Chapter 8 Review, pages 404–409
Knowledge
1. a
2. a
3. d
4. b
5. a
6. d
7. d
8. d
9. d
10. False. Replacement insulin for diabetics was first collected from the pancreases of pigs and
cows.
11. False. If a restriction enzyme cuts straight across the strand, a blunt end results.
12. True
13. True
14. False. During gel electrophoresis, negatively charged DNA fragments travel through a gel
away from a negative electrode at the starting end and toward a positive electrode at the
destination end.
15. True
16. True
17. True
18. False. The national DNA databank in Ottawa was established to store the genetic identities
of all Canadians convicted of a crime as well as crime scene samples.
19. (a) iii
(b) v
(c) ii
(d) iv
(e) i
20. DNA ligase is an enzyme that seals or anneals cut strands of DNA back together. The two
DNA strands must be complementary and bond initially on their own through hydrogen bonding.
DNA ligase then comes in and strengthens that bond by connecting the phosphate groups.
21. DNA fragments with sticky ends are easier to put back together because they overlap and
form a stronger bond. Blunt ends do not overlap.
22. The sudden change in temperature disrupts the charges on the cell membrane, and the
plasmid can slip through.
23. (a) DNA ligase is the enzyme that forms the phosphodiester bonds between two pieces of
DNA strand backbone. The DNA strands are tightly bound when this happens.
(b) Initially, hydrogen bonds form between the complementary base pairs but this is not a
stable arrangement.
24. The recognition sites for restriction enzymes on the DNA are palindromic (they read the
same forwards and backwards) when you consider both strands. For example, the sequence
ATCCTA is palindromic.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-2
25. PCR can be used to identify whether a wildlife species has been raised in captivity or in the
wild. This knowledge can be used as evidence in court to charge poachers, illegal hunters, or
animal collectors. PCR compares the DNA of wild and captive populations so it can trace the
origin of an individual.
26. denaturing: separating the two DNA strands
annealing: single stranded DNA primers attach to separated strands
elongation: new DNA strands are synthesized on both original strands
27. The Sanger chain termination method adds labelled dideoxynucleotides, which terminate the
elongation of the strand. The DNA fragments are then separated by gel electrophoresis with a
resolution of one nucleotide. The sequence of the DNA fragment can then be determined by the
order of specific labelling of ddNTPs that correspond to the specific nucleotides of the DNA
fragment. The whole-genome shotgun method fragments the DNA strands and then uses
computer technology to reconstruct the genome. The nanopore method passes a single strand of
DNA through a small 2.5 nm hole to identify nucleotide bases. All method can identify base
pairs and rely on computer technology. The chain termination method is the slowest technique.
28. Sequence similarity searches look for the same sequence of base pairs in different organisms.
29. Researchers use DNA microarrays to determine the expression of genes and therefore to
understand the function of genes. They can also be used to detect genetic mutations.
30. Biopharming is the genetic engineering of organisms so that they produce products for
human use such as pharmaceuticals. It is done by inserting a gene that codes for a desired protein
into an organism that doesn’t usually carry that gene.
31. A transgenic organism is an organism in which a foreign gene has been inserted into its
genome. Examples are canola resistant to herbicides, cattle resistant to mad cow disease, and
E. coli to produce insulin.
32. PKU is a genetic disease in which the individual cannot break down the amino acid
phenylalanine. It is treated by changing the diet to one that it is low in phenylalanine.
33. Humans cannot receive germ-line therapy because it has been deemed unethical since both
the individual and their offspring will be permanently changed.
34. The goal of the Human Genome Project (HGP) was to map the human genome. It was started
in 1990 and completed in 2001.
Understanding
35. The probability of finding any one base is 1/41 or 1/4 at any one site. The exponent is the
number of bases being sought, and accounts for the exponential effect of probability.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-3
36.
37. In a laboratory, scientists can use calcium chloride at the freezing point of water (0 °C) to
induce a bacterial cell that is not competent to take up a plasmid-containing foreign DNA. The
calcium ions stabilize the negative phosphate ions on the lipid bilayer. The calcium chloride
solution is then quickly heated and re-cooled. The sudden temperature change disrupts the
membrane momentarily, allowing the plasmid to enter.
38. (a) In nature, restriction enzymes protect the cells in which they are found. When a
bacteriophage injects its own DNA into a bacterial cell, the restriction enzymes can cut apart that
viral DNA.
(b) Scientists figured out how to use this characteristic of restriction enzymes in DNA
technology to excise a DNA molecule at a specific location.
39. Plasmids are beneficial because they confer certain protection to their cells, such as antibiotic
resistance or resistance to toxins such as heavy metals or chemicals. They provide a mechanism
for certain cells to be more adaptable to change.
40. (a) A hybridization probe is a small segment of DNA that can be used to detect the presence
of a complementary sequence in a sample.
(b) The purpose of hybridization is to confirm the presence of a certain gene or DNA sequence.
Because the probe binds to this sequence, it must be exactly complementary and therefore
specific to the desired sequence.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-4
(c) Biologists transferring an insulin gene into a bacteria or other organism for production can
use hybridization to confirm whether or not the insulin gene is present after the transformation
attempt.
41. Researchers insert a human insulin gene into the E. coli in a recombinant plasmid. Then,
through cloning, the plasmid with the recombinant DNA is replicated over and over again to
produce many plasmids, all of which will code for insulin production.
42. Restriction enzymes that have shorter recognition sequences will make far more cuts than
other restriction enzymes, resulting in smaller DNA fragments than the scientists might want.
43.
44. 2.5 nm = 2.5 × 10–7 cm
45. Answers may vary. Sample answer: Plants and animals can be produced in higher numbers
and less expensively if some of the problems associated with raising them for commercial
purposes can be overcome. These problems include insects and weeds, a lack of rainfall, as well
as reduced harvest yields. Additionally, genetic engineering can improve flavour, add vitamins
or other wanted ingredients, and produce a product that is easier to bring to market.
46.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-5
In germ-line therapy, the modification can be passed on to the next generation. It is not used in
Canada because of ethical issues. Somatic gene therapy involves gene transfer into somatic cells
and is not widely used in humans due to dangerous side effects and other issues.
Analysis and Application
47. 5′-TACCTACGAAGCTTATCGCCCGC-3′; complement 3′-GCTTCG-5′
48. The fewer base pairs on the recognition site for a restriction enzyme, the greater the number
of cuts. The probability of finding a particular four-pair sequence is one in 44, or 0.4 %. For
EcoRI, the chance of finding the six-pair sequence it needs to perform a cut is one in 46, or
0.02 %.
49. 5′- TTATTATTAAAGCTTCTCGAATTCGAGAAGCTTGGTCCCC-3′
3′- AATAATAATTTCGAAGAGCTTAAGCTCTTCGAACCAGGGG– 5′
Using EcoRI cuts the sequence in one location: the 18th bp. HindII makes two cuts, one at
the 11th bp and one starting at the 30th bp. There were no recognition sites for the other two
restriction enzymes.
50.
Lane B
distance
(mm)
12
23
43
61
bp
42 000
10 500
3 000
1 900
Lane C
distance
(mm)
8
21
33
46
bp
100 000
12 000
5 000
2 900
51. In plasmids the formula is: number of segments = number of recognition sites on the
plasmid
In eukaryotic chromosomes the formula is: number of segments = number of recognition sites
on the chromosome + 1.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-6
52. (a) The plasmid is 7896 bp long.
(b) (c) (d)
EcoRI
BamHI
HindIII
6660
1236
6497
1399
6396
1071
429
EcoRI +
HindIII
4788
1236
1071
429
372
EcoRI, BamHI,
and HindIII
2333
1399
1236
1071
1056
429
372
(e) BamHI should not be used on this plasmid as it cuts the plasmid in the middle of the
tetracyclin resistance gene.
(f)
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-7
53. (a)
(b) The 1.1 and 1.3 kbp fragments might be difficult to isolate because they are close together.
(c) Running the gel for a longer period of time and with a longer gel might separate the
fragments more. Alternatively, those 2 fragments could be isolated and run in a separate gel.
54. number of cuts = 45 =1024; frequency of cuts = 200 000/1024 = 195.3 bp
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-8
55. (a)
(b) During the first two replications the segments are unequal as taq adds nucleotides until it
reaches the end of the DNA sequence. On the first replication, variable length strands are now
produced with the target region located at one end and a tail at the other. This is a result of the
primers annealing on either side of the target sequence. On the second replication, there are
two sequences that terminate at the target region and the primers can anneal on either side of
the target sequence.
(c) In the third replication, all the fragments are the same length.
(d) Reverse primer: 3′-CAATTAG-5′; forward primer: 5′-TACG-3′
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies
8-9
56.
Flowcharts should show use of the HinIII restriction enzyme as it leaves the gene intact, lyses
the DNA behind the operon and promoter, and leaves the glo gene intact.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies 8-10
57. (a) Answers may vary. Graphic organizers should show that genome analysis includes
structural genomics, which is the study of the actual sequencing of a genome and the analysis of
the nucleotide sequences to locate genes within the genome, and functional genomics, which is
the study of the functions of genes, how they are expressed, what proteins they make, and what
role these proteins play in metabolic processes.
(b) Functional genomics would benefit from microarray technology as the technology is
designed to look for functioning proteins rather than their shape.
58. Answers may vary. Sample answer: There are many surprising structural and functional
features to gene organization that have been revealed through gene sequencing. The eukaryotic
genomes sequenced to date contain large numbers of previously unknown genes. As many as
12 000 of the 19 000 genes are of unknown function. Another surprising feature is the number of
pseudogenes and how ubiquitous they are throughout the evolutionary tree.
59. You would use BamHI. PvuI cuts the plasmid in the middle of the ampicillin resistance gene.
Any genes inserted here would render the ampicillin resistance gene nonfunctional, and no
transformed bacteria would survive exposure to ampicillin.
60.
61. Scientists can change the diet of a patient to reduce the buildup of amino acids or proteins in
the body. Another method of treatment involves directly providing the protein that a missing or
defective gene is failing to make. Scientists may also perform surgery to replace defective organs
with a transplant or to make repairs to an organ. Surgery is the most invasive of these three
treatments.
62. The evidence does not support the officers’ suspicion. Although the sample with restriction
enzyme 1 indicates similarity, enzyme 2 does not show any matches at any of the restriction
enzyme sites. Therefore this fish is not similar to the established markers used for this species.
Evaluation
63. Answers may vary. Answer should include the following steps:
1) Isolate the desired gene or DNA fragment.
2) Use restriction enzymes to excise the gene fragment.
3) Insert the gene into a vector such as a plasmid. This is now recombinant DNA.
4) Introduce the vector into a suitable organism known as the host (transformation).
5) Select the cells that have been successfully transformed.
6) Allow those host cells to grow and divide, and put them in conditions to express the target
gene.
64. Answers may vary. Answers should include elaboration of this idea and examples to support
it: DNA sequencing techniques have made it possible to analyze the sequences of entire
genomes. Having this sequence aids researchers in unravelling how each gene functions.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies 8-11
65. Palmiter’s work was the first time that gene therapy was used. This therapy implied that a
similar technique might be able to be developed to correct genetic disorders in humans. Palmiter
injected a growth hormone gene from rats into fertilized mouse eggs and implanted the eggs into
a surrogate mother. She gave birth to some normal-sized mouse pups that grew faster than
normal and became about twice the size of their normal littermates. The media called these giant
mice.
66. (a) In shotgun sequencing, the DNA is broken up into many fragments. The multiple DNA
fragments are overlapped and reassembled by matching overlapping sequences in each fragment.
The shotgun sequencing method poses problems because the genome has some repeating
sections that are difficult to overlap correctly.
(b) Answers may vary. Sample answer: The book analogy is a better analogy than the shotgun
blast analogy because it is easier to understand how the genome (book) could be reconstructed
using overlapping pages from several identical books. The shotgun analogy gives an idea of how
the genome will be randomly fragmented, but it does not help to understand the reconstruction of
the genome.
67. In most cases this would indicate that the cell has become competent and successfully took
up the desired DNA sequence. For example, bacterial cells that were mixed with genetically
engineered plasmids are grown under optimum conditions. The cells are then tested for
ampicillin resistance. Those that contain the plasmid will be resistant and will grow in a medium
containing ampicillin. If they do not grow and replicate, they do not contain the ampicillinresistant plasmid, and therefore transformation did not occur.
68. (a) For DNA ligase to rejoin DNA, the ends of the two DNA fragments need to be naturally
attracted to each other. If they were made using the same restriction enzyme, they will be
complementary because each restriction enzyme cuts specifically at one sequence of nucleic
acids.
(b) As the two DNA fragments join, a water molecule is driven off during a condensation
reaction. Many organic and body reactions are the same condensation reaction.
69. Answers may vary. Sample answer: One analogy for sequencing the genome is finding the
blueprints and all the parts for a jumbo jet whereas deciphering the proteome is like finding the
assembly, repair, and operation manual. Although both are important, the structural and
functional proteome has more value, as it is more data rich.
70. The laboratory mouse is well studied in medical experiments and has a similar genetic
complexity to humans. Caenorhabditis is a simple multi-cellular animal with a set number of
cells. Fruit flies have been used for years in the study of genetics. Yeast represents common
single-celled organisms and E. coli is a useful essential bacteria. The HGP wanted to use
organisms that have been widely and previously studied, not rarities or exceptions, because these
would have the widest applications in the study of comparative genomics.
71. Answers may vary but should include concerns such as the negative consequences for the
organism, the possibly that genetically modified plants will outcompete other species, the
possibility of cross-pollination with non-GM plants, and expense; and benefits such as higher
yields, drought tolerance, herbicide resistance, faster growth rates, longer fruiting times, high
protein assimilation.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies 8-12
72. Answers may vary. Sample answer: Certain bacteria can produce the biopolymer needed for
biodegradable plastic. Three enzymes have to intervene to produce this. By transferring bacterial
genes into plants, a significant amount of carbon metabolism can be re-routed in the plants to
produce a biodegradable plastic. This provides significant environmental benefits. However, the
use of prime farmland for the production of biodegradable plastics is concerning in that it
removes valuable farmland from producing food crops. Ideally scientists should also look for
organisms or genes that can grow on marginal farmland rather than on prime farmland.
73. (a) Knockout mice are genetically engineered to make certain genes nonfunctional so that
scientists can study the effects of life without them. They become homozygous for one certain
gene with both copies of that gene altered.
(b) Scientists raise the mice and study them to see if the presence of the nonfunctional gene
changed the mice in any way.
(c) Answers will vary. Answers should include opinions and factual support for the opinions
based on commonly used procedures for inserting transgenic materials.
74. Answers may vary. Answers should include: information about the right to disclosure for
companies, the right to privacy of information of the individual, the right to be free from
discrimination, and the right to be free from persecution and prosecution based on genetic
identity.
75. Sickle cell disease can be treated by replacing bone marrow cells with stem cells from the
umbilical cord of an unrelated infant. These stem cells produced healthy bone marrow cells. Yet,
a teenage patient in a somatic gene therapy trial died as a result of a severe immune response to
the viral vector being used to introduce a normal gene to correct his genetic deficiency. Other
patients have developed a leukemia-like condition from the introduction of genes into blood
stem cells.
76. Answers may vary. Sample answer: After early success treating genetic disorders, somatic
gene therapy has been somewhat of a disappointment. In some cases, it must be repeated to be
effective and in others, people have died. I believe it is worth pursuing research in somatic gene
therapy because it could result in permanent cure for some genetic diseases, but use of it as
treatment should be delayed until it is more reliable.
Reflect on Your Learning
77. Answers may vary. Answers should include explanations that use information about a
particular genetic technology or issue.
78. Answers may vary. Sample answer: First I would discuss the results with a genetic
counsellor to learn more about the mutation and the consequences of having that mutation. With
the genetic counsellor, I would then devise a plan to deal with the disorder. If I had children I
would want to discuss the matter with them.
79. Answers may vary. Sample answer: Yes, I would want to know my genetic profile. This
would allow me to make educated decisions about my life; for example, whether I wanted to
have children.
80. Answers may vary. Sample answer: Yes, there should be a Genetic Charter of Rights. There
are so many holes in our knowledge of gene function that people might be discriminated against
based on their genetic code for no valid reason. As science improves its understanding of
genetics we need to protect our rights while we develop a better understanding of how our
DNA works.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies 8-13
Research
81. Answers may vary. Sample answer: The people in developing countries who are most in
need of the transgenic plants cannot afford to buy the seeds based on the price set by the
manufacturers. Often, these are also crops that are not native to the area and require complete
cultural shifts. For example,, in some parts of Africa although golden rice is grown and can be
cultivated cheaply, the previous years of food aid included corn. Because golden rice is yellow,
the colour of corn and corn meal, it has been associated with being poor. This has prevented
golden rice from being more widely adopted in these areas.
82. Answers may vary. Answers should include: Molecular anthropology is the field of
anthropology that uses molecular techniques to compare DNA sequences of modern and ancient
human populations to determine their relatedness. Evolutionary genetics is the field of biology
that looks at the causes and consequences of changes in gene frequency in populations over time.
Ancient DNA degrades over time so it tends to be low quality and difficult to isolate. Scientists
hope to find DNA in specimens that have been preserved, for example in peat bogs or glaciers,
or in amber. They have to be careful to not contaminate the specimen with modern DNA.
83. Answers may vary. Answers should include:
 The GFP is extremely useful in marking and tracking modifications in a wide variety of
organisms at both the cellular level and organism level. One application of the GFP has been
to track viral infections in crop plants.
 Many experiments are using the GFP to identify sick livestock. By manipulating the germ line
of an organism, scientists use the organism’s immune system to activate the GFP gene. When the
organism is sick, it produces the GFP. For example, if a pig that has swine flu passes under a UV
light, it glows, indicating that it needs to be treated. This could reduce the number of infections
and limit the evolution of the diseases since the organisms would only receive medication when
necessary. This would save money for farmers and prevent medications from entering the food
chain in the tissues of our food.
 Additionally, this would allow earlier detection and treatment or isolation of the sick animals.
This would allow nations to treat the disease and prevent its spread without jeopardizing the
entire nation’s food supply and it will allow the industry to isolate the disease and recover more
quickly using the assurance that the virus will be detected very early using the GFP gene.
84. Answers may vary. Answers may include mention of the technique of dipping plant tissues
into a solution that greatly increases transformation.
85. Answers will vary but should include fluorescence in situ hybridization (FiSH). Using this
technique, researchers have replaced radioactive probes with fluorescent ones which are easier
to use and safer, and provide conspicuous gene detection.
86. Two-dimensional gel electrophoresis is used to analyze complex protein mixtures. Two
dimensions of separation take place. First, the proteins are separated using isoelectric
characteristics. Then, the proteins are run through a second gel that separates them based on
molecular weight.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies 8-14
87. Answers may vary. Answers may include: Some companies have developed genetically
engineered seeds that grow plants that do not produce viable seeds. These companies want
farmers to buy seeds new each season instead of storing seeds from the crop. This has caused
enormous controversy for farmers who typically do not need to buy seed each year. Some of
these companies have sued farmers who have grown plants from stored seeds, even if they have
accidentally blown onto the farmer’s land. This has many social implications: it makes food
more expensive. It reduces people’s buying power and forces farmers to become slaves to their
seed suppliers. This has tremendous impact for our food prices and the stability of the global
economy. It also presents an environmental risk: as farmers stop planting other varieties of the
crop, its genetic diversity may be lost.
88. Answers may vary. Answers should include: Frederick Sanger was born in 1918. His first
Nobel Prize in 1958 was for work on proteins, including identifying the structure of insulin. The
second prize in 1980 recognized the development of a method to sequence bases in nucleic acids.
DNA and RNA sequencing has led to much more understanding of different diseases and
conditions. It has increased our longevity and almost made it possible to feed the more than 7
billion people on this planet.
89. Answers may vary. Answers may include: Biopharming poses several issues of concern.
Unintentional spread of pharmaceutical genes can occur if pollen from a transgenic plant
fertilizes a wild-type plant. The offspring could produce the foreign gene, posing health
problems to animals, plants, and potentially the entire ecosystem.
90. Answers may vary. Answers may include: Polyhydroxybutyrate (PHB) is produced by
certain microorganisms, whereas tradition plastics are produced from hydrocarbons. Therefore
PHB is a renewable resource. Students may include one study that showed that several types of
industrial waste may be a source of substrate for developing and harvesting large quantities of
PHB at a much lower cost. Transgenic plants, such as corn and potato have also been used to
produce PHB.
91. Heirloom crops are varieties that were traditionally grown, but at present are rarely used in
large-scale production. More and more home gardeners are growing heirloom varieties. These
varieties have the potential to increase the genetic variation of our current crop cultivars if they
are cross bred. The public is becoming more interested in heirloom varieties and so some
growers are starting to use these varieties.
92. (a) STR analysis uses shorter fragments which is better for more degraded samples than
VNTR analysis is.
(b) The FBI predict a 13-loci match to be approximately 1 in 1012. Compared to the 5-VNTR
method at 1 in 109, this is a 1000 fold improvement. To determine the FBI method you multiply
the probabilities of all the individual STRs.
(c) DNA fingerprint analysis allows law enforcement officials to identify criminals with a high
degree of accuracy. However, police should not rely solely on this technique to solve crimes. It
can result in false convictions to infer guilt from the presence of DNA alone.
93. Answers may vary. Answers may include: Jesse Gelsinger was an 18-year old who
participated in a trial for ornithine transcarboxylase deficiency (OTCD), a genetic disease
affecting the liver. He died following a severe immune response to the adenoviral vector.
This shows that there are many risks associated with somatic gene therapy including factors
associated with the viral vector and the patient’s immune response.
Copyright © 2012 Nelson Education Ltd.
Chapter 8: Genetic Technologies 8-15