Final Review Key Part I

advertisement
Name ______________________________
Date _______________
Biology I Fall Semester Exam Review
Directions: Answer the following on your own paper for extra credit on your exam.
I. Scientific Method/Process of Science and Graphing
1. Define the following terms:
a. Controlled experiment – an
c. Experimental group – the group
experiment with only one
independent variable
being tested.
d. Independent variable – the
b. Control group – the group with
variable that the experimenter
no manipulation. *used for
comparison*
changes.
e. Dependent variable – variable
that changes as a result.
2. What variable is always graphed on the X axis? Independent (MIX) What variable is graphed on
the Y axis? Dependent (DRY)
3. When is a bar graph used? Comparison When is a line graph used? Show relationship
4. List the steps of the scientific method and briefly describe each.
1. Problem – make observations to find a question to be studied
2. Hypothesis – make an educated guess to answer the problem *must be testable*
3. Prediction – what you expect to happen if the hypothesis is true
4. Experiment – Test the hypothesis, collect data
5. Conclusion – Summary of the results *Evaluates the hypothesis*
5. Define the following terms:
a. Reproduction – the process of generating new individuals of the same kind.
b. Evolution – change over time
c. Metabolism – obtaining and using energy
d. Homeostasis – stable internal environment
e. Development – grow and develop
6. List the characteristics of living things. Made of cells, reproduce, based on a universal genetic
code (DNA), grow and develop, obtain and use materials and energy (metabolism), respond
to their environment (stimuli), maintain a stable internal environment (homeostasis), taken
as a group living things change over time (evoluation).
7. Define the following and place in order from smallest to largest:
Page 1
a. biosphere
c. community
b. ecosystem
d. population
e. species
species  population  community  ecosystem  biosphere
8. Define the following and place in order from smallest to largest:
a. cell
c. organism
b. organ system
d. organ
e. tissue
cell  tissue  organ  organ system  organism
II. The Cell
1. Describe the following scientists’ contributions to cellular biology:
a. Virchow – cells form from other cells
c. Schwann – animals made of cells
b. Hooke – coined the term “cells”
d. Schleidan – plants made of cells
2. What are the three parts of the cell theory?
1. Living things are composed of one or more cells
2. Cells are the basic units of structure and function in organisms
3. Cells are produced only from other cells.
3. For the following, write a “P” if it belongs to a plant; write an “A” if it belongs to an animal; write
“B” if it applies to BOTH a plant and animal cells; write “N” if it applies to neither:

Cell membrane B

Golgi body B

Ribosomes B

Cytoplasm B

Chloroplast P

Large vacuole P

Cell wall P

Mitochondria B

Small vacuole A

Nucleus B

SER B

Prokaryotic N

Nucleolus B

RER B

Eukaryotic B
4. Copy the following chart. Place an “X” in the box if the characteristic applies to the type of cell.
cell
membrane
DNA
cytoplasm
Bacteria
X
X
X
Plants
X
X
X
Animals
X
X
X
cell wall,
chloroplasts
X
nucleus
membrane-bound
organelles
X
X
X
X
Page 2
5. Copy and fill in the following chart:
Organelle and Sketch
Mitochondria
Nucleus
Function
Provides energy
Contains genetic material
Nucleolus
Ribosome synthesis
Ribosome
Protein synthesis
Rough Endoplasmic Reticulum
Vacuole
Makes & transports proteins
Stores food and water
Chloroplast
Energy conversation – plants only
Centrioles
Aids in cell division – animals only
Golgi Apparatus
Plasma Membrane
Cell Wall
Packages and distributes
Barrier around cell
Protection, shape, structure – plants
only
Lysosome
Smooth Endoplasmic Reticulum
Cytoplasm
Digestive enzymes- break down waste
Makes lipids
Location of all organelles
6. Give the main function of each of the following organic macromolecules:
a. Lipid – store energy. Made of glycerol head and 3 fatty acid tails
b. Nucleic Acid – store and transmit genetic info. Monomer - nucleotides
c. Carbohydrate- Energy. Monomer- simple sugars
d. Protein –act as enzymes, transport materials, muscles. monomers- amino acids
7. Give the monomer (building block) of each of the above next to its description.
Page 3
8. Draw and label plasma membrane with the following components/labels:
a. embedded (integral) proteins
e. fatty acids
b. lipid bilayer
f. head
c. individual phospholipids
g. hydrophilic
d. cholesterol
h. hydrophobic
Lipid bilayer
9. What is passive transport? Movement of particles from areas of high concentration to low. No
energy required. Example: 1. diffusion 2. facilitated diffusion – needs transport protein 3.
osmosis – diffusion of water molecules.
10. Describe each of the 3 types listed above.
11. Describe what happens to a cell placed in the following solutions and what happens to the net
movement of water:
a. Isotonic – concentration inside and outside cell are the same = no net water movement
b. hypertonic – concentration of water is greater inside the cell = water moves out
c. hypotonic – concentration of water is greater outside the cell = water moves in
12. What is active transport? Movement of particles from areas of low concentration to high.
Movement against the concentration gradient. Requires energy and a transport protein.
13. Compare and contrast exocytosis and endocytosis. Exocytosis- movement of particles out of a
cell. Endocytosis – movement of particles into a cell
14. Suppose a certain protein is needed outside of the cell. Describe the pathway of the protein from
its synthesis to its exit from the cell. The involved organelles are listed. Please give the correct
order in which the organelles would be used and briefly explain how each is involved.
Page 4
a. Plasma Membrane
b. Ribosomes
c. Nucleus
d. Vacuoles
e. Golgi Apparatus
f. Rough E. R.
g. Nuclear Membrane
h. Nucleous
Ribosome is made in the nucleous. Directions for the protein are found coded in the DNA which is
found in the nucleus. The message is transcribed into RNA and travels from the nucleus to the
ribosome (on the rough ER). The protein is constructed at the ribosome and gets modified in the
rough ER. The protein then travels to the golgi to be packaged and distributed. The protein travels
in a vacuole to the plasma membrane and leaves the cell by exocytosis.
III. Photosynthesis
1. Define autotroph and give an example of an organism that is an autotroph. An organism that
makes its own food. Ex: plants
2. Define heterotroph and give an example of an organism that is a heterotroph. An organism that
must obtain its nutrients from another source. Ex: humans
3. Copy the following chart. Place an X in the appropriate boxes.
ATP
ADP
Contains Adenine
X
X
Contains Ribose
X
X
Contains 3 phosphates
X
Contains 2 phosphates
X
“fully charged battery”
X
“partially charged battery”
X
4. Write the balanced equation for photosynthesis.
6CO2 + 6H2O  C6H12O6 + 6O2
a. Label the reactants. CO2 AND H2O
b. Label the products. C6H12O6 AND O2
c. Label the reactants and products in the LDR. H2O AND O2
Page 5
d. Label the reactants and products in the LIR. CO2 AND C6H12O6
5. What is the function of a pigment? Absorb light in the thylakoid
6. What main pigment do chloroplasts contain? Describe the colors that this pigment absorbs and the
main colors that it reflects. Chlorophyll, absorbs all colors, reflects green
7. What is the organ of photosynthesis? What organelle is found in the cells of this organ?
chloroplast
8. Draw the organelle of photosynthesis and include the
following:
a. Thylakoids
b. Stroma
9. Sketch the light dependent reactions (LDR) that occur along the thylakoid membrane of the
chloroplast. Include the following AND label:
a. light
i. light
o. NADP+
b. chlorophyll
j. electron
p. NADPH
c. Photosystem II
d. Photosystem I
e. Water
transport chain
k. NADP+
reductase
f. Oxygen
l. ATP synthase
g. H+ ions
m. ADP + P
h. electrons
n. ATP
Page 6
10. Draw a chloroplast and sketch the Calvin Cycle (LIR). Include the following (label):
a. Stroma
b. Carbon dioxide
c. Glucose
d. NAPDH
e. ATP
11. Describe how the Calvin Cycle depends on
the Light Dependent reactions.
The dark reaction uses the ATP and NADPH
made in the light reaction to turn CO2 into
glucose.
IV. Cellular Respiration
1. Write the balanced equation for cellular respiration.
C6H12O6 + 6O2  6CO2 + 6H2O + ATP
a. Label the reactants. C6H12O6 + 6O2
b. Label the products 6CO2 + 6H2O + ATP
2. What is the organelle of cellular respiration? Mitochondria What other part of the cell is
involved? Cytoplasm
3. What is the difference between aerobic and anaerobic respiration? Aerobic- with oxygen.
Anaerobic- no oxygen Which types of organisms perform each? Anaerobes (some bacteria);
anaerobic respiration. Aerobic – animals, plants, etc.
4. What is the first step of cellular respiration? Glycolysis What is broken down in this step?
Glucose What is produced? 2 pyruvate, 2 ATP, 2NADH
5. If there is no oxygen present, what happens after glycolysis? Fermentation
6. What is fermentation? Describe the two types of fermentation and give an example of an
organism that performs each. 1. Lactic acid – takes place in animals. Produces lactic acid from
glucose. 2. Alcoholic – produces alcohol from glucose. Takes place in plants and yeast.
7. Draw cell with the organelle involved in cellular respiration. Show where glycolysis, the Krebs
cycle, and the electron transport chain all occur. Indicate what goes in and comes out of each step.
Page 7
V. Comparing Photosynthesis and Cellular Respiration:
8. How are NADPH (in photosynthesis) and NADH (in cellular respiration) similar? Both high
energy electron carriers.
9. How are mitochondria and chloroplasts similar? Both deal with energy conversions.
10. Describe the role of ATP in photosynthesis vs. cellular respiration. PS- ATP is used to make
glucose (food for plant). CR- ATP is usable energy used for cellular processes.
11. Copy the following and mark an “X” in the appropriate spaces (one, both, or neither):
Photosynthesis
Stores Energy as glucose
Cellular Respiration
X
Releases Energy in glucose
X
Occurs in Living Cells
X
X
Uses an Electron Transport Chain
X
X
X- NADPH
X- NADH & FADH2
X
X
Uses electron carrier molecules
Occurs in Plant Cells
Occurs in Animal Cells
Releases Oxygen
X
X
Releases Carbon Dioxide
X
Uses Oxygen
X
Page 8
Converts
Creates Energy
X
energy
X
Water is released
X
Water is consumed
The number of ATP produced is
X (32)
higher in
Occurs during the day
Occurs at night
X
X
X (dark rxns)
X
VI. DNA Structure and Replication
1.
Describe the experiments/major contributions of the following scientists:
a. Griffith – transformation: gene from one cell was taken in by another cell
b. Avery – repeated Griffith’s work: when DNA was destroyed transformation did not
occur.
c. Watson and Crick – made 3D model of DNA – double helix
d. Rosalind Franklin – used Xray diffraction to predict the shape of DNA (helix)
e. Chargaff – base pairing rules: A-T and G-C
f. Hershey and Chase - used bacteriophages to prove DNA transmits genetic information.
2. What is the monomer of DNA? Nucleotide What are the 3 parts that make up this monomer?
Deoxyribose sugar, phosphate, nitrogenous base (A,T,G,C)
3. What are the four nitrogenous bases in DNA? Adenine, Thymine, Guanine, Cytosine.
4. Explain the base paring rules of DNA. A-T and G-C
5. Which bases are purines? Adenine & Guanine Which are pyrimidines? Thymine & Cytosine
6. What type of bonds hold nitrogenous bases together? Hydrogen bonds
7. What is represented by the “rungs of the ladder” of DNA? Bases What is represented by the
“backbone” of DNA? Sugar and phosphate.
8. Write the correct complementary sequence of the following. Draw and label deoxyribose,
phosphate, hydrogen bonds, 3’ and 5’ ends to make a complete strand.
5’ A A T C G C G T T 3’
3’ T T A G C G C A A 5’
9. Where does DNA replication take place in eukaryotes? Nucleus
Prokaryotes? Cytoplasm
Page 9
10. What is the end result of DNA replication? 2 identical copies of DNA (each with one old and
one new strand).
11. Describe the steps in DNA Replication. Be sure to include the following:
a. Helicase
d. Okazaki
b. DNA
fragments
polymerase
c. Ligase
g. 5’ end
h. 3’ end
e. Leading strand
i. Template
f. Lagging strand
strand
Step 1: Helicase unwinds the DNA
Step 2: DNA Polymerase adds one nucleotide at a time in the 3’  5’ direction.
Both strands act as a template. The strand that is assembled in a continuous motion is the
leading strand. The strand that is assembled in a back stitch motion is a lagging strand and
contain small fragments call Okazaki fragments. The gaps between the Okazaki fragments
are closed by the enzyme ligase.
Step 3: DNA Polymerase proofreads.
12. What is the direction of new strand elongation during replication? DNA polymerase “reads” in
the 3’  5’ direction. new strand elongates from 5’  3’
13. Describe how DNA replication “checks” itself. DNA polymerase proofreads the newly
assembled DNA.
VII. Protein Synthesis
1. Transcribe the following sequence: T G A C G G A C T T G G A A C T A A T A G T C C
ACUGCCUGAACCUUGAUUAUCAGG
a. What did you create after transcribing the sequence? RNA
b. How many codons does the sequence have? 8
2. Where does transcription occur? Nucleus
3. Describe the function of RNA polymerase in transcription. Adds one nucleotide at a time
4. Describe IN DETAIL the process of transcription beginning with DNA and ending with mature
RNA that will leave the nucleus. In the nucleus, RNA polymerase binds to the DNA and bring
one nucleotide at a time to form the RNA strand. Before the RNA leaves the nucleus, it must
be edited. Here, the INTRONS are removed and the EXONS are pieced together to make the
mature RNA.
5. What do we get from transcription that is used in translation? RNA
6. Sketch each of the following and write its function.
Page 10
a. mRNA – brings a coded message from the nucleus to the ribosome. Contains codons
that code for specific amino acids.
b. rRNA – makes up the ribosome
c. tRNA – brings the amino acids to the ribosome to construct the protein. Contains
anticodons.
7. What is a codon? Sequence of 3 bases found on the mRNA. It codes for specific amino acids.
8. Using the RNA from #1, write the sequence of amino acids that will be put together in translation.
Thr – Ala – Stop – Thr – Leu – Ile – Ile – Arg
a. What tool did you use to figure out the sequence of amino acids? Codon chart/wheel
b. Describe how to use the Codon Wheel. First base is the inside, second base is the
middle ring and the third base is the outside ring.
9. Where does translation occur? Ribosome
10. What is an anticodon? Sequence of 3 bases found on the tRNA. It “locates” the proper codon
to bring the correct amino acid to the ribosome.
11. What is the “Genetic Code”? the rules by which genetic information is translated into
proteins. (ex: ACU = Thr)
12. What is a polypeptide? Chain of amino acids = protein.
13. What is a peptide bond and where is it found? Bond that holds amino acids together. Found in
a polypeptide.
14. What is a protein? What is its purpose? Protein is a chain of amino acids. It carries out cellular
functions, acts as enzymes, etc.
15. Describe IN DETAIL the entire process of translation. The mRNA arrives at the ribosome. The
codons (located on the mRNA) codes for a specific amino acid which is brought to the
ribosome by the tRNA. The amino acids are added one at a time, creating peptide bonds
between them. Once a stop codon is reached, the ribosome breaks apart and a polypeptide
remains the carry out cellular functions.
16. Explain the terms protein synthesis and gene expression. Genes are translated into proteins so
that the genes are then expressed.
17. What is a mutation? How are mutations caused? Mutation is a change/error in a gene.
Mutations can be genetic or caused by environmental factors like radiation, etc.
18. Describe a point mutation. A point mutation is a mutation that changes one base in a DNA
sequence.
a. Transcribe the following DNA sequence: A T G C A C A C G C G T
Page 11
UACGUGUGCGCA
b. Re-write the DNA sequence, substituting the 3rd “A” for a “T”. Transcribe the mutated
sequence. ATGCACTCGCGT
UACGUGAGCGCA
c. Translate the amino acid sequence of
i. The original DNA sequence (a) Tyr – Val – Cys - Ala
ii. The mutated DNA sequence (b) Tyr – Val – Ser – Ala
d. Describe the difference between the amino acid sequences. One amino acid changed
19. Describe a frameshift mutation and the two types. Frameshift mutation is when every base
following the mutation is affected. Ex: Deletion and Insertion
Page 12
Download