Biofilm formation
C. albicans wild type CAI4-CIp10, rps41Δ-CIp10 mutant and the RPS41 gene reintegrate strain
rps41Δ-RPS41 were grown overnight in SC/Uri- medium supplemented with 50 mM glucose at 30℃.
After 16 h of incubation, the cells, which were in the late exponential growth phase, were harvested,
washed twice with phosphate buffered saline (PBS, pH=7.2) and resuspended in RPMI1640 medium
and counted with a hemacytometer. The cells were adjusted to a cell count of 1×107 cells/ml. Biofilms
were grown in pre-sterilized, polystyrene, flat-bottomed 6-well microtiter plates. Aliquots of 2 ml
of
7
standard cell suspensions of yeasts (10 cells/ml) were transferred into each well and incubated for 1.5
h at 37ºC at 75 rpm in an orbital shaker. After the adhesion phase, the cell suspensions were gently
aspirated and each well was washed twice with PBS to remove any remaining planktonic cells, taking
care not to disturb the adhered cells. In order to allow the growth of biofilm, 3 ml of freshly prepared
RPMI1640 medium was added to each well. The plates were incubated for 48h at 37ºC at 75 rpm in an
orbital shaker. At 24 h of incubation, the medium was aspirated and, biofilms were washed twice with
PBS followed by addition of 3 ml of fresh medium.
Systemic murine candidiasis model
C. albicans CAI4-CIp10, rps41Δ-CIp10, and rps41Δ-RPS41 mutant were grown overnight in
SD/Uri-/Met-/Cys- at 30℃. Logarithmic-phase cells were harvested, washed, resuspended in sterile
saline and adjusted to 1×107 c.f.u./mL. BALB/C female mice (6-8 weeks; Shanghai SLAC Laboratory
Animals, Shanghai, China) were used to establish the systemic candidiasis model. Twenty four mice
were randomly divided into 3 groups (Groups A-C). All mice were inoculated by injection of the C.
albicans suspension into the lateral tail vein (2×106c.f.u./mouse). Mice of group A were injected with
CAI4-CIp10 cells; mice of Group B were injected with rps41Δ-CIp10 cells; mice of Group C were
injected with rps41Δ-RPS41 cells.
Mice were monitored for survival for 28 days after infection (moribund animals were euthanized and
recorded as dying on the following day). The Kaplan–Meier log rank test was used to determine the
statistical difference between Groups A, B and C. This analysis was performed by using SPSS software.
P < 0.05 was considered significant.
Real-time quantitative PCR
(RT-PCR)
First-strand cDNAs were obtained through 500ng of total RNA in a 10 μl reverse transcription reaction
volume using the cDNA synthesis kit for reverse transcription PCR (TaKaRa). Triplicate independent
quantitative real-time PCR was performed with SYBR Green I (TaKaRa), using ABI PRISM 7500
real-time PCR system (Applied Biosystems). The PCR protocol consisted of an initial step at 95 ℃ for
1 min, followed by 40 cycles at 95℃ for 10 s, 60 ℃ for 20 s, then melting curve program at 60-95℃
with a heating rate of 0.1℃ per second and continuous fluorescence measurement and finally a cooling
step to 40℃. ACT1 was used as an internal control. Forward primer of the RPS41 gene for RT-PCR is
ATTGTCCGGTACTTATGC; and reverse primer is TGATGGCTTTGACTTCTC. Forward primer of
ACT1 for RT-PCR is ACGGTGAAGTTGCTGCTTTAGTT; and reverse primer of ACT1 for RT-PCR
is CGTCGTCACCGGCAAAA. Fold changes greater than 1.5 fold was considered significant.
Supplementary table 1. Strains used in this study
Strain
Parent
Description
Reference
CAI4
CAF2-1
ura3Δ::immm434/ura3Δ::immm434
Fonzi et al, 1993
rps41Δ
CAI4
rps41Δ::hisG / rps41Δ::hisG /rps41Δ::hisG
Lu et al., 2015
CAI4-CIP10
CAI4
ura3Δ::immm434/ura3Δ::immm434/RPS1::-URA3
Lu et al., 2015
rsp41Δ-CIP10
rps41Δ
rps41Δ::hisG / rps41Δ::hisG /rps41Δ::hisG/ RPS1::URA3
Lu et al., 2015
rsp41Δ-RPS41
rps41Δ
rps41Δ::hisG / rps41Δ::hisG /rps41Δ::hisG/RPS1::RPS41-URA3
Lu et al., 2015