Microbial Genetics: DNA and RNA
What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
•
•
The Need for Protein Making Instructions
•
Phenotype = genotype (+ environment)
•
1 chromosome gene ---> 1 protein
•
DNA-->RNA (copy)-->protein production
Structure of DNA, The Genetic Material
•
Two polynucleotide strands with H bonds
•
•
•
•
RNA is single stranded, difft sugar, uracil
How DNA copies itself when a cell divides
•
DNA replication by unzipping
•
DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
Transcription: Making a short DNA copy
•
•
•
DNA + protein make up a chromosome
RNA polymerase makes RNA from DNA
•
Only one set of instructions (gene) is copied
•
Copy is complementary to the DNA gene
•
In eukaryotes, the RNA copy is edited
The Three Kinds of RNA
•
mRNA: carries instructions for 1 protein
•
rRNA: structural support in ribosomes
•
tRNA: amino acid trucks with anticodons
Steps of Translation (Protein Synthesis)
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in
building proteins for the cell.
Flow of Genetic Information
Figure 8.2
DNA is a Double-Stranded Chain of Nucleotides
DNA
Figure 8.4
Microbial Genetics: DNA and RNA
What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
•
•
The Need for Protein Making Instructions
•
Phenotype = genotype (+ environment)
•
1 chromosome gene ---> 1 protein
•
DNA-->RNA (copy)-->protein production
Structure of DNA, The Genetic Material
•
Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome
•
•
•
RNA is single stranded, difft sugar, uracil
How DNA copies itself when a cell divides
•
DNA replication by unzipping
•
DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
Transcription: Making a short DNA copy
•
RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied
• Copy is complementary to the DNA gene
• In eukaryotes, the RNA copy is edited
•
The Three Kinds of RNA
• mRNA: carries instructions for 1 protein
• rRNA: structural support in ribosomes
• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in
building proteins for the cell.
DNA Replication is Semiconservative
Figure 8.3
DNA
• DNA replication is semiconservative
Figure 8.7
DNA Replication Involves Several Enzymes
Figure 8.6
Central
Dogma are
of Biology:
How Shape
Form Are
Dictated
By DNA Genes
DNA Genes
Instructions
for and
Making
Specific
Polypeptides
Genotype:
The genes
carried in a
cell for a
particular
trait
Phenotype:
The physical
expression of
genes for a
particular trait
QuickTime™ and a
decompressor
are needed to see this picture.
A segment of
DNA (gene)
carries
specific coded
instructions
for the making
of a single
proteins.
Microbial Genetics: DNA and RNA
What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
•
•
The Need for Protein Making Instructions
•
Phenotype = genotype (+ environment)
•
1 chromosome gene ---> 1 protein
•
DNA-->RNA (copy)-->protein production
Structure of DNA, The Genetic Material
•
Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome
•
•
•
RNA is single stranded, difft sugar, uracil
How DNA copies itself when a cell divides
•
DNA replication by unzipping
•
DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
Transcription: Making a short DNA copy
•
RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied
• Copy is complementary to the DNA gene
• In eukaryotes, the RNA copy is edited
•
The Three Kinds of RNA
• mRNA: carries instructions for 1 protein
• rRNA: structural support in ribosomes
• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in
building proteins for the cell.
Transcription is Performed by RNA Polymerase
Translation or Protein Synthesis
Figure 8.2
Anatomy
ofaaChain
Messenger
RNA
mRNA is
of Nucleotides
Trailer
Leader
Figure 10.17
Microbial Genetics: DNA and RNA
What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
•
•
The Need for Protein Making Instructions
•
Phenotype = genotype (+ environment)
•
1 chromosome gene ---> 1 protein
•
DNA-->RNA (copy)-->protein production
Structure of DNA, The Genetic Material
•
Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome
•
•
•
RNA is single stranded, difft sugar, uracil
How DNA copies itself when a cell divides
•
DNA replication by unzipping
•
DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
Transcription: Making a short DNA copy
•
RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied
• Copy is complementary to the DNA gene
• In eukaryotes, the RNA copy is edited
•
The Three Kinds of RNA
• mRNA: carries instructions for 1 protein
• rRNA: structural support in ribosomes
• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in
building proteins for the cell.
3 Types of RNA – Each With a Different Job
Messenger RNA (mRNA)
Carries copy of gene information
to the ribosome to make protein
anticodon
Transfer RNA
(tRNA)
CUG
=
CUG
Carries amino acids to the ribosome for
linking; identified by anticodon “sign”
Ribosomal RNA (rRNA)
Part of the structure of
the ribosome; key
component in amino
acid linking machinery
How Gene Instructions are Communicated
mRNA Codon Dictionary of the Genetic Code
Central Dogma: DNARNAProtein
DNA template strand:
CGTTTACGACCGGCCTTAGATCCTGACG
Transcription
mRNA:
GCAAAUGCUGGCCGGAAUCUAGGACUGC
Translation
Protein:
by RNA polymerase
by ribosome
Met - Leu - Ala - Gly - Ile
Translation in Prokaryotes Can Occur Simultaneously With Transcription
Figure 8.11
A Ribosome Has Two Subunits and Three tRNA Binding Sites
Translation: Initiation, Elongation, Termination
Initiation
Elongation (3-4 steps)
Termination
Steps of Translation
Protein Synthesis Movie