AAAI05 Tutorial on Bioinformatics & Machine Learning Jinyan Li & Limsoon Wong Institute for Infocomm Research 21 Heng Mui Keng Terrace Singapore Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Tutorial Plan 1. Intro to Biology & Bioinformatics 2. TIS Prediction feature generation & feature selection 3. Tx Optimization for Childhood ALL emerging patterns & PCL 6. Subgraphs in Protein Interactions closed patterns 7. Mining Errors from Bio Databases association rules 4. Analysis of Proteomics Data 5. Prognosis based on Gene Expression decision tree ensembles & CS4 extreme sample selection & ERCOF Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Coverage • Data: – DNA sequences, gene expression profiles, proteomics mass-spectra, protein sequences, protein structures, & biomedical text/annotations • Feature selection: – 2, t-statistics, signal-to-noise, entropy, CFS • Machine learning and data mining: – Decision trees, SVMs, emerging patterns, closed patterns, graph theories Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Body and Cell • Our body consists of a number of organs • Each organ composes of a number of tissues • Each tissue composes of cells of the same type • Cells perform two types of function – Chemical reactions needed to maintain our life – Pass info for maintaining life to next generation • In particular – Protein performs chemical reactions – DNA stores & passes info – RNA is intermediate between DNA & proteins Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong DNA • Stores instructions needed by the cell to perform daily life function • Consists of two strands interwoven together and form a double helix • Each strand is a chain of some small molecules called nucleotides Francis Crick shows James Watson the model of DNA in their room number 103 of the Austin Wing at the Cavendish Laboratories, Cambridge Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Classification of Nucleotides • 5 diff nucleotides: adenine(A), cytosine(C), guanine(G), thymine(T), & uracil(U) • A, G are purines. They have a 2-ring structure • C, T, U are pyrimidines. They have a 1-ring structure • DNA only uses A, C, G, & T A C Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong G T U Watson-Crick Rule • DNA is double stranded in a cell • One strand is reverse complement of the other • Complementary bases: – A with T (two hydrogen-bonds) – C with G (three hydrogen-bonds) C A T 10Å Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong G 10Å Chromosome • DNA is usually tightly wound around histone proteins and forms a chromosome • The total info stored in all chromosomes constitutes a genome • In most multi-cell organisms, every cell contains the same complete set of chromosomes – May have some small diff due to mutation • Human genome has 3G bases, organized in 23 pairs of chromosomes Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Gene • A gene is a sequence of DNA that encodes a protein or an RNA molecule • About 30,000 – 35,000 (protein-coding) genes in human genome • For gene that encodes protein – In Prokaryotic genome, one gene corresponds to one protein – In Eukaryotic genome, one gene may correspond to more than one protein because of the process “alternative splicing” Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Central Dogma • Gene expression consists of two steps – Transcription DNA mRNA – Translation mRNA Protein Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Genetic Code • Start codon: ATG (code for M) • Stop codon: TAA, TAG, TGA Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Protein • A sequence composed from an alphabet of 20 amino acids – Length is usually 20 to 5000 amino acids – Average around 350 amino acids • Folds into 3D shape, forming the building block & performing most of the chemical reactions within a cell Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Classification of Amino Acids • Amino acids can be classified into 4 types • Positively charged (basic) – Arginine (Arg, R) – Histidine (His, H) – Lysine (Lys, K) • Negatively charged (acidic) – Aspartic acid (Asp, D) – Glutamic acid (Glu, E) Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Classification of Amino Acids • Polar (overall uncharged, • Nonpolar (overall but uneven charge uncharged and uniform distribution. can form charge distribution. cant hydrogen bonds with form hydrogen bonds water. they are called with water. they are hydrophilic) called hydrophobic) – – – – – – – Asparagine (Asn, N) Cysteine (Cys, C) Glutamine (Gln, Q) Glycine (Gly, G) Serine (Ser, S) Threonine (Thr, T) Tyrosine (Tyr, Y) Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong – – – – – – – – Alanine (Ala, A) Isoleucine (Ile, I) Leucine (Leu, L) Methionine (Met, M) Phenylalanine (Phe, F) Proline (Pro, P) Tryptophan (Trp, W) Valine (Val, V) Bioinformatics Applications • • • • • Bio Data Searching Gene finding Cis-regulatory DNA Gene/Protein Network Protein/RNA Structure Prediction • Evolutionary Tree reconstruction • Infer Protein Function • Disease Diagnosis, Prognosis, & Treatment Optimization, ... Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Part 2: Translation Initiation Site Recognition Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong A Sample cDNA 299 HSU27655.1 CAT U27655 Homo sapiens CGTGTGTGCAGCAGCCTGCAGCTGCCCCAAGCCATGGCTGAACACTGACTCCCAGCTGTG CCCAGGGCTTCAAAGACTTCTCAGCTTCGAGCATGGCTTTTGGCTGTCAGGGCAGCTGTA GGAGGCAGATGAGAAGAGGGAGATGGCCTTGGAGGAAGGGAAGGGGCCTGGTGCCGAGGA CCTCTCCTGGCCAGGAGCTTCCTCCAGGACAAGACCTTCCACCCAACAAGGACTCCCCT ............................................................ ................................iEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE • What makes the second ATG the TIS? Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong 80 160 240 80 160 240 Approach • Training data gathering • Signal generation – k-grams, distance, domain know-how, ... • Signal selection – Entropy, 2, CFS, t-test, domain know-how... • Signal integration – SVM, ANN, PCL, CART, C4.5, kNN, ... Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Training & Testing Data • • • • • • Vertebrate dataset of Pedersen & Nielsen 3312 sequences 13503 ATG sites 3312 (24.5%) are TIS 10191 (75.5%) are non-TIS Use for 3-fold x-validation expts Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong [ISMB’97] Signal Generation • K-grams (ie., k consecutive letters) – – – – K = 1, 2, 3, 4, 5, … Window size vs. fixed position Up-stream, downstream vs. any where in window In-frame vs. any frame Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Too Many Signals • For each k, there are 4k * 3 * 2 k-grams • If we use k = 1, 2, 3, 4, 5, we have 24 + 96 + 384 + 1536 + 6144 = 8184 features! • This is too many for most machine learning algorithms Need to do signal selection – t-stats, 2, CFS, signal-to-noise, entropy, gini index, info gain, info gain ratio, ... Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Signal Selection Basic Idea • Choose a signal w/ low intra-class distance • Choose a signal w/ high inter-class distance Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Signal Selection by T-Statistics Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Signal Selection by 2 Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Sample K-Grams Selected by CFS Leaky scanning Kozak consensus • Position –3 • in-frame upstream ATG • in-frame downstream Stop codon – TAA, TAG, TGA, – CTG, GAC, GAG, and GCC Codon bias? Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Signal Integration • kNN – Given a test sample, find the k training samples that are most similar to it. Let the majority class win • SVM – Given a group of training samples from two classes, determine a separating plane that maximises the margin of error • Naïve Bayes, ANN, C4.5, CS4, ... Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Results (3-fold x-validation) TP/(TP + FN) TN/(TN + FP) TP/(TP + FP) Accuracy Naïve Bayes 84.3% 86.1% 66.3% 85.7% SVM 73.9% 93.2% 77.9% 88.5% Neural Network 77.6% 93.2% 78.8% 89.4% Decision Tree 74.0% 94.4% 81.1% 89.4% Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Technique Comparisons • Pedersen&Nielsen [ISMB’97] – Neural network – No explicit features • Zien [Bioinformatics’00] – SVM+kernel engineering – No explicit features • Hatzigeorgiou [Bioinformatics’02] – Multiple neural networks – Scanning rule – No explicit features Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong • This approach – Explicit feature generation – Explicit feature selection – Use any machine learning method w/o any form of complicated tuning – Scanning rule is optional mRNAprotein A T How about using k-grams from the translation? E F L L P R S stop S Y C H W R Q I M V T N K A D E Copyright © 2003, 2004, 2005 by Jinyan Li and Limsoon Wong G Amino-Acid Features Copyright © 2003, 2004, 2005 by Jinyan Li and Limsoon Wong Amino-Acid Features Copyright © 2003, 2004, 2005 by Jinyan Li and Limsoon Wong Amino Acid K-Grams Discovered (by entropy) Copyright © 2003, 2004, 2005 by Jinyan Li and Limsoon Wong Validation Results (on Chr X and Chr 21) Our method ATGpr • Using top 100 features selected by entropy and train SVM on Pedersen & Nielsen’s Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Part 3: Treatment Optimization of Childhood Leukemia Image credit: FEER Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Childhood ALL • Major subtypes are: – T-ALL, E2A-PBX, TELAML, MLL genome rearrangements, BCRABL, Hyperdiploid>50 • The subtypes look similar • Diff subtypes respond differently to same Tx Over-intensive Tx • Conventional diagnosis – Development of secondary cancers – Reduction of IQ – Immunophenotyping – Cytogenetics – Molecular diagnostics Under-intensiveTx – Relapse Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Unavailable in most ASEAN countries Single-Test Platform of Microarray & Machine Learning Image credit: Affymetrix Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Overall Strategy Diagnosis of subtype Subtypedependent prognosis • For each subtype, select genes to develop classification model for diagnosing that subtype Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Riskstratified treatment intensity • For each subtype, select genes to develop prediction model for prognosis of that subtype Subtype Diagnosis by PCL • • • • Gene expression data collection Gene selection by 2 PCL Classifier training by emerging pattern Classifier tuning (optional for some machine learning methods) • Apply PCL for diagnosis of future cases Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Emerging Patterns • An emerging pattern is a set of conditions – usually involving several features – that most members of a class satisfy – but none or few of the other class satisfy Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong PCL: Prediction by Collective Likelihood Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Childhood ALL Subtype Diagnosis Workflow A tree-structured diagnostic workflow was recommended by our doctor collaborator Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Training and Testing Sets Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Accuracy of Various Classifiers The classifiers are all applied to the 20 genes selected by 2 at each level of the tree Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Understandability of EP & PCL • E.g., for T-ALL vs. OTHERS, one ideally discriminatory gene 38319_at was found, inducing these 2 EPs • These give us the diagnostic rule Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Conclusions Conventional Tx: • intermediate intensity to everyone 10% suffers relapse 50% suffers side effects costs US$150m/yr Our optimized Tx: • high intensity to 10% • intermediate intensity to 40% • low intensity to 50% • costs US$100m/yr Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong •High cure rate of 80% • Less relapse • Less side effects • Save US$51.6m/yr Part 4: Topology of Protein Interaction Networks: Hubs, Cores, Bipartites Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Protein Representations • Four types of representations for proteins: primary, secondary, tertiary, and quaternay • Protein interactions play an important role in inter cellular communication, in signal transduction, in the regulation of gene expression Courtesy of JE Wampler Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Interaction Determination Approaches Computational Methods Sequence based Experimental Methods (Phage Display, mutagenesis, two hybrid) Structure based (Docking) Domain Domain Interactions Motif Discovery Complex based Copyright © 2005 by Jinyan Li and Limsoon Wong Protein Interaction Databases • PDB---Protein Databank (http://www.rcsb.org/pdb/; reference article: H.M. Berman, etal: The Protein Data Bank. NAR, 28 pp. 235-242 (2000) ) structure info; complex info. • BIND---The Biomolecular Interaction Network Database (http://binddb.org; Bader et al. NAR, 29. 2001) • The GRID: The General Repository for Interaction Datasets http://biodata.mshri.on.ca/grid/servlet/Index • DIP---Database of Interacting Proteins (http://dip.doe-mbi.ucla.edu/). Xml format. Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Graph Representation of Protein Interactions Maslov & Sneppen, Science, v296, 2002 318 edges 329 nodes In nucleus of S. cerevisiae A power law: Most neighbors of highly connected nodes have rather low connectivity. The highly connected nodes are called hubs Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong K-cores in Protein Interaction Graphs Yeast SH3 domain-domain Interaction network: 394 edges, 206 nodes Tong et al. Science, v295. 2002 Copyright © 2005 by Jinyan Li and Limsoon Wong 8 proteins containing SH3 5 binding at least 6 of them Bipartite Subgraphs SH3 Proteins Copyright © 2005 by Jinyan Li and Limsoon Wong SH3-Binding Proteins Some Definitions • A graph G=VG, EG, where VG is a set of vertices and EG is a set of edges. No self loops, no parallel edges, undirected • A graph H= VH, EH is a subgraph of G, if VH is contained in VG and EH is contained in EG • H = V1V2, EH is bipartite subgraph of G if – H is a subgraph of G, and – V1V2 = {}, and – every edge in EH joins a vertex in V1 and a vertex in V2 Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Example Bipartite Subgraph of Protein Interaction Network V1 Copyright © 2005 by Jinyan Li and Limsoon Wong V2 Maximal Complete Bipartite Subgraphs • A complete bipartite subgraph H = V1V2, EH of G is said to be maximal if there is no other complete bipartite subgraph H’ = V’1 V’2, EH’ of G such that V1 V’1 and V2 V’2 Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Study of Protein Interaction Network Topology • List all maximal complete bipartite subgraphs from a protein interaction network (Step 1) • Discover motifs from these protein groups (Step 2) • Form binding motif pairs (Step 3) The problem previously studied by Epptein (1994, Info Proc Lett); Makino & Uno (2004, SWAT); Zaki & Ogihara (1998). Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Efficient Mining of Maximal Complete Bipartite Subgraphs • Equiv to mining of closed patterns from adjacency matrix of G • Why: – the number of closed patterns is even, – is precisely double of the number of the maximal complete bipartite subgraphs, and – there is one-to-one correspondence betw a maximal complete bipartite subgraph & a closed pattern pair • Many state-of-the-art algorithms for mining closed patterns Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Adjacency Matrix: A Special Transactional Database (TDB) • Let G be a graph with VG = {v1, v2, …, vp} • Adjacency matrix A of G is a p x p matrix defined by 1 if (vi, vj) EG A[i,j] = 0 otherwise A is symmetrical, main diagonal is 0 Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong TDB, Freq Patterns, Equiv Classes, & Closed Patterns C g f TDB (C ) Pasquier etal, ICDT 99; Grahne & Zhu, FIMI03 Copyright © 2005 by Jinyan Li and Limsoon Wong Support threshold = 2 Some Expt Results 4904 proteins, 17440 interactions, ave size of neighborhood is 3.56 A protein interaction network taken from GRID Breitkreutz, Genome Biol. 2003 Mining algorithm---FPclose* Grahne & Zhu, 2003 Copyright © 2005 by Jinyan Li and Limsoon Wong Fixed Point Idea • The idea: f(x)=x • Instantiation in life science, f(DNA)=DNA, f(proteinType) = proteinType (Meng et al. Bioinformatics, 2004) • The variable x can be a pair of AA segment patterns, then after the transformations by f, the stable pattern is binding motif pair. (Li and Li, Bioinformatics, 2005) Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Part 5: Treatment Prognosis for DLBC Lymphoma Image credit: Rosenwald et al, 2002 Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Diffuse Large B-Cell Lymphoma • DLBC lymphoma is the most common type of lymphoma in adults • Can be cured by anthracycline-based chemotherapy in 35 to 40 percent of patients DLBC lymphoma comprises several diseases that differ in responsiveness to chemotherapy Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong • Intl Prognostic Index (IPI) – age, “Eastern Cooperative Oncology Group” Performance status, tumor stage, lactate dehydrogenase level, sites of extranodal disease, ... • Not very good for stratifying DLBC lymphoma patients for therapeutic trials Use gene-expression profiles to predict outcome of chemotherapy? Our Approach “extreme” sample selection ERCOF Copyright © 2005 by Jinyan Li and Limsoon Wong Extreme Sample Selection Short-term Survivors v.s. Long-term Survivors Short-term survivors who died within a short period Long-term survivors who were alive after a long follow-up time F(T) < c1 and E(T) = 1 F(T) > c2 T: sample F(T): follow-up time E(T): status (1:unfavorable; 0: favorable) c1 and c2: thresholds of survival time Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong ERCOF EntropyBased Rank Sum Test & Correlation Filtering Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong SVM Kernel Function • llm(X) = sign(kk*Yk* (Xk•X) + b) Linear Learning Machine • svm(X) = sign(kk*Yk* (Xk• X) + b) svm(X) = sign(kk*Yk* K(Xk,X) + b) where K(Xk,X) = (Xk• X) Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong SVM = LLM + Kernel Risk Score Construction Linear Kernel SVM regression function G (T ) ai yi K (T , x (i )) b i T: test sample, x(i): support vector, yi: class label (1: short-term survivors; -1: long-term survivors) Transformation function (posterior probability) S (T ) 1 1 e G ( T ) ( S (T ) (0,1)) S(T): risk score of sample T Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Knowledge Discovery from Gene Expression of “Extreme” Samples 240 samples 7399 genes From Rosenwald et al., NEJM 2002 “extreme” sample selection: < 1 yr vs > 8 yrs knowledge discovery from gene expression 47 shortterm survivors 26 longterm survivors 84 genes T is long-term if S(T) < 0.3 T is short-term if S(T) > 0.7 Copyright © 2005 by Jinyan Li and Limsoon Wong 80 samples Kaplan-Meier Plots 80 test cases Improvement over IPI p-value of log-rank test: < 0.0001 Risk score thresholds: 0.7, 0.3 Cases rated as IPI low can still be split p-value = 0.0063 Copyright © 2005 by Jinyan Li and Limsoon Wong Merit of “Extreme” Samples W/o sample selection (p =0.38) W/ sample selection (p < 0.0001) No clear difference on the overall survival of the 80 samples in the validation group of DLBCL study, if no training sample selection conducted Copyright © 2005 by Jinyan Li and Limsoon Wong Effectiveness of ERCOF Total wins 22 38 46 Copyright © 2005 by Jinyan Li and Limsoon Wong 47 48 51 47 67 Conclusions • Selecting extreme cases as training samples is an effective way to improve patient outcome prediction based on gene expression profiles and clinical information • ERCOF is a systematic feature selection method that is very useful – ERCOF is very suitable for SVM, 3-NN, CS4, Random Forest, as it gives these learning algos highest no. of wins – ERCOF is suitable for Bagging also, as it gives this classifier the lowest no. of errors Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Part 6: Decision Tree Based In-Silico Cancer Diagnosis • Bagging, • Boosting, • Random Forest, • Randomization Trees, & • CS4 Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Structure of Decision Trees x1 Root node > a1 x2 x3 Internal nodes > a2 x4 A B B A B Leaf nodes A A • If x1 > a1 & x2 > a2, then it’s A class • C4.5 & CART, two of the most widely used • Easy interpretation, but accuracy generally unattractive Copyright © 2005 by Jinyan Li and Limsoon Wong Elegance of Decision Trees A B B A A • Diagnosis of central nervous system in hematooncologic patients (Lossos et al, Cancer, 2000) • Prediction of neurobehavioral outcome in head-injury survivors (Temin et al, J. of Neurosurgery, 1995) • Reconstruction of molecular networks from gene expression data (Soinov et al, Genome Biology, 2003) Copyright © 2005 by Jinyan Li and Limsoon Wong Decision Tree Construction • Steps – Select the “best” feature as the root node of the whole tree – After partition by this feature, select the best feature (wrt the subset of training data) as the root node of this sub-tree – Recursively, until the partitions become pure or almost pure Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong • 3 Measures to Evaluate Which Feature is Best – Gini index – Information gain – Information gain ratio Single coverage & Fragmentation Problem For Decision trees Motivating Example • • • • • h1, h2, h3 are indep classifiers w/ accuracy = 60% C1, C2 are the only classes t is a test instance in C1 h(t) = argmaxC{C1,C2} |{hj {h1, h2, h3} | hj(t) = C}| Then prob(h(t) = C1) = prob(h1(t)=C1 & h2(t)=C1 & h3(t)=C1) + prob(h1(t)=C1 & h2(t)=C1 & h3(t)=C2) + prob(h1(t)=C1 & h2(t)=C2 & h3(t)=C1) + prob(h1(t)=C2 & h2(t)=C1 & h3(t)=C1) = 60% * 60% * 60% + 60% * 60% * 40% + 60% * 40% * 60% + 40% * 60% * 60% = 64.8% Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Bagging: Bootstrap Aggregating, Breiman 1996 Original training set 50 p + 50 n Draw 100 samples with replacement (injecting radomness) 48 p + 52 n 49 p + 51 n … 53 p + 47 n A base inducer such as C4.5 A committee H of classifiers: h1 h2 Equal voting Copyright © 2005 by Jinyan Li and Limsoon Wong …. hk AdaBoost: Adaptive Boosting, Freund & Schapire 1995 100 instances with equal weight A classifier h1 error Samples misclassified by hi If error is 0 or >0.5 stop 100 instances with different weights Otherwise re-weight correctly classified instances by: e1/(1-e1) Renormalize total weight to 1 Copyright © 2005 by Jinyan Li and Limsoon Wong A classifier h2 error Random Forest Breiman 2001 Original training set 48 p + 52 n 50 p + 50 n 49 p + 51 n … 53 p + 47 n A base inducer (not C4.5 but revised) A committee H of classifiers: h1 h2 Equal voting Copyright © 2005 by Jinyan Li and Limsoon Wong …. hk A Revised C4.5 as Base Classifier Original n number of features Selection is from mtry number of randomly chosen features Root node Similar to Bagging, but the base inducer is not the standard C4.5 Make use twice of randomness Copyright © 2005 by Jinyan Li and Limsoon Wong Randomization Trees Dietterich 2000 Original n number of features Root node Select one randomly from {feature 1: choice 1,2,3 feature 2: choice 1, 2, .. . feature 8: choice 1, 2, 3 } Total 20 candidates Equal voting on the committee of such decision trees Make use of randomness in the selection of the best split point Copyright © 2005 by Jinyan Li and Limsoon Wong CS4: Cascading & Sharing for Decision Trees, Li et al 2003 root nodes 1 total k trees 2 k tree-1 tree-2 tree-k • Selection of root nodes is in a cascading manner! • Doesn’t make use of randomness • Not equal voting Copyright © 2005 by Jinyan Li and Limsoon Wong Summary of Ensemble Classifiers Bagging Random Forest AdaBoost.M1 Randomization Trees Copyright © 2005 by Jinyan Li and Limsoon Wong CS4 Rules may not be correct when applied to training data Rules correct Example of Decision Tree Given a test sample, at most 3 of the 4 genes’ expression values are needed to make a decision! • Yeoh et al., Cancer Cell 1:133-143, 2002; Differentiating MLL subtype from other subtypes of childhood leukemia • Training data (14 MLL vs 201 others), Test data (6 MLL vs 106 others), Number of features: 12558 Copyright © 2005 by Jinyan Li and Limsoon Wong Performance of CS4 • • • • Whether top-ranked features have similar gain ratios Whether cascading trees have similar training performance Whether the trees have similar structure Whether the expanding tree committees can reduce the test errors gradually • Gain ratios are: 0.39, 0.36, 0.35, 0.33, 0.33, 0.33, 0.33, 0.32, 0.31, 0.30; 0.30, 0.30, 0.30, 0.29, 0.29, 0.28, 0.28, 0.28, 0.28, 0.28. Copyright © 2005 by Jinyan Li and Limsoon Wong Discovery of Diagnostic Biomarkers for Ovarian Cancer • Motivation: cure rate ~ 95% if correct diagnosis at early stage • Proteomic profiling data obtained from patients’ serum samples • The first data set by Petricoin et al was published in Lancet, 2002 • Data set of June-2002. • 253 samples: 91 controls and 162 patients suffering from the disease; 15154 features (proteins, peptides, precisely, mass/charge identities) Copyright © 2005 by Jinyan Li and Limsoon Wong SVM: 0 errors; Naïve Bayes: 19 errors; k-NN: 15 errors. Part 7: Mining Errors from Bio Databases Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Data Cleansing, Koh et al, DBiDB 2005 • 11 types & 28 subtypes of data artifacts – Critical artifacts (vector contaminated sequences, duplicates, sequence structure violations) – Non-critical artifacts (misspellings, synonyms) • > 20,000 seq records in public contain artifacts • Identification of these artifacts are impt for accurate knowledge discovery Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong • Sources of artifacts – Diverse sources of data • • Repeated submissions of seqs to db’s Cross-updating of db’s – Data Annotation • • • Db’s have diff ways for data annotation Data entry errors can be introduced Different interpretations – Lack of standardized nomenclature • • Variations in naming Synonyms, homonyms, & abbrevn – Inadequacy of data quality control mechanisms • Systematic approaches to data cleaning are lacking A Classification of Errors Copyright © 2005 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic Uninformative sequences Invalid values Undersized sequences ATTRIBUTE Ambiguity Example Meaningless Seqs Dubious sequences Vector contaminated sequence Crossannotation error RECORD Annotation error • Among the 5,146,255 protein records queried using Entrez to the major protein or translated nucleotide databases , 3,327 protein sequences are shorter than four residues (as of Sep, 2004). • In Nov 2004, the total number of undersized protein sequences increases to 3,350. • Among 43,026,887 nucleotide records queried using Entrez to major nucleotide databases, 1,448 records contain sequences shorter than six bases (as of Sep, 2004). • In Nov 2004, the total number of undersized nucleotide sequences increases to 1,711. Sequence structure violation Undersized protein sequences in major databases Sequence redundancy Data provenance flaws 1015 1000 DDBJ 800 EMBL 600 400 200 GenBank 528 383 364 218 171 116 123 3 0 SwissProt 51 2 0 151 42 125 12 23 0 MULTIPLE SOURCE DATABASE 1 Erroneous data transformation PDB 2 Sequence Length 3 PIR Number of records SINGLE SOURCE DATABASE Number of records 1200 Undersized nucleotide sequences in major databases 233 228 250 200 DDBJ 150 100 50 115108 108 73 69 45 40 6 2 104 81 9 3 77 51 55 67 2 3 Sequence Length Incompatible schema Copyright © 2005 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic 4 GenBank PDB 24 0 1 EMBL 5 Invalid values ATTRIBUTE Overlapping intron/exon Ambiguity Example Overlapping Intron/Exon Dubious sequences Vector contaminated sequence Crossannotation error RECORD Annotation error Sequence structure violation SINGLE SOURCE DATABASE Sequence redundancy Data Provenance flaws MULTIPLE SOURCE DATABASE Erroneous data transformation • Syn7 gene of putative polyketide synthase in NCBI TPA record BN000507 has overlapping intron 5 and exon 6. • rpb7+ RNA polymerase II subunit in GENBANK record AF055916 has overlapping exon 1 and exon 2. Incompatible schema Copyright © 2005 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic Replication of sequence information Invalid values Different views Overlapping annotations of the same sequence ATTRIBUTE Ambiguity Dubious sequences Example Seqs w/ Identical Info Submission of the same sequence to different databases • Repeated submission of the same sequence to the same database Vector contaminated sequence • Initially submitted by different groups • Protein sequences may be translated from duplicate nucleotide sequences Crossannotation error RECORD Annotation error Sequence structure violation SINGLE SOURCE DATABASE Sequence redundancy Data provenance flaws MULTIPLE SOURCE DATABASE Erroneous data transformation Incompatible schema http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db =protein&list_uids=11692005&dopt=GenPept http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db =protein&list_uids=11692005&dopt=GenPept Copyright © 2005 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic Association Rule Mining for De-duplication Select matching criteria Compute similarity scores from known duplicate pairs Generate association rules Detect duplicates using the rules Copyright © 2005 by Jinyan Li and Limsoon Wong. Features to Match Copyright © 2005 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic Association Rule Mining AAG39642 AAG39643 AC0.9 LE1.0 DE1.0 DB1 SP1 RF1.0 PD0 FT1.0 SQ1.0 AAG39642 Q9GNG8 AC0.1 LE1.0 DE0.4 DB0 SP1 RF1.0 PD0 FT0.1 SQ1.0 Similarity scores of known duplicate pairs P00599 PSNJ1W AC0.2 LE1.0 DE0.4 DB0 SP1 RF1.0 PD0 FT1.0 SQ1.0 P01486 NTSREB AC0.0 LE1.0 DE0.3 DB0 SP1 RF1.0 PD0 FT1.0 SQ1.0 O57385 CAA11159 AC0.1 LE1.0 DE0.5 DB0 SP1 RF0.0 PD0 FT0.1 SQ1.0 S32792 P24663 AC0.0 LE1.0 DE0.4 DB0 SP1 RF0.5 PD0 FT1.0 SQ1.0 P45629 S53330 AC0.0 LE1.0 DE0.2 DB0 SP1 RF1.0 PD0 FT1.0 SQ1.0 Association rule mining Frequent item-set with support Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong LE1.0 PD0 SQ1.0 (99.7%) SP1 PD0 SQ1.0 (97.1%) SP1 LE1.0 PD0 SQ1.0 (96.8%) DB0 PD0 SQ1.0 (93.1%) DB0 LE1.0 PD0 SQ1.0 (92.8%) DB0 SP1 PD0 SQ1.0 (90.4%) DB0 SP1 LE1.0 PD0 SQ1.0 (90.1%) RF1.0 SP1 LE1.0 PD0 SQ1.0 (47.6%) RF1.0 DB0 LE1.0 PD0 SQ1.0 (44.0%) Dataset Entrez (GenBank, GenPept, SwissProt, DDBJ, PIR, PDB) scorpion AND (venom OR toxin) serpentes AND venom AND PLA2 Scorpion venom dataset containing 520 records Snake PLA2 venom dataset containing 780 records Expert annotation 251 duplicate pairs 444 duplicate pairs 695 duplicate pairs are collectively identified. Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Duplicates detected by association rules 60 49.4 50 FP% and FN% Results 40 36.3 32.7 30 20 10 Rule 1. Identical sequences with the same sequence length and not originated from PDB are 99.7% likely to be duplicates. Rule 2. Identical sequences with the same sequence length and of the same species are 97.1% likely to be duplicates. Rule 3. Identical sequences with the same sequence length, of the same species and not originated from PDB are 96.8% likely to be duplicates. 6 2.4 1.8 3.8 0.3 9.4 7.9 7.5 5.2 5.7 0.1 0 le Ru 1 le Ru 2 le Ru 3 le Ru 4 le Ru 5 le Ru 6 le Ru Association rules FP% FN% x 1000 Rule 1 S(Seq)=1 ^ N(Seq Length)=1 ^ M(PDB)=0 (99.7%) Rule 2 S(Seq)=1 ^ M(PDB)=0 ^ M(Species)=1 (97.1%) Rule 3 S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 (96.8%) Rule 4 S(Seq)=1^ M(PDB)=0 ^ M(DB)=0 (93.1%) Rule 5 S(Seq)=1 ^ M(Seq Length)=1 ^ M(PDB)=0 ^ M(DB)=0 (92.8%) Rule 6 S(Seq)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.4%) Rule 7 S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.1%) Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic 7 Acknowledgements TIS Prediction • Huiqing Liu, Roland Yap, Fanfan Zeng Treatment Optimization for Childhood ALL • James Downing, Huiqing Liu, Allen Yeoh Prognosis based on Gene Expression Profiling • Huiqing Liu Analysis of Proteomics Data • Huiqing Liu Copyright © 2004, 2005 by Jinyan Li and Limsoon Wong Subgraphs in Protein Interactions • Haiquan Li, Donny Soh, Chris Tan, See Kiong Ng Mining Errors from Bio Databases • Vladimir Brusic, Judice Koh, Mong Li Lee