Appl Microbiol Biotechnol (2006) 71: 522–532
DOI 10.1007/s00253-005-0190-8
APPLIED MICRO BIAL AND CELL PHYSIOLOGY
Barbara Brezna . Ohgew Kweon . Robin L. Stingley .
James P. Freeman .
Ashraf A. Khan . Bystrik Polek . Richard C. Jones .
Carl E. Cerniglia
Molecular characterization of cytochrome P450
genes in the polycyclic aromatic hydrocarbon
degrading Mycobacterium vanbaalenii PYR-1
Received: 29 July 2005 / Revised: 1 September 2005 / Accepted: 9 September 2005 / Published online: 30 November 2005
# Springer-Verlag 2005
Abstract Mycobacterium vanbaalenii PYR-1 has the ability to degrade low- and high-molecular-weight polycyclic
aromatic hydrocarbons (PAHs). In addition to dioxygenases,
cytochrome P450 monooxygenases have been implicated
in PAH degradation. Three cytochrome P450 genes,
cyp151 (pipA), cyp150, and cyp51, were detected and
amplified by polymerase chain reaction from M. vanbaalenii PYR-1. The complete sequence of these genes was
determined. The translated putative proteins were ≥80%
identical to other GenBank-listed mycobacterial CYP151,
CYP150, and CYP51. Genes pipA and cyp150 were
cloned, and the proteins partially expressed in Escherchia
coli as soluble heme-containing cytochrome P450s that
exhibited a characteristic peak at 450 nm in reduced carbon
monoxide difference spectra. Monooxygenation metabolites of pyrene, dibenzothiophene, and 7-methylbenz[α]
anthracene were detected in whole cell biotransformations,
with E. coli expressing pipA or cyp150 when analyzed by
B. Brezna . O. Kweon . R. L. Stingley .
A. A. Khan . C. E. Cerniglia (*)
Division of Microbiology,
National Center for Toxicological Research,
US Food and Drug Administration,
3900 NCTR Road,
Jefferson, AR 72079, USA
e-mail: ccerniglia@nctr.fda.gov
Tel.: +1-870-5437341
Fax: +1-870-5437307
B. Brezna . B. Polek
Institute of Molecular Biology, Slovak Academy of Sciences,
845 51 Bratislava, Slovakia
J. P. Freeman
Division of Biochemical Toxicology, National Center
for Toxicological Research, Food and Drug Administration,
Jefferson, AR 72079, USA
R. C. Jones
Division of Systems Toxicology, National Center
for Toxicological Research, Food and Drug Administration,
Jefferson, AR 72079, USA
gas chromatography/mass spectrometry. The cytochrome
P450 inhibitor metyrapone strongly inhibited the S-oxidation of dibenzothiophene. Thirteen other Mycobacterium
strains were screened for the presence of pipA, cyp150, and
cyp51 genes, as well as the initial PAH dioxygenase (nidA
and nidB). The results indicated that many of the Mycobacterium spp. surveyed contain both monooxygenases
and dioxygenases to degrade PAHs. Our results provide
further evidence for the diverse enzymatic capability of
Mycobacterium spp. to metabolize polycylic aromatic
hydrocarbons.
Introduction
Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous
environmental pollutants. Chemically, they constitute a
class of organic compounds containing two or more fused
benzene rings in linear, angular, or cluster arrangement.
Because of their human and ecotoxicity, there is a considerable interest to determine the fate of these compounds
in the environment and to consider possible use of
microorganisms for remediation of polluted sites (Cerniglia
and Sutherland 2001; Kanaly and Harayama 2000; Mueller
et al. 1996).
M. vanbaalenii PYR-1, isolated from a petrogenic
chemical polluted site, can utilize or biotransform a wide
range of PAHs (Khan et al. 2002). Studies of PAH metabolites showed that this bacterium uses both dioxygenase(s)
and cytochrome P450 monooxygenase(s) to metabolize
PAHs (Heitkamp et al. 1988; Kelley et al. 1990; Khan et al.
2001; Kim et al. 2004a,b, 2005; Moody et al. 2001, 2002,
2003, 2004, 2005). While cis-dihydrodiols produced by
this strain are typical metabolites of aromatic ring-hydroxylating dioxygenases, trans-dihydrodiols (Heitkamp
et al. 1988; Kelley et al. 1990; Kim et al. 2005; Moody
et al. 2001, 2003, 2004, 2005) are presumably formed by
cytochrome P450 catalyzed epoxidation of the aromatic
nucleus with enzymatic hydration by epoxide hydrolase.
523
Among other suspected cytochrome P450 metabolites
formed by M. vanbaalenii PYR-1 are 4-hydroxybiphenyl
(Moody et al. 2002), dibenzothiophene (DBT) sulfoxide (unpublished results), and a 7-hydroxymethyl-12-methylbenz
[α]anthracene (Moody et al. 2003). Despite the metabolic
evidence that implicated cytochrome P450, it has not been
identified in M. vanbaalenii PYR-1. However, there are
genetic data on several cytochrome P450 families in different Mycobacterium spp. that were not associated with
PAH degradation (Aoyama et al. 1996, 1998; Bellamine et al.
1999; Cole and Barrell 1998; Jackson et al. 2003; Kelly
et al. 2003; Lepesheva et al. 2001; McLean et al. 2002;
Mowat et al. 2002; Poupin et al. 1999a; Trigui et al. 2004).
In this study, we report the detection and molecular characterization of three CYPs from M. vanbaalenii PYR-1,
two of which were cloned and expressed in Escherchia coli
and assessed for their ability to oxygenate PAHs. In addition, 13 other Mycobacterium strains were screened for the
presence of cytochrome P450 and aromatic ring-hydroxylating dioxygenase genes.
Materials and methods
Chemicals
Pyrene, DBT, and piperidine hydrochloride were purchased from Sigma Chemical Company (St. Louis, MO,
USA). Solvents were purchased from J.T. Baker, Inc.
(Miamisburg, OH, USA). 7-Methylbenz[α]anthracene (7MBA) was synthesized by Dr. Peter Fu at the National
Center for Toxicological Research, (Jefferson, AR, USA).
Strains and media
Mycobacterium strains used in this study are listed in
Table 1. For cloning, E. coli host strains EPI300 (Epicentre,
Madison, WI, USA), DH5α (Promega, Madison, WI,
USA), Novablue (Novagen, Madison, WI, USA), and
vector pET-17b (Novagen) were used. Middlebrook 7H11
medium was purchased from Remel (Lenexa, KS, USA).
Mineral salts medium (MBS) with nutrients and MBS agar
amended with phenanthrene by using a spray-plate technique were prepared as described by Heitkamp et al.
(1988).
DNA preparation
Mycobacterium strains were cultivated for 7 days on
Middlebrook agar 7H11, or on MBS amended with
phenanthrene, if they were capable of phenanthrene PAH
utilization. The cells were scraped from the plates, and their
total genomic DNA was isolated with the DNeasy tissue kit
(Qiagen, Valencia, CA, USA). Plasmid and fosmid DNA
preparations from E. coli strains were made by using the
Qiaprep Spin Miniprep kit (Qiagen).
Table 1 Mycobacterium strains used in this study that were screened for the presence of cytochrome P450 genes and nidA and nidB genes
Strain
M.
M.
M.
M.
M.
M.
M.
M.
M.
M.
M.
aurum (ATCC 23366)
austroafricanum (ATCC 33464)
austroafricanum GTI-23a
chlorophenolicum PCP-1 (ATCC 49826)
flavescens PYR-GCK (ATCC 700033)
frederiksbergense FAn9T (DSM 44346)
gilvum (ATCC 43909)
gilvum BB1 (DSM 9487)
petroleophilum (ATCC 21497)
smegmatis mc2155 (ATCC 700084)
vaccae JOB-5 (ATCC 29678)
M. vanbaalenii PYR-1(DSM 7251)
Mycobacterium sp. 7E1B1W (ATCC 29676)
Mycobacterium sp. PAH 2.135 (RJGII-135)b
Substrate or other characteristic
Type strain
Type strain, related to M. vanbaalenii
PAHs
Polychlorinated phenols
PAHs
PAHs
Type strain
PAHs
n-Paraffins
Transformation host
Gaseous, long chain, cycloparaffinic
and monoaromatic hydrocarbons
PAHs
Gaseous and long chain hydrocarbons
PAHs
Detection of
nidAc
nidBd
pipAe
cyp150f
cyp51g
(−)
(−)
+
(−)
(−)
(−)
−
(+)
(−)
−
(−)
(−)
(−)
+
(−)
(+)
(+)
−
(+)
(−)
−
(−)
−
−
+
−
+
+
−
+
−
−
−
+
+
−
−
+
+
+
+
+
+
+
+
+
−
+
−
+
−
−
+
+
+
(+)
(−)
(+)
(+)
(−)
(+)
+
−
+
+
+
−
+
−
+
“+” PCR product of expected size was present, “−” PCR product of expected size was not obtained. In brackets are the cumulative PCR and
Southern hybridization results from the previous study as follows: “(+)” the studied gene is present (Brezna et al. 2003), “(−)” the studied
gene is not present (Brezna et al. 2003)
a
Obtained from Dr. B.W. Bogan at the Gas Technology Institute in Des Plaines, IL
b
From Dr. D. Warshawsky at the University of Cincinnati
c
PCR primers nidAf and nidAr were used
d
Primers nidBf and nidBr
e
Primers RP1F1 and RP1R2
f
Primers FM10F1 and FM10R2
g
Primers Cyp51F and Cyp51R
524
PCR reactions
Detection of cytochrome P450
Polymerase chain reaction (PCR) primers used in this study
are listed in Table 2. Regular PCR was performed with Taq
DNA polymerase and supplied PCR solutions according to
the manufacturer’s instructions (Qiagen). The PCR regime
consisted of 3 min preincubation at 95°C; 30 cycles of 30-s
denaturation at 94°C, 30-s annealing at 55°C, and 1-min
extension at 72°C; followed by a final hold at 72°C for
7 min. In each PCR reaction, the concentration of primers
was 0.5 μM each, and the template DNA was added at a
final concentration of 10 pg μl−1.
Proofreading PCR was performed with PCR Supermix
High Fidelity (Invitrogen, Carlsbad, CA, USA). The
conditions were the same as for regular PCR, but the
primers were added at a final concentration of 0.2 μM and
the extension step of the PCR cycle was 90 s.
Primers RP1F1 and RP1R2 for detection of pipA were
designed according to conserved regions in GenBank
sequences AF102510 (pipA from Mycobacterium smegmatis mc2155) and AJ310142 (morA from Mycobacterium
sp. RP1). Primers FM10F1 and FM10R2 for cyp150 detection were designed from the conserved regions in sequences AF107047 (probable cytochrome P450 from M.
smegmatis mc2155) and AF107046 (probable cytochrome
P450 from Mycobacterium sp. FM10). To design primers
MSCYP51F1 and MSCYP51R2 for detection of sterol 14
α-demethylase cytochrome P450 (cyp51), sequence covering cyp51 and surrounding regions from Mycobacterium
tuberculosis H37Rv (BX842574) was aligned with sequences from unfinished genome sequencing projects of
M. smegmatis mc2155 and Mycobacterium avium 104
available at http://www.tigr.org, the web site of the
Institute for Genomic Research. Total genomic DNA
from M. vanbaalenii PYR-1 was used as a PCR template.
Southern hybridization
pipA-specific digoxigenin (DIG)-labeled DNA probe was
prepared using PCR DIG-labeling kit (Roche Diagnostics,
Indianapolis, IN, USA), primers RP1F1 and RP1R2, and
the total genomic DNA from M. vanbaalenii PYR-1 as a
PCR template. cyp150-specific DIG-labeled DNA probe
was prepared in the same way, using PCR primers FM10F1
and FM10R2. DNA was transferred from colonies grown
on Petri dishes to positively charged nylon membranes
(Roche) using the procedures described in the Genius
System User’s Guide (Roche). Hybridization and detection
was performed according to the DIG DNA Labeling and
Detection Kit instruction manual (Roche). The results were
visualized using the chemiluminiscent substrate CSPD
(Roche).
PCR screening of pipA, cyp150, nidA, and nidB genes
in 14 Mycobacterium strains
Total genomic DNA of each strain was used as a PCR
template at a final concentration 50 pg μl−1. For screening
of pipA, the primer pairs RP1F1 and RP1R2 were used. For
screening of cyp150, FM10F1 and FM10R2 were used;
Cyp51F and Cyp51R were used for cyp51. In strains where
genes nidA and nidB were not screened previously (Brezna
et al. 2003), the nidA detection using nidAF and nidAR
primers and the nidB detection using nidBF and nidBR
were performed.
Table 2 PCR primers used in this study
Primer name
Primer sequence
Reference microorganism
Reference sequence
Position
RP1F1
RP1F2
Fm10F1
Fm10R2
MSCYP51F1
MSCYP51R2
PipAclonF
PipAclonR
agctggatcctcaacaag
tcatcgcgatcatgctc
ccctacttcgatcacctgcgc
ccgaacgcgatgtgctcgcg
gggccgatgttccagccg
tcgccgagacgccgcgcg
acgccatatgtcgtcggccactgtcggttctgtca,b
agctaagcttcaatggtgatggtgatggtgggaa
gcgggcgtgaagccgaa,c
acgccatatgagcgacttcgacacgatcgactaca,b
agctaagcttcaatggtgatggtgatggtgtcga
accggggtgaacgtgaa,c
cgacggcctgcctgatcg
tcctcggggatccggttg
Mycobacterium sp. RP1
AJ310142
Mycobacterium sp. FM10
AF107046
M. smegmatis mc2155
contig3312
M. vanbaalenii PYR-1
AY485998
1,161–1,178
1,354–1,370
489–509
1,504–1,485
1,289,527–1,289,544
1,291,356–1,291,339
1–27
1,200–1,181
M. vanbaalenii PYR-1
AY496703
322–348
1,589–1,608
M. vanbaalenii PYR-1
AY575951
507–524
1,137–1,120
Cyp150clonF
Cyp150clonR
Cyp51F
Cyp51R
a
Italic denotes parts of primers not aligning to target sequence
Underlined are NdeI restriction sites
Underlined are HindIII restriction sites, double underlined are 6xHis-tagged codons
b
c
525
Cloning and sequencing
A fosmid genomic library of M. vanbaalenii PYR-1 was
constructed previously (Stingley et al. 2004a,b). Colonies
of library clones were transferred from the petri dishes to
positively charged nylon membranes. pipA- or cyp150containing clones were identified by colony hybridization
with pipA- or cyp150-specific DIG-labeled DNA probes,
respectively. One positive fosmid clone was selected for
each cytochrome gene. The fosmid DNA was digested with
EcoRI in the case of the PipA-containing clone and with
SacI in the case of the CYP150-containing clone. The
restriction fragments were subcloned into pGEM-11zf(+)
(Promega), and the resulting subclones were rescreened
by colony hybridization with pipA- or cyp150-specific
DIG-labeled DNA probes. pipA- and cyp150-containing
subclones were named pGEM-PIP and pGEM-CYP, respectively, and were sequenced. For subcloning into expression
vector pET-17b (Novagen), the genes were amplified with
proofreading PCR. In the forward PCR primers, an NdeI
restriction site was incorporated; in the reverse primers, the
6-His-tag codon and a HindIII restriction site were incorporated. Primers PipAclonF and PipAclonR for amplification of pipA and Cyp150clonF and Cyp150clonR for
amplification of cyp150 are listed in Table 2. As the PCR
template, the plasmid DNA of pGEM-PIP and pGEM-CYP
was used. The PCR amplicons were subcloned into pET17b, resulting in plasmids pET-17b-PIP and pET-17b-CYP.
Recombinant plasmids were transformed into NovaBlue E.
coli host strain and subsequently retransformed into BL21
(DE3)pLysS host strain (Novagen).
DNA sequencing was performed on an Applied
Biosystems Model 377 DNA sequencer at the University
of Arkansas for Medical Sciences, Little Rock, AR, USA.
Sequences were compiled, translated, and analyzed using
Lasergene software (DNASTAR, Madison, WI, USA) and
compared to similar genes and proteins using online
database searches (http://www.ncbi.nlm.nih.gov/BLAST/).
cooling period between each burst depending on its usage.
The lysates were centrifuged at 8,400×g to pellet the
cellular debris.
The 6xHis-tagged proteins were purified from the total
soluble protein fraction using the Ni-NTA resin, as
described in the Qiaexpressionist handbook (Qiagen). All
the buffers were adjusted to pH 7.4.
PipA and CYP150 containing covalently attached heme
were identified by heme-staining with dimethoxybenzidine
(Francis and Becker 1984) after separation via denaturing
polyacrylamide gel electrophoresis (PAGE). The stained
bands were excised, digested robotically with trypsin, and
analyzed using nano liquid chromatography (LC)–tandem
mass spectrometry (MS/MS) on an LCQ Deca XP Plus ion
trap mass spectrometer (Thermo, San Jose, CA, USA)
(Edmondson et al. 2002). Samples (40 μl) were loaded
using an Endurance autosampler (Micro-Tech Scientific,
Vista, CA, USA) onto an IntegraFrit (New Objective,
Woburn, MA, USA) vented column (Licklider et al. 2002)
(75 μm×3 cm) packed with 1 cm Jupiter C12 material
(Phenomenex, Torrance, CA) at 14 μl min−1 and eluted
with a 50-min gradient (0.1–30% B in 35 min, 30–50% B
in 10 min, and 50–80% B in 5 min, where A=99.8% H2O,
0.1% acetonitrile, 0.1% formic acid; and B=80% acetonitrile, 19.9% H2O, 0.1% formic acid) at 200 nl min−1
(generated with a split tee) using an UltraPlus II capillary
HPLC pump (Micro-Tech Scientific) over a 75 μm×15 cm
IntegraFrit analytical column packed also with Jupiter C12
material. The column was coupled to a stainless steel
emitter (30 μm ID×3 cm; Proxeon, Odense, Denmark).
MS/MS was performed on the top four ions in each MS
scan using the data-dependent acquisition mode. Normalized collision energy was set at 35%, and three microscans
were summed following AGC implementation (target
values for MS and MS/MS were 2×108 and 6×107 counts,
respectively). Dynamic exclusion and repeat settings
ensured each ion was selected only once and excluded
for 30 s thereafter. Product ion data were searched against
the NCBInr protein database using a locally stored copy of
the Mascot search engine (Matrix Science, London, UK).
Protein expression, purification, and identification
A single colony of BL21(DE3)pLysS E. coli cells expressing cytochrome PipA or cytochrome CYP150, respectively, were grown overnight on LB plates with 100 μg
ampicillin ml−1. A single colony of each E. coli clone was
transferred into 10 ml of liquid LB medium containing
100 μg ampicillin ml−1. After overnight incubation with
shaking, these starter cultures were added to 250 ml of LB
medium with 100 μg ampicillin ml−1. Cultures were
incubated with shaking at 20°C until the OD600 reached
0.5. Subsequently, 2 mM of heme precursor 5-aminolevulinic acid (ALA), 10 μg ml−1 of FeCl3, and 1 mM of the
inducer isopropylthiogalactoside (IPTG) were added. For
apo-P450 synthesis analysis, ALA and FeCl3 were not
added. Cells were incubated overnight at 20°C and then
spun at 4,000×g. The cells were lysed by boiling for 3 min
or by sonication of six 10-s bursts at 300 W, with a 10-s
Spectrophotometric analysis of cytochrome P450
Total soluble protein fractions were prepared from E. coli
cells expressing cytochromes PipA and Cyp150 or those
containing pET-17b vector without insert, as described
earlier in the protein expression and purification section.
Reduced CO difference spectra were measured in soluble
protein extracts as described previously (Omura and Sato
1964; Schlenk et al. 1994).
Biotransformation experiments
The transformed E. coli BL21 (DE3)pLysS(pET-17b-PIP),
BL21 (DE3)pLysS(pET-17b-PIP)(pBRCD), BL21 (DE3)
pLysS(pET-17b-CYP150), BL21 (DE3)pLysS(pET-17bCYP150)(pBRCD), and control E. coli BL21 (DE3)pLysS
526
(pET-17b) were cultivated analogously as in the protein
expression experiment. The total culture volumes were
50 ml. After the addition of IPTG, FeCl3, and ALA for
holo-P450 and IPTG only for apo-P450, the cultures were
grown for 8 h at 20°C with vigorous shaking. Afterwards,
the cells were spun at 4,000×g, washed with 50 ml of
50 mM sodium–phosphate buffer (pH 7.4), and resuspended in 20 ml of the same buffer, with the final cell
suspension adjusted to OD600=4.3. To each flask, 7.5 μl of
the prepared substrate stock solutions, which were 10%
DBT, 7-MBA, or pyrene in dimethylformamide, was
added. For cytochrome P450 inhibition studies, metyrapone was added to a final concentration of 0.27 mM. After
a 16-h incubation with shaking at 20°C, the transformation
reaction was stopped by the addition of an equal volume of
ethyl acetate. The cell suspensions were extracted three
times with 70 ml ethyl acetate. Combined ethyl acetate
fractions were evaporated at 25°C on a vacuum rotary
evaporator, redissolved in 3 ml ethyl acetate, and dried in a
vacuum evaporator.
Gas chromatography and mass spectrometry
After collection, the metabolites were analyzed by gas
chromatography (GC)/electron ionization mass spectrometry (EI-MS) with a TSQ 700 or TSQ 7,000 tandem quadrupole mass spectrometer (ThermoFinnigan, San Jose, CA,
USA). The mass spectrometer was operated in the single
quadrupole mode with 70 eV electron ionization (EI) energy and 150°C ion source temperature. AVarian 3,400 gas
chromatograph was employed for the GC/EI-MS analyses.
Separation was achieved with a 30m×0.25mm×0.25 μm
DB-5 ms capillary column (J&W Scientific, Folsom, CA,
USA). The column was heated from 70°C to 280°C at
20°C min−1. The helium carrier gas flow rate was controlled at 15 psi. In order to estimate the relative amounts
of the detected metabolites, extracted ion chromatograms
and base peak ions were generated for the molecular ions
and for the metabolites, respectively, and the resulting
chromatographic peaks were integrated electronically with
the chromatographic software. Ratios were calculated for
the resulting peak areas and averaged for each metabolite.
Results
Detection, cloning, and sequence analysis
of cytochrome P450 in M. vanbaalenii PYR-1
Carbon monoxide difference spetra of cellular lysates of M.
vanbaalenii PYR-1 grown in the presence of PAHs
indicated that the 100,000-g supernatant fraction contained
trace levels of cytochrome P450. As a strategy for a more
sensitive detection of cytochrome(s) P450 in M. vanbaalenii PYR-1, we used a genomic approach and considered
most likely that member(s) of the CYP150 or the CYP151
family would be present since they originate from fastgrowing environmental Mycobacterium strains RP1 (Trigui
et al. 2004) and FM10 (AF107046). The presence of
CYP51 in M. vanbaalenii PYR-1 was also hypothesized
because of its conservation among several mycobacteria
and even in different biological kingdoms (Aoyama et al.
1996).
PCR screening of M. vanbaalenii PYR-1 genomic DNA
with two primer pairs designed from strain RP1 for pipA
gene and from strain FM10 for cyp151 gene (Table 2) gave
expected PCR products sizes, 0.25 and 1.0 kb, respectively.
The preliminary sequencing of PCR products confirmed
that they were indeed parts of the targeted cyp isogenes.
Afterwards, the DIG-labeled versions of these PCR products were used as probes to screen M. vanbaalenii PYR-1
genomic library. Complete sequences of both cyp isogenes
were obtained from positive library subclones. The PCR
product of expected size 1.8 kb of the third cyp isogene,
cyp51, in M. vanbaalenii PYR-1 resulted from the primer
combination MSCYP51F1 and MSCYP51R2. Since this
PCR product covered the complete cyp51 gene, no subsequent library screening was necessary. The 1.8-kb PCR
product was sequenced by primer-walking.
The sequence of M. vanbaalenii PYR-1 pipA region was
submitted to GenBank under accession number AY485998.
This sequence contains a gene for cytochrome P450
PipA, a ferredoxin, and a partial sequence of glutamine
synthetase (Fig. 1). This locus organization is identical
to M. smegmatis mc2155 (GenBank accession number
AF102510) and similar to Mycobacterium sp. RP1 (GenBank
accession number AJ310142). However, strain RP1 has a
gene for a putative ferredoxin reductase located between a
ferredoxin and a putative glutamine synthetase gene unlike
M. vanbaalenii PYR-1. The cytochrome P450 and the
ferredoxin genes were identified based on ≥86% and
≥69% identity, respectively, of proposed proteins to their
counterparts in M. smegmatis mc2155 (AF102510) and
Mycobacterium sp. RP1 (AJ310142) and by using the
conserved domain database search at http://www.ncbi.nlm.
nih.gov. Partial sequence of the putative glutamine synthetase gene covers only 33 aminoacids at the N terminus of
the proposed protein, where no conserved domains are
present. However, this N-terminal sequence is 75%
identical to putative protein of M. smegmatis
(AF102510), where beta-grasp domain of glutamine synthetase (pfam03951) is present.
The sequence of the M. vanbaalenii PYR-1 cyp150
region was submitted to GenBank under accession number
AY496703. In addition to the open reading frame (ORF)
for cytochrome P450 (cyp150), the sequence contains an
incomplete ORF coding for a possible protein that contains
a conserved domain of bacterial regulatory TetR-family
proteins, as well as two hypothetical proteins (Fig. 1).
There is a similar locus organization in Mycobacterium sp.
FM10 (AF107046) and in M. smegmatis (AF107047).
CYP150 from M. vanbaalenii PYR-1 is 96 and 88%
identical to its counterparts in Mycobacterium sp. FM10
and M. smegmatis, respectively, at the protein level.
The sequence of the cyp51 region of M. vanbaalenii
PYR-1 (GenBank accession number AY575951) contains
an incomplete ORF coding for a probable oxidoreductase,
527
Fig. 1 Physical maps and conserved sequence alignments of the
cytochrome P450 monooxygenases and ferredoxins from M.
vanbaalenii PYR-1 with those from other sources. The amino acid
residues involved in binding to heme (FX2GX3CXG) and to the
[3Fe-4S] cluster (CX5CXnC) are indicated by highlighted characters. Designations: CYP151 (PipA), CYP150, and CYP51—
cytochromes P450; Fdx—ferredoxins; GlnA—putative glutamine
synthetase; orf2 and orf3—hypothetical proteins; orf4—probable
regulatory protein from TetR-family. GenBank accession numbers
are as follows. PipA of M. vanbaalenii PYR-1, AY485998; PipA of
M. smegmatis mc2155, AF102510; morA of Mycobacterium
tokaiense THO100, AY816211; morA of Mycobacterium sp. RP1,
AJ310142; morA of Mycobacterium sp. HE5, AY816211; CYP51 of
M. vanbaalenii PYR-1, AY575951; CYP51 of M. avium subsp.
paratuberculosis str. k10, NC_002944; CYP51 of M. tuberculosis
CDC1551, AE000516; CYP51 of M. tuberculosis H37Rv,
NC_000962; M. bovis AF2122/97NC_002945; CYP150A2 of M.
smegmatis mc2155, ; CYP150 of M. vanbaalenii PYR-1,
AY496703; CYP150 of Mycobacterium sp. FM10, AF107046;
CYP of Burkholderia fungorum LB400, NZ_AAAJ03000005;
CYP150 of Arthrobacter sp. FB24, NZ_AAHG01000018;
CYP107L2 of Streptomyces avermitilis MA-4680, BA000030;
CYP of Pseudomonas aeruginosa PA01, NC_002516
cytochrome CYP51, and a ferredoxin, and another incomplete ORF coding for a hypothetical protein of unknown
function (Fig. 1). This ORF organization is conserved in
several other Mycobacterium spp. (Jackson et al. 2003).
CYP51 from M. vanbaalenii is 80–92% identical to those
of M. smegmatis, M. avium M. tuberculosis, and Mycobacterium bovis subsp. bovis (GenBank accession numbers
BX842574, AE006970, BX248336, and AE017229 and
unfinished genomes of M. smegmatis mc2155 and M.
avium 104 at http://www.tigr.org).
A phylogenetic tree was constructed by the neighbor–
joining (NJ) approach of the collection of 29 aligned
cytochrome P450 protein sequences including three cytochrome P450s from M. vanbaalenii PYR-1 (Fig. 2). The
tree shows six distinct groups for the 29 cytochrome P450s.
The three cytochrome P450s from M. vanbaalenii PYR-1
fall into three different groups but belong to the same class
I. PipA of M. vanbaalenii PYR-1 belongs to the PipA
(morA) group that shows over 86% identity to each other.
CYP150 of M. vanbaalenii PYR-1 belongs to the CYP150
group displaying very high identity (≥82%) to CYP150s
from other Mycobacterium spp. but with very low identity
(≤39%) to the remaining CYP150s. CYP51 of M. vanbaalenii PYR-1 is placed in CYP51 group and shows very high
identity (≥79%) to CYP51s from Nocardia farcinica
IFM10152 and other Mycobacterium spp. but with very
low identity (≤36%) to other CYP51s. The pairwise
distance values obtained by using Gonnet weight matrix
were less than 0.700 within each group, with the exception
of the group CYP150. The CYP150 group can be divided
into two subgroups by using the pairwise distance value,
0.700. Within each group, the pairwise distance values
were less than 0.700.
Expression, purification, and identification of PipA
and CYP150
Recombinant His-tagged protein PipA heterologously expressed in E. coli was soluble. After a passage through NiNTA resin, partial purification was achieved, i.e., His-tagged
PipA was a predominant protein in the resin eluate (Fig. 3a,
lane 5). His-tagged CYP150 was localized mainly in the
insoluble fraction when expressed in E. coli (data not
shown), probably due to the formation of inclusion bodies.
However, some of the protein was also produced in the
soluble form and was partially purified from the soluble
fraction using the Ni-NTA resin.
The overexpressed PipA and CYP150 were stained with
dimethoxybenzidine, and the two stained bands were ana-
528
Fig. 2 Phylogenetic tree obtained from the alignment of three
cytochrome P450s from M. vanbaalenii PYR-1 with related
proteins. The protein sequences of the 29 cytochrome P450s are
classified. The amino acid sequences were aligned with the Clustal
X package (version 1.83), and the tree was constructed by the NJ
method and displayed with the program TreeView X (1.6.6). Scale
bar indicates the percentage divergence. The pairwise distance
matrix was obtained by using Clustal X (Gonnet 250). Class I
cytochrome P450s are three-component systems comprising of a
flavin adenine dinucleotide (FAD)-containing reductase, an iron–
sulfur protein (ferredoxin), and a cytochrome P450. The eukaryotic
class I enzymes are associated with the mitochondrial membrane.
Class II cytochrome P450s are two-component systems, and both
class III and class IV are a single polypeptide. In a class II system,
the cytochrome P450 is partnered with a diflavin (FDA/FMN)
reductase, whereas in the class III systems, the diflavin (FDA/FMN)
reductase is fused to the cytochrome P450. Class IV system is made
up of FMN-containing reductases with a ferredoxin-like center
linked to a cytochrome P450 (Roberts et al. 2002). GenBank
accession numbers are as follows (refer to Fig. 1 for the remaining
protein sequences): P450 of Ralstonia metallidurans CH34,
NZ_AAAI00000000; P450RhF of Rhodococcus. sp. NCIMB
9784, AF459424; P450 of Rhodococcus rubber DSM 44319, ;
P450cam of Pseudomonas putida, M12546; P450 Novosphingobium aromaticiviorans DSM 12444, NZ_AAAV02000002; CYP505
of Fusarium oxysporum MT-811, AB030037; P450BM-3 of Bacillus megaterium Fulco PB85, J04832; P450 of Bacillus cereus ATCC
14579, AE017008; P450 of B. cereus E33L, NC_006274; CYP51 of
Sorghum bicolor SS1000, U74319; CYP51 of Homo sapiens,
CH236949; CYP51 of N. farcinica IFM 10152
lyzed by LC–MS/MS. The resultant product ion data were
searched against the public NCBI protein database. The
44.8-kDa band for CYP150 matched to cytochrome P450
from M. vanbaalenii PYR-1 (AY496703) with 46 unique
peptides and 75% sequence coverage. The 48.7-kDa band
for PipA (Fig. 3a, lane 4) also matched to cytochrome P450s
from the same species with accession number AY485998
showing 31 peptides and 78% sequence coverage.
Reduced CO-difference spectra of soluble protein cell
extracts from E. coli expressing PipA and CYP150 showed
a typical peak at 450 nm, confirming the cytochrome P450like character of these proteins (Fig. 3b). A negative control, E. coli containing a vector without insert, showed no
peak at 450 nm. (Fig. 3b).
from DBT, which had a retention time (12.44 min) (Fig. 4a,b)
and mass spectral fragmentation pattern (m/z 200 and m/z
184) (Fig. 4f) identical to DBT 5-oxide (Schlenk et al. 1994).
Moreover, supplementation of pBRCD, containing the cistrons encoding [3Fe-4S] ferredoxin (phdC) and ferredoxin
reductase (phdD) component from Nocardioides sp. KP7
(Saito et al. 2000) in pipA and cyp150, increased DBT 5oxide formation twofold.
To confirm PipA DBT S-oxidase activity, the effects of
PipA inhibitor metyrapone and ALA and FeCl3 were
tested. As shown in Fig. 4c, metyrapone markedly inhibited DBT-sulphoxide production in E. coli containing pET17b-PIP (43% decrease), but was less efficient in E. coli
containing pET-17b-PIP (pBRCD) (11.8% decrease) (data
not shown).
To support more direct evidence of the role of PipA in
DBT oxidation, apo-PipA lacking heme was expressed
without the addition of ALA and FeCl3 and confirmed by
heme-staining with dimethoxybenzidine (Fig. 3a, lanes 8
and 9). Apo-PipA and the negative control showed no DBT
5-oxidation activity (Fig. 4d,e). This result indicates that
Biotransformation of DBT, 7-MBA, and pyrene
by PipA and CYP150
The expression of pipA and cyp150 in E. coli lacking the
electron-transport components produced one metabolite
529
Fig. 4 GC/EI-MS extracted ion chromatograms of DBT extracts for
(a) CYP150, (b) PipA, (c) PipA+metyrapone, (d) apo-PipA, (e)
negative control sample, and (f) mass spectrum of DBT 5-oxide
Fig. 3 Expression and purification of recombinant PipA of M.
vanbaalenii PYR-1 at 20°C. aLane M molecular size marker, lane 1
cell extract from E. coli (BL21)(pET-17b), lane 2 cell extract from
E. coli (BL21)(pET-17b-PIP) prepared by glass bead cell disruption,
lane 3 cell extract from E. coli (BL21)(pET-17b-PIP) prepared by
boiling, lane 4 heme-stain of the same cell extract as lane 2, lane 5
partial purification of 6xHis-tagged PipA on Ni-NTA resin
(Qiagen), lane 6 Coomassie blue stained cell extract from E. coli
(BL21)(pET-17b-PIP) grown in the presence of ALA and FeCl3,
lane 7 heme-stain of lane 6, lane 8 Coomassie-blue-stained cell
extract from E. coli (BL21)(pET-17b-PIP) grown in the absence of
ALA and FeCl3, lane 9 heme-stain of lane 8. b Reduced CO
difference spectra of total soluble E. coli protein extracts from
cultures of expressing transgenic PipA (solid line), CYP150 (dashed
line), and E. coli containing pET-17b vector without insert (dash and
dotted line). The protein concentrations were 6 mg ml−1
PipA was responsible for S-oxygenation of DBT and
needed heme as a prosthetic group for enzyme activity. As
shown in Fig. 3a (lanes 6 and 8), the addition of ALA and
FeCl3 did not increase the expression level of PipA.
When the substrate was 7-MBA, one metabolite was
observed in each sample eluting at 17.7 min. The mass spectrum consisted of an apparent molecular ion at m/z 258 and a
major fragment ion at m/z 229. The mass spectrum and retention time are consistent with an authentic 7-hydroxymethylbenz[α]anthracene (Fig. 5b) (Cerniglia et al. 1982).
GC/MS analysis of the pyrene extracts produced three
chromatographic peaks with apparent molecular mass of
218 that contained a major fragment ion at m/z 189. These
peaks eluted at 16.6, 16.8, and 19.5 min. The mass spectral
fragmentation data were identical to pyrenols (Cerniglia
et al. 1986). Authentic 1-hydroxypyrene eluted at the same
retention time (19.5 min) and produced the same mass
spectrum as the third peak. Since pyrene is a symmetrical
molecule, the only isomers that could be formed are 1-hydroxy-, 2-hydroxy-, or 4-hydroxypyrene (Fig. 5c).
Fig. 5 Reactions catalyzed by E. coli cells expressing cytochromes
P450 PipA and CYP150 from M. vanbaalenii PYR-1
530
Detection of cytochrome P450 genes pipA, cyp150,
and cyp51 and of dioxygenase genes nidA and nidB
in Mycobacterium strains
The amplification of 0.25-kb PCR product indicating pipA
presence, 1.0-kb product indicating cyp150, and 0.63-kb
product indicating cyp51 presence varied among the strains,
as documented in Table 1. nidA and nidB genes coding
for the large and small subunits of an aromatic ring-hydroxylating dioxygenase were detected by PCR in Mycobacterium austroafricanum GTI-23. Mycobacterium gilvum
ATCC 43909 and M. smegmatis mc2155 did not produce
the PCR products (Table 1). For the rest of the strains, the
results of nidA and nidB screening from the previous study
(Brezna et al. 2003) are summarized in Table 1.
Discussion
M. vanbaalenii PYR-1 was the first organism known to
produce both cis-dihydrodiol and trans-dihydrodiol metabolites of high-molecular-weight PAHs such as pyrene
(Heitkamp et al. 1988; Kelley et al. 1990; Kim et al. 2005;
Moody et al. 2001), indicating that both dioxygenase(s)
and cytochrome P450 monooxygenase(s) can initiate PAH
degradation in this bacterium. One of these enzymes, aromatic ring-hydroxylating dioxygenase, is encoded by nidA
and nidB genes and has been cloned and characterized
previously (Khan et al. 2001; Kim et al. 2004a; Stingley
et al. 2004b). This study complements the previous information by identifying three genes encoding alternative
PAH-oxidative enzymes, cytochromes P450, in this organism. To our knowledge, this is the first study proving that
functional cytochrome P450 genes can coexist with aromatic ring-hydroxylating dioxygenase in a high-molecularweight PAH utilizer. Three CYPs were detected in M.
vanbaalenii PYR-1 using the PCR approach that were
>80% identical to other mycobacterial CYP151, CYP150,
and CYP51, respectively. However, considering the high
number of CYP isozymes in complete genomes of some
mycobacteria, i.e., 20 CYPs in M. tuberculosis (Cole and
Barrell 1998), 18 CYPs in M. bovis (Garnier et al. 2003),
42 CYPs in M. avium ssp. paratuberculosis (NC_002944),
and approximately 40 CYPs in M. smegmatis (Jackson et al.
2003) and M. avium 104 (Kelly et al. 2003), it is quite
likely that M. vanbaalenii also has more than three CYPs.
Only the complete genome sequence of M. vanbaalenii
PYR-1 will tell the total number of CYPs present in this
bacterium.
Studies on the activity of bacterial CYPs towards PAHs
are scarce (Carmichael and Wong 2001; England et al.
1998; Harford-Cross et al. 2000; Joo et al. 1999; Li et al.
2001; Taylor et al. 1999), and none of these previously
assayed CYPs originate from a Mycobacterium or from a
PAH utilizing strain. In our study, two CYPs from M.
vanbaalenii PYR-1, PipA and CYP150, were heterologously expressed in E. coli, and whole cell biotransformation experiments were performed to prove their ability to
oxygenate PAHs.
Cytochrome P450s are multicomponent enzymes consisting of two separated functional classes, electron transfer
and oxygenation. Interaction and complementation between two functional classes are necessary for the full
catalytic function. The expression in E. coli of both PipA
and CYP150 from M. vanbaalenii PYR-1 with functional
activity suggests that the electron transport system for PipA
and CYP150 can be complemented by the unidentified
electron transport systems of E. coli used as a host. This
result has been observed in many cytochrome P450s and
dioxygenases (Joo et al. 1999; Khan et al. 2001; Kurkela et
al. 1988; Laurie and Lloyd-Jones 1999; Simon et al. 1993).
Moreover, the supplementation of phdCD electron-transport system of a nonheme dioxygenase from Nocardioides
sp. KP7 (Saito et al. 2000) increased the transforming
activity of PipA and CYP150. This suggests the relatively
low specificity of the electron-transport systems toward
PipA and CYP150. The PhdC protein used in our study
was the first example of the [3Fe-4S] type of ferredoxin in
nonheme dioxygenases (Saito et al. 2000) and has 38%
identity to the [3Fe-4S] type of ferredoxin component of
PipA from M. vanbaalenii PYR-1. The three cysteine residues that serve as ligands for the iron–sulfur cluster are
conserved in both PhdC and ferredoxin of PipA (Fig. 1).
This tolerance between cytochrome P450s and other electron transport systems gives clues for understanding the
relationships in the number and the specificity of a redox
partnership between cytochrome P450 and electron transport systems.
In order to obtain direct evidence of the oxidation of
PAHs by cytochrome P450 in M. vanbaalenii PYR-1, PipA
that was expressed mainly as a functionally active form
in the cytosol was chosen and tested for the inhibition of
cytochrome P450 and the oxidation activity of apo-PipA.
Based on the previous investigation (Schlenk et al. 1994),
DBT and metyrapone were used as a substrate and inhibitor, respectively. S-oxidation of DBT in E. coli that can
express active PipA was decreased by metyrapone. In addition, apo-PipA lacking heme could not form DBT 5-oxide.
These conclusive results support the metabolic evidence of
the involvement of cytochrome P450s in PAH metabolism
in M. vanbaalenii PYR-1. According to Richardson et al.
(1995), the influence of ALA on cytochrome P450 synthesis in E. coli depends on the form of cytochrome P450. The
addition of ALA and FeCl3 did not increase the expression
level of PipA, based on the intensity of the bands corresponding to holo-PipA and apo-PipA in the SDS-PAGE gel
(Fig. 3a, lanes 6 and 8), indicating that heme synthesis was
not a rate-limiting step in PipA production.
According to PCR results, pipA, cyp150, and cyp51
detection varied among the strains and exhibited no correlation with the strains’ PAH-degrading ability (Table 1). In
contrast to this, the alternative PAH-oxygenation enzyme,
the aromatic ring-hydroxylating dioxygenase encoded
by nidA and nidB genes, was consistently present in PAHutilizing mycobacteria and absent in PAH nonutilizers
(Table 1) (Brezna et al. 2003). It seems that the genes nidA
and nidB are specialized for the degradation of PAHs,
whereas the primary role of pipA, cyp150, and cyp51 is
531
different and the PAH monooxygenation is only a fortuitous or nonspecific reaction. The true biological function
of PipA (CYP150 family) is degradation of heterocyclic
amines like morpholine or piperdine (Poupin et al. 1999a,
b; Sielaff et al. 2001; Taylor et al. 1999; Trigui et al. 2004),
while the physiological roles of CYP150 and mycobacterial CYP51 are obscure (Cole and Barrell 1998). Regardless of the primary function of the three CYPs, the results
of the PCR screening showed that it is not unusual for
soil mycobacteria to have both ring-hydroxylating dioxygenases and cytochromes P450 since all of the strains that
contained nidAB genes possessed at least one of the studied
cyp isogenes. Thus, several mycobacteria have a potential
to use both dioxygenation and monooxygenation reactions
for initial biotransformation of PAHs.
Acknowledgements This work was supported in part by an
appointment to the Postgraduate Research Program at the National
Center for Toxicological Research administered by the Oak Ridge
Institute for Science and Education through an interagency agreement between the US Department of Energy and the US Food and
Drug Administration.
References
Aoyama Y, Noshiro M, Gotoh O, Imaoka S, Funae Y, Kurosawa N,
Horiuchi T, Yoshida Y (1996) Sterol 14-demethylase P450
(P45014DM*) is one of the most ancient and conserved P450
species. J Biochem (Tokyo) 119:926–933
Aoyama Y, Horiuchi T, Gotoh O, Noshiro M, Yoshida Y (1998)
CYP51-like gene of Mycobacterium tuberculosis actually encodes
a P450 similar to eukaryotic CYP51. J Biochem (Tokyo) 124:
694–696
Bellamine A, Mangla AT, Nes WD, Waterman MR (1999)
Characterization and catalytic properties of the sterol 14alphademethylase from Mycobacterium tuberculosis. Proc Natl Acad
Sci U S A 96:8937–8942
Brezna B, Khan AA, Cerniglia CE (2003) Molecular characterization of dioxygenases from polycyclic aromatic hydrocarbondegrading Mycobacterium spp. FEMS Microbiol Lett 223:177–
183
Carmichael AB, Wong LL (2001) Protein engineering of Bacillus
megaterium CYP102. The oxidation of polycyclic aromatic
hydrocarbons. Eur J Biochem 268:3117–3125
Cerniglia CE, Sutherland JB (2001) Bioremediation of polycyclic
aromatic hydrocarbons by ligninolytic and non-ligninolytic
fungi. In: Gadd GM (ed) Fungi in bioremediation. Cambridge
University Press, Cambridge, pp 136–187
Cerniglia CE, Fu PP, Yang SK (1982) Metabolism of 7-methylbenz
[a]anthracene and 7-hydroxymethylbenz[a]anthracene by Cunninghamella elegans. Appl Environ Microbiol 44:682–689
Cerniglia CE, Kelly DW, Freeman JP, Miller DW (1986) Microbial
metabolism of pyrene. Chem Biol Interact 57:203–216
Cole ST, Barrell BG (1998) Analysis of the genome of Mycobacterium tuberculosis H37Rv. Novartis Found Symp 217:160–
172; discussion 172–167
Edmondson RD, Vondriska TM, Biederman KJ, Zhang J, Jones RC,
Zheng Y, Allen DL, Xiu JX, Cardwell EM, Pisano MR, Ping P
(2002) Protein kinase C epsilon signaling complexes include
metabolism- and transcription/translation-related proteins: complimentary separation techniques with LC/MS/MS. Mol Cell
Proteomics 1:421–433
England PA, Harford-Cross CF, Stevenson JA, Rouch DA, Wong
LL (1998) The oxidation of naphthalene and pyrene by
cytochrome P450cam. FEBS Lett 424:271–274
Francis RT Jr, Becker RR (1984) Specific indication of hemoproteins in polyacrylamide gels using a double-staining process.
Anal Biochem 136:509–514
Garnier T, Eiglmeier K, Camus JC, Medina N, Mansoor H, Pryor M,
Duthoy S, Grondin S, Lacroix C, Monsempe C, Simon S,
Harris B, Atkin R, Doggett J, Mayes R, Keating L, Wheeler
PR, Parkhill J, Barrell BG, Cole ST, Gordon SV, Hewinson RG
(2003) The complete genome sequence of Mycobacterium
bovis. Proc Natl Acad Sci U S A 100:7877–7882
Harford-Cross CF, Carmichael AB, Allan FK, England PA, Rouch
DA, Wong LL (2000) Protein engineering of cytochrome p450
(cam) (CYP101) for the oxidation of polycyclic aromatic
hydrocarbons. Protein Eng 13:121–128
Heitkamp MA, Freeman JP, Miller DW, Cerniglia CE (1988) Pyrene
degradation by a Mycobacterium sp.; identification of ring
oxidation and ring fission products. Appl Environ Microbiol
54:2556–2565
Jackson CJ, Lamb DC, Marczylo TH, Parker JE, Manning NL,
Kelly DE, Kelly SL (2003) Conservation and cloning of
CYP51: a sterol 14 alpha-demethylase from Mycobacterium
smegmatis. Biochem Biophys Res Commun 301:558–563
Joo H, Lin Z, Arnold FH (1999) Laboratory evolution of peroxidemediated cytochrome P450 hydroxylation. Nature 399:670–
673
Kanaly RA, Harayama S (2000) Biodegradation of high-molecularweight polycyclic aromatic hydrocarbons by bacteria. J Bacteriol
182:2059–2067
Kelley I, Freeman JP, Cerniglia CE (1990) Identification of
metabolites from degradation of naphthalene by a Mycobacterium sp. Biodegradation 1:283–290
Kelly SL, Lamb DC, Jackson CJ, Warrilow AG, Kelly DE (2003)
The biodiversity of microbial cytochromes P450. Adv Microb
Physiol 47:131–186
Khan AA, Wang RF, Cao WW, Doerge DR, Wennerstrom D,
Cerniglia CE (2001) Molecular cloning, nucleotide sequence,
and expression of genes encoding a polycyclic aromatic ring
dioxygenase from Mycobacterium sp. strain PYR-1. Appl
Environ Microbiol 67:3577–3585
Khan A, Kim SJ, Paine DD, Cerniglia CE (2002) Classification of a
polycyclic aromatic hydrocarbon-metabolizing bacterium, Mycobacterium sp. strain PYR-1, as Mycobacterium vanbaalenii
sp. Int J Syst Evol Microbiol 52:1997–2002
Kim SJ, Jones RC, Cha CJ, Kweon O, Edmondson RD, Cerniglia
CE (2004a) Identification of proteins induced by polycyclic
aromatic hydrocarbon in Mycobacterium vanbaalenii PYR-1
using two-dimensional polyacrylamide gel electrophoresis and
de novo sequencing methods. Proteomics 4:3899–3908
Kim YH, Moody JD, Freeman JP, Engesser KH, Cerniglia CE
(2004b) Evidence for the existence of PAH-quinone reductase
and catechol-O-methyltransferase in Mycobacterium vanbaalenii PYR-1. J Ind Microbiol Biotechnol 31:507–516
Kim YH, Freeman JP, Moody JD, Engesser KH, Cerniglia CE
(2005) Effects of pH on the degradation of phenanthrene and
pyrene by Mycobacterium vanbaalenii PYR-1. Appl Microbiol
Biotechnol 67:275–285
Kurkela S, Lehvaslaiho H, Palva ET, Teeri TH (1988) Cloning,
nucleotide sequence and characterization of genes encoding
naphthalene dioxygenase of Pseudomonas putida strain NCIB9816.
Gene 73:355–362
Laurie AD, Lloyd-Jones G (1999) The phn genes of Burkholderia
sp. strain RP007 constitute a divergent gene cluster for
polycyclic aromatic hydrocarbon catabolism. J Bacteriol 181:
531–540
Lepesheva GI, Podust LM, Bellamine A, Waterman MR (2001)
Folding requirements are different between sterol 14-alphademethylase (CYP51) from Mycobacterium tuberculosis and
human or fungal orthologs. J Biol Chem 276:28413–28420
Li QS, Ogawa J, Schmid RD, Shimizu S (2001) Engineering
cytochrome P450 BM-3 for oxidation of polycyclic aromatic
hydrocarbons. Appl Environ Microbiol 67:5735–5739
532
Licklider LJ, Thoreen CC, Peng J, Gygi SP (2002) Automation of
nanoscale microcapillary liquid chromatography-tandem mass
spectrometry with a vented column. Anal Chem 74:3076–3083
McLean KJ, Cheesman MR, Rivers SL, Richmond A, Leys D,
Chapman SK, Reid GA, Price NC, Kelly SM, Clarkson J,
Smith WE, Munro AW (2002) Expression, purification and
spectroscopic characterization of the cytochrome P450 CYP121
from Mycobacterium tuberculosis. J Inorg Biochem 91:527–
541
Moody JD, Freeman JP, Doerge DR, Cerniglia CE (2001) Degradation of phenanthrene and anthracene by cell suspensions of
Mycobacterium sp. strain PYR-1. Appl Environ Microbiol
67:1476–1483
Moody JD, Doerge DR, Freeman JP, Cerniglia CE (2002) Degradation of biphenyl by Mycobacterium sp. strain PYR-1. Appl
Microbiol Biotechnol 58:364–369
Moody JD, Fu PP, Freeman JP, Cerniglia CE (2003) Regio- and
stereoselective metabolism of 7,12–dimethylbenz[a]anthracene
by Mycobacterium vanbaalenii PYR-1. Appl Environ Microbiol 69:3924–3931
Moody JD, Freeman JP, Fu PP, Cerniglia CE (2004) Degradation of
benzo[a]pyrene by Mycobacterium vanbaalenii PYR-1. Appl
Environ Microbiol 70:340–345
Moody JD, Freeman JP, Cerniglia CE (2005) Degradation of benz
[a]anthracene by Mycobacterium vanbaalenii strain PYR-1.
Biodegradation 16:513–526
Mowat CG, Leys D, McLean KJ, Rivers SL, Richmond A, Munro
AW, Ortiz Lombardia M, Alzari PM, Reid GA, Chapman SK,
Walkinshaw MD (2002) Crystallization and preliminary
crystallographic analysis of a novel cytochrome P450 from
Mycobacterium tuberculosis. Acta Crystallogr D Biol Crystallogr 58:704–705
Mueller JG, Cerniglia CE, Pritchard PH (1996) Bioremediation:
principles and applications. Cambridge University Press,
Cambridge
Omura T, Sato R (1964) The carbon monoxide-binding pigment of
liver microsomes. I. Evidence for its hemoprotein nature. J Biol
Chem 239:2370–2378
Poupin P, Ducrocq V, Hallier-Soulier S, Truffaut N (1999a) Cloning
and characterization of the genes encoding a cytochrome P450
(PipA) involved in piperidine and pyrrolidine utilization and its
regulatory protein (PipR) in Mycobacterium smegmatis
mc2155. J Bacteriol 181:3419–3426
Poupin P, Godon JJ, Zumstein E, Truffaut N (1999b) Degradation of
morpholine, piperidine, and pyrrolidine by Mycobacteria:
evidences for the involvement of a cytochrome P450. Can J
Microbiol 45:209–216
Richardson TH, Jung F, Griffin KJ, Wester M, Raucey JL, Kemper
B, Bornheim LM, Hassett C, Omienski CJ, Johnnson EF
(1995) A universal approach to the expression of human and
rabbit cytochrome P450s of the 2C subfamily in Escherichia
coli. Arch Biochem Biophys 323:87–96
Roberts GA, Gideon G, Andy G, Sabine LF, Nicholas JT (2002)
Identification of a new class of cytochrome P450 from a
Rhodococcus sp. J Bacteriol 184:3898–3908
Saito A, Iwabuchi T, Harayama S (2000) A novel phenanthrene
dioxygenase from Nocardioides sp. strain KP7: expression in
Escherichia coli. J Bacteriol 182:2134–2141
Schlenk D, Bevers RJ, Vertino AM, Cerniglia CE (1994) P450
catalysed S-oxidation of dibenzothiophene by Cunninghamella
elegans. Xenobiotica 24:1077–1083
Sielaff B, Andreesen JR, Schrader T (2001) A cytochrome P450 and
a ferredoxin isolated from Mycobacterium sp. strain HE5 after
growth on morpholine. Appl Microbiol Biotechnol 56:458–464
Simon MJ, Osslund TD, Saunders R, Ensley BD, Suggs S, Harcourt
A, Suen WC, Cruden DL, Gibson DT, Zylstra GJ (1993)
Sequences of genes encoding naphthalene dioxygenase in
Pseudomonas putida strains G7 and NCIB 9816-4. Gene
127:31–37
Stingley RL, Brezna B, Khan AA, Cerniglia CE (2004a) Novel
organization of genes in a phthalate degradation operon of
Mycobacterium vanbaalenii PYR-1. Microbiology 150:3749–
3761
Stingley RL, Khan AA, Cerniglia CE (2004b) Molecular characterization of a phenanthrene degradation pathway in Mycobacterium vanbaalenii PYR-1. Biochem Biophys Res Commun
322:133–146
Taylor M, Lamb DC, Cannell R, Dawson M, Kelly SL (1999)
Cytochrome P450105D1 (CYP105D1) from Streptomyces
griseus: heterologous expression, activity, and activation effects
of multiple xenobiotics. Biochem Biophys Res Commun 263:
838–842
Trigui M, Pulvin S, Truffaut N, Thomas D, Poupin P (2004)
Molecular cloning, nucleotide sequencing and expression of
genes encoding a cytochrome P450 system involved in
secondary amine utilization in Mycobacterium sp. strain RP1.
Res Microbiol 155:1–9