habitat types in which they are born even in the absence of physical barriers preventing them from dispersing into adjacent habitats (Sacks et al.

2004, Sack et al. 2005, Sacks et al. 2008). Therefore, it is possible that urban coyotes remain in the city and rarely disperse out, and rural coyotes rarely disperse into the city.

Alternatively, in cases where natural areas within cities are

4

Figure 1. Land use map of Sacramento County illustrating the beginning and end of the

American River Parkway. The parkway, consists of the river itself and the floodzone bordering it, providing a narrow band of habitat amid a vast and densely urbanized area

(CA Dept. of Housing and Community Development 2000).

5 close to rural areas or connected by natural-area corridors, coyote populations might be genetically continuous.

In the city of Sacramento, observation of coyotes is common in the narrowly forested American River Parkway, which runs continuously into the Sierra Nevada foothills but is separated from the adjacent rural portions of the Great Valley by densely urbanized habitat (Fig. 1). The American River Parkway spans 37 km of the American river but is less than 0.4 km wide on both sides of the river for large stretches. The

American River connects directly to natural habitat continuing all the way to the upper reaches in the Sierra Nevada mountains The Great Valley (rural) coyote population is genetically distinct from the contiguous Sierra Nevada population (Fig. 2; Sacks et al.

2005). Thus, to the extent that these American River Parkway urban coyotes are in genetic communication with rural coyotes, a related question is which rural population?

On the one hand, the long, riparian channel may be used as a wildlife corridor linking coyote populations in the Sierra foothills and American River Parkway. The wooded vegetation of low elevation Sierra Nevada habitat is similar to the riparian habitat of the

American River Parkway so it is possible that, despite elevational differences, Sierra

Nevada coyotes disperse into the American River Parkway and that American River

Parkway coyotes disperse into the Sierra Nevada. On the other hand, the American River

Parkway is contained in the Great Valley and it could be that the American River

Parkway population is more genetically connected with the adjacent rural Great Valley population despite the concrete habitat separating them.

6

Figure 2. Map of study area and coyote genetic clusters corresponding to bioregions:(1)

Great Valley, (2) Cascades, Sierra Nevada, Modoc, (3) Northwestern, (4) Central

Western. (Sacks et al. 2004, figure reprinted from Sacks et al. 2005).

San Francisco poses a contrasting situation. San Francisco is an even more densely urbanized city than Sacramento and lacks any apparent natural corridors to neighboring rural coyote populations. Coyotes began to appear in San Francisco, first in the Presidio and then in Bernal Heights, in 2003 (Rubenstein 2003). Most coyotes have been sighted in parkland that is isolated from natural rural area except along the coast

(Fig.3). However, given that the coast connects to the southern population [Central

Western] and preliminary data indicate this population arose from the north

[Northwestern] (Sacks et al. 2006), the San Francisco population is more likely insular.

Given the relatively recent colonization of San Francisco by coyotes, this can be investigated with genetic markers. For example, do all coyotes in this population arise from a single breeding pair?

7

8

Figure 3. Satellite image of the San Francisco Area, depicting locations of the 2003 coyote sightings (Bernal Heights and the Presidio) in correlation with the general locations of the Northwestern (NW) and Central Western (CW) bioregions .

9

Objectives and Hypotheses

I investigated the degree of genetic connectivity of the two urban coyote populations with adjacent rural populations to better understand their origins and maintenance. Specific hypotheses and predictions for the American River Parkway populations were:

(1a) The American River Parkway population is isolated from rural populations.

Prediction: American River Parkway coyotes are genetically distinct from both

Great Valley and Sierra Nevada populations.

(1b) The American River Parkway population originated from or is connected with other

Great Valley habitat.

Prediction: the urban coyotes cluster more closely with Great Valley coyotes than

Sierra Nevada coyotes.

(1c) The American River Parkway population arose from or is connected to the Sierra

Nevada population via the American River Parkway corridor.

Prediction: The American River Parkway coyotes cluster more closely with

Sierra Nevada coyotes than Great Valley coyotes.

Specific hypotheses and predictions for the San Francisco populations were:

10

(2a) The San Francisco coyote population arose from the population north of the Golden-

Gate Bridge.

Prediction: San Francisco coyotes cluster more closely with Northwestern than

Central Western populations.

(2b) The San Francisco coyote population arose from the population south of the city.

Prediction: San Francisco coyotes cluster more closely with Central Western than

Northwestern populations.

(3a) The San Francisco coyote population is a result of a single founder breeding pair of coyotes.

Prediction: There are greater than or equal to four alleles present at any locus in the San Francisco population.

(3b) The San Francisco population is a result of greater than two ancestral founders.

Prediction: There are greater than or equal to four alleles at some loci and genetic distance is low between at least one of the adjacent rural populations

(Northwestern, Central Western).

11

METHODS

Study sites

Both study sites were located within Central California, where coyote genetic structure corresponded to 4 genetic subdivisions associated with the four major bioregions in the study area: Great Valley, Cascades/Sierra Nevada/Modoc (hereafter referred to as Sierra Nevada), Northwestern, and Central Western (Fig. 2; Sacks et al.

2004).

The American River Parkway

The American River flows from the North, Middle and South Fork beginning in the Sierras and coming together at Folsom Lake. The American River Parkway study area was relatively linear, occupying approximately 30 km² of potential habitat. The

American River Parkway begins at Folsom Lake, at an elevation of 142 m above sea level (ASL), and runs west along the American River to its confluence with the much larger, north-south running Sacramento River, at an elevation of five m ASL (CSUS

2008; CA Dept. Water Resources 2008). The American River Parkway, entirely within

Sacramento County, is bordered on both sides by dense urban areas (Fig. 1). Although figures were unavailable for urban density, Sacramento County as a whole has an estimated population density of 541 people per km² (US Census Bureau 2004). Assuming most of the population occurs in the urban area, approximately 20% of the County, this translates to an urban human density of approximately 2500 people per km².

12

The parkway is a high-use area with recreational uses, including water activities, horseback riding, biking, jogging, and dog walking. Despite the amount of human use and the narrowness of some of the portions of the American River Parkway, coyotes are prevalent in the parkway (Hocker 2008) and even den (i.e., produce pups) in the most disturbed portions of the American River Parkway. One such den was observed, during sample collection, approximately 200 m northwest of the Guy West footbridge, directly across the river from the California State Sacramento University campus (2007 May 11,

LAT 38.56525, LON -121.42083, Katherine Marquez, personal observation). An additional den was observed at the Sunrise Park area of the American River Parkway, this area of the parkway is wider but inherently contains many of the same drawbacks as the other den (2007 June 23, LAT 38.63485, LON -121.25183, Katherine Marquez, personal observation).

San Francisco

San Francisco is a large metropolis with an estimated population density of 6156 people per km² or approximately two to three times the human density of Sacramento

(US Census Bureau 2004). Potential coyote habitat islands in San Francisco total approximately 20 km² and include three National Parks—the Presidio, Lincoln Park, and

Golden Gate Park—along with several regional parks, such as Bernal Heights, Lake

Merced, and Glen Park (Fig. 4). The Presidio is a large park that encompasses the area where the Golden Gate Bridge meets San Francisco. The Golden Gate Bridge is the most likely path of Northwestern coyotes into the San Francisco (Sacks et al. 2006). About 1.5

13 km south of the Presidio, is Golden Gate Park, and about 3.5 km further south is Lake

Merced, both comparable to the Presidio in size and accessible from the coastline.

Samples also were collected opportunistically in smaller parks such as Glenn Park which is in the interior of the city and do not seem to have any natural connections to any of the larger parks.

Genetic Sampling

To assess connectivity of urban with rural populations, we used non-invasive genetic sampling techniques supplemented with five DNA samples from coyotes killed within San Francisco. We calculated that we needed 30—50 scats from each study site to sample greater than ten individuals, based on the breeding density (0.5 breeding coyotes per km²) observed in several studies throughout California (Shivik 1995, Sacks et al.

1999b, Riley et al. 2003, Sacks et al. 2005).

We collected coyote scat along the American River Parkway bike trail and from connecting unpaved trails. A San Francisco resident and volunteer, Janet Kessler, collected scats for our study from San Francisco’s parks. Coyote scat was differentiated from dog scat in the field by the prominence of animal hair in the scat and the appearance of tapered ends. At the sample location, scat was placed in a 15-mL centrifuge tube in a one to four scat to 95% ethanol ratio to preserve DNA (Murphy et al. 2002, Adams et al.

2003). Sample locations were recorded in a database, based on a GPS waypoint (Fig. 4) or on a paper map (Fig.5).

14

Laboratory Methods

We removed approximately 0.2 mg of scat from the ethanol from which we extracted and purified DNA using a QIAamp DNA Stool Mini kit (Qiagen Inc.). To determine species of origin, we used mitochondrial sequencing at a portion of the D-loop and then matched those sequences to existing sequences in Genbank using Basic Local

Alignment Search Tool (BLAST; Altschul et al. 1990). We first amplified 402 base pairs of the mtDNA D-loop using primers, CCCTGACACCCCTACATTCA (forward) and

CTTATATGCATGGGGCAAACC (reverse). Polymerase Chain Reaction (PCR) was conducted with the following profile: 95°C for 10 minutes, 85°C for 10 minutes, 95°C for one minute, 50°C for 30 seconds, 72°C for 45 seconds, steps three through five 33 times,

72°C for 30 minutes, 5º forever. Amplification products were then sequenced using the forward primer and Big Dye sequencing chemistry (Applied Biosystems, Inc.), and run on an ABI 3730® sequencer. Sequences were lined up in Sequencher and compared to those accessioned in the Genbank nucleotide database using BLAST.

Subsequent laboratory methods followed procedures from Sacks et al. (2004).

Briefly, we genotyped coyote individuals at the same 14 microsatellite loci used for the reference population: FH2004, FH2088, FH2054, FH2289, FH2161, FH2001 (multiplex

1) and FH2010, FH2328, FH2100, FH2096, FH2079, FH2441, FH2457, FH2380

(multiplex 2). The PCR involved 95°C for 10 minutes, 85°C for 10 minutes, 95°C for one minute, 64°C for 30 seconds, 72°C for 45 seconds, steps three through five 33 times,

72°C for 30 minutes, 5º forever. An ABI 3730® automated sequencer with genescan

15 analysis 3.1® in conjunction with an internal size standard, GeneScan 500 LIZ (Applied

Biosystems) was then used to visualize the PCR product. Alleles were then scored using

STRand v2.2.30 (Veterinary Genetics Laboratory, University of California, Davis).

Data analysis

We first assigned the genotypes of the American River Parkway and San

Francisco individuals to one of the previously defined genetic clusters, using published reference genotypes (Sacks et al. 2004). Specifically, for each population, we assessed the estimated proportion of ancestry of each sampled coyote with respect to previously defined clusters of the two adjacent rural populations: Great Valley and Sierra Nevada for

American River Parkway, and Northwestern and Central Western for San Francisco. To assign American River Parkway genotypes, we included only reference genotypes sampled from the Great Valley and Sierra Nevada; to assign San Francisco genotypes, we used reference genotypes only from the Northwestern and Central Western.

We used the program STRUCTURE v2.0 (Pritchard et al. 2000) to estimate proportions of ancestry of each genotype with respect to the two reference clusters.

Program STRUCTURE is a Bayesian model-based program that uses mutlilocus genotypes to identify genetic clusters based on minimizing linkage disequilibrium and deviations from Hardy-Weinberg equilibrium within clusters. We first constrained the program to assign ancestry of genotypes with respect to two clusters (K = 2) using the prior-information model, which allows the reference data to be assigned a-priori, and treating the genotypes from American River Parkway and San Francisco coyotes as

16 unknowns. If individuals were not assigned primarily to one of the two reference clusters, we further evaluated whether the urban population was itself a distinct cluster.

Specifically, we conducted a run with all genotypes (reference and urban) treated as unknowns (i.e., no prior information) and assuming K =3 clusters to assess whether the urban genotypes formed a distinct cluster from the two reference clusters. For all

STRUCTURE analyses, we based ancestry estimates on 10

6

Markov Chain Monte Carlo

(MCMC) cycles, following a burn-in period of 30,000 MCMC cycles (Pritchard et al.

2000). Additionally, because natural populations ultimately share ancestry, we assumed allele frequencies were correlated among clusters (Falush et al. 2003; Sacks et al. 2004).

Based on previous empirical and simulation studies, we operationally presumed complete assignment to one cluster when membership assignment probability (i.e., estimated proportion of ancestry, or “Q-value”) was ≥80% (Sacks et al. 2004; Väha and

Primmer 2006). Mapping such assignments illuminated geographical patterns of structure while reducing clutter due to admixture (Sacks et al. 2004).

To determine whether individuals in the San Francisco population could have descended from a single breeding pair, we assessed direct relationships among those coyote genotypes. We used the software ML-Relate (Kalinowski et al. 2008) to estimate relatedness (i.e., proportion of genes shared by descent) and most likely relationship, specifically, Parent-offspring (PO), full-sibling (FS), half-sibling (HS), or unrelated (U).

For each pair of individuals, the program used a search algorithm to obtain maximumlikelihood estimates for relatedness and each type of relationship. Then we compared maximum likelihoods for each type of relationship to assess which type had the highest

likelihood. We also used this program to estimate number of alleles, observed allele frequencies, and expected heterozygosity (Nei 1978).

17

18

RESULTS

We collected 111 scats along the American River Parkway, of which 96 (90%) yielded enough usable DNA to be sequenced. Of those, 23 (24%) were determined to be coyote (Appendix A). Most of these (n = 15) were collected between the H-Street Bridge and Watt Avenue Bridge (near CSUS); one was collected at Sunrise Park, and seven were collected between the Greenback Bridge and Folsom Prison (Fig. 3).

All 14 loci were polymorphic, with 95 alleles in total and an average of 6.8 alleles per locus (range = 3–11). Observed heterozygosity (average H o

= 0.61, range 0.07–0.91) was slightly lower than expected heterozygosity (average H e

=0.73, range 0.48–0.91).

Heterozygote deficiencies were significant in all but three loci (FH2001 P =0.14, FH2004

P <0.01, FH2010 P <0.01, FH2054 P =0.18, FH2079 P <0.01, FH2088 P =0.02, FH2096

P <0.01, FH2100 P <0.01, FH2161 P =0.01, FH2289 P <0.01, FH2328 P <0.01, FH2380

P =0.25, FH2441 P <0.01, FH2457 P <0.01).

We analyzed the 23 American River Parkway coyotes along with 69 Great Valley and 62 Sierra Nevada coyote genotypes from previously published data (Sacks et.al.

2004). Based on the STRUCTURE analysis assuming K = 2 and using prior information for the reference sample, 14 of the 23 American River Parkway genotypes (61%) assigned to the Sierra Nevada cluster (i.e., at the Q ≥ 0.8 threshold) while the remaining nine (39%) had Q-values of 0.33-0.58 for the Great Valley cluster and 0.42-0.67 for the

Sierra Nevada Clusters(Fig. 3). Specifically, 10 of 15 scats (67%) from near CSUS and 3 of 7 scats (43%) from near Folsom Prison assigned to the Sierra Nevada cluster, but these

19

Figure 4. Map depicting location and genetic assignment of samples collected along the

American River Parkway (ARP). The southern subset features the area between the H

Street bridge and Watt bridge (near CSUS), the point in between the two boxes was collected at the Sunrise river access, and the Northern section features the area from the

Greenback Bridge to Folsom Prison. Orange points identify assignment to the Sierra

Nevada (SN) cluster at the Q ≥ 0.8 threshold and blue points identify individuals that did not clearly assign to the Sierra Nevada or Great Valley cluster; STRUCTURE analysis assumed K = 2. (See Appendix A for collection and extraction data).

20

proportions did not differ significantly (Fisher Exact test P = 0.21). The sample collected at the Sunrise river access assigned to the Sierra Nevada cluster.

In the STRUCTURE analysis with no prior information and K = 3, 15 genotypes

(65%) assigned to the new cluster, seven genotypes (30%) assigned to the Sierra Nevada cluster, and one (5%) genotype had an ambiguous assignment, with Q = 0.55 (Great

Valley), Q = 0.24 (Sierra Nevada), and Q = 0.21 to the new cluster.

A total of 47 scats was collected in SF, including 35 (5%) that yielded usable DNA.

Of those, ten (29%) were determined to be coyote (Appendix B). Including the genotypes from the five additional coyotes sampled alive or from carcasses, we obtained

15 coyote DNA samples from SF: six from the Presidio (three tissue, three scats), three from Golden Gate Park (two tissue, one scat), three scats from Glen Park, and three scats

From Lake Merced (Fig. 5).

All 14 loci were polymorphic, with a total of 75 alleles and an average of 5.4 alleles per locus (range = 2–10). Observed heterozygosity (average H o

= 0.68, range

0.25–1) was slightly lower than expected heterozygosity (average H e

=0.73, range 0.22–

0.89). Heterozygote deficiencies were significant in six of 14 loci (FH2001 P =0.95,

FH2004 P =0.16, FH2010 P =0.09, FH2054 P =0.72, FH2079 P =0.04, FH2088 P =0.06,

FH2096 P =0.37, FH2100 P =0.01, FH2161 P =0.01, FH2289 P <0.01, FH2328 P =0.02,

FH2380 P =0.25, FH2441 P <0.01, FH2457 P =0.14).

The 14 loci of the San Francisco population had allele counts ranging from two to ten, with seven loci (50%) displaying counts greater than four. In contrast the

Table 1. Allele counts for San Francisco and adjacent rural populations.

Locus

Population 1, 2

SF NW CW

FH2001 4 8 6

FH2004 6 16 11

FH2010 5 5 7

FH2054 4 8 4

FH2079 2 4 3

FH2088

5 7 5

FH2096 4 5 4

FH2100 3 7 5

FH2161 7 15 5

FH2289 6 23 12

FH2328 10 23 12

FH2380 4 7 6

FH2441 7 9 7

FH2457

8 17 11

Number of loci > 4

7 13 11

Percent

50.00 92.86 78.57

1 SF, San Francisco; NW, Northwestern; CW, Central Western.

2

Allele counts greater than four are in bold.

21

22

Figure 5. Map depicting locations of parks and genetic assignment of samples collected in San Francisco. Samples with unclear assignment are represented with orange dots .

Sample ID S08-0130, represented by a yellow dot, was the only individual that showed a clear assignment to the Central Western cluster (when K=2). (See Appendix B for collection and extraction data). *Sample S08-0359 was collected just outside of the

Presidio.

23

Northwestern population (range= 4-23, 13 counts greater than four (92.86%), Table 1) had significantly more loci with allele counts greater than four (Fisher Exact test P =0.02).

Despite the Central Western populations higher trend in allele counts greater than four, there was no significant difference between it and the San Francisco population (range=3-

12, 11 counts greater than four (78.57%), Fisher Exact test P = 0.10).

We analyzed the 15 San Francisco coyotes in STRUCTURE along with 159

Northwestern and 25 Central Western coyote genotypes from the previously published data. Based on the STRUCTURE analysis assuming K = 2 and using prior information for the reference sample, none of the 15 genotypes assigned to the Northwestern cluster and only one (6.67%), collected at Lake Merced, assigned to the Central Western cluster at the Q > 0.8 threshold. The remaining 14 genotypes (93%) had Q-values that ranged

0.25–0.75 for both Clusters.

In the STRUCTURE analysis with no prior information and K = 3, 3 (20%) genotypes assigned to a new cluster, including two from the Presidio and one from Lake

Merced, at the Q > 0.8 threshold. The remaining 12 (80%) showed Q-values ranging

0.10–0.49 for the Northwestern cluster, 0.06–0.43 for the Central Western cluster, and

0.29–0.78 for the new cluster.

When we analyzed relatedness for this study site, the proportion of relatives was higher within populations than between them (Table 2). Although the proportion of related individuals was similar in San Francisco and the Central Western population, a greater proportion of the relationships were first-order (FS, PO) in San Francisco than in the Central Western population.

24

Within San Francisco parks, pairwise comparisons among coyotes yielded seven

(29%) for which the most likely relationship was FS, eight (33%) for which it was HS, and nine (38%) for which it was U (Appendix C). None of these was most likely to be a

PO relationship. The Park with the highest number of relationships among its members was the Presidio (73% were related).

Among parks, pairwise comparisons indicated most likely relationships were PO

(n = 1), FS (n = 6), HS (n = 25), and U (n=49) (Table 3). The Glen Park and Lake Merced exhibited the highest number of relationships (56%). Additionally, relationships between

Glen Park and the Presidio (50%) and Glen Park and Golden Gate (44%) displayed the second and third highest relationship numbers among the different parks.

25

Table 2. Number and type of relationships within and among the San Francisco population and adjacent rural populations.

Population

Comparison

TOTAL

SF, NW and

CW

1

Total Pairwise

Relationships

21321

105

2 U % U R % R

18821 0.88 2500 0.12

58 0.55 47 0.45

Relationship 3 Total

HS

FS

PO

HS

FS

PO

% of R 4

2333 0.93

145 0.06

22 0.01

33 0.70

13 0.28

1 0.02 SF-SF

SF↔NW

SF↔CW

2610

480

2321 0.89 289 0.11

384 0.80 96 0.20

HS

FS

PO

HS

FS

PO

HS

262 0.91

24 0.08

3 0.01

76 0.79

19 0.20

1 0.01

1726 0.94

NW-NW

13861

18336

12028 0.87 1833 0.13

16474 0.90 2162 0.12

FS

PO

HS

FS

90

17

2028

115

0.05

0.01

0.94

0.05

NW↔CW PO

HS

19 0.01

102 0.82

300 175 0.58 125 0.42 FS 21 0.17

CW-CW PO 2 0.02

1 Number and type of relationships within (-) and among (↔) the San Francisco (SF),

Northwestern (NW), and Central Western (CW) populations.

2

Total pairwise comparisons including Unrelated (U) and Related (R) relationships.

3

Relationships defined as Half Sibling (HS), Full Sibling (FS), and Parent/Offspring

(PO).

4

Percent of related comparisons that are of a specific relationship (% of R).

26

Table 3. Number and type of relationships within and among the San Francisco parks.

(See Appendix C for a matrix of San Francisco relationships).

Park

Comparison 1

PR-PR

Number of

Relationships 2

15

18

U % U

4

14

0.27

0.78

R % R Relationship

11

4

0.73

0.22

HS

FS

PO

HS

FS

3 Total

% of

R 4

7 0.64

4

0 0.00

4

0.36

1.00

0 0.00

PR↔GG

PO

HS

0

7

0.00

0.78

PR↔GP

18 9 0.50 9 0.50 FS

PO

2

0

0.22

0.00

PR↔LM

18

3

11

2

0.61

0.67

7

1

0.39

0.33

HS

FS

PO

HS

FS

6

1

0

0

1

0.86

0.14

0.00

0.00

1.00

GG-GG

GG↔GP

GG↔LM

9

9

5

6

0.56

0.67

4

3

0.44

0.33

PO

HS

FS

PO

HS

FS

PO

HS

FS

0 0.00

1 0.25

2 0.50

1 0.25

2 0.67

1 0.33

0 0.00

1 0.50

1 0.50 3 1 0.33 2 0.67

GP-GP

9 4 0.44 5 0.56

PO

HS

FS

PO

0 0.00

5 1.00

0 0.00

0 0.00

GP↔LM

3 2 0.67 1 0.33

HS

FS

0

1

0.00

1.00

LM-LM PO 0 0.00

1

Number and type of relationships within (-) and among (↔) the San Francisco parks;

Presidio (PR), Golden Gate Park (GG), Glen Park (GP), and Lake Merced (LM).

2 Total pairwise comparisons including Unrelated (U) and Related (R) relationships.

3

Relationship: Half Sibling (HS), Full Sibling (FS), and Parent/Offspring (PO).

4

Percent of related comparisons that are of a specific relationship (% of R).

27

DISCUSSION

We investigated two urban coyote populations, including their genetic connectivity to adjacent rural populations and whether the San Francisco population could have originated from a single breeding pair. For the American River Parkway population, the STRUCTURE results indicate both a high level of assignment to the

Sierra Nevada cluster and no assignment to the Great Valley cluster. In addition, when the results were analyzed for the separate American River Parkway sampling locations, the elevational change along the American River Parkway did not appear to have an effect on the results. These results support specific hypothesis (1c) that the American

River Parkway population arose from or is connected to the Sierra Nevada population via the American River Parkway. In this situation, the riparian habitat of the American River

Parkway may be more similar to the habitat of the Sierra Nevada population cluster than that of the Great Valley cluster, thus, the natal habitat preference that Sacks et al. 2004 observed on a bioregion scale is apparent even at a smaller scale.

When the data were analyzed in STUCTURE with K = 3, many coyotes assigned to a cluster distinct from the Great Valley or Sierra Nevada, which indicates high genetic similarity among the American River Parkway coyotes relative to the surrounding populations. Again, providing support for natal-habitat-biased dispersal. Although the densely urban habitat on either side of the American River Parkway may serve as a physical barrier to gene flow to the Great Valley, this would not explain the insularity of the American River Parkway population relative to the Sierra Nevada. On the other

28 hand, given the linearity of the American River Parkway, isolation by distance could contribute to the genetic distinctiveness of the American River Parkway and Sierra

Nevada populations. Traditional theories of landscape ecology view riparian zones as movement corridors, facilitating movement of mammals large and small, plants and even nutrients (Forman and Gordon 1986). However, these results suggest that the American

River Parkway serves not only as a possible dispersal corridor into the foothills for coyotes and other organisms but as a stretch of habitat for wildlife.

Theories about wildlife corridors were originally developed in a binary fashion of absolute boundaries and linear stretches of permeable landscape (corridors) (Simberloff et al. 1992). New theories are now being developed with the understanding that boundaries are not absolute and corridors are not always the favored route. Instead, the usage of a corridor by an organism is a function of the characteristics of the “boundary” versus the characteristics of the corridor (Chetkiewicz et al. 2006). Depending on the purpose of the corridor, models using species-specific characteristics can be a useful management tool in determining location and design. These characteristics can include parameters discerned on an individual level, such as previous data on urban coyotes exhibiting a preference for natural habitat (Crooks 2002, Riley et al. 2003), a progressive increase in anthropogenic diet as urban density increases (McClure et al. 1995, Quinn

1998b , Morey et al. 2007), and a trend toward nocturnal activity cycles (Grinder and

Krausman 2001a, Riley et al. 2003, Morey et al. 2007). In addition, these models would benefit from parameters discerned on a population level such as the natal habitat preference which was exhibited both in our American River Parkway data and in

29 previous research (Sacks et al. 2004, Sack et al. 2005, Sacks et al. 2008). The greater the disparity in the quality of habitat between the “boundary” and the corridor, the more likely that wildlife will utilize the corridor rather than the urban areas surrounding it, thus limiting the opportunity for conflict between humans and wildlife.

Our findings with respect to the San Francisco population did not support but were most consistent with hypothesis (3a), that the San Francisco coyote population did not necessarily arise from a single founder pair however it is currently isolated from

Northwestern and Central Western populations. Having allele counts of greater than 4 for half of our loci, does not support the single founder pair hypothesis but these counts could have been skewed due to genotyping error. In addition, the significant difference between the number of loci with allele counts greater than four in the sample population and the Northwestern reference populations provides support for a small founding population if not a single pair. Our data also did not support specific hypotheses (2a) and (2b) because we did not see a strong clustering with either the Northwestern or

Central Western cluster, 93.33% showed unclear assignment. The single individual that did assign to the Central Western cluster was from the most southern park sampled, indicating that there is some immigration from the Central Western population to San

Francisco. This, in conjunction with previous data providing evidence of immigration into San Francisco from the Northwestern population (Sacks et al. 2006), provides support for assertions that the San Francisco area may now serve as a link allowing direct gene flow between the Northwestern and Central Western genetic clusters, two historically distinct populations (Sacks et al. 2006, Sacks et al. 2004).

30

When STRUCTURE analysis was done with K=3 there was still unclear assignment for 80% of the individuals. The single sample that clustered with the Central

Western reference data in the K=2 analysis was displayed as a new cluster here along with two Presidio individuals, thus possibly representing a willingness of the San

Francisco coyotes to disperse among the patchy habitat available in the city.

San Francisco coyotes showed a high level of relatedness with each other despite unclear assignment in STRUCTURE analysis. This high relatedness among San

Francisco individuals does not support a hypothesis of high immigration from either the

Northwestern or Central Western populations. Conflicts between humans and coyotes are a growing concern for San Francisco residents but our data indicate that management strategies should be focused within the interior of the city and not at its borders. There are a wide spectrum of management possibilities ranging from education and outreach programs for neighboring residents to population control methods.

The lack of genetic connectivity between the Northwestern and/or Central

Western populations and the San Francisco population is a contrasting situation from our

American River Parkway study site. The patchy habitat of the San Francisco park system is much more distinct from the mountainous coastal habitat of both the Northwestern and

Central Western populations. Coyotes might perceive the urban parkland in the city of

San Francisco as a distinct habitat type. Natal habitat preference also could be a significant factor in this population, potentially contributing to the low immigration observed from the neighboring rural populations. Likewise, coyotes born in this urban

31 environment would have little choice but to traverse the city, but also might have been less inclined to leave it for unfamiliar rural habitat.

Interestingly, when assessing relatedness within the reference populations, the

Central Western population displayed high levels of relatedness (41.7%) similar as to what was seen within San Francisco but the Northwestern population displayed low levels of relatedness (13.2%) within its population. This may be a result of a higher level of dispersal and interbreeding among a larger population in Northwestern California than in other clusters as opposed to the especially high relatedness of Central Western individuals.

When assessing relatedness among populations we found, despite the fact that the

Northwestern cluster and the Central Western cluster were geographically isolated from each other, our analysis nevertheless yielded relationships among 12% of pairwise comparisons. A true relationship between any of the Northwestern individuals and the

Central Western individuals would be highly unlikely, thus, the 12% relatedness value likely reflects the statistical error inherent in the analysis. If so, this suggests the 11% level of relatedness observed between individuals in the Northwestern and San Francisco populations is also reflected error and therefore it is possible that none of the comparisons between these populations were of true relatives. By the same reasoning, the slightly higher level of relatedness (20%) between individuals of the San Francisco and Central

Western populations could indicate on the order of 8% relationships, which is consistent with the one San Francisco individual that assigned to the Central Western cluster with greater than or equal to 80% probability.

32

When assessing relationships by park it seems that there is a high relatedness within the Presidio, including one sample having been collected in 2003 (Appendix B).

This could be a result of the larger sample size obtained from that park compared to the other three parks. Among the different parks, the pairs of parks that showed the three highest numbers of relationships were between Glen Park and each of the other three parks. Glen Park is the smallest park where we collected coyote samples and the only park not bordering the San Francisco coastline, thus, completely surrounded by dense urban areas. The among-parks relationship data shows both evidence of the willingness of coyotes to traverse urban landscapes and the inability of small parks to sustain many individuals. From a management perspective coyotes in small parks, such as Glen Park, would be the greatest concern. Among-park relatedness data suggest high levels of dispersal (likely due to limited habitat size) through the city into other parks. This dispersal increases the opportunity for human wildlife interactions, which have a wide variety of results from high mortality rate of coyotes due to vehicle collision to physical conflicts between coyotes and humans or their pets. Understanding the genetic connectivity among parks can help elucidate likely coyote travel ways, enabling management and outreach efforts to be focused in neighborhoods most likely to encounter coyotes.

We used noninvasive genetic sampling, which has become an increasingly valuable tool in genetic studies of mammalian carnivores. However, there are inherent limitations to collection of fecal samples for genetic analysis because it yields low-quality and low-quantity DNA. For this reason, genotypic error due to allelic dropout is

33 common. Allelic dropout occurs when there is low quantity of DNA, some alleles can get left out of the amplification process and are therefore not detected (Taberlet et al.

1999). Lack of detection of one allele can produce false homozygotes.

In addition, season/weather, age of feces at collection, and time between preservation and DNA extraction all greatly affect PCR amplification success (Piggot

2002, Murphy et. al. 2006, Murphy et al. 2002). In our study, we collected American

River Parkway samples in the summer and the dry heat may have aided in preservation but also made it hard to determine how fresh the sample was at time of collection.

Unfortunately, we did not process about half of the preserved American River Parkway samples for DNA extraction until a year after they were collected. The prolonged period prior to extraction may have decreased PCR amplification success. In contrast, the San

Francisco samples were collected in a moist climate that may have decreased PCR amplification success but were processed relatively soon after collection.

34

CONCLUSION

The American River Parkway data support the specific hypothesis of a strong

Sierra Nevada connection. In contrast the San Francisco population showed little connection to adjacent populations, illustrating some possible differences between the effects if linear habitat connection versus patches of habitat available for urban wildlife.

This is something that cities should take note of in developing plans for either urban expansion or establishment of wildlife areas.

Both the American River Parkway and the San Francisco study sites offer insight from a wildlife management perspective. This information can be used in many ways, including the development of corridors and wildlife areas to promote urban wildlife and/or for strategies in managing the population size of current urban coyote populations. Although seemingly conflicting, both strategies meet the purpose of limiting the human-wildlife interface within urban areas and thus limiting the opportunity for conflict.

In order to gain clearer understanding of the underlying dynamics of the establishing San Francisco population a study that uses primers specifically designed for fecal DNA may yield clearer results.

APPENDICES

35

APPENDIX A

Table 1. Collection and extraction data for samples collected in the American River Parkway study site. All samples were scat collected by Katherine Marquez.

Sample ID Location Latitude Longitude Collected Extracted DNA

Mitochondrial

Sequence Species 1 Assignment 2

S08-0066

Effie

Yeaw

S08-0045 Folsom

S08-0046 Folsom

S08-0047 Folsom

S08-0048 Folsom

S08-0049 Folsom

S08-0050 Folsom

S08-0051 Folsom

S08-0052 Folsom

S08-0053 Folsom

S08-0054 Folsom

S08-0055 Folsom

S08-0056 Folsom

S08-0057 Folsom

S08-0058 Folsom

S08-0059 Folsom

S08-0060 Folsom

S08-0061 Folsom

S08-0062 Folsom

S08-0488 Folsom

S08-0489 Folsom

S08-0490 Folsom

S08-0491 Folsom

S08-0492 Folsom

N/A 3/31/2008 Yes

38.6831 -121.1747 8/11/2007 3/2/2008 No

38.6850 -121.1720 8/11/2007 3/2/2008 Yes

38.6853 -121.1712 8/11/2007 3/2/2008 No

38.6896 -121.1698 8/11/2007 3/2/2008 Yes

38.6888 -121.1690 8/11/2007 3/2/2008 Yes

38.6827 -121.1727 8/20/2007 3/2/2008 Yes

38.6827

38.6834

3/2/2008 Yes

3/2/2008 No

38.6868 -121.1667 8/20/2007 3/2/2008 No

38.6845 -121.1687 8/20/2007 3/2/2008 No

38.6845 3/2/2008 Yes

38.6843 -121.1693 8/20/2007 3/31/2008 Yes

38.6843 -121.1693 8/20/2007 3/31/2008 Yes

38.6833 -121.1713 8/20/2007 3/31/2008 Yes

38.6831 -121.1717 8/20/2007 3/31/2008 Yes

38.6890 -121.1675 8/20/2007 3/31/2008 Yes

38.6892 -121.1683 8/20/2007 3/31/2008 Yes

38.6842

38.6882

38.6889

38.6831

38.6867

38.6851

N/A 3/20/2008

-121.1723 8/20/2007

-121.1720 8/20/2007

-121.1687 8/20/2007

-121.1732 8/20/2007

-121.1677 8/27/2007

-121.1690 8/27/2007

-121.1720 8/27/2007

-121.1667 8/27/2007

-121.1677 8/27/2007

3/31/2008 NO

8/26/2008 Yes

8/26/2008 Yes

8/26/2008 Yes

8/26/2008 Yes

8/26/2008 Yes

D-loop

N/A

D-loop

N/A

D-loop

D-loop

D-loop

D-loop

N/A

N/A

N/A

D-loop

D-loop

D-loop

D-loop

D-loop

COYOTE N/A

N/A N/A

COYOTE UNCLEAR

N/A N/A

COYOTE UNCLEAR

FAILED

FAILED

COYOTE UNCLEAR

N/A

N/A

N/A

DOG

FAILED

FAILED

DOG

DOG

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

D-loop COYOTE N/A

Cytochrome b COYOTE UNCLEAR

N/A N/A N/A

N/A

N/A

N/A

N/A

N/A N/A

Cytochrome b DOG

Cytochrome b DOG

N/A

N/A

N/A

N/A

N/A

Table 1. continued

Sample Mitochondrial

ID Location Latitude Longitude Collected Extracted DNA Sequence Species 1 Assignment 2

S08-0512 Folsom

S08-0513 Folsom

S08-0514 Folsom

S08-0515 Folsom

S08-0516 Folsom

S08-0517 Folsom

S08-0518 Folsom

S08-0519 Folsom

S08-0520 Folsom

S08-0521 Folsom

S08-0522 Folsom

S08-0523 Folsom

S08-0524 Folsom

S08-0525 Folsom

S08-0526 Folsom

S08-0544 Folsom

S08-0545 Folsom

S08-0546 Folsom

S08-0547 Folsom

S08-0548 Folsom

S08-0549 Folsom

S08-0550 Folsom

S08-0551 Folsom

S08-0033 CSUS

S08-0034 CSUS

S08-0035 CSUS

S08-0036 CSUS

S08-0037 CSUS

38.6833 -121.1752 9/13/2007 9/2/2008 Yes

38.6838 -121.1742 9/13/2007 9/2/2008 Yes

38.6845 -121.1725 9/13/2007 9/2/2008 Yes

38.6851 -121.1712 9/13/2007 9/2/2008 Yes

38.6850 -121.1713 9/13/2007 9/2/2008 Yes

38.6864 -121.1697 9/13/2007 9/2/2008 Yes

38.6863 9/2/2008 Yes

38.6865 -121.1695 9/13/2007 9/2/2008 Yes

38.6868 -121.1687 9/13/2007 9/2/2008 Yes

38.6885 -121.1682 9/13/2007 9/2/2008 Yes

38.6845 -121.1697 9/13/2007 9/2/2008 Yes

38.6844 -121.1695 9/13/2007 9/2/2008 No

38.6846 -121.1687 9/13/2007 9/2/2008 No

38.6856

38.5596

38.6876

38.6888

38.6823

38.6831

38.6835

38.6845

38.6865

9/2/2008 No

9/2/2008 Yes

9/22/2008 Yes

9/23/2008 Yes

9/24/2008 Yes

9/25/2008 Yes

9/26/2008 Yes

9/27/2008 Yes

9/28/2008 Yes

38.6852 -121.1675 9/30/2007 9/29/2008 Yes

38.5655 -121.4207 5/11/2007 5/16/2007 Yes

38.5647

38.5629

38.5652

38.5652

-121.1695 9/13/2007

-121.1672 9/13/2007

-121.4073 9/14/2007

-121.1678 9/30/2007

-121.1675 9/30/2007

-121.1725 9/30/2007

-121.1715 9/30/2007

-121.1710 9/30/2007

-121.1688 9/30/2007

-121.1667 9/30/2007

-121.4228 5/11/2007

-121.4198 5/11/2007

-121.4203 5/11/2007

-121.4207 5/11/2007

5/16/2007 Yes

5/16/2007 Yes

5/16/2007 Yes

5/16/2007 Yes

N/A

N/A

N/A

N/A

N/A

N/A

N/A N/A N/A

Cytochrome b COYOTE SN

Cytochrome b COYOTE SN

N/A N/A N/A

N/A N/A N/A

N/A N/A N/A

Cytochrome b CONTAM. N/A

Cytochrome b COYOTE SN

Cytochrome b DOG N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

D-loop

N/A

D-loop

D-loop

N/A

N/A

N/A

N/A

N/A

N/A N/A

Cytochrome b DOG

N/A N/A N/A

Cytochrome b CONTAM. N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

COYOTE SN

N/A

COYOTE

COYOTE

N/A

UNCLEAR

SN

Table 1. continued

Sample Mitochondrial

ID Location Latitude Longitude Collected Extracted DNA Sequence Species 1 Assignment 2

S08-0038 CSUS

S08-0039 CSUS

S08-0040 CSUS

S08-0041 CSUS

S08-0042 CSUS

S08-0044 CSUS

S08-0063 CSUS

S08-0064 CSUS

S08-0065 CSUS

S08-0475 CSUS

S08-0476 CSUS

S08-0477 CSUS

S08-0478 CSUS

S08-0479 CSUS

S08-0480 CSUS

S08-0481 CSUS

S08-0482 CSUS

S08-0483 CSUS

S08-0484 CSUS

S08-0485 CSUS

S08-0486 CSUS

S08-0487 CSUS

S08-0493 CSUS

S08-0494 CSUS

S08-0495 CSUS

S08-0496 CSUS

S08-0497 CSUS

S08-0498 CSUS

38.5653 -121.4208 5/11/2007 5/16/2007 Yes

38.5654 -121.3910 6/22/2007 7/17/2007 Yes

38.5677 -121.3837 6/22/2007 7/17/2007 Yes

38.5653 -121.3927 6/22/2007 7/17/2007 Yes

38.5637 -121.3985 6/22/2007 7/17/2007 No

38.5655 -121.4208 6/25/2007 7/17/2007 Yes

38.5632 3/31/2008 Yes

38.5644 -121.4203 8/21/2007 3/31/2008 Yes

38.5645 -121.4205 8/21/2007 3/31/2008 No

38.5645 -121.4205 8/21/2007 8/20/2008 Yes

38.5677 -121.4212 8/21/2007 8/20/2008 Yes

38.5685 -121.4215 8/21/2007 8/20/2008 Yes

38.5655 -121.4232 8/21/2007 8/20/2008 Yes

38.5654

38.5590

38.5597

38.5597

38.5608

38.5609

38.5618

38.5680

38.5680

8/20/2008 Yes

8/20/2008 Yes

8/20/2008 Yes

8/20/2008 Yes

8/20/2008 Yes

8/20/2008 Yes

8/20/2008 Yes

8/26/2008 Yes

8/26/2008 No

38.5644 -121.3865 8/27/2007 8/26/2008 Yes

38.5607 -121.4165 8/28/2007 8/26/2008 Yes

38.5606

38.5603

38.5618

38.5618

-121.4197 8/21/2007

-121.4230 8/21/2007

-121.4160 8/21/2007

-121.4032 8/21/2007

-121.4022 8/21/2007

-121.3977 8/21/2007

-121.3973 8/21/2007

-121.3943 8/21/2007

-121.3843 8/21/2007

-121.3848 8/21/2007

-121.4165 8/28/2007

-121.4135 8/28/2007

-121.4072 10/2/2007

-121.4072 10/2/2007

8/26/2008 No

8/26/2008 Yes

8/27/2008 Yes

8/28/2008 Yes

D-loop

D-loop

D-loop

D-loop

N/A

D-loop

D-loop

N/A

N/A

N/A

COYOTE SN

COYOTE SN

COYOTE UNCLEAR

COYOTE SN

N/A N/A

COYOTE UNCLEAR

COYOTE UNCLEAR

D-loop

N/A

COYOTE UNCLEAR

N/A N/A

N/A N/A N/A

Cytochrome b COYOTE SN

N/A

N/A

N/A

Cytochrome b DOG

N/A N/A

N/A N/A

Cytochrome b DOG

N/A N/A

N/A

N/A

N/A

Cytochrome b COYOTE SN

N/A N/A N/A

Cytochrome b DOG N/A

Cytochrome b COYOTE SN

Cytochrome b COYOTE SN

N/A N/A N/A

N/A

N/A

N/A

N/A

N/A

Cytochrome b DOG N/A

Cytochrome b CONTAM. N/A

N/A N/A N/A

Table 1. continued

Sample Mitochondrial

ID Location Latitude Longitude Collected Extracted DNA Sequence Species 1 Assignment 2

S08-0499 CSUS

S08-0500 CSUS

S08-0501 CSUS

S08-0502 CSUS

S08-0503 CSUS

S08-0504 CSUS

S08-0505 CSUS

S08-0506 CSUS

S08-0507 CSUS

S08-0527 CSUS

S08-0528 CSUS

S08-0529 CSUS

S08-0530 CSUS

S08-0531 CSUS

S08-0532 CSUS

S08-0533 CSUS

S08-0536 CSUS

S08-0537 CSUS

S08-0538 CSUS

S08-0539 CSUS

S08-0540 CSUS

S08-0541 CSUS

S08-0542 CSUS

S08-0543 CSUS

S08-0552 CSUS

S08-0553 CSUS

S08-0554 CSUS

S08-0555 CSUS

38.5620 -121.4057 10/2/2007 8/29/2008 Yes

38.5621 -121.4053 10/2/2007 8/30/2008 Yes

38.5628 -121.4022 10/2/2007 8/31/2008 Yes

38.5629 -121.4020 10/2/2007 9/1/2008 Yes

38.5629 -121.4017 10/2/2007 9/2/2008 Yes

38.5651 -121.3933 10/2/2007 9/3/2008 Yes

38.5639 9/4/2008 Yes

38.5651 -121.4063 10/2/2007 9/5/2008 Yes

38.5675 -121.4238 10/2/2007 9/6/2008 Yes

38.5591 -121.4098 9/14/2007 9/2/2008 Yes

38.5590 -121.4068 9/14/2007 9/2/2008 Yes

38.5591 -121.4052 9/14/2007 9/2/2008 Yes

38.5594 -121.4048 9/14/2007 9/2/2008 Yes

38.5596

38.5601

38.5616

38.5603

38.5598

38.5644

38.5617

38.5665

38.5650

9/2/2008 Yes

9/3/2008 Yes

9/2/2008 Yes

9/14/2008 Yes

9/15/2008 Yes

9/16/2008 No

9/17/2008 Yes

9/18/2008 Yes

9/19/2008 Yes

38.5625 -121.4037 9/14/2007 9/20/2008 Yes

38.5649 -121.4228 9/14/2007 9/21/2008 Yes

38.5609

38.5616

38.5638

38.5589

-121.3888 10/2/2007

-121.4042 9/14/2007

-121.3997 9/15/2007

-121.3950 9/14/2007

-121.4135 8/28/2007

-121.4027 8/28/2007

-121.3962 9/14/2007

-121.4070 9/14/2007

-121.3898 9/14/2007

-121.3937 9/14/2007

-121.4113 10/2/2007

-121.4072 10/2/2007

-121.3890 10/2/2007

-121.4123 10/2/2007

9/30/2008 Yes

10/1/2008 Yes

10/2/2008 Yes

10/3/2008 Yes

Cytochrome b CONTAM. N/A

N/A N/A N/A

N/A

N/A

N/A

N/A

N/A

N/A

Cytochrome b DOG

Cytochrome b DOG

Cytochrome b DOG

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

Cytochrome b DOG

Cytochrome b DOG

N/A N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

Cytochrome b DOG

Cytochrome b DOG

N/A N/A

Cytochrome b DOG

N/A N/A

Cytochrome b FAILED

N/A N/A

Cytochrome b DOG

N/A

N/A

N/A

N/A

N/A

N/A

N/A

Cytochrome b COYOTE SN

Cytochrome b DOG N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

Table 1. continued

Sample Mitochondrial

ID Location Latitude Longitude Collected Extracted DNA Sequence Species 1 Assignment 2

S08-0556 CSUS

S08-0557 CSUS

38.5591

38.5590

-121.4130 10/2/2007

-121.4093 10/2/2007

10/4/2008 Yes

10/5/2008 Yes

N/A

Cytochrome b

N/A

FAILED

N/A

N/A

S08-0043 Sunrise

Totals

38.6349 -121.2518 6/23/2007 7/17/2007 Yes

111 96

D-loop

--

COYOTE

COY=23

SN

SN=14

Percent of Total 90.0 -- 20.72 60.87

1 Species column displays results from mitochondrial sequencing as coyote, dog, contaminated sample (CONTAM.), failed to detect DNA

(FAILED), or no sequence was attempted (N/A).

2 Genetic assignment based on microsatellite genotypes (analyzed in program Structure) at the greater than or equal to 80% threshold with

K=2.

APPENDIX B

Table 1. Collection and extraction data for samples collected in the San Francisco study site.

Sample ID Type Location Collector Collected Extracted DNA

Mitochondrial

Sequencing Species 1 Assignment 2

S08-0113 scat Bernal Heights

S08-0114 scat Lake Merced

S08-0115 scat Lake Merced

S08-0116 scat Presidio

Janet Kessler

Janet Kessler

Janet Kessler

3/9/2008

4/3/2008

4/1/2008

4/7/2008

4/7/2008

4/7/2008

Yes

No

No

D-loop

N/A

N/A

S08-0117 scat Golden Gate Park Janet Kessler 3/15/2008 4/7/2008 No N/A

COYOTE

N/A

N/A

N/A

N/A

Janet Kessler 3/25/2008 4/7/2008 Yes Cytochrome b COYOTE N/A

N/A

N/A

N/A

S08-0118 scat Golden Gate Park Janet Kessler 3/17/2008 4/7/2008 Yes Cytochrome b DOG

S08-0119 scat Golden Gate Park Janet Kessler 3/23/2008 4/7/2008 No N/A N/A

S08-0120 scat Golden Gate Park Janet Kessler 3/26/2008 4/7/2008 Yes Cytochrome b DOG

N/A

N/A

N/A

S08-0121 scat Golden Gate Park Janet Kessler 3/26/2008 4/7/2008 Yes Cytochrome b DOG

S08-0122 scat Glen Park Janet Kessler 3/1/2008 6/1/2008 Yes Cytochrome b COYOTE

N/A

UNCLEAR

S08-0123 scat Glen Park

S08-0124 scat Glen Park

Janet Kessler

Janet Kessler

3/1/2008

3/1/2008

6/1/2008

6/1/2008

Yes

No

Cytochrome b

N/A

COYOTE

N/A

UNCLEAR

N/A

S08-0125 scat Glen Park

S08-0126 scat Glen Park

S08-0127 scat Lake Merced

S08-0128 scat Lake Merced

S08-0129 scat Lake Merced

Janet Kessler 2/25/2008 6/1/2008 Yes Cytochrome b COYOTE UNCLEAR

Janet Kessler 2/25/2008 6/1/2008 No N/A

Janet Kessler 4/4/2008 6/1/2008 No N/A

Janet Kessler 4/4/2008 6/1/2008 Yes Cytochrome b

N/A

Janet Kessler 4/4/2008 6/1/2008 Yes Cytochrome b DOG

N/A

DOG

N/A

N/A

N/A

N/A

S08-0130 scat Lincoln Park

S08-0131 scat Lincoln Park

S08-0171 scat Glen Park

S08-0172 scat Glen Park

S08-0173 scat Lake Merced

Janet Kessler 4/3/2008 6/1/2008 Yes Cytochrome b COYOTE UNCLEAR

Janet Kessler 4/3/2008 6/1/2008 Yes Cytochrome b DOG N/A

Janet Kessler 4/5/2008 6/1/2008 Yes Cytochrome b DOG N/A

Janet Kessler 4/5/2008 6/1/2008 No N/A N/A N/A

Janet Kessler 4/6/2008 6/1/2008 Yes Cytochrome b COYOTE UNCLEAR

Table. 1 continued

Mitochondrial

Sample ID Type Location Collector Collected Extracted DNA Sequencing Species 1 Assignment 2

S08-0174 scat Lake Merced

S08-0175 scat Lake Merced

Janet Kessler 4/6/2008 6/1/2008 Yes D-loop

Janet Kessler 4/6/2008 6/1/2008 Yes D-loop

DOG N/A

COYOTE CW

S08-0176 scat Golden Gate Park Janet Kessler 4/8/2008 6/1/2008 Yes Cytochrome b COYOTE UNCLEAR

S08-0177 scat Mc Lauren Park Janet Kessler 4/9/2008 6/1/2008 Yes D-loop DOG N/A

S08-0178 scat Mc Lauren Park Janet Kessler 4/14/2008 6/1/2008 Yes Cytochrome b DOG

S08-0179 scat Stowe Lake Janet Kessler 4/16/2008 6/1/2008 Yes D-loop DOG

N/A

N/A

S08-0180 scat Stowe Lake Janet Kessler 4/16/2008 6/1/2008 No N/A

S08-0181 scat Mc Lauren Park Janet Kessler 4/20/2008 6/1/2008 Yes D-loop

S08-0182 scat Presidio

S08-0183 scat Glen Park

Janet Kessler

Janet Kessler

4/21/2008 6/1/2008

4/22/2008 6/1/2008

No

Yes

N/A

D-loop

N/A

DOG

N/A

DOG

N/A

N/A

N/A

N/A

S08-0184 scat Glen Park

S08-0185 scat Glen Park

S08-0186 scat Presidio

S08-0187 scat Presidio

S08-0188 scat Presidio

S08-0189 scat Presidio

S08-0190 scat Glen Park

S08-0191 scat Kite hill

S08-0192 scat Kite hill

S08-0193 scat Kite hill

S08-0194 scat Kite hill

S08-0195 scat Kite hill

S08-0196 scat Kite hill

S08-0197 scat Kite hill

Janet Kessler 4/22/2008 6/1/2008 Yes Cytochrome b DOG

Janet Kessler 4/22/2008 6/1/2008 Yes D-loop DOG

Janet Kessler 4/24/2008 6/1/2008 Yes D-loop

Janet Kessler 4/24/2008 6/1/2008 No N/A

COYOTE

N/A

N/A

N/A

UNCLEAR

N/A

Janet Kessler 4/24/2008 6/1/2008 Yes D-loop

Janet Kessler 4/24/2008 6/1/2008 Yes D-loop

COYOTE UNCLEAR

DOG N/A

Janet Kessler 4/22/2008 6/1/2008 Yes Cytochrome b COYOTE UNCLEAR

Janet Kessler 4/27/2008 6/1/2008 Yes D-loop DOG N/A

Janet Kessler 4/27/2008 6/1/2008 Yes D-loop

Janet Kessler 4/27/2008 6/1/2008 Yes D-loop

Janet Kessler 4/27/2008 6/1/2008 Yes D-loop

Janet Kessler 4/27/2008 6/1/2008 Yes D-loop

Janet Kessler 4/27/2008 6/1/2008 Yes D-loop

Janet Kessler 4/27/2008 6/1/2008 Yes D-loop

DOG

DOG

DOG

DOG

DOG

DOG

N/A

N/A

N/A

N/A

N/A

N/A

Table. 1 continued

Mitochondrial

Sample ID Type Location Collector Collected Extracted DNA Sequencing Species 1 Assignment 2

S08-0198 scat Kite hill Janet Kessler 4/27/2008 6/1/2008 No N/A N/A N/A

Scat Totals

Percent Scat of Total

Sample ID Type Location Collector

GG1 carcass Golden Gate Park CA DFG

GG2

SID carcass Golden Gate Park CA DFG blood Presidio Ben Sacks

S08-0360 carcass

S08-0359 carcass

Lincoln Ave @ horse stables

Richardson and

Lombard Sts

SFAnimCare

Control

SFAnimCare

Control

Tissue/ blood Totals

47 35 10 CW=1

74.5 21.3 6.67

Collected Extracted DNA

Mitochondrial

Sequencing Species 1 Assignment 2

7/15/2007 ----

7/15/2007 ----

5/9/2003 ----

Yes N/A

Yes N/A

Yes N/A

COYOTE UNCLEAR

COYOTE UNCLEAR

COYOTE UNCLEAR

6/5/2008 7/14/2008 Yes N/A COYOTE UNCLEAR

3/16/2008 7/14/2008 Yes N/A

5 5

COYOTE UNCLEAR

5 N/A

Percent of Tissue/BloodTotal 100 100 N/A

1 Species column displays results from mitochondrial sequencing as coyote, dog, or no sequence was attempted (N/A).

2 Genetic assignment based on microsatellite genotypes (analyzed in program Structure) at the greater than or equal to 80% threshold with

K=2.

APPENDIX C

Table 1. Matrix of San Francisco individuals showing the relationship 1 between each pair that has the highest likelihood.

GG1 GG2

S08-

0116

S08-

0123

S08-

0125

S08-

0130

S08-

0173

S08-

0175

S08-

0176

S08-

0186

S08-

0188

S08-

0190

S08-

0359

S08-

0360 SID

GG1 -

GG2 FS

S08-0116 U

-

U

S08-0123 U

S08-0125 U

U

U

S08-0130 FS U

S08-0173 U U

S08-0175 U

S08-0176 U

U

U

-

HS

HS

HS

U

U

U

-

FS

U

U

U

FS

-

HS

HS

HS

PO

-

U

U

HS

-

FS

U

-

HS -

S08-0186 U

S08-0188 U

U

U

HS

HS

U

U

HS

U

FS

HS

U

U

U

U

HS

HS

S08-0190 HS FS HS U

S08-0359 U HS U HS

HS

U

U

HS

HS

HS

HS

U

U

U

-

FS

HS

HS

-

U

HS

-

FS -

S08-0360 U U HS U HS HS HS U U FS FS FS

SID U HS U U U U U U U U HS U

1 Relationships are defined as: U = Unrelated ; HS = Half Sibs; FS = Full Sibs; PO = Parent / Offspring.

FS

U

-

HS -

45

LITERATURE CITED

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and D.J. Lipman. 1990. Basic Local

Alignment Search Tool. Journal of Molecular Biology 215: 403–410.

Adams, J.R., Kelly, B.T. and L.P. Waits. 2003. Using faecal DNA sampling and GIS to monitor hybridization between red wolves ( Canis rufus ) and coyotes ( Canis latrans ). Molecular Ecology 12:2175–2186.

Atkinson, K.T. and D.M. Shakleton. 1991. Coyote, Canis latrans , ecology in a rural- urban environment. Canadian Field Naturalist 105:49-54.

Bekoff, M. and E.M. Gese. 2003. Coyote ( Canis latrans ). pp. 467–481 in G.A.

Feldhamer, B.C. Thompson and J.A. Chapman, eds. Wild mammals of North

America: biology, management, and conservation . Johns Hopkins University

Press, Baltimore, USA.

Bounds, D.L. and W.W. Shaw. 1997. Movements of suburban and rural coyotes at

Saguaro National Park, Arizona. The Southwestern Naturalist 42:94-99.

California Department of Housing and Community Development. Last updated 2000. http://www.hcd.ca.gov/hpd/hrc/rtr/sacto.jpg. Accessed April,18, 2008.

California Department of Water Resources. Last updated 4/18/2008. http://cdec.water.ca.gov/cgi-progs/queryDaily?FOL. Accessed April 19, 2008.

California State University, Sacramento. Last updated 2008. http://www.csus.edu/envs/Area/Sacramento.html. Accessed April 19, 2008.

Chetkiewicz, C.B., St. Clair, C.C., and M.S. Boyce. 2006. Corridors for Conservation:

Integrating Pattern and Process. Annual Review of Ecology, Evolution, and

Sytematics 37:317-342.

Crooks, Kevin R. 2002. Relative sensitivities of Mammalian Carnivores to habitat

46 fragmentation. Conservation Biology 16:488-502.

Excoffier, L., P. Smouse and J. Quattro. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131:479-491.

Falush D., M. Stephens, and J. Pritchard. 2003. Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics

164:1567–1587.

Feiglehy., P. 1992. The ecology of the raccoon in suburban Long Island, New York and its relation to soil contamination with Baylisascarisp rocyoniso va . Ph.D.

Dissertation, State University of New York, Syracuse, New York, USA.

Forman, R.T.T. and M. Gordon. 1986. Landscape Ecology. John Wiley & Sons, New

York.

Frankham, R., J.D. Ballou and D.A. Briscoe. 2002. Introduction to Conservation

Genetics. Cambridge University Press, New York, USA pp. 324-329.

Gese, E.M. and M. Bekoff. 2004. Canids: foxes, wolves, jackals and dogs. IUCN

Action plan 2004. Chapter 4.1: Central and North America (Neararctic), Coyote, pp. 81-87.

Gill, D. and P. Bonnet. 1973. Nature in the urban landscape: a study of city ecosystems.

York Press. Baltimore, Maryland.

Grinder, M. and P.R. Krausman. 2001a. Home Range, habitat use, and nocturnal activity

of coyotes in an urban environment. Journal of Wildlife Management 65:887-

898.

Grinder, M. and P.R. Krausman. 2001b. Morbidity-mortality factors and survival of coyotes in an urban environment. Journal of Wildlife Diseases 37:312-317.

47

Hadidian,J., D. A. Manski, and S. Riley. 1991. Daytime resting site selection in an urban raccoon population. Pages 39-45 in L. W. Adams and D. L. Leedy, editors.

Wildlife conservation in metropolitan environments. National Institute for Urban

Wildlife Symposium Series 2, Columbia, Maryland, USA.

Hoffman, C.O. and J.L. Gottschang. 1977. Numbers, distribution, and movements of a raccoon population in a suburban residential community. Journal of Mammalogy

58:623-636.

Hocker, Lauren (assigned DERA analyst). 2008. American River Parkway plan update.

Environmental Impact Report, released 7 March, page 6-6.

Kalinowski, A.T.,Wagner, A.P. and M.L. Taper. 2006. ML-Relate: a computer program for maximum likelihood estimation of relatedness and relationship. Molecular

Ecology Notes 6:576-579.

Lucchini, V., Fabri, E., Marucco, F., Ricci, S., Biotani, L.,and E. Randi. 2002.

Noninvasive molecular tracking of colonizing wolf ( Canis lupus ) packs in the western Italian Alps. Molecular Ecology 11:857-868.

Manel, S., O.E. Gaggiotti and R.S. Waples. Assignment methods: matching biological questions with appropriate techniques. Trends in Ecology and Evolution

20:136-142.

48

McClure, M.F., Smith N.S. and W.W. Shaw. 1995. Diets of coyotes near the boundary of Saguaro National Monument and Tucson, Arizona. The Southwestern

Naturalist 40:101-125.

McCullough, D.R., Jennings, K.W., Gates, N.B., Eilliot, B.G. and J.E. DiDonato. 1997.

Overabundant deer populations in California. Wildlife Society Bulletin 25:478-

483.

Miller, J.R. and R.J. Hobbs. 2002. Conservation where people live and work.

Conservation Biology 16:330-337.

Moore, G. C. and G.R. Parker. 1992. Colonization by the eastern coyote ( Canis latrans ).

Pp. 23–37 in A. Boer, ed. Ecology and management of the eastern coyote .

Wildlife Research Unit, University of New Brunswick, Fredericton, Canada.

Morey, P.S., Gese, E.M., and S. Gehrt. 2007. Spatial and temporal variation in the diet of coyotes in the Chicago metropolitan area. American Midland Naturalist

158:147-161.

Murphy, M.A., Waits, L.P., Kendall, K.C., Wasser, S.K., Higbee, J.A., and R. Bogden.

2002. An Evaluation of long-term preservation methods for brown bear ( Ursus arctos ) faecal DNA samples. Conservation Genetics 3:435–440.

Murphy, M.A., Kendall, K.C., Robinson A., and L.P. Waits. 2006. The impact of time field conditions on brown bear (Ursus arctos) faecal DNA amplification.

Conservation Genetics 8:1219-1224.

Nei, M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89:583-590.

Noss, R.F., Quigley, H.B., Hornocker, M.G., Merrill, T., and P.C. Paquet. 1996.

Conservation biology and carnivore conservation in the Rocky Mountains.

Conservation Biology 10:949-963.

Peakall, R. and P.E. Smouse. 2006. Genalex 6: genetic analysis in Excel. Population

49 genetic software for teaching and research. Molecular Ecology Notes 6:288-295.

Piggot, M.P. 2004. Effect of sample age and season of collection on the reliability of microsatellite genotyping of faecal DNA. Wildlife Research 31:485-493.

Pritchard, J.K., Stephens, M., and P. Donnelly. 2000. Inference of population structure using multilocus genotype data. Genetics 155:945-959.

Queller, D.C. and K.F. Goodnight. 1989. Estimating relatedness using genetic markers.

Evolution 43:258-275.

Quinn, T. 1997a. Coyote ( Canis latrans ) habitat selection in urban areas of western

Washington via analysis of routine movement. Northwest Science 71:289-297.

Quinn, T. 1997b. Coyote ( Canis latrans ) food habits in three urban habitat types of

Western Washington. Northwest Science 71:1-5.

Riley, S.P.D., Sauvajot, R.M., Fuller, T.K., York, E.C., Kamradt, D.A., Bromley, C., and R.K. Wayne. 2003. Effects of Urbanization and Habitat Fragmentation on Bobcats and Coyotes in Southern California. Conservation Biology 17:

566-576.

Riley, S. P. D., Hadidian, J., and D. A. Manski. 1998. Population density, survival, and rabies in raccoons in an urban national park. Canadian Journal of Zoology

76:1153-1164.

50

Rosatte, R. C., Power, M.J., and C. D. Macinnes. 1991. Ecology of urban skunks, raccoons, and foxes in metropolitan Toronto. Pages 31-38 in L. W. Adams and D.

L. Leedy, editors. Wildlife conservation in metropolitan environments. National

Institute for Urban Wildlife Symposium Series 2, Columbia, Maryland, USA.

Rubenstein, S. 2003. Coyote makes S.F. a truly wild town. Page A1 in San Francisco

Chronicle, 14 November.

Sacks, B.N., Bannasch, D.L., Chomel, B.B., and H.B. Ernest. 2008. Coyotes demonstrate how habitat specialization by individuals of a generalist species can diversify populations in a heterogeneous ecoregion. Molecular Biology and

Evolution 25:1384-1394.

Sacks, B.N., Brown, S.K., and H.B. Ernest. 2004. Populations structure of California coyotes corresponds to habitat-specific breaks and illuminates species history.

Molecular Ecology 13:1265-1275.

Sacks, B.N., Ernest, H.B. and E.E. Boydston. 2006. San Francisco’s golden gate: a bridge between historically distinct coyote ( Canis latrans ) populations? Western

North American Naturalist 66:263-264.

Sacks, B.N., Mitchell, B.R., Williams, C.L., and H.B. Ernest. 2005. Coyote movements and social structure along a cryptic population genetic subdivision. Molecular

Ecology 14:1241-1249.

Sacks, B. N., Jaeger, M.M., Neale, J. C. C. and D.R. McCullough. 1999b. Territoriality and breeding status of coyotes relative to sheep predation. Journal of Wildlife

Management 63: 593-605.

Schinner,J.R ., and D. L. Cauley. 1974. The ecology of urban raccoons in Cincinnati,

51

Ohio. Pages 125-130 in J. H. Noyes and D. R. Progulske, editors. Wildlife in an urbanizing environment. Planning and Resource Development Series Number 28,

Holdsworth Natural Resources Center, Amherst, Massachusetts, USA.

Schneider, S., D. Roessli and L. Excoffier. 2000. Arlequin ver. 2.000: a software for population genetics data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland.

Shivik, J. A. 1995. Factors influencing space use and activity of Sagehen Basin coyotes.

M. S. Thesis. University of California, Berkeley.

Simberloff, D., Farr, J.A., Cox, J., and D.W. Mehlman. 1992. Movement corridors: conservation bargains or poor investments? Conservation Biology 6:493-504.

Taberlet, P., Waits, L.P., and G. Luikart. 1999. Noninvasive genetic sampling: look before you leap. Trends in Evolution and Ecology 14:323-327.

Timm, R.M. and R.O. Baker. 2007. A History of Urban Coyote Problems. Proceedings of the 12 th

Wildlife Damage Management Conference (D.L. Nolte, W.M.

Arjo, D.H. Stalman, Eds), 272-286.

US Census Bureau. 2004. Population density for counties: July 1, 2004. http://www.census.gov/popest/gallery/maps/popden_c4.html. Accessed 28 April

2008.

Väha J.P. and C.R. Primmer. 2006. Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Molecular Ecology 15:63–72.

52

Weir, B.S. and C.C. Cockerham. 1984. Estimating F-statistics for the analysis of population structure. Evolution 38:1358-1370.

Wilcove, D.S., D. Rothenstien, J. Dubow, A. Phillips and E. Losos. 1998. Quantifying threats to imperiled species in the United States. Bioscience 48:607-615.

Wilson, G.A. and B. Rannala. 2003. Bayesian inference of recent migration rates using multilocus genotypes. Genetics 163:1177-1191.