Specificity of argonaute protein association with miRNA Molly Blatz Dr. Jim Carrington Dr. Sunny Gilbert Importance of small RNA • • • • Gene regulation Growth and development Therapeutics Agriculture miRNA Functions miRNA precursor Dicer miRNA RISC proteins (Zamore, Bartel, Sharp, Carrington labs) Translation arrest Target RNA degradation Background • Small RNA silencing is a mode of gene regulation. • Argonaute proteins are the catalytic components of RISC. • miRNAs guide AGOs to their targets. • The nucleotide at the 5’ end is one source of miRNA specificity. 5’ nucleotide specificity of AGO’s Kim, N. (2008) Cell Montgomery, et. al. (2008) Cell; Mi et. Al. (2008) Cell; Takeda, et. Al. (2008) Plant Cell Physiology What We Know • 5’ nucleotide specificity rule has exceptions. • There are miRNA’s that associate with AGO1 and lack 5’U. • AGO7 has no known 5’end nucleotide specificity. – Instead it only binds miR390. • GOAL: Understand the rules of miRNA association with AGO’s. miRNA Sequence • miRNA’s that deviate from AGO1, 5’U rule contain U at eleventh position. • Hypothesis: A uracil at position 11 is important for association with AGO1. miR172: AGAAUCUUGAUGAUGCUGCAU miR172-11G: AGAAUCUUGAGGAUGCUGCAU miR390: AAGCUCAGGAGGGAUAGCGCC miR390-11U: AAGCUCAGGAUGGAUAGCGCC Binds AGO1 Binds AGO1 ??? Binds AGO7 Binds AGO1 ??? How • Construct mutant miRNAs. • Infiltrate Nicotania benthamiana with constructs containing miRNAs, tagged proteins, and appropriate controls. HA-AGO Tissue • Co-immunoprecipitation Input Lyse Cells Fraction • Small RNA gels Immunoprecipitate using HA antibody IP Fraction Small RNA gels Small RNA gels Position 11U Results Vector in HA HA-AGO1 HA-AGO7 in HA in HA HA-AGO Tissue Vector miR172-11G associates Lyse Cells with AGO1 miR172 Input Fraction Immunoprecipitate miR172-11G Vector in HA miR390-11U associates with AGO7 and not AGO1 using HA antibody HA-AGO1 in HA IP Fraction HA-AGO7 in HA Small RNA gels Vector Small RNA gels miR390 miR390-11U 11U is not a specificity determinant. Determine how non-5’U miRNAs are specified • Too much background miR390 and miR172 • Make new system using a miRNA that is distinguishable from endogenous miRNA but is still processed efficiently. Alteration of miR390 • Eliminate competition with other AGOs. • Purine and pyrimidine conservation. • Changed position 19 from a G to C – Choose miRNA over miRNA* • Changed position 1 from an A to a G – 5’ end of miR390 doesn’t play a role in association. miR390: AAGCUCAGGAGGGAUAGCGCC miR390-19C: AAGCUCAGGAGGGAUAGCCCC miR390: AAGCUCAGGAGGGAUAGCGCC miR390-5’G: GAGCUCAGGAGGGAUAGCGCC Alteration of miR390 • Prediction: Both miR390-5’G and miR390-19C should bind AGO7 and accumulate as well as endogenous miR390. miR390 Alteration Results miR390-5’G creates a 19 nucleotide small RNA miR390-19C accumulates more miR390 Alteration Results miR390-5’G associates with AGO7 even though it is a 19 nucleotide small RNA. Future Plans • Create miR390 with single point mutations at every position. • Test nonconserved miRNAs. Acknowledgement • • • • Howard Hughes Medical Institute Dr. Jim Carrington Dr. Sunny Gilbert The Carrington Lab