Genetically engineered anthocyanin pathway for high health-promoting pigment Yanjie Zhang

advertisement
Genetically engineered anthocyanin pathway for high health-promoting pigment
production in eggplant
Yanjie Zhang1*, Guihua Chu1*, Zongli Hu1, Qiong Gao1, Baolu Cui1, Shibing Tian2,
Bo Wang2, Guoping Chen1†
1
Bioengineering College, Key Laboratory of Biorheological Science and Technology
(Chongqing University), Ministry of Education, Chongqing University, Campus B,
Room 515, 174 Shapingba Main Street, Chongqing 400044, People’s Republic of
China;
2
The Institute of Vegetable Research,Chongqing Academy of Agricultural Sciences,
401329 Chongqing , People’s Republic of China;
*
†
These authors contributed equally to this work.
Corresponding author. Guoping Chen, Tel: 00862365112674; Fax: 0086 23
65112674; E-mail: [email protected]
Supplementary Table 1. primers used for qPCR analysis in transgenic and wild-type
eggplants
Genes
Forward primer (5' to 3', top),
Accession
reverse primer (5' to 3', bottom)
SmPAL
TGCCTATGCTGATGATCCCT
FS095735
GTTCCCACTTTCCAACGCTA
SmCHS
TCCATTACCAGAAGTCGAAAG
FS083297
TTCCAATCAGAAATGCCTAA
SmCHI
AAATACAAAAGCCAGCATAACC
FS057776
AGGGGAGTGTCACCTACAACTA
SmF3H
AATGCGATAGTGTATCCGTTAA
FS038632
CAAGCAAGAATTTCCTCAATG
SmF3'5'H
CTCATCTAGCGTGATAGAATGG
X70824
TTTAGTGGCGTTGAAGGGT
SmDFR
TTCATTTGCTCATCCCATC
FS075550
GCCCCTTGATACATATCCTC
SmANS
GCACTGACTTTCATCCTCCAC
EU809469
TCTTGTACTTTCCGTTGCTTAG
SmUFGT
CTGTGAACCAGATGATGGAAGT
X77369
AAAAGAACCGATCACAAAGAT
SmAN11
TCGGTATCTGCTGATGGGTC
KF727473
TGTATCTCAAATCTTGCTTGTTCC
SmbHLH1
CTTTGGAGACCAGAAGTTGATG
KF727475
CTTGCTACCAGTTGGCAGAAT
SmMYB1
CAAGTGACAAGCAAACTACCG
KF727476
TCTTCTCCTTCAACAGCGTC
SmGAPDH
GTACGACAACGAATGGGGTTA
TCATATCAGCAGCACCAGCA
FS001574
Supplementary Figure 1. Fruit and flower phenotypes in T0 generation of transgenic
eggplants containing SmMYB1 under the control of the 35S promoter. (A) Map of
T-DNA region of the binary vector used for transformation. LB, left T-DNA border
region; RB, right T-DNA border region; nptII gene conferring kanamycin resistance
under the control of the nos promoter; Tnos, terminator region of nptII gene. (B)
Phenotype of flower in wild-type eggplant, the picture at the top right corner indicates
an enlargement of the selected region (framed by red circle). (C) Phenotype of flower
in transgenic eggplant, the picture at the top right corner indicates an enlargement of
the selected region (framed by red circle). (D) Phenotype of fruit in wild-type
eggplant, (E) Phenotype of fruit in transgenic eggplant.
Supplementary Figure 2. The MS/MS spectrum of candidate anthocyanins indicated
in figure 3 A and Table 1. Figure A, B, C, D, E, F and G refers to characteristic
fragmentations of peak1, 2, 3, 4, 5, 6 and 7 in the HPLC profiles and table 1
respectively.
Supplementary Figure 3. Anthocyanin contents in the leaves, petals, stamens, fruit
peels and flesh of WT and transgenic lines (A). (B) Expression analysis of SmMYB1
in the leaves, petals, stamens, fruit peels and flesh of WT and transgenic plants. WT:
non-transformed plants. N、P and R indicate independent transgenic lines. The
asterisks indicate significant difference (p<0.05) and extremely significant difference
(p<0.01) separately between WT and transgenic lines.
Supplementary Figure 4. Expression profiles of anthocyanin biosynthetic genes
(A-H) in the leaves, petals, stamens, fruit peels and flesh of WT and transgenic lines.
WT: non-transformed plants. N, P and R indicate independent transgenic lines. Values
represent mean ± SD (n = 3). The asterisks indicate significant difference (p<0.05)
and extremely significant difference (p<0.01) separately between WT and transgenic
lines.
Supplementary Figure 5. Expression profiles of anthocyanin biosynthesis regulatory
genes in the leaves, petals, stamens, fruit peels and flesh of WT and transgenic plants.
WT: non-transformed plants. N, P and R indicate independent transgenic lines. Values
represent mean ± SD (n = 3). The asterisks indicate a significant difference (p<0.05)
between WT and transgenic lines.
Download