Supplementary Information Supplementary Figure S1 Supplementary Fig. S1. PCR identification of Os04g54340 and Os08g08030 in rice. Lane1, DNA marker; Lane2-4, PCR amplification of Os08g08030-F/R in Zhongxian 3037, Yandao 8 cDNA and water; Lane5-7, PCR amplification of Os04g54340-F/R in Zhongxian 3037, Yandao 8 cDNA and water; 8-10: PCR amplification of Ubiquitin in Zhongxian 3037, Yandao 8 cDNA and water. Supplementary Figure S2 Supplementary Fig. S2. Characterization of the OsMRE11-deficient plant phenotype. (a-b) Comparison of a wild-type plant (a) and an OsMRE11-deficient plant (b); Fertile pollen grains stained with 1% I2-KI solution in a wild-type plant (c) and completely sterile pollen grains in OsMRE11-deficient plants (d). Scale bars: 50 μm. Supplementary Figure S3 Supplementary Fig. S3. Real-time PCR analysis of OsMRE11 in different tissues. Ubiquitin is used as endogenous control. Error bars represent SD (n=3). Supplementary Figure S4 Supplementary Fig. S4. Immunofluorescent localization of γH2AX on meiotic spreads of the wild type and OsSPO11RNAi-deficient chromosomes. Immunofluorescent localization of γH2AX on meiotic spreads of the wild type (a) and OsSPO11RNAi-deficient chromosomes (b), The anti-OsREC8 antibody is used to indicate the PMCs in green (the left panel) and the anti-γH2AX staining was shown in red (the middle panel), the overlapped images are showed in the right panel. Scale bars: 5 μm. Supplementary Table S1. List of primers used in this study Purpose Name Forward Reverse Gene OS08G08030-F/R ATGCATGCTAGCTTTGCATCA TCAGATAACAGGAGCTTTGCC Identificati Os04g54340-F/R ATGGGAGACGAAAGCAACACA TCATCTCCTCCTAACAGCTCC on Mre11-F GTGCAATCTTCTTCAGATGAG pCAMB2300-R CGACGTTGTAAAACGACGGCC OsMRE11-RT-F/R ATGGGAGACGAAAGCAACACA GCACAAAATCAACCTTATTCT Ubi-RT-F/R CAAGATGATCTGCCGCAAATGC TTTAACCAGTCCATGAACCCG Antibody OsMRE11-Ab-F/R CAGGATCCATGGGAGACGAAAGCAACACA GAGTCGACTCTCCTCCTAACAGCTCCGTA RNAi OsMRE11-RANi-F/R GTGGATCCGTTACAGCTCAAAGTAACCTG CAGTCGACTCTCCTCCTAACAGCTCCGTA q-RT-PCR