Advancesin NeuroimmunologyVol. 6, pp. 309-346, 1996
Pergamon
© 1997 Elsevier Science Ltd. All rights reserved
Printed in Great Britain
0960-5428/96 832.00
PII: S0960-5428(97)00028-9
Biology of the congenitally hypothyroid hyt/hyt
mouse
Elzbieta Biesiada *, Perrie M. Adams~f, Douglas R. Shanklin$,
George S. Bloom§ and Stuart A. Stein* II
*Division of Neurology,Children's Hospital of Orange County,455 South Main Street, Orange County, CA 92868, USA
tDepartments of Psychiatry and §Cell Biology and Neuroscience. University of Texas Southwestern Medical School,
Dallas, TX 75235, USA
+Department of Pathology and Obstetrics and Gynecology,University of Tennessee-Memphis, Memphis, TN 38120, USA
[tDepartment of Neurology, University of Miami School of Medicine, Miami, FL 33136, USA
Keywords~Hypothyroidism, hyt/hyt mouse, human sporadic congenital hypothyroidism, TSH receptor, TSH receptor
mutation, tubulin isoforms, neuronal process growth, thyroid hormone, gene expression.
Summary
The hyt/hyt mouse has an autosomal recessive,
fetal onset, characterized by severe hypothyroidism that persists throughout life and is a reliable model of h u m a n sporadic congenital
hypothyroidism. The hypothyroidism in the hyt/
hyt mouse reflects the hyporesponsiveness of the
thyroid gland to thyrotropin (TSH). This is
attributable to a point mutation of C to T at nucleotide position 1666, resulting in the replacement
of a Pro with Leu at position 556 in transmembrane domain IV of the G protein-linked TSH
receptor. This mutation leads to a reduction in all
c A M P - r e g u l a t e d events, i n c l u d i n g thyroid
hormone synthesis. The diminution in T3/T 4 in
serum and other organs, including the brain, also
leads to alterations in the level and timing of
expression of critical brain molecules, i.e. selected
tubulin isoforms (M~5, MI]2, and Mt~l), microtubule associated proteins (MAPs), and myelin
Corresponding author (at Orange County affiliation).
basic protein, as well as to changes in important
neuronal cytoskeletal events, i.e. microtubule
assembly and SCa and SCb axonal transport. In
the hyt/hyt mouse, fetal hypothyroidism leads to
reductions in M~5, M~2, and Meal mRNAs,
important tubulin isoforms, and M~5 and M~2
proteins, which comprise the microtubules. These
molecules are localized to layer V pyramidal
neurons in the sensorimotor cortex, a site of differentiating neurons, as well as a site for localization of specific thyroid hormone receptors. These
molecular abnormalities in specific cells and at
specific times of development or maturation may
contribute to the observed neuroanatomical
abnormalities, i.e. altered neuronal process growth
and maintenance, synaptogenesis, and myelination, in hypothyroid brain. Abnormal neuroanatomical development in selected brain regions may
be the factor underlying the abnormalities in
reflexive, locomotor, and adaptive behavior seen in
the hyt/hyt mouse and other hypothyroid animals.
© 1997 Elsevier Science Ltd. All rights reserved.
309
310
Advances in Neuroimmunology
hyt/hyt mouse (see Table 1)
Thyroid hormones and brain development
The
Thyroid hormones exert a broad range of effects
on development, growth, and metabolism.
Thyroxine (T4), the primary secretory product of
the thyroid, is relatively inactive and is converted
to the active hormone triiodothyronine (T3). The
actions of thyroid hormones are primarily the
result of the interaction o f T 3 with nuclear receptor proteins for T 3. This T 3 receptor (TH-R)
complex then binds to thyroid responsive elements (TREs) of the target genes to modify their
expression (Chin, 1992; Brent et al., 1991).
Thyroid hormone receptors (THRs) are members
of a family of hormone-responsive nuclear
transcription factors that are similar in structure
and mechanism of action (Lazar, 1993). THRs
contain a number of domains: a carboxy-terminal
portion, which is important for ligand binding
and interaction between receptors, a DNAbinding domain, and an amino-terminal domain,
which does not have an identified functional role.
The hyt/hyt mouse (see Table 1) has a severe and
persistent primary inherited hypothyroidism
(Stein et al., 1989a-d, 1991a-d) that is related to
a point mutation in the thyroid-stimulating
hormone receptor (TSHr) receptor of the thyroid
gland (Stein etal., 1994). This reduction in thyroid
hormone, similar to human SCH starts during the
fetal period with normal maternal thyroid function and is a reliable model of this human disorder.
H y t / h y t mouse demonstrates specific brain,
particularly cerebral cortex molecular and neuroanatomical abnormalities (Stein et al., 1989a,
1991 c) and pathological motor behavior (Stein et
al., 1991c). These behavioral abnormalities are
manifested by delayed and abnormal reflexive,
locomotor, and adaptive behavior (Adams et al.,
1989; Anthony et al., 1993; Adams et al., 1997)
in comparison to hyt/+ euthyroid littermates and
BALB/cBY +/+ progenitor strain controls. In the
hyt/hyt mouse, the autosomal recessive hypothyroidism begins in late gestation and persists
throughout life (Beamer et al., 1981 ; Stein et al.,
1989b). The fetal onset of this hypothyroidism
after fetal autonomous thyroid hormone secretion at 15 days post-conception (d pc) is also
temporally associated with fetal process growth
from the sensorimotor cortex (Schreyer and Jones,
1982; Jones et al., 1982; Wise et al., 1983). The
timing of the hypothyroidism corresponds to the
crucial late gestational and neonatal period of
appearance of reflexive motoric behaviors, cerebral
cortex neuronal differentiation of pyramidal
neurons, corticospinal tract development, and new
specific mRNA and protein synthesis in pyramidal
neurons and other cells of the cerebral cortex.
Because of these facts, this mouse is an ideal model
to evaluate the effects of thyroid hormone
deficiency on cortical pyramidal neurons that give
rise to the corticospinal tracts. Similarly, the timing
of the hypothyroidism corresponds to the molecular
and anatomical development of pyramidal neurons
in the hippocampus, visual cortex, and the olfactory cortex. Therefore, the hyt/hyt mouse has
relevance for understanding the role of thyroid
hormones on a number of critical neuronal systems.
Disorders of thyroid hormone level
Thyroid hormones have been shown to play
significant but poorly understood roles in the
development and differentiation of the rodent and
human brain. In humans, disorders of maternal
and fetal thyroid function include maternal and
secondary fetal iodine deficiency, and maternal
hypothyroidism or hyperthyroidism, and disorders
related to deficient fetal autonomous thyroid
hormone secretion, i.e. goiter or sporadic
congenital hypothyroidism (SCH). These
disorders are identifiable causes of mental retardation, cerebral palsy, and other significant
neurological abnormalities. The different human
conditions of thyroid hormone deficiency include
endemic cretinism, maternal hypothyroidism, and
sporadic congenital hypothyroidism. The timing
of the thyroid hormone deficiency and its duration can be used to classify these specific thyroid
hormone disorders in humans and in animal
models of the disorders (de Escobar et al., 1989;
Porterfield and Hendrich, 1991; Stein et al., 1989a,
1994; Stein, 1994) (see Fig. 1).
Biology of the congenitally hypothyroid hyt/hyt mouse
The hyt/hyt mouse as a model of human
sporadic congenital hypothyroidism
Although no animal is exactly the same as a
human, the hyt/hyt mouse is specifically relevant
to SCH because of the following factors:
(1) (The time of onset and severity of the fetal
hypothyroidism and its persistence postnatally; as with humans, the timing of onset of
the autosomal recessive hypothyroidism in the
hyt/hyt mouse at 15 (d pc) (Beamer et al.,
1981; Adams et al., 1989; Stein et al., 1989b)
corresponds with the beginning of autonomous
fetal thyroid hormone secretion. The severity
of the fetal hypothyroidism in the hyt/hyt mouse
is similar to patients with SCH and severe fetal
hypothyroidism who are more likely to
demonstrate learning disabilities despite early
T 4 treatment.
(2) (The hypothyroidism persists post-natally,
which simulates untreated SCH.
(3) (The hypoplasia and hyporesponsiveness of
the hyt/hyt thyroid gland is similar to a broad
group of identified human etiologies of SCH.
The hyt/hyt mouse is a model of severe fetal
SCH due to glandular hypoplasia or TSH
hyporesponsiveness; a number of cases of
hyporesponsiveness of the human thyroid
gland to TSH have been presented (Sunthornthepuarskul et al., 1995; Medeiros-Neto et
al., 1979; Stanbury, 1968; Codaccioni etal.,
1980; Takamatsu etal., 1993) and are similar
to the hyt/hyt mouse biochemically, physiologically, anatomically (e.g. thyroid gland
hypoplasia). Hypoplasia is a cause of SCH
in 63-83% of reported cases (Foley, 1991).
Hyt/hyt hypoplasia gives us insight not only
into cases of TSH hyporesponsiveness but
also the whole spectrum of SCH associated
with hypoplasia, whether the gland is in a
normal or ectopic position.
(4) The specific hyt/hytmutation is equivalent to
certain specific etiologies of SCH patients.
(5) Motor abnormalities (referable to the corticospinal tracts) and learning abnormalities
are observed.
311
(6) The use of an hyt/+ euthyroid mother for
mating assures fetal hypothyroidism related
to fetal gland dysfunction rather than
maternal hypothyroidism. Further, compared
to other models of hypothyroidism, the hyt/
hyt mouse has a primary inherited hypothyroidism and is superior to mice with
secondary hypothalamic-pituitary hypothyroidism (Noguchi, 1988) or artificially
produced pre-natal or post-natal hypothyroidism (Porterfield and Hendrich, 1991).
By the use of an hyt/hyt father and a euthyroid hyt/+ mother, relatively equal numbers
of hyt/hyt progeny and hyt/+ euthyroid
progeny, an internal control group, can be
generated (Adams et al., 1989).
Moderate to severe human sporadic
congenital hypothyroidism: a persistent
cause of m o t o r and learning disabilities
In the industrialized world, early human neonatal diagnosis by the mandatory neonatal blood
screening program and treatment with T4 have
effectively eliminated mental retardation and short
stature (reviewed in Stein, 1994; Glorieux et al.,
1992; Rovet et al., 1987; Wolter et al., 1979).
Currently in SCH, the contribution from and treatment of fetal hypothyroidism, the appropriate
dose for severe neonatal hypothyroidism and the
maintenance dose, and the timing and type of
post-natal clinical evaluations are not firmly
established. Current early treatment guidelines
and maintenance recommendations are based only
on normalization of T 4 and TSH in the serum.
The principles of nervous system treatment of
SCH are predicated on the results of studies by
the American Academy of Pediatrics 1993, which
differ in their findings and recommendations. The
New England Collaborative Group (New England
Congenital Hypothyroidism Collaborative, 1985,
1990) has suggested that early post-natal therapy
and adequate follow-up and maintenance therapy
are all that is required to prevent lowered IQ and
learning disability. Despite early T 4 therapy of
SCH, a number of excellent longitudinal
neurological and neuropsychological studies have
312
A d v a n c e s in N e u r o i m m u n o l o g y
GEPR Rat
A
.............
[PostnatalHTRat ]
Maternal Hypothyroid Rat
[
Iodine Deficient Rat
I
I
cog/cogMouse
I
I
hyt/hyt mouse
............
Birth
15
I
I
I
I Days
I
I
I
I Weeks
0
12
24
I
Birth
RODENT
HUMAN
I Sporadic Congent. HT
I
Endemic Cretinism
..........
I PrimaryMaternal Hypothyroidism I
I PrimaryMaternal Hyperthyroidism I
B
(FORMATION OF BRAIN STRUCTURES)
....
( BRAINSTEM
......
)
( BRAINSTEM
.....
NUCLB
( BRAINSTEM
( CEREBRAL
.......
)
PROJECTIONS
CORTEX
)
) ...............
{CEREBELLUM)
.........
( BASAL
.............
.............
GANGLIA
) ..........
( GLIOGENESIS
} ...........................
(CEREBRAL
CORTEX
NEUROGENESIS
..............
CEREBRAL
..................
( CC AXONAL
..................
( THALMO-CORTICO
......................
.....................................
.
AND
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
)
CORTEX
MIGRATION)
...................
DEN DRITtC
GROWTH
PROJECTIONS
( CC SYNAPTOGENESIS
) .....
) ....
) .............
( MYELINATION
) .................................
Fig. 1. (a) Comparison of rodent models of human fetal and neonatal hypothyroidism and human thyroid hormone syndromes.
(b) Temporal relationships between human and rodent syndromes of thyroid hormone deficiency and normal sequential
development of the fetal and neonatal brain. The iodine-deficient rat is a model of human maternal iodine deficiency with
secondary maternal hypothyroidism and secondary fetal iodine and thyroid hormone deficiency during pregnancy. The
maternal hypothyroid rat is a model of human maternal hypothyroidism. The hyt/hyt mouse is a model of human sporadic
congenital hypothyroidism with normal maternal thyroid function but deficient fetal thyroid function. The major brain
structures, such as brainstem and cerebral cortex, are usually formed before about 8 weeks of gestation. Following neurogenesis, migration, and differentiation of neurons, synaptogenesis, selective cell death, and myelination occur (Sidman and Rakic,
1974; Jones et al., 1982). Myelination can occur for prolonged periods post-natally; refinement and pruning of neuronal processes both of axons and dendrites can occur up to at least 6 years of age (Conel, 1938-42). The maintenance and plasticity of
neuronal process efficacy and dendritic spines occurs throughout the life-cycle (Stein, 1994). All events are sensitive to changes
in thyroid hormone level. The hyt/hyt mouse is useful for evaluation of the effects of thyroid hormones throughout the lifecycle, but is particularly relevant for the period from 15 days post conception to birth, a time of synthesis of critical molecules
and process outgrowth and elongation, particularly of pyramidal neurons in the sensorimotor cortex and hippocampus.
(Reproduced with permission from Advances in Perinatal Thyroidology, 1991, by Plenum Publishing Corporation.)
B i o l o g y o f the congenitally h y p o t h y r o i d h y t / h y t m o u s e
313
Table 1. Characterization of the hyt/hyt mouse
Index/observation
Level/presence
Reference
~" (5-- 10X)~
,1.
.[.(16x) ~
]'(100x) ~
"I'd
+(5x)
+
+
+
q'(2x)
.1.
,[.
Stein et al., 1989b
Beamer, 1982
Stein et al., 1989b
Stein et al., 1989b
Nogushi, 1986
Stein et al., 1989b
Stein et al., 1989b
Stein et al., 1989b
Stein et al., 1989b
Stein et al., 1991; this paper
Shanklin and Stein, 1988; this paper
This paper
.l.
Stein et al., 1989, 1989b
]"
+
+
+
NL
1"
$~
Minimal
NL
NL
.l.(3x) ~
$(4z 16x) ~
NL
+
Absent
Present
Present
Shanklin and Stein, 1988; this paper
Stein et al., 1991c
Stein et aI., 1985b
Stein and Taurog, unpublished
Stein et al., 1989b
Beamer and Creswell, 1982
Stein et al., 1991c
Stein et al., 1991c
Stein et al., 1991c
Stein et al., 1991c
Stein et al., 1991c
Stein et al., 1991c
Stein et al., 1991c
Stein et al., 1994
Stein et al., 1994
Gu et al., 1995
Gu et al., 1995; this paper
Delayed
Delayed
Delayed
Abnormal
Abnormal
+
Adams et al., 1989
Adams et al., 1989
Adams et al., 1989
Stein et al., 1991
Stein et al., 1991
Crawford and Stein, unpublished data
Stein et al., 1989, 1991
+
This paper
,[,
J-l]"
Stein et al., 1991a, 1991c
Stein et al., 1991a, 1991c
$
Stein e t a l . , 1991a, 1991c
Thyroid function:
T4abc
Intrathyrod T~3
T 3"
TSH ~
TRH
Thyroid gland hypoplasia "b~
Varied folicular diameter ab"
Small follicles "be
Reduced follicular cytoplasm "be
Follicular cell number "b~
Size and number of microvillPbc
Amount of follicular
endoplasmic reticulum "bc
Amount of colloid "be
Nuclear ARC ratio (measure of share of
nucleus and cytoplasm per follicular cell) b~
Bioactive TSH ~
Iodinated thryoglobulin
Mono/diiodotyrosines
Thyroglobulin processing
Thyroid gland iodine uptake
Thyroid gland cAMP "~
Thyroid gland response to TSH "c
Thyroid gland Gs function "c
Thyroid gland adenylyl cyclase "c
Thyroid gland TPO mRNA ~c
Thyroid gland thyroglobulin mRNA "~
Size and level of thyroid gland TSH receptor mRNA ~
Replacement of Pro with Leu in TMD IV of TSHr
Binding of TSH to TSHr
Processed and mature TSHr protein
Expression of TSHr on cell surface
Somatic/neurobiologicah
Day of eye opening ~d
Day of ear raising cd
Reflexive behavioffa
Locomotive/cognitive function ca
Cerebral cotex/hippocampus cd
Development
Fetal cerebral cortex mRNA
reduction (ECF, tubulin isoforms) ~a
Fetal cerebral cortex
protein reduction (tubulin isoforms) ~d
Sca and Scb axonal transport
Axonal levels of tubulin/calmodulin cd
Axonal transport of tubulin, actin, spectrin,
neurofllament ~
+ = present; 1" = decreased; .l. = increased; aTSH regulated event; babnormal in fetal and neonatal thyroid;
Cstatistically significant changes; aT4 responsive; GS = G stimulating protein; TPO = thyroid peroxidase; TSHr
= TSH receptor; Sca = slow component A axonal transport; SCb = slow component B axonal transport.
314
Advances in Neuroimmunology
shown that learning disabilities (Rochiccioli et
al., 1992; Rovet et al., 1987), reduced IQ (Rovet
etal., 1987; Glorieux etal., 1992), fine and gross
motor abnormalities (Rochiccioli et al., 1989;
Fuggle, 1991; Koolstra et al., 1994), hearing
deficits (Laureau et al., 1986), and abnormalities
in visual evoked responses (Laureau et al., 1986;
Giroud etal., 1988) and in somatosensory evoked
responses (Laureau et al., 1986; Giroud et al.,
1988) still occur in some patients with SCH,
particularly those with evidence of severe fetal
hypothyroidism manifested by delayed bone age
and T 4 levels below 0.5 ~g/dl (reviewed in Stein,
1994). However, all of these studies suggest a
contribution from fetal hypothyroidism,
particularly when severe, to irreversible damage
to the motor system and brain, and to postnatal
hypothyroidism, which requires adequate treatment throughout life. In these patients with severe
fetal SCH, definitive fetal identification and treatment options need to be evaluated. The hyt/hyt
mouse is relevant with respect to answering many
clinical questions related to the timing, rapidity
of replacement, initial dosing, and degree of T 4
replacement during the neonatal period, the
prevention of secondary brain hyperthyroidism,
and the optimal doses and timing ofT 4 to maintain
or normalize brain T 4 levels throughout childhood and the adult period.
The hyt/hyt mouse: initial studies of
hypothyroidism and general description
The hyt/hyt mouse has a 5-10-fold reduction in
T 4 compared to hyt/+ litter-mates and progenitor
strain BALB/cBY mice. The hyt/hyt mice, in
comparison to hyt/+ and +/+ mice have been
characterized (Table 1) from a multidisciplinary
standpoint to determine the mechanisms of
hypothyroidism and the effects of thyroid
hormones on the developing brain (reviewed in
Stein et al., 1991c; Stein, 1994). The mutant
phenotype was first observed in a sib-mated pair
of RF/J mice, when females failed to grow or
reproduce (Beamer et al., 1981). The mutant gene
was transferred by outcrossing to BALB/cBYJ
mice to circumvent the poor reproductive
performance of RF/J mice and to test the effects
of the mutant gene on a heterogeneous background
(Beamer et al., 1981; Beamer and Cresswell,
1982). The mutants are characterized by retarded
growth, infertility, mild anemia, elevated serum
cholesterol, very low to undetectable s e r u m T4,
and elevated serum TSH (Adams et al., 1989;
Stein et al., 1989b; Beamer et al., 1981, 1982).
The thyroid glands are in the normal location but
are reduced in size and are hypoplastic (Stein et
al., 1989b). Hyt/hyt mice respond to thyroid
hormone therapy with improved growth and fertility (Beamer et al., 1982).
The hyt/hyt mouse offers several advantages
over hypophysectomized or thyroidectomized
animals. There is no surgical trauma or uncertainty
about the completeness of gland ablation, and
mice can be used at any age and without prolonged
pretreatment with anti-thyroid agents. Mating
between homozygous (hyt/hyt) and heterozygous (hyt/+) mice produces relatively equal
numbers of hypothyroid and euthyroid littermates, and BALB/cBY progenitor strain mice
can be used as additional controls. Therefore,
ideal control animals including hyt/+ euthyroid
mice, which can be identified on the basis of
serum T 4 levels, are available, as are the BALB/
cBYJ mice.
Based on studies of the synthesis and processing of thyroglobulin in the hyt/hyt thyroid gland
(Stein et al., 1989b), this reduction is not due to
an inherited defect in the thyroglobulin molecule
(Stein et al., 1989b). Histological analysis of the
gland suggested no potential immune mechanisms
for the defect. However, the hyt/hyt mouse has a
100-fold elevation of TSH in the serum (Stein et
al., 199 ld). Using a mouse bioassay, serum TSH
samples from the hyt/hyt and the hyt/+ mice were
equally bioactive (Stein et al., 1991c). This suggested that the hypothyroidism observed was not
related to a mutation in the TSH molecule.
The hyt/hyt mouse is a model of thyroid
hormone action in the developing brain
The hyt/hyt mice and their litter-mates permit
testing of a model for thyroid hormone deficiency
Biology of the congenitally hypothyroid hyt/hyt mouse
and action in utero (Fig. 2a). Furthermore, the
hyt/hyt mouse has a specific mutation in the TSH
receptor that leads to hypothyroidism and
significant molecular, neuroanatomical, and
behavioral effects in the brain, as represented in
Fig. 2b.
C h a r a c t e r i z a t i o n of the
hyt/hyt
mouse
From 6 days after birth, hypothyroid hyt/hyt mice
can be distinguished from hyt/+ litter-mates and
+/+ mice by T 4 levels, the time of eye opening
and ear raising, and by delays and abnormalities
in reflexive, locomotor, and adaptive behavior
(Adams et al., 1989; Anthony et al., 1993). A
simple T 4 assay is sufficient after 7 days of age
to distinguish an hyt/hyt from an hytl+ mouse
(Adams et al., 1989). The hyt/hyt mouse has a
severe hypothyroidism that starts during fetal life
and extends throughout the life of the animal.
Prior to 6 days of age and during the fetal period,
the distinction process is more difficult. From
birth to 6 days of age, hyt/hyt mice cannot be
distinguished visually from their hyt/+ littermates; at this stage combining T 4 levels using an
ultrasensitive T 4 assay (Germain and Galton,
1985), the ratio of T 4 levels, and qualitative
(Shanklin and Stein, 1988), semiquantitative and
quantitative ultrastructural indices together can
be used to distinguish hyt/hyt from hyt/+ littermates. In neonatal mice, the serum T 4 levels of
the hyt/+ mice were 50 ng/ml or greater, while in
hyt/hyt animals the levels were no more than 10
ng/ml. However, within a litter, the absolute level
was often not useful; instead, ratios o f T 4 greater
than 3:1 were of value in distinguishing hyt/hyt
from hyt/+ mice. Initial electron micrographs of
the hyt/hyt thyroid gland showed that neonatal
to, t/hyt mice could be distinguished by observation of a reduced colloid level using electron
microscopy (EM) and histochemistry (Stein et
al., 1989b).
EM was further used to study the appearance
of neonatal thyroid glands to define the anatomical features of the hyt/hyt gland, to determine
how early these features were seen, and to use
this as a potential means for distinguishing neo-
315
natal hyt/hyt from hyt/+ mice (see Fig. 3 and
Table 2). Extending this process, EM studies of
the thyroid glands from the day of birth of hyt/hyt
animals, identified by previously established
histological methods, demonstrated a smaller
amount of colloid and minimal intranuclear gaps
with closely packed nuclei. Mitochondria were
fewer and more immature as compared to hyt/+
litters. In the hyt/+ mice, unlike the hyt/hyt
animals, tight junction material commonly
protruded into the colloid space and there was an
increased number of thicker dark microvilli. The
capillary network of the follicle was more closely
apposed to the follicle in the hyt/+ thyroid gland
in comparison with the hyt/hyt thyroid gland. The
latter two features correspond functionally with
greater production and secretion ofT 4 in the hyt/+
mouse. In the hyt/hyt mouse on the day of birth,
the endoplasmic reticulum has begun to balloon,
a feature of the 8-14 day old hyt/hyt mouse (Stein
et al., 1989a,b). These observations indicate that
the hyt/hyt mouse can be distinguished at birth
from an hyt/+ litter-mate, but the task is more
cumbersome prior to the 6th day.
The hyt/hyt m o u s e is a m o d e l of severe fetal
h y p o t h y r o i d i s m that begins with
a u t o n o m o u s secretion of thyroid h o r m o n e s
As with humans, the timing of onset of the autosomal recessive hypothyroidism in the hyt/hyt
mouse at 15 d pc (Beamer et al., 1981; Stein et
al., 1989b) corresponds with the beginning of
autonomous fetal thyroid hormone secretion. The
severity of the fetal hypothyroidism in the hyt/hyt
mouse is similar to the patients with SCH and
severe fetal hypothyroidism who are more likely
to demonstrate learning disabilities, despite early
T a treatment.
T h e hyt/hyt m o u s e is a m o d e l of severe fetal
S C H due to g l a n d u l a r h y p o p l a s i a or T S H
hyporesponsiveness
Thyroid-releasing hormone (TRH) made by the
hypothalamus stimulates the production of thyroid
stimulating hormone (TSH) by the pituitary gland.
316
A d v a n c e s in N e u r o i m m u n o l o g y
(A)
:,
Abnormal Fetal or Neonatal Brain Levels of T3/T4
Interaction of T3/T4 with Specific Receptors in Specific Brain Sites
Alterations in Expression and/or Stability of Specific mRNAs
Alterations in Specific Protein Synthesis
I
i
I
Specific Neuroanatomical Abnormalities
t
Specific Reflexive, Locomotor, or Cognitive Abnormalities
Fig. 2. (a) Model of thyroid hormone action and brain development: mechanisms for production of abnormalities. Alterations
in fetal serum and brain T3/T 4 levels, following interaction with specific thyroid hormone receptors in specific brain sites or
with specific proteins or the transitional apparatus in specific sites, may lead to alterations in expression and/or stability of
specific rnRNAs or specific proteins. These mRNAs and proteins may have particular functional roles. These mRNA or protein
abnormalities in specific sites and at specific times of gestation or the neonatal period may lead to specific neuroanatomical
abnormalities. The neuroanatomical abnormalities affected depend on the events that are sequentially occurring at the time of
the molecular abnormalities and the hypothyroidism. These neuroanatomical abnormalities, in combination with other neuroanatomical abnormalities, may contribute to some of the changes in reflexive, locomotor, or adaptive behavior that are
observed in hypothyroidism. (Reproduced with permission from Advances in Perinatal Thyroidology, 1991, by Plenum
Publishing Corporation.) (b) Model of sporadic congenital hypothyroidism, fetal hypothyroidism, and hypothyroidism
throughout life. The hyt/hyt mouse has an autosomal recessive, fetal onset, severe hypothyroidism that persists throughout
life and is a model of human sporadic congenital hypothyroidism. The hypothyroidism in the hyt/hyt mouse reflects on
hyporesponsiveness of the thyroid gland to TSH. This is attributable to a point mutation of C to T in the nucleotide at position 1666, resulting in the replacement of a Pro with Leu at position 556 in transmembrane domain IV of the G protein-linked
TSH receptor. This mutation leads to a reduction in all cAMP-regulated events, including thyroid hormone synthesis. The
diminution in T3/T 4 in serum and other organs, including the brain, also leads to alterations in the level of timing of expression of critical brain molecules, i.e. selected tubulin isoforms, MAPs, and myelin basic protein, as well as changes in important
neuronal cytoskeletal events, i.e. microtubule assembly and SCa and SCb axonal transport. In the hyt/hyt mouse, fetal
hypothyroidism leads to reductions in MI35, MI32. and Mo~I mRNAs, important tubulin isoforms, and M[35 and M~2 proteins,
which comprise the microtubules. These molecules are localized to layer V pyramidal neurons in the sensorimotor cortex, a
site of differentiating neurons, as are the thyroid hormone receptors. These molecular abnormalities may contribute to the
observed neuroanatomical abnormalities, i.e. altered neuronal process growth and maintenance, synaptogenesis, and myelination, in the hypothyroid brain. Abnormal neuroanatomical development in selected brain regions may underlie the abnormalities in reflexive, locomotor, and adaptive behavior in the hyt/hyt mouse and other hypothyroid animals. Reproduced with
permission from Molecular Endocrinology (1994) by The Endocrine Society (Publisher).
Biology of the congenitally hypothyroid hyt/hyt mouse
317
(B)
SINGLE BASE CHANGE (CCG---~ CTG, PRO---~ Leu)
IN TSH RECEPTOR RESULTS IN
HYPOTHYROIDISM IN THE hyt/hyt MOUSE
Receptor
T
4,Thyroid Gland cAMP
I
v
4, T3/T4
I
Alteration inv Expression
of Functional Brain Molecules
Developmental
Neuroanatomical and
Behavioral Abnormalities
TSH released by the pituitary gland into the
circulation then acts on the thyroid gland by binding to a TSH receptor (TSHr). In the normal
thyroid gland, TSH acting via the G proteincoupled TSHr plays a pivotal role in the normal
growth and the normal synthesis and secretion of
thyroid hormones (Nagayama and Rappaport,
1992). The TSHr is an integral membrane protein
with an unusually large extracellular domain and
transmembrane and cytoplasmic domains with
seven membrane-spanning regions. Following
ligand binding, the actions of TSH are transduced
by TSHr interactions with regulatory G proteins
and subsequent activation of adenylyl cyclase
and increased level of cAMP synthesis
(Nagayama and Rappaport, 1992; Vassart et al.,
1994). This TSH interaction with the production
of cyclic AMP sets up an entire set of events in
the thyroid gland that leads to the synthesis and
secretion of thyroid hormones. Iodine is taken up
by thyroid follicular cells and added to tyrosine
residues on a thyroglobulin molecule by the action
3 18
A d v a n c e s in N e u r o i m m u n o l o g y
Fig. 3. Electron microscopy of day of birth hyt/hyt CA, B, and E) and hyt/+ (C, D, and F) thyroid glands (original magnification: x5000; print magnification: x 14,300). The hyt/hyt thyroid glands show a smaller amount of colloid (F) and cytoplasm
in their follicular cells, which are designated by their nuclei (N) (1EL than the hyt/+ glands (IF). lntranuclear gaps are
prominent in hyt/hyt versus hyt/+ glands (arrowheads) ( IE and IF). The hyt/hyt glands show scant numbers of mitochondria
(M) (1A), scant tight junctional material (J) (1A and I B), and a paucity of endoplasmic reticulum (E) (IA and I B). Small and
irregular microvilli are seen in the follicles in the hyt/hyt glands (V) (IA). In the hyt/+ glands, a more distal placement of
capillaries from the follicular lumen is seen (1C), as are prominent mitochondria (M) and endoplasmic reticulum (E) ( 1C and
1D). In the hyt/+ gland, numerous tall microvilli (V) and abundant tight junctional material (J) are observed (IC and 1D). For
the hyt/hyt mice, the T 4 values were not detectable (IA, IB, IE). The hyt/+ T 4 values were 3.5 ng/ml (1C), 5.0 ng/ml (ID),
and 5.8 ng/ml (IF). The ratio of hyt/+ maximum to hyt/byt > 3.0 was used in all other situations. For distinction of hyt/hyt
mice and hyt/+ mice after 6 days of age, T 4 values were sufficient [hyt/hyt = 0.61 ~g/dl _+0.18, n = 41; hyt/+ = 6.26 _+ 1.43, n
= 21 (t = 25.1, 60 df, P<0.001]. The bar in B equals 1 ~m. (See also Table 2.)
Biology of the congenitally hypothyroid hyt/hyt mouse
319
Table 2. Distinction of day of birth hyt/hyt mice from hyt/+ littermates
1. Electronic microscopy criteria
A. Qualitative criteria:
Arrangement of and distance between nuclei
Size of gaps between nuclei
Number of nuclei separated by gaps
Amount of cytoplasm and colloid
Number of mitochondria present
Amount of endoplasmic reticulum present
Number and size of microvilli
Closeness of follicular capillaries to follicular lumen
Number and thickness of follicular tight junctions
B. Quantitative criteria:
Nuclear arc ratio
2. Serum T 4 level (ng/ml) (range:0-20 ng/ml)
hyt/hyt
hyt/ +
0-1+
0-1+
0-1 +
3+
3+
3+
1 +
1+
+1+
Distal
1 +, thin
2-3+
2-3+
2-3+
Close
3 +, thick
0.895 + 0.007
0.589 + 0.014
(Chi square = 20.4, P <0.001)
Ratio of hyt/ + to hyt/hyt > 3.0
The nuclear arc ratio was derived using polar coordinates centered on the midpoint of the follicular lumen. The
relative size of the lumen can be adjusted for the magnification, yielding a value for thyroid gland colloid
volume. From this, a determination of the proportion of space taken up by nuclei within the follicular cells could
also be carried out. This was designated as the nuclear arc ratio and represents a quantitative measure of space
taken up by nuclei versus cytoplasm/colloid. Serum T 4 levels prior to 7 days of age were determined by an
ultrasensitive T4 radioimmunoassay (St Germaine and Galton, 1983). (See also Fig.3.)
o f t h y r o i d p e r o x i d a s e . T h y r o g l o b u l i n is
transcribed and translated and forms the backbone
for iodinated tyrosines, which will eventually be
cleaved to yield thyroid hormones. The iodinated
thyroglobulin is taken through microvilli into a
colloid space, which is a repository for thyroid
hormone precursors. Thyroglobulin is transported
from the colloid space and then cleaved to yield
thyroid hormones, which are then secreted from
the cell. The hyt/hyt thyroid gland makes a reduced
amount of thyroid hormones, as well as all the
other necessary components for normal thyroid
hormones. Although the gland is hypoplastic, all
essential anatomical structures are observed.
Compared to its euthyroid hyt/+ litter-mate
mice and progenitor strain B A L B / c B Y +/+ mice,
the hyt/hyt mouse has a 5-10-fold reduction in
serum T 4 ( A d a m s et al., 1989; Stein et al.,
1989a,b), a 16-fold decrease in T 3 (Stein et al.,
1989b), a 100-fold elevation in TSH-like activity
(Stein et al., 1989b), an increased number of
pituitary TSH granules (Noguchi, 1988; Noguchi
et al., 1986), reduced hypothalamic TSH releasing hormone (Noguchi, 1988; Noguchi et al.,
1986) that is responsive to exogenous T 4 (Noguchi
et al., 1986), and a biologically active T S H
molecule (Stein et al., 1991d). In fact, the basal
level of cyclic A M P in the hyt/hyt thyroid gland
is reduced compared to the hytl+ mouse and the
response of hyt/hyt glands in vitro to TSH is
significantly reduced in hyt/hyt versus euthyroid
animals. N e v e r t h e l e s s , c A M P p r o d u c t i o n is
equivalent when the hyt/hyt and control thyroid
glands are exposed to forskolin, cholera toxin,
propranolol, and PGE2 (Stein et al., 1991d).
Anatomically, the gland is hypoplastic, despite a
100-fold increase in circulating TSH, with small
follicles, reduced size and number of microvilli
and reduced colloid space. Reductions in TSHc A M P r e g u l a t e d m o l e c u l a r events are also
observed, including statistically significant reductions in individual hyt/hyt gland levels of thyroglobulin m R N A and thyroid peroxidase (TPO)
m R N A . The abnormal observations in the hyt/hyt
320
Advances in Neuroimmunology
thyroid gland are consistent with TSH hyporesponsiveness of the gland. A defect in the TSHr
rather than an inherited hypothalamic or pituitary
hypothyroidism, a generalized or selective G
protein disorder (reviewed in Spiegel, 1996), or
a defect in the adenylyl cyclase molecule was
supported by our work (Stein et al., 1991 d). Since
a normal sized hyt/hyt TSHr mRNA at levels
equivalent to those in hyt/+ and wild-type +/+
mice was seen, the putative defect in the hyt/hyt
TSHr did not appear to represent a major deletion/
insertion or promoter defect (Stein et al., 1991 d).
The hyt/hyt TSH receptor gene has a single
nucleotide difference in transmembrane
domain (TM) IV that could affect TSH
binding and/or signal transduction leading
to hypothyroidism
Anatomical, physiological, biochemical, and
molecular data point to a coding region rather
than a promoter mutation in the TSHr underlying
the observed hypothyroidism and TSH hyporesponsiveness. Southern blot hybridization with a
TSHr probe for genomic DNA from hyt/hyt, hyt/+
and +/+ mice indicated no gross insertion, deletion or duplication of the hyt/hytTSHr gene (Stein
et al., 1994). Direct PCR sequencing was used to
sequence the entire coding region and portions of
the 5' and 3" flanking regions of the normal and
hyt/hyt mouse TSHr. Lambda genomic clones
and selected PCR products derived from total
genomic DNA, lambda genomic TSHr DNA
clones, and total cDNA were used. Total thyroid
gland RNA from hyt/hyt and +/+ mice were microisolated and poly A + RNA isolated. These RNAs
were used to construct portions of TSHr from
both mouse types by PCR using degenerate primers. All lambda genomic clones from hyt/hyt and
+/+ TSHr were isolated from +/+ and hyt/hyt total
genomic libraries in EMBLT6T7 that had been
screened with TSHr exon 1 and exon 10 probes.
All PCR primers used for fragment production or
direct PCR sequences were constructed using
degenerate primers or conserved regions derived
from rat, human, and dog TSHrs or regions where
we had established the sequence. The DNA
sequence of the TSHr from wild-type BALB/
cBY +/+ mouse is 92 and 94% identical at the
nucleotide and the amino acid levels, respectively,
compared to the rat TSHr gene (Akamizu et al.,
1990).
When comparing the entire coding region of
the TSHr in hyt/hyt versus +/+ mice, along with
adjacent noncoding regions (2510 bases in total),
the only difference found between the TSHr from
wild-type and hyt/hyt mice is a single C to T
transition at nucleotide number 1666. This transition (Fig. 4) was confirmed by direct sequencing
of two different lambda genomic clones (lambdaM770-1, lambda-M770-5) from the hyt/hyt
genomic library, from PCR products derived from
these genomic clones, and from both strands of
hyt/hyt genomic DNA. In the hyt/hyt TSHr, this
CCG to CTG transition makes a Pro to Leu codon
change at amino acid 556 in TM IV (Fig. 4). This
Pro is highly conserved at this site in all other
glycoprotein hormone receptors and at least 82%
of other G protein-coupled receptors.
Hyt/+ mice represent the euthyroid and littermate heterozygotes for the hyt/hyt mice. The
partial nucleotide sequence of the hyt/+ TSHr
from PCR-amplified total genomic DNA revealed
both a C and a T at position 1666 (Fig. 4). The
presence of both C and T at position 1666 in the
hyt/+ euthyroid mice affirms the observed autosomal recessive inheritance of the hyt gene and
the classification of the hyt/+ mice as heterozygotes (Adams et al., 1989; Stein et al., 1989b).
Therefore, one normal allele may be sufficient
for a normal TSHr and euthyroidism.
The Pro to Leu replacement in the TSHr
eliminates binding of the TSHr to TSH
The Pro mutation in the hyt/hyt mouse TSHr was
the first demonstration of a naturally occurring
mutation in the TSHr with functional
consequences. Using a PCMV (Clonetech)human-TSHr expression vector, site-directed
mutagenesis was performed to create the C to T
mutation at nucleotide 1666, similar to the mutation in the hyt/hyt TSHr. This hyt/hyt TSHr and a
wild-type human TSH were then transfected into
Biology of the congenitally hypothyroid hyt/hyt mouse
(B)
*5'
(A)
* 5 j
G
A
T
C
Leu
Leu T
Ala
Ala
321
(c)
G
A
T
C
* 5'
G
A
T
C
C
,!
c
c_.
Leu
C
T
G
T
Leu T
Pro 556
Leu556 T
c
Leu
Leu
Met - '
Met
3'
+/+
G~
3'
hyt/hyt
hyt/+
Fig. 4. Comparison of DNA sequencing gel autoradiographs of +/+ (A), hyt/hyt (B), and hyt/+ genomic DNA surrounding the
hyt mutation. The sequence is from primer 1869as (GTAGATCTTCCACATAGCAGG) on PCR-amplified genomic mousetail DNA. The hyt/+ PCR product used for sequencing was derived from PCR amplification with primers 1345s (GGCAATATCTTCGTCCTGCTC) and 1869as. The hyt/hyt and +/+ PCR products for sequencing were derived from PCR amplification with
1345s and 123as (GATGAACTCTGACCCTATG). The corresponding coding sequence reading from 5' (top) to 3' (bottom)
is shown for each mouse (*) to the left of the anticoding sequence. The presence of both C (+/+) and T (hyt/hyt) bases in the
hyt/+ heterozygote at base 1666 is noted, (Legend derived from Stein et al., 1994; the methods involved are described in detail
in Stein et al., 1994.) Reproduced, with permission, from Molecular Endocrinology (1994), by The Endocrine Society
(Publisher).
COS-7 cells. A similar sized mRNA of higher
abundance than the wild-type was observed in
the COS cells transfected with the mutant TSHr,
suggesting that the mutation does not produce a
defect in transcription or mRNA stability of the
TSHr mRNA. Abolition of TSH binding to the
TSHr was noted in COS-7 cells transfected with
the mutant TSHr vector compared to the human
wild-type TSHr (Stein et al., 1994). Gu et al.
(1995) have demonstrated that solubilized
membranes from cells making the hyt/hyt mutant
receptor also do not bind TSH. The Pro to Leu
replacement in the mutant TSHr and hyt/hyt TSHr
may abolish ligand binding by a structural effect
on the binding regions of the TSHr (the extracellular domain) or by interference with translation,
trafficking, or appropriate insertion or expression of the receptor on the cell membrane. In
defense of a trafficking defect, EM of the hyt/hyt
thyroid gland shows ballooned endoplasmic
reticulum with electron-dense material (Stein et
al., 1989b). However, this is not seen in CHO
cells that are stably transfected with either human
mutant or human wild-type TSHr (Diedrich and
Stein, unpublished observations). Further support for the defect not involving trafficking comes
from Western blot analysis by Gu et al. (1995)
that demonstrated that hyt/hyt mutant and wildtype receptors were processed through similar
precursors and eventually a similar 95 kDa mature
TSHr was seen in both.
The hyt/hyt TSH receptor is expressed on
the plasma m e m b r a n e
To determine whether or not the TSH receptor was
expressed on the plasma membrane in the wildtype or hyt/hytmutation, immunofluorescent experiments with an anti-human TSH receptor were
carried out with CHO cells transfected with the
wild-type or hyt/hyt version of the human TSH
receptor. The mutant hyt/hyt receptor was created
by site-directed mutagenesis of the normal human
wild-type TSH receptor (Stein et al., 1994).
Constructs were created that included a human TSH
receptor construct that had been converted by sitedirected mutagenesis to exactly simulate the hyt/
hyt receptor mutation. These stable transfected cells
were incubated by double immunofluorescence
with an antibody that was specific for the TSH
receptor. This antibody, provided by M. Zakafija,
was created from the sequence YYVFFEEDEDEIIGF, which represents a unique region at the
terminal end of the extracellular domain of the
322
Advances in Neuroimmunology
TSH receptor, hnmunofluorescence with this
antibody to both the human wild-type and the hyt/
hyt mutant containing CHO cells revealed staining
of an equivalent amount around the entire plasma
membrane in both groups. This suggested that the
TSH receptor was appropriately targeted with both
the wild-type and the hyt/hyt construct to the plasma
membrane. Further, the orientation of the extracellular domain was such that the antibody to the
terminal extracellular domain could recognize the
TSH receptor. Further experiments looked at
immunofluorescence with this antibody to CHO
cells with both the wild-type and the mutant TSH
receptor, where the cells were permeabilized with
Triton. In this situation, the immunofluorescence
for the TSH receptor was indistinguishable for the
hyt/hyt and the wild-type TSH receptor. Staining
was seen both on the plasma membrane and intracellularly involving Golgi apparatus and other intracellular vesicles. The latter data suggest that the
TSH receptor is trafficked and targeted to the
membrane.
Taken together, these observations suggest that
the hyt/hyt mutation does not interfere with the
transcription of TSH mRNA, and transport,
processing, targeting and plasma membrane insertion of the TSH receptor. With regard to the latter, our studies indicate that at the very/east the
extracellular domain, including its most terminal
extent, of the TSH receptor achieves an extracellular position with respect to the plasma
membrane. These observations suggest that the
obliteration of TSH binding to the hyt/hyt TSHr
is related to a change in tertiary structure of TSHr
brought on by the conversion of a conserved and
functionally important proline to leucine. This
also suggests that TM IV is critical for normal
TSH binding to the TSHr. The abolition of binding interferes with the normal transduction of a
TSHr-cAMP response, leading to TSH hyporesponsiveness and a significant drop in thyroid
hormone synthesis by the hyt/hyt thyroid gland.
What is the importance of the hyt/hyt proline
and other transmembrane IV mutations?
The site and identity of the proline mutation in
the hyt/hyt mouse is critical, because this proline
is highly conserved at this site in as many as 82%
of G protein-coupled receptors and in all glycoprotein hormone receptors (reviewed in Stein et
al., 1994). The Pro556Leu mutation occurs at a
similar site to naturally occurring mutations.
Pro171Leu is seen in retinitis pigmentosa and is
a naturally occurring mutation in the rhodopsin
molecule that leads to blindness (Dryja et al.,
1991). Pro201Ala substitution in a muscarinic
M3 receptor leads to a 450-fold reduction in binding to muscarinic agonists and antagonists. Prolines are also important because: (1) they are
conserved in other transmembrane sites in G
protein-linked receptors; and (2) proline substitution may significantly alter receptor function
(reviewed in Stein et al., 1994).
The hyt/hyt mouse has a mutation of the
TSH receptor similar to h u m a n patients
with sporadic congenital hypothyroidism
The gene defect in the hyt/hyt mouse TSHr
produces TSH hyporesponsiveness. Hyporesponsiveness of the human thyroid gland to TSH may
be present much more frequently than previously
reported and is similar to the hyt/hyt mouse
biochemically, physiologically, anatomically (e.g.
thyroid gland hypoplasia), and even clinically.
Hypoplasia is a cause of SCH in 63-83% of
reported cases (Foley, 1991). Therefore, the hyt/
hyt hypoplasia gives us insight not only into cases
of TSH hyporesponsiveness but also the whole
spectrum of SCH associated with hypoplasia,
whether the gland is in a normal or ectopic position. Moreover, the TSH hyporesponsiveness of
the hyt/hyt mouse has relevance for understanding the thyroid gland and its dysfunction in human
SCH due to maternal TSH receptor blocking
antibodies, a cause of moderate to severe retardation, molecular mutations of the TSH molecule,
and disorders of the Gs stimulatory protein with
hypothyroidism, i.e. pseudohypoparathyroidism.
Human SCH cases now include a TSHr mutation in the extracellular domain (Sunthornthepvarkul et al., 1995) and in TM IV (Vassart,
personal communication) that are similar to the
hyt/hyt mouse. In a reported kindred, a compound
Biology of the congenitally hypothyroid hyt/hyt mouse
heterozygote with elevated TSH demonstrates
different point mutations in exon 5 at different
locations in the paternal and maternal alleles,
related in part to mutations, similar to the hyt/hyt
mouse, that convert proline to alanine and threonine. Related to this mutation, as in the hyt/hyt
mouse, the proposita had a 25-fold reduction in
binding that corresponds to a 25-fold elevation of
serum TSH, resistance to TSH, and hypothyroidism (Sunthornthepvarkul et al., 1995).
Other mutations in the TSHr in thyroid
disorders
The hyt/hyt mouse and the patients of Sunthornthepvarakul et al. (1995) represent mutations of
transmembrane domain IV (homozygous) and
the extracellular domain (compound heterozygote), respectively, that lead to congenital
hypothyroidism via interference with receptor
function and/or binding. In certain disorders where
excess thyroid hormone or hyperthyroidism is
observed, mutations in the TSHr lead to the
expression of an altered receptor protein that possesses constitutive activity (reviewed in Morris,
1996, and in van Sande et al., 1995). In these
cases, the TSHr is activated and leads to increased
production of thyroid hormones without TSH,
the primary ligand, being present. Mutations in
the TSHr that lead to hyperthyroidism have been
observed in neonatal non-immune hyperthyroidism (de Roux et al., 1996), families with
congenital non-immune hyperthyroidism (toxic
thyroid hyperplasia), and in patients with
autonomous functioning thyroid nodules and
hyperthyroidism (reviewed in Morris, 1996). The
mutations may be germline or somatic. The mutations may involve the second, third, sixth, and
seventh transmembrane domains, as well as the
third intracellular loop and the first and second
extracellular loops. It is clear that certain mutations occurring in certain hot-spots may cause
activation, but in vitro evaluations of the mutations reveal variability in terms of origin, germline or somatic, constitutive activity plus or minus
increased liganded activity, and activity of an
alternative inositol phosphate cAMP pathway in
323
the thyroid gland. Interestingly, mutations in the
extracellular domain may lead to Graves' disease
and immune hyperthyroidism by presenting an
antigenic stimulus that triggers this disorder (Bahn
et al., 1994). The spectrum of different functions
of the different regions and nucleotides in the
TSHr has been reviewed (Nagayama and Rappoport, 1992). Similar changes are seen on activating mutation in another glycoprotein hormone
receptor, the luteinizing hormone receptor, in the
sixth transmembrane domain (Shenker et al.,
1993), and the third intracellular loop (Latronico
et al., 1995).
Behavior characteristics of the
mouse
hyt/hyt
The hyt/hyt mouse has abnormalities in
olfactory system mediated behaviors
The behavioral testing was designed to test
reflexive, locomotor, and adaptive behaviors that
depend on motor and sensory functioning. The
testing of olfactory orientation has been defined
in the rat (Almli and Fisher, 1977; Altman et al.,
1975). This utilizes three different stimuli that
differ in their strength of olfactory stimulation,
which include Mennen skin bracer, similac
formula or Hershey's chocolate. The latter is the
weakest and Mennen the strongest stimulator. A
positive response is defined as turning of the head
toward a stimulant containing these odors (Adams
et al., 1997). Testing of hyt/hyt versus hyt/+ mice
at days 3-6 post-natal with the weakest stimulus
(chocolate) revealed that the hyt/hyt mice
performed more poorly on days 3, 4 and 5 relative to the wild-type +/+ group (P, 0.05). The
hyt/hyt mice were poorer on day 6 versus the
hyt/+ litter-mates (P<0.01) for the same stimulus.
No differences were noted between hyt/hyt and
hyt/+ mice for the stronger stimuli. Olfactory
deficits have been reported previously in hypothyroid mice and rats (Paternostro and Meisami,
1989). Neonatal hypothyroidism reduced olfactory epithelial cell number, the surface area of
olfactory receptor neurons, and axonal sprouting
from neurons in the olfactory tubercle (MackaySim and Beard, 1987; Gottesfeld etal., 1987). In
324
Advances in Neuroimmunology
the hyt/hyt mouse, neonatal and, perhaps, fetal
hypothyroidism may influence the development
of the olfactory system, as evidenced by
diminished sensitivity to certain types of odors
(Adams et al., 1997).
The hyt/hyt mouse shows delays in normal
motor reflexive behavior with subsequent
normal performance, dependent on the
corticospinal tracts and brainstem pathways
Motor activity and learned motor behaviors are
impaired in the hyt/hyt mouse
Hyt/hyt mice demonstrated hypoactivity and
hyperactivity in locomotor activity compared to
euthyroid mice on different testing days (Adams
et al., 1989). For learned motor behavior, the
hyt/hyt mice were unable to learn swim-escape or
the distal Morris maze, which also involves visual
cues (Adams et al., 1989; Anthony et al., 1993).
In the proximal morris maze task, the hyt/hyt
mice were significantly slower than the hyt/+ and
+/+ mice in solving the task, but showed some
improvement in response time over the total
period of testing (Anthony et al., 1993).
Permanent impairments in cognitive and complex
motor functions are seen in untreated and latetreated human SCH cases (Klein, 1985; Macfaul
et al., 1978).
Delays in cliff avoidance and negative geotaxis
were found in the hyt/hyt mice versus hyt/+ euthyroid litter-mates at 5 and 6 days after birth (dab)
that normalized with time (Adams et al., 1989).
These reflexes and early behaviors may be sensitive to the function and anatomical development
of the developing cerebellum, brainstem and
vestibular system, which, in turn, are altered by
pre-natal and early post-natal hypothyroidism Anatomical localization of spatial learning
(Narayanan and Narayanan, 1985; Legrand, and other rodent behaviors
1982-83).
Similarly, assessment of early motor reflexes The performance on spatial learning tasks has
that may involve corticospinal tract functioning, been related to the number of pyramidal neurons
including placing, grasping and the crossed exten- in the CA 1 and CA3 regions of the hippocampus
sor reflex, showed delays in forepaw and hind- (reviewed in Anthony et al., 1993). The number
paw grasping between the hyt/hyt and their of pyramidal neurons and the extent of their proceuthyroid litter-mates and +/+ control mice. esses may be reduced in the hyt/hyt mouse hipForepaw grip strength was significantly lower in pocampus (Crawford and Stein, 1992), similar to
the hyt/hyt mice at 8 and 9 dab, and then reached results seen in other work with the rodent hippoca normal level at 10 d a b (Adams et al., 1997). ampus (Rami et al., 1986a,b). However, spatial
The corticospinal tracts, as well as other pathways, learning also involves complex motor function
may be involved in placing, grasping, and crossed and visual processing that may involve the visual
extension and these reflexes normally appear soon cortex and other associated regions of the mouse
after birth (Donatelle, 1977). The delays in brain. Fetal and neonatal hypothyroidism may
forepaw grasping suggest a slower development affect a number of different sites within the
of the corticospinal neurons and of rostral-caudal developing mouse cerebral cortex, other brain
motor function maturation. In humans with SCH regions, and their interconnections. Based on the
treated before 1 month of age (and later), altered, timing of behavioral abnormalities and the timpersistent, or asymmetric grasp reflexes reflect ing of neuroanatomical events, fetal and neonaaltered motor function or hemiparesis. The tal hypothyroidism may affect the brainstem, the
performance and precise timing of these sensory olfactory system, the motor system, the hippocbehaviors (olfactory orientation) and motor ampus, and the visual system.
reflexes may be required for the normal development of more complex motor and adaptive behav- Neuroanatomical effects of hypothyroidism
iors in the rodent, i.e. swim-escape and Morris One of the most consistent neuroanatomical
maze activity.
abnormalities related to fetal hypothyroidism in
Biology of the congenitally hypothyroid hyt/hyt mouse
both rodents and humans is persistent abnormalities in process growth and connectivity. In the
developing hypothyroid brain, disorders of neuronal process growth (Eayrs, 1968; Lauder, 1989;
Legrand, 1982-83; Garza et al., 1988) are
observed in both central and peripheral neurons.
These abnormalities are manifested by diminished
axonal (Lauder, 1989; Legrand, 1982-83; Eayrs,
1968; Marinesco, 1924) and dendritic outgrowth
and elongation (Lauder, 1989; Legrand, 198283; Ruiz-Marcos, 1989) and branching (Marinesco, 1924; Ruiz-Marcos, 1989). In
hypothyroidism, there is direct alteration of synaptogenesis (Ruiz-Marcos, 1989), the number and
distribution of dendritic spines (Ipina etal., 1987;
Ruiz-Marcos, 1989), and of the subsequent myelination of neuronal processes (Almazon et al.,
1975; Sarlieve et al., 1983). These alterations in
process growth and connectivity are observed in
pyramidal regions of the cerebral cortex and visual
and auditory cortex and frontal cortex, with reductions in the levels of thalamocortical fibers and
corticocortical fibers (Marinesco, 1924), and in
the size of the pyramidal tracts (Rosman, 1975),
as well as in hippocampal pyramidal and granule
neurons, cerebral cortical neurons, basal forebrain neurons, and cerebral Purkinje neurons
(Gould and Butcher, 1989; Lauder, 1989; Rami
et al., 1986; Eayrs, 1955; Ruiz-Marcos, 1989;
Marinesco, 1924). The sites of these abnormalities in process growth and connectivity are related
to the motor, memory, and visuomotor abnormalities observed in human and rodent thyroid
syndromes.
Thyroid hormone acts on the cytoskeleton
to determine neuroanatomical effects
The foundations of the abnormalities in process
growth and maintenance and connectivity are
changes in microtubule number and function, as
well as function and number of the neuronal
cytoskeletal structures, including neurofilaments
and microfilaments (reviewed in Stein et al.,
1991c; Stein, 1994). Normal process growth during development depends on the synthesis of
cytoskeletal proteins, their assembly into cytoskel-
325
etal structure (i.e. microtubules, neurofilaments,
and micro filaments), and on the delivery of these
proteins via axonal transport to the distal axon
and growth cone (Fig. 5, Model 1) (Smith, 1988;
Mitchinson and Kirschner, 1988; Lasek, 1988;
Brady, 1988; Panda etal., 1994; Hammerschlag
et al., 1994). Growth cones are motile structures
at the growing tip of extending neurites (GordonWeeks, 1991). Neurofilaments are the major
determinants of axonal caliber (Cleveland et al.,
1991; Hoffman et al., 1985). Microfilaments
consist of actin subunits, which couple with
microtubules in the growth cone. Microfilaments
are particularly important in axonal growth cones
and process growth (Smith, 1988). Alteration of
the thyroid hormone level may affect process
growth and maintenance by altering the cytoskeleton at multiple levels (Fig. 5, Model 1). In a
specific neuron at a specific time, these various
effects of thyroid hormones may be operating
simultaneously or individually.
Synthesis of the constituent polypeptides for
the cytoskeleton occurs in the neuronal cell body,
followed by assembly into cytoskeletal structures,
and transport of these structures to the distal axon,
presynaptic terminal, or growth cone (Lasek,
1988). Each of these steps may be vulnerable to
hypothyroidism at different stages of development and maturity. Each of the skeletal elements
may be affected by thyroid hormone levels
through various mechanisms (Stein 1991c).
Microtubules are composed of two classes of
proteins, tubulin and the microtubule-associated
proteins (MAPs) (Mandelkov and Mandelkov,
1989). Tubulin is a 100 kDa, dimeric protein that
exists in the forms of equally sized c~and [3 subunits. It serves as the structural protein of the microtubule wall, and can polymerize to form
microtubules under appropriate in vitro conditions in the absence of other proteins. Numerous
isoforms of both c~ tubulin and [3 tubulin have
been described (Lewis and Cowan, 1988; Sullivan, 1988), and each has a characteristic tissue
and cellular distribution (Lewis et al., 1985; Burgoyne et al., 1988) and developmental pattern of
expression (Lewis et al., 1985). In the mouse
brain, for example, mRNAs that encode the MI35,
326
Advances in Neuroimmunology
o=
.L~'-~-~
.~,"= ~ ' o
r---~O'~
~1
~1
I
I
~
-
~
~
~
~
~
~
~
t-
o~ ,-- ' ~
I ~.
•
,-:
-~
0
t-oh-
I--
o~
o
0
..
z
,
a
oX
.oli
~
0
c
®
~
~
~
~)
~
\,
~L.#i';
~i
¢
\1
II ~ I
-~
_
I
/.i#.
11
" ~1 1 1I
I
I
.-
0
m
z
...1
.-I
w
o
z
0
IE
w
z
ax
~
~
w
~
~'6 H~
~-_~
~
I-I
'~>
<-~ [ q
VG
I .~ I .~1 ~ w / ~ ¢
/
,
/
II <./~ ¢ w ~ f ' II--~'~ ~ / " " ' - /
<~ I~1
II ~ 1 I
I~1
"->"
I
I
,
,
,
~
~[
0
~
I--.- <,, I-"1=
IE'I~
a¢~
-~
~"
~
I 1I:~)._
~
o=~
w~
__
Ill
~ //
/
/
/
/
/
/
~LLI~
17, $
i-E
rr
," "u,r"-~-'~_
/ ' ~
I~1
~
\
<~
I
/
/-~
'"
z
/
(
.="
~
o~
<~ o
~
. ~
C~
<~"
i- ~
~
iT
\~
.<..,
"b/,
fli~//
~--
~h~-, 0
~....--
:~ ~ -
<"6~
~
~
-_-~
~7
E
0~
~
/
/
0 . ~
=
•
-
~"-'-
"E'~
~
~
w
/
•
*
/
<
OU
,--
o_
±
0
._o
B i o l o g y o f the c o n g e n i t a l l y h y p o t h y r o i d h y t / h y t m o u s e
327
Fig. 5. Model 1: potential model of process growth in the developing axon, its relationship to cytoskeletal structures and their
molecular components, and thyroid hormone regulation (*; see in the hyt/hyt mouse #) (Stein et al., 1991). Normal process
growth is dependent on the function of dimers of a and b tubulins, and having side arms made up of microtubule-associated
proteins (MAPs) (Mandelkow and Mandelkow, 1989). The a and b tubulin isotypes and different MAPs are transcribed in the
nucleus of the neuronal cell body, which may be regulated by thyroid hormones (*, #). Following translation and selected
post-transcriptional modifications, equal quantities of c~and [3isoforms are assembled (Nunez et al., 1989) together with MAPs
into brain microtubules (MT) from soluble pools of tubulins and MAPs in the neuronal cytoplasm or distal axon/growth cone.
After assembly in the cytoplasm, these MTs are transported through the axoplasm of the axonal process to the distal axon and
the growth cone (Hammershclag et al., 1994). The transported microtubules may be added to the distal end of growing MTs
and may be in dynamic equilibrium with free tubulin isoform and MAP subunits. Alternatively, soluble pools of microtubule
components at the growth cone add assembled microtubules directly to microtubules at the distal neurite (Gordon-Weeks.
1991). Concerning axonal elongation, the assembly of microtubules in the growth cone may be functionally more important
than in the cell body or neurite (Adams etal., 1989). Similar to certain tubulin isoforms, MAP1B is present in extending processes, and occurs in particularly high concentrations distally and at the growth cone (Mansfield and Gordon-Weeks, 1991)
and is essential, particularly when phosphorylated (Mansfield et al.. 1992) and assembled with microtubules, for initiation of
neurite outgrowth in cerebral cortex and PC12 neurons (Mansfield and Gordon-Weeks, 1991). MAP1B is upregulated by
thyroid hormones at the time of neurite outgrowth and is localized by in situ hybridization to the processes of extending corticospinal axons (Gordon-Weeks, 1991). Certain post-transcriptional modifications of the tubulins, including glutamylation
(M135), acetylation, phosphorylation, and tyrosination, and MAPs, i.e. phosphorylation, favor microtubule assembly and
process growth (Gordon-Weeks, 1991 ; Audebert et al., 1994; Mary et al., 1994). The amount of [3 tubulin isoforms, including M135,available for assembly is regulated by a feedback mechanism. The 13tubulin protein subunits interact in an unknown
way with the amino-terminus of [3 tubulin polysomal RNA bound to ribosomes to stabilize or destabilize the bound RNA
(Cleveland. 1989: Bachurski et al., 1994: Pachter et al., 1987: Yen et al., 1988).
Thyroid hormones regulate certain genes at the transcriptional level, i.e. for growth hormone and myosin, and/or mRNA
stability, i.e. for growth hormone. For transcription, regulation occurs by the formation of dimeric complexes of ~ and/or [3
thyroid hormone receptors, or TR (thyroid hormone receptor)-auxiliary protein (TRAP) (reviewed in Chin, 1992). o~1, l] l and
[32 bind T3 and are directly involved with activation of transcription, al is expressed in the fetal cerebral cortex plate in differentiating neurons (Bradley et al., 1992). 131is expressed in germinal zone dividing neurons and in the post-natal rat cerebral
cortex (Bradley et al., 1987, 1992). Dimeric complexes of the ligand (T3)-receptor bind to thyroid response element (TRE),
commonly present in the 5" flank of TH responsive genes, and this binding activates or inhibits transcription (reviewed in Stein
et a l., 1996; B rent et al., 1991 ; Chin, 1992). In developing brain, thyroid hormones regulate expression of genes involved with
axonal and dendritic process growth, e.g. nCAM, tubulins, MAPs, synapsin I, CAT (Quirin-Stricker et al., 1994), calbindin,
calmodulin, NaK ATPase (Corthesy-Theulaz et al., 1991), and RC-3 mRNA, and myelination, e.g. myelin basic protein
(Farsetti et al., 1991), MAG, and PLP (Bemal et al., 1992; reviewed in Porterfield and Stein, 1994). As shown, M[35 and other
tubulin isoforms may be regulated by thyroid hormone at the level of transcription, mRNA/polysomal RNA stability, or both.
Modified from Stein (1994).
M ~ 2 , a n d Mc~2 i s o f o r m s o f t u b u l i n are p r e s e n t at
h i g h a b u n d a n c e in t h e m i d - g e s t a t i o n e m b r y o
( L e w i s e t a l . , 1985), b u t d e c r e a s e s u b s t a n t i a l l y in
the early n e o n a t a l p e r i o d ( B o n d a n d F a r m e r , 1983;
Stein et al., 1989a). Although functional
i n t e r c h a n g e a b i l i t y h a s b e e n d e m o n s t r a t e d for different tubulin isoforms, certain tubulin isoforms
and certain MAPs may have functional effects on
m i c r o t u b u l e s ( A s a i a n d R e m o l o n a , 1989; C u m m i n g e t al., 1983; H o y l e a n d Raft, 1990; J o s h i e t
a l . , 1987; J o s h i a n d C l e v e l a n d , 1990; L e e e t al.,
1989; L u d u e n a e t a l . , 1989). D i s t i n c t t u b u l i n isof o r m s M135 a n d MI]2 a n d M A P s are p r o d u c e d in
the developing neurons and differentiating
n e u r o n s , a n d are p r e f e r e n t i a l l y a s s e m b l e d into
m i c r o t u b u l e s in e x t e n d i n g n e u r i t e s ( J e a n t e t a n d
G r o s , 1981; L u d u e n a , 1993). F u r t h e r m o r e , the
tubulin isoforms have distinct carboxy-termini
that may be functionally important in postt r a n s l a t i o n a l m o d i f i c a t i o n a n d b i n d i n g to c e r t a i n
M A P s ( S u l l i v a n , 1988). M A P s b i n d w i t h different affinities to d i f f e r e n t c a r b o x y - t e r m i n i .
S e v e r a l d i s t i n c t t y p e s o f M A P s are k n o w n , a n d
e a c h o f t h e s e p r o t e i n s a n d t h e i r m R N A s also
e x h i b i t s its o w n u n i q u e p a t t e r n o f d e v e l o p m e n tally r e g u l a t e d l o c a l i z a t i o n at the tissue, c e l l u l a r
a n d s u b c e l l u l a r l e v e l s ( M a t u s , 1988; B l o o m a n d
Vallee, 1983; B l o o m e t a l . , 1984; S c h o e n f e l d e t
al., 1989). In b r a i n , the m a j o r M A P s i n c l u d e
M A P 1 A , M A P 1 B , M A P 2 a n d tau ( B l o o m a n d
Vallee, 1982; V a l l e e a n d B l o o m , 1984; M a t u s ,
1988; Tucker, 1990). A h a l l m a r k p r o p e r t y o f m o s t
M A P s is t h a t t h e y act in v i t r o as s t i m u l a t o r s o f
t u b u l i n p o l y m e r i z a t i o n a n d m i c r o t u b u l e stability
( N u n e z e t a l . , 1989). It is likely, t h e r e f o r e , t h a t t h e
extension of axons and dendrites during development depends upon adequate levels of appropriate types o f b o t h t u b u l i n a n d M A P s , b u t d i s t i n c t
M A P s , s u c h as M A P 1 B a n d fetal tau, m a y play a
part in early n e u r o n a l d i f f e r e n t i a t i o n .
328
Advances in Neuroimmunology
Use of the hyt/hyt mouse to study
mechanisms of process growth
Since the hyt/hyt mice are deficient in thyroid
hormone, starting during late gestation, these
animals afford a means of looking at the effects
of thyroid hormone deficiency during a critical
period of molecular biological and neuroanatomical development of the brain, with particular
relevance for the cerebral cortex. These animals
may be used to evaluate the presence and potential
effects of specific brain mRNA changes related
to fetal and neonatal thyroid hormone deficiency.
Neuronal differentiation, particularly of cerebral
cortical layers V and VI is temporally correlated
with general brain (20,000-30,000 mRNAs) and
cerebral cortex specific synthesis of new poly A +
mRNAs (17 d pc to birth) and the onset of fetal
thyroid function (Chaudhari and Hahn, 1983).
The late gestational and early neonatal hypothyroid hyt/hyt mouse and its euthyroid hyt/+ littermates provide a means to dissect out thyroid
hormone effects during the narrow period of initial
differentiation of layer V pyramidal neurons and
their corticospinal tracts (Jones etal., 1982; Miller,
1987, 1988). Since the hyt/hyt mice only differ
from their hyt/+ litter-mates by their T 4 level,
specific brain and cerebral cortex molecular and
neuroanatomical abnormalities (Stein et al.,
1989a, 1991a-c; Noguchi, 1988), and delayed
and abnormal reflexive, locomotor, and adaptive
behavior (Adams et al., 1989, 1997; Anthony et
al., 1993) differences reflect o n T 4 level differences and, possibly, regulation.
The hyt/hyt mouse has been used to test
hypotheses developed from the model in Fig. 2.
These are predicted based on the following points.
First, fetal and neonatal hypothyroidism cause
abnormal motor behavior by altering the anatomical development of differentiating neurons in the
late gestational and early neonatal cerebral cortex
and their associated axonal tracts (as illustrated
in the models in Figs 2, 5, 10 and 11). Second, the
anatomical abnormalities in process growth and
connectivity are based on alteration by hypothyroidism of the cytoskeletal structures, particularly
microtubules, and their molecular components
that contribute to axonal outgrowth and elongation of the scaffolding neurons, such as pyramidal
neurons, during the fetal and neonatal period.
Third, these abnormalities in axonal growth are
predicated on the selective effects of thyroid
hormone deficiency on the number, molecular
composition, and function of axonal and growth
cone microtubules. Fourth, hypothyroidism alters
the level and timing of expression of certain tubulin isoforms, i.e. M[35 (see below), and
microtubule-associated proteins (MAPs), i.e.
MAP1B, fetal tau and MAP2, that comprise the
axonal microtubule in the developing cerebral
cortex. Fifth, M~5, M~2, and Meal tubulin isoform mRNA and the protein tau mRNA, MAP2,
and MAP1B mRNAs and protein are reduced
and/or demonstrate changes in the timing of
expression in fetal hyt/hyt (Stein et al., 1991 c, see
below) and hypothyroid neonatal rat cerebral
cortex (Nunez et al., 1989).
Utility of the hyt/hyt mouse for studies of
tubulin isoform expression, thyroid
hormone regulation, and process growth
abnormalities in pyramidal neurons in the
cerebral cortex
For the tubulin isotypes, particularly M~5, the
aims of our studies were to use the developing
mouse: (1) to define the normal timing, pattern
and level of expression oftubulin isotype mRNAs
and their translation products and total c~ and
tubulin mRNAs and protein; (2) to establish when
and whether these specific and total tubulin isotypes are altered by hypothyroidism during a
specific period of cerebral cortex differentiation;
and (3) to determine if reductions in specific tubufin isotype mRNAs might underly reductions in
specific tubulin proteins and total tubulin in
hypothyroidism.
Certain tubulin and other cytoskeletal
mRNAs and their proteins may be
expressed during a narrow window of
cerebral cortex development in the mouse
Our studies, using Northern gel, solution
hybridization, and quantitative immunoblotting
Biology of the congenitally hypothyroid hyt/hyt mouse
on individual fetal and neonatal cerebral cortex
samples have revealed several points related to
the MI35, M ~ I , and M[32 isoforms of tubulin.
The general developmental pattern of expression of mRNA for several isoforms in total brain
tissue of normal mice was previously determined
(Lewis and Cowan, 1988). The following study
began by focusing on the cerebral cortex, where
thyroid hormone is thought to exert significant
effects (Ruiz-Marcos, 1987), and by measuring
tubulin mRNA levels at more frequent time
intervals than had been examined in earlier work
(Lewis and Cowan, 1988).
Northern blot and solution hybridization
analyses were used to measure the levels of total
[3 tubulin mRNA, and mRNA for isotypes of c~
tubulin (Mc~I) and ~ tubulin (M[32 and MI35)
during post-natal development of normal, euthyroid mice. Data obtained prior to birth were from
the +/+ (wild-type) progenitor strain. For postnatal mice, we found that +/+ and hyt/+ animals
were indistinguishable and, therefore, data from
both groups were merged.
First, in developing euthyroid mice, the mRNA
for M[35 was shown to follow a developmental
pattern of expression in the cerebral cortex which
was quite distinct from that of whole brain (Fig.
6). The peak of expression was at 17 d pc in the
total brain and on the day of birth in cerebral
cortex. Hence, different brain regions must
employ di sti nct programs for regulating the levels
of M~5 mRNA during early development.
Second, the levels of M[35, M[32, and M ~ I
mRNA, when expressed for the fetal cerebral
cortex, peaked on the day of birth and declined
to low levels 7-16 dab. This low level of expression persisted throughout the adult period.
Similarly, the translation product for M~5 peaked
at one day and then declined significantly over
the next six days. Thus, M[35 and the other tubufin isotope changes demonstrate that the composition of microtubules in the fetal and neonatal
developing cerebral cortex normally change in a
manner related to constitutive patterns of expression, i.e. turning on or turning off certain tubulin
isotopes. These patterns of expression in mice
and rats are noted for other important functional
329
molecules, including other isotype mRNAs
(Lewis et al., 1985), total tubulin (Bond and
Farmer, 1983; Farmer et al., 1986), MAPs (Nunez
et al., 1989~ Lewis et al., 1986), actin mRNAs
(reviewed in Stein et al., 1991c), EGF (Stein et
al., 1991c), and GAP43 (reviewed in Stein et al.,
1991c). Taken together, the above findings suggest that common endogenous signals or constitutive developmental programs, operating at the
transcriptional level (Sullivan, 1988), may
exercise tight control of mRNA and protein levels
for a number of mRNAs and their translation
products that are essential for process growth in
the developing brain; this must be considered in
any analysis of thyroid hormone regulation of
these genes.
M[35 Protein levels follow a different profile
compared to M[35 mRNA
M[35 protein also peaks on the day of birth and
then demonstrates a precipitous decline that differs from its mRNA. The more rapid fall in M[35
protein versus M[35 mRNA after the day of birth
suggests that protein translation and/or stability
may be distinct in some ways from the constitutive mechanisms for mRNA decline (Fig. 6a).
Also, the expression of M[~5 mRNA peaks in
total brain at 18 d pc, which differs from its peak
for cerebral cortex on the day of birth (Fig. 6a).
Similarly, total [3 tubulin peaks at 18 d pc in
cerebral cortex (Fig. 6b). These facts suggest that
other brain regions rather than cerebral cortex are
utilizing these tubulin isotypes at an earlier time
in gestation; perhaps the brainstem, which differentiates during mid-gestation (Narayanan and
Narayanan, 1982; Sidman and Rakic, 1974) is
one such site.
M[35 tubulin mRNA and protein and M[~2
mRNA are significantly reduced in fetal
and early neonatal hyt/hyt cerebral cortex
Having established the developmental pattern of
expression o f m R N A for several tubulin isoforms
in euthyroid animals, we next performed similar
studies in hyt/hyt mice. M[35 tubulin mRNA and
330
A d v a n c e s in N e u r o i m m u n o l o g y
O
,'7
(A)
~LU
0_ O
!
150
I.U ~
lOO
MB5 mRNA ABUNDANCE IN EUTHYROID BRAIN
~] 1 +/+ TOTAL BRAIN
~ r ~ +/+ AND HYT/+ CEREBRAL CORTEX
Z<
<>..
m<
za
50
--ffl
~--
0
m
-6 -5-4-3-2-1
0 1 2 3 4 5 6 7 8 9 10
AGE (DAYS)
(B)
4000 --
TOTAL [B-TUBULIN mRNA
IN EUTHYROID CEREBRAL CORTEX
I
T O T A L fl-TUBULIN m R N A
3000
8
2000
1000
<
0
-5-4-3-2-1
o
1 2 3 4 5 6 7 8 9 lO
AGE (DAYS)
O
IJ_
(C)
o
LUll
nO
03Z
200 - -
Oz
l.lJ~
Orn
Z<
15o
Za
100
M~I, MB2, AND MB5 mRNAABUNDANCE
IN EUTHYROID CEREBRAL CORTEX
E:3 M~I mRNA
I I M!B2 mRNA
M!33 mRNA
--
<
a~
'IFl,.u
o
- 6 - 5 - 4 - 3 - 2 -1
o
1 2 3 4 5 6 7 8 9 1 0
AGE (DAYS)
Fig. 6. (Caption overleaf.)
Biology of the congenitally hypothyroid hyt/hyt mouse
331
Fig. 6. mRNA abundance of M[35(2A, C), M~2 (2C), Meal (2C) and total [3tubulin in hyt/+and +/+ fetal and neonatal cerebral
cortex (2A-C) and total brain (2A). Northern gel hybridization in conjunction with visage scanning and betascope analysis of
these hybridizations was used to determine abundance. Each point reflected the mean of a minimum of three abundance
determinations. In the cerebral cortex, all tubulin isotypes peaked on the day of birth (2A, 2C) and then fell in abundance.
Total ~3tubulin mRNA peaked at 19 d pc and then fell in abundance (2B). M~35mRNA peaked at 18 d pc in total mouse brain
(2A). Days on which no bars are shown were not sampled for mRNA abundance. For all figures: day -1 = 19 d pc; day -6 =
14 d pc; day 1 = day of birth or 1 dab; day after birth = 2 dab; 7 days of age = 7 dab. RNA was isolated by the methods of
Kedzierski and Porter (1990) and Ilaria et al. (1985). Quantitative solution hybridization was modified from Kedzierski et al.
(1990).
protein and M[32 m R N A are significantly reduced
in fetal and early neonatal hyt/hyt cerebral cortex.
Reduced thyroid hormone as reflected in the hyt/
hyt cerebral cortex compared to hyt/+ cerebral
cortex leads to: (a) a statistically significant reduction (1.5-5-fold) of M~5 m R N A on the day of
birth (1 d ab) and 2 days after birth (Fig. 7) using
solution hybridization (Fig. 7c) and Northern blot
(Fig. 7a) analysis with single-stranded c R N A
probes; (b) a reduction o f M ~ l m R N A in 5 d a b
total brain (not pictured); and (c) a significant
reduction of M[~5 protein on the day of birth
using quantitative immunoblotting (Fig. 8). These
reductions are statistically significant and have
been replicated for M~5 m R N A . This m R N A is
also reduced on the second day of life (2 d a b ) ,
but reaches a normal level at 3 d a b . Preliminary
but statistically significant trials with M~2 show
that this m R N A and E G F m R N A (Stein et al.,
1991 c) are also reduced in the hyt/hyt versus hyt/+
cerebral cortex.
The differences in specific m R N A abundance
between the hyt/+ and hyt/hyt animals may reflect
on thyroid hormone regulation of late gestation
and early neonatal m R N A and protein synthesis.
The specificity of these changes in tubulin isotype m R N A abundance is suggested by the lack
of change of: (1) 9A6 m R N A (Sher et al., 1997;
Stein, 1988) and other tubulin isoform m R N A s ,
and (2) total brain and cerebral cortex Poly A ÷
R N A (Fig. 9) and ribosomal R N A (Fig. 9) in day
of birth hyt/hyt versus hyt/+ mice in Northern gel
hybridization and solution hybridization (total
R N A is made up of both poly A ÷ R N A and ribosomal RNA). In mouse cerebral cortex, there is
98% ribosomal R N A and 2% poly A + R N A (Fig.
9). This suggests that thyroid hormone deficiency
does not cause global changes in all RNAs, but
rather specific changes in specific m R N A s in
specific brain regions at specific times, which is
corroborated by the elevations in Mc~l and M ~ 5
m R N A s in day of birth brain remainder. The
degree of reduction of M[35 m R N A and its protein
are similar, which m a y suggest that the fetal
m R N A reduction has a direct effect on the expression of its protein.
The mechanisms of regulation for M~5 by
thyroid hormones are not clear. Given the above
facts, the depression in M~5 isotype m R N A and
its translation product at birth and the rate of fall
in abundance of these molecules in fetal and neonatal cerebral cortex could represent a complex
regulation by thyroid hormones o f the M[35
m R N A and its protein at the level of transcription, m R N A stability (Fernyhough et al., 1989;
Cleveland, 1989), or both, interacting (Diamond
and Goodman, 1985) with developmentally timed
genetic programs of expression. Our results suggest that M~5 m R N A declines more rapidly after
peaking on the day of birth in euthyroid brain
than in the hyt/hyt brain. These observations are
consistent with a transcriptional turn-off at a
particular time, requiring a certain level of thyroid
hormone. Thyroid hormones can work simultaneously on a single gene to regulate m R N A levels
by transcription and m R N A stability (Narayanan
and Towle, 1985); the mechanisms of activation
on t u b u l i n i s o t y p e and M A P m R N A s are
unknown, as are the potential TRE 5' flanking
regions in their gene.
The reduction in certain tubulin and M A P and
m R N A s and alterations in their pattern of expression in fetal and neonatal hypothyroidism can be
related to: (1) thyroid hormone effects on gene
transcription and translation and/or m R N A stability; (2) constitutive programs of expression of
groups of genes, i.e. tubulin isoforms and M A P s
that support neuronal differentiation in cerebral
332
A d v a n c e s in N e u r o i m m u n o l o g y
o')
I
I
uaoov7
CO
LU
~
o
I-x
<w
z I-
.... ::: :::::
uO'~
::::: M!:: :::: ::
zer
"=N°==o<
+~±,~H
.[,~H/±~,H
•
. ~
b~
~..,
._="~ ~ < ~. <:
BN~Z=
co
: :~:::::~:~ . . . . . . . . . . . . . . .
:: ~,~
zp.'~
• ................
:
] ~ i i ~ : ........... ~ ~
~
.....
:: 7~7':
z
+/1AH
:
11HI11H
iI
oi-
~
>
1,kHIIAH
_
.~-~. ~.~
~ ' - ~
,,, ,,,
.-
o
~
'
~
m
v
X
ILl
Ira
X
iii
l-n-
I
I
I
I
I
I
I
n"
ill
~.~.~
o
n"
Zlll
o
<m
+
,,¢:
Z
mi--
I
nr"
0
E
I~
g~
z<~
m-r
E~r~
1-
8a
< 0
w ,
< ,'~'~
>>. Z
I-"r"
7I-~"
I
<
0
o
-,-
+
>.- >,.
I
-r
lr
0
=
oo>
~ ~ + p'r~
~,~
I
z
~
,~.~
O
ol
o
o
I
I
I
o
g
o
o~
o9
¢~
I
I
I
I
0
0
~
~00
oo~ X BONVaNnQV
÷//AH
/ 3ONVQNRSV
±AH/$AH
o
0
I
I
o
o
0o
o
o
co
I
o
o
(1N31/~lV=IEII
39V37ONN
EI31-1V
0310310Wd
£±NnOO)
3ONVaNnQV
VNWW
< ~: --= .~. ~
Z<
~ z
,oZ~
Biology of the congenitally hypothyroid hyt/hyt mouse
cortex motor neurons; (3) the timing and location
of expression of thyroid hormone receptors (~1
receptors) to pyramidal neurons in layer V sensorimotor cortex; and (4) endogenous autoregulatory mechanisms that modulate ]3 (Cleveland,
1989; Theodorakis and Cleveland, 1992; Yen et
al., 1988) and c~ (reviewed in Bachurski et al.,
1994; Theodorakis and Cleveland, 1992) tubulin
levels by reducing the stability of polysomal tubulin isoform RNAs (Fig. 5).
Potential relevance of M[35 and thyroid
hormone for microtubules and process
growth: reductions in M[35 mRNA and
protein may affect microtubule composition
and function in extending axons of the
developing cerebral cortex
MI]5 or Class I tubulin isoform represents a
ubiquitous isotype that is made in a variety of
organ systems (Lewis et al., 1985; Cowan et al.,
1983) across the phylogenetic scale (Sullivan,
1988). In the fetal and neonatal mouse (Lewis et
al., 1985) and rat brain (Bond et al., 1983) this
isoform is abundant and common. During this
period, M[35 would be expected to contribute as
a major isotype to microtubules. The evidence
for the potential linkage for M]35, microtubules,
and process growth comes from a number of
points. First, in the cerebral cortex, M~5 and
other tubulin isotypes (M~2 and Mc~l) are
expressed (starting at 15 d pc) and peak (day of
birth) during a narrow period of cerebral cortex
development that correlates temporally and may
contribute molecularly to the initial axonal
outgrowth from layer III neurons and layer V
pyramidal neurons. During this period, the
outgrowth, elongation and branching of basal and
apical dendrites for these neurons, and the
ingrowth of afferent thalamocortical fibers, are
also occurring (Miller, 1988). Second, by in situ
hybridization and immunohistochemistry, MI35
mRNA and its translation product (Burgoyne et
al., 1988) are localized to neurons. As an example
of this, on in situ hybridization, the M~5 and
Mc~l mRNAs (Stein etal., 1989a, 1991c) and its
rat counterpart, Tc~l (Miller et al., 1987), are
333
localized to cell groups in superficial and deep
cortex on the day of birth (particularly layer V
pyramidal neurons in mouse sensorimotor cortex)
(Stein et al., 1991c). These neurons are the
forerunners of layers II, III, IV, and V of the sensorimotor cortex. The layer V neurons are the
origin of the corticospinal tracts. Total tubulin
protein is also evident in pyramidal neurons (Stein
et al., 1991c). Third, layer III and layer V
pyramidal neurons are: (a) areas of active differentiation in the developing fetal and neonatal
cerebral cortex, particularly the motor cortex
(Miller, 1987; Jones et al., 1982); and (b) sites
that have shown abnormalities in process growth
related to hypothyroidism (Marinesco, 1924;
Eayrs, 1955; Ruiz-Marcos, 1989). These regions
are also: (a) specific cellular sites for certain developmentally expressed MAPs; and (b) sites for
localization of specific thyroid hormone receptors, i.e. al, that peak during late gestation and
the neonatal period (Bradley et al., 1992; Fox et
al., 1987; Strait et al., 1990).
Fourth, MI35, as opposed to other tubulin isotypes, may affect microtubules through the effects
of its distinct carboxy-terminus (Sullivan, 1988;
Burgoyne et al., 1988), the glutamylation of this
C-terminus (Audebert et al., 1994; Mary et al.,
1994) and other sequence regions (Luduena,
1993) by preferentially promoting microtubule
subunit polymerization (Joshi and Cleveland,
1990) in vivo and in vitro in extending neurites
(Luduena, 1993), and by selectively promoting
certain MAPs, i.e. tau (Paschal etal., 1989; Audebert et al., 1994; Mary et al., 1994). These MAPs
may directly stimulate tubulin polymerization and
alter microtubule stability. MI35 is a component
of microtubules with dynamic instability, a
requirement for microtubule elongation and
axonal process growth. The implication of our
results with M135 is that diminished levels of
M[35 and/or M~2 in the hyt/hyt mice, along with
effects on the timing and level of expression of
certain MAPs (Hargreaves et al., 1988; Nunez et
al., 1989), might alter microtubule composition
and the composition of the growth cone, axonal,
and soma pools of microtubule components at
critical developmental times of axonal outgrowth
334
Advances in Neuroimmunology
e~
~X
~+
I-.- t.-.>.- >.- +
n- -r- "~
LUC:
So
><
Zrr
LId
¢r
<
~LL/
_JOO
So
F/1/1////1////Hill//////////!
f-
I,
I , l ~ l , I ,
o
o
o
o
o
o
o°
o°°
O
O
O
O
O
C~
O
O
oo
oo
o
aNno8
o
s~l
o
04
77771TTT
V,'HIHIHIIHIIIIHIII~
00
u,,,zz,.,,,,.,,,
F.,-
x
w
~r
I.--0
~
2:<
--nzm
=
IH.','H.'/.'//.'.'.'HJ//J////g
O<
rrrr
l~_rn
+
I->32
d
VlH,'.'HHIZ,'I.'.'I/H/:/II/II
rlllllllllllZZllllllllllllllllllllllll
zr.r"
t,
oo
o
SJ.NROO
Z
-U.I
I--~r.
0 Z
~r'r"
n E
I:1,
o°
o
I
co
r,..
.~
tm
m
(9
--
<
Oo
~. '-'r
,,,
Z ~
c~
m>c~_ " r
>-m
Z"~
~
Z
_
_
I
I
I
1
,
o
o
°[
I
,
,
,
1.0
>..
'1-
+
I
~
<
v
I->'l-
S8
-->"
No
I
o
~
I ....
0
m
)~VQ
:INO
I ....
0
0
0
I , , , T l ~ , , , I , , r :
0
0
0
0
0
0
0
0
0
-IO qONVGNnSV/
,,KVC] 0 1 - . 1 1 0 3 c l S
.40 3C)NVGNPISV
£.LNNO0
C]NNO£
sz~l
Biology of the congenitally hypothyroid hyt/hyt mouse
335
Fig. 8. M135and total tubulin protein abundance in hyt/hyt and hyt/+ cerebral cortex using quantitative immunoblotting. M135
mRNA and protein fell after peaking on the day of birth, but the level of M~35protein declined more rapidly (5A). M~5 protein
was depressed in abundance in hyt/hyt day of birth cerebral cortex (5B). Total tubulin, as assessed by a monoclonal antibody
to c~tubulin, was unchanged in hyt/hyt versus hyt/+ cerebral cortex on the day of birth (5C). All data points were determined
by the mean of at least four separate immunoblots, which were repeated at least three times. Standard SDS-PAGE was utilized
with electrophoretic transfer of proteins to nitrocellulose lnembranes which were used for quantitation. Primary antibodies
included rabbit polyclonals specific for either M[32or M[35, supplied by Drs Nicolas Cowan and Sally Lewis, and the DM 1A
mouse monoclonal (Amersham, Arlington Heights, ILL which recognizes all forms of c~tubulin. Primary rabbit antibodies
were detected using 125Iprotein A. Following gel autoradiography,immunoreactive tubulin bands were excised and counted
by gamma counting. In addition, for total tubulin, quantitation was determined in relation to an established tubulin concentration series.
and elongation. "A cell may adjust the relative
amounts of isotypes which it expresses as a means
to regulate the dynamic behavior o f microtubules . . . . Subtle changes in the ratio of tubulin
isoforms could have important consequences for
the cell" (Luduena, 1993). Changes in microtubule composition, in combination with other
c y t o s k e l e t a l effects o f t h y r o i d h o r m o n e
deficiency, m a y influence the assembly, stability,
and, perhaps, functional properties and distinctness of neuronal microtubules, and may contribute
to abnormalities in process growth in hypothyroid developing cerebral cortex and in hyt/hyt
hippocampal neurons.
Relationship of process growth to thyroid
hormone, tubulin isoforms, MAPIB, the
hyt/hyt mouse, and molecular regulation
The localization of certain tubulin isoforms to the
developing cortex, the molecular structures with
various termini with distinct affinities and other
unique sequence regions, the selective timing of
expression during late gestation, the importance
of selective tubulin isoforms and M A P s in supporting process growth and their role in forming
functionally important microtubules, all argue for
the roles of certain tubulin isotypes and certain
M A P s in normal process growth. Such processes
are compiled for the molecular effects of hypothyroidism on neuroanatomical abnormalities and
behavioral changes for the hyt/hyt mouse and
other rodents (Fig. 10, Model 2).
The level of thyroid hormone, particularly its
deficiency, may regulate the cytoskeleton and
process growth by (Fig. 11, M o d e l 3): (1) reductions in the synthesis of certain developmentally
regulated tubulin isoforms and MAPs, i.e. tau,
related to effects on transcription (Stein et al.,
1989a, 1991c; Nunez etal., 1989), splicing (Aniello et al., 1991), m R N A stability, or translation;
(2) alterations in the timing and site of expression
of microtubule components; (3) altered kinetics
for microtubule assembly (Nunez et al., 1989);
(4) reductions in SCa and SCb for tubulins, microtubules, neurofilaments, and actin and reduced
axonal tubulin content (Stein et al., 1991a); (5)
elevations in axonal calmodulin (Stein et al.,
1991 b), which may affect microtubule assembly
and disassembly; (6) assembly of actin into microfilaments by a non-nuclear mechanism (SiegristKaiser et al., 1990); (7) p h o s p h o r y l a t i o n of
neurofilaments (Marc et al., 1986), which affects
the stability of the axonal cytoskeleton; (8) tyrosination of ~ tubulin (Laksmanan et al., 1981),
which contributes to dynamic instability of the
microtubule; and (9) regulation of RC3 m R N A ,
a protein kinase C substrate of dendritic spines,
and of N - C A M m R N A (Munoz et al., 1991 ; Berhal et al., 1992).
Hypothyroidism affects process growth by
altering the slow component A and slow
component B axonal transport of selected
proteins that are critical for process growth
and maintenance: studies utilizing the
hyt/hyt optic nerve
The growth and maintenance of neuronal processes and connectivity depends not only on the
synthesis of critical molecules and proteins in the
cell body, but also their delivery to the distal axon
and growth cone. Three separate rate components,
fast, slow c o m p o n e n t A (SCa), and slow
336
Advances in Neuroimmunology
(c)
(A)
POLY A+ RNA SOLUTION HYBRIDIZATION STANDARD
CURVE OF POLY rA TEMPLATE AND 32p POLY dT
Ribosomal RNA
1 day
Cerebral Cortex (CC)
I
1
~
. . . . .~
I-ILl
z I-
10000 - -
~_ ~
"~
9000
(/) ~_.
8000
7000
rr
.s-
6000
I1.
sooo
z
o
,0o0
/
o
~
-
°
~
°
I
I
I
3000
....
7
~ 0
2000
Q'>,
..E
>,
.,c:
~>,
.1:=
>,
+
~
JE
I
•=
POLY
28S RIBOSOMAL RNA ABUNDANCE
IN HYT/HYT, HYT/+, AND +/+ CEREBRAL CORTEX
I~
4 ~
zl--(:3
>-
1:3
LU
N
I
(D)
rA TEMPLATE
I
I
I
I
(NG)
CONCENTRATION
POLY A+ RNA CONCENTRATION
IN HYT/HYT AND HYT/+ CEREBRAL CORTEX
E:
nn
Tn'>"
(/)
oo
oo
4a
(/)v
rr
I
8000
HYT/HYT (DAY OF BIRTH)
HYT/+ (DAY OF BIRTH)
+/+ (DAY OF BIRTH)
= _z
4,,,
<o
z.
=4
om
_
I
0.00.1 0 . 2 0 . 3 0 . 4 0 . 5 0 . 6 0 . 7 0 . 8 0 . 9 1 . 0
(B)
0Z
1000
-t~
..E
0
Z
HYT/HYT
HYT/+
+/+
D
r[F'/T'~ HYT/HYT (DAY OF BIRTH)
,o006°°°
2000
10
m
<
TOTAL
30
CEREBRAL
35
40
CORTEX
45
50
--
RNA (UG)
Fig. 9. Determination of ribosomal RNA and total poly A+ RNA content of total brain and cerebral cortex in hyt/hyt and hyt/+
day of birth mice. Using Northern gel hybridization, 28S ribosomal RNA was not altered in hyt/hyt, hyt/+, or +/+ cerebral
cortex or total brain on the day of birth (4A, 4B). Total poly A + RNA content of total brain and cerebral cortex in hyt/hyt and
hyt/+ day of birth mice (4C, 4D) was determined. Poly rA (Pharmacia) was transcribed by MMLV reverse transcriptase with
PTTP (Pharmacia). The single-stranded poly dT probe of a specific concentration was then hybridized in solution with known
amounts of total RNA from hyt/hyt and hyt/+ total brain and cerebral cortex. As assessed by S 1 nuclease resistant 32p counts
per minute, the rise in amount of hybridization with increasing amounts ofhyt/hyt versus hyt/+ cerebral cortex was essentially
the same (4C). Total poly A ÷ RNA was calculated to be 2% in hyt/hyt and hyt/+ cerebral cortex by a standard curve based on
hybridization of the poly rA template to the single-stranded poly dT (4D). All data points represented the mean of triplicate
determinations.
component b (SCb), carry distinct groups of critical proteins distally. Fast axonal transport includes
movement of membrane bound vesicles, including synaptic vesicles, certain proteins (e.g.
dopamine ~ hydroxylase) and plasma membrane
components. This rate component is dependent,
in part, on the efficacy of axonal microtubules
and is reduced in hypothyroid axons (Rasool et
al., 1985). SCa, the slowest rate component, is
primarily composed of tubulin and/or microtubules and neurofilaments. As such, this rate
component plays important roles in supporting
neuronal shape, growth, and function (Brady,
1988). SCb moves more rapidly than SCa and
typically carries actin, brain spectrin, HSC70,
calmodulin, clathrin and associated proteins, and
glycolytic proteins (deWaegh and Brady, 1990).
This rate component functions in energy
Biology of the congenitally hypothyroid hyt/hyt mouse
MODEL 2
337
Reduced Fetal/Neonatal Brain T3/T4
,~ MAP Synthesis " /
Delayed ; A P Expr7
~, MI35 mRNA in Day of I~
I \
Birth Cerebial Cortex I '
1%
~, MI35 Protein in Day of I ~
Birth Cerebral Cortex
11
- .. ~ Other Tubulin - - ~,- t Hippoeampus
isoforms/MAPs
1. ~, Mossy Fibers
1. Delayed Granular
Cell Migration
2. Purkinje and Granular
Dendritic Abnormalities $ Axonal Transport of Tubulin
and Tubulin isotype Proteins to
3. Parallel/Climbing
Distal Microtubule and Growth Cone
Fiber Abnormalities
\
of Growing Corticospinal Axons
\
\
\
\
Altered Microtubules at
Distal Axon and Growth Cone
\
\
\
'i 2 . D e n d r i t i c A b n o r m a l i t i e s -
i
Pyramidal/Granular Neurons
|
Visual Cortex and Optic Nerve
1. Dendritic Abnormalities
of Pyramidal Neurons
2. ~,SCa of Optic Nerve
\
\
\
Delayed Abnormal Corticospinal
Tract Penetration into Spinal Cord
Grey Matter Below Cervical Region
\
\
\
\
\
\
\ Delayed or Altered Placing an
Grip Strength
\
Altered Visual
Development
Altered Spatial
. / , . ~ ¢ Learning "1. . . . . .
\
Altered Complex Juvenile
and Adult Motor Behavior
Fig. 10. Model2: modelof thyroidhormoneactionon motorand other systems.Reducedfetalthyroidhormonelevelsmay effect
specific cytoskeletalmoleculesthat contributeto the formationof microtubulesand subsequentnormalneuronalprocess growth.
Reductionsin certaincytoskeletalmolecules,and potentialchangesin the numberand functionof specificmicrotubulesin selective braincells and regionsat specifictimes of developmentcan affect the motor system.This may be manifestedby anatomical
changes and subsequentdelays or permanentalterationsin early reflexes or more complex motorbehavior.With respect to the
latter, similareffects on other systems in the hippocampus and cerebellummay contributeto the total effects on the brain.
Reproduced, withpermission,from The Damaged Brain and Iodine Deficiency (1994), by CognizantCommunicationCorp.
metabolism, growth cone mobility, receptor scaffolding, and regeneration of neuronal processes
(Hammerschlag et al., 1994).
To define the potential mechanisms of process
growth in hypothyroidism, we used the hyt/hyt
m o u s e optic nerve to look at the level and
composition of SCa and SCb. This employed the
pulse labeling method (reviewed in Stein et al.,
1991a) in the optic nerve of 3 month old, agematched hyt/hyt, hyt/+, and +/+ mice. For SCa,
the velocity of transport for neurofilaments and
tubulins was significantly reduced in the hyt/hyt
optic nerves versus the hyt/+ and +/+ nerves (Stein
et al., 1991a). This may also be generalized to
certain MAPs, which may be complexed to SCa
components. Furthermore, the actual amounts of
tubulin within the axon were reduced, which may
be a reflection of synthesis, assembly, and
transport difficulties and the actual reductions
observed in axonal microtubule number. Taken
together, these observations suggest that the axon,
and particularly its distal aspect, where these
components are required, would be relatively
deficient in the hyt/hyt optic nerve (Stein et al.,
1991a).
Hypothyroidism may also affect the axon and
338
A d v a n c e s in N e u r o i m m u n o l o g y
Altered Late Fetal and Neonatal Thyroid Hormone Levels
CONSTITUTIVE PROGRAMS OF TIMING AND LEVEL OF GENE EXPRESSION
or t3 Thyroid Hormone Receptors
Reduced Abundance of Mt35mRNA, M~I or ? MAP mRNAs
Reduced Actin Polymerization
Reduced Abundance and Altered Timing of Appearance
of M135, Mot1 and Certain Other Isoform Proteins and/or Reduced
Abundance or Delayed Appearance of Certain MAP Products
1.
2.
3.
4.
5.
Reduced Assembly and Numbers of Microtubules
Altered Microtubular Composition
Reduced Axonal Tubulin/Microtubules
Altered Timing of Appearance of Specific Microtubules
Altered Microtubular Stability/Function
Reduced SCa
-~- Axonal Transport
of Tubulin and MAPs
Reduced Fast Axonal
Transport of Organelles
and Membrane Proteins
Alteration and Delay in Fetal and Neonatal
Cerebral Cortex Axonal and Dendritic
Elongation, Branching and Stability and
in Later Process Maintenance
? Reduced SCb Transport
of Actin/Miirofilaments
[ _ Altered Neuronal and
- - " Glial Microfilaments
Altered
m Dendritic
Spines
Altered Neurofilament
Phosphorylation and
Number and Reduced
Axonal Transport of
J
Neurofilaments
,, Altered Neuronal Connectivity
Fig. 11. Model 3: an integrated model of thyroid hormone effects on the cytoskeleton and their relationship to process growth
abnormalities and abnormal connectivity with respect to the hyt/hyt mouse. Molecular, neuroanatomical, and behavioral
abnormalities in the hyt/hyt mouse and other animal models and the human neuropathology suggest a more specific model of
thyroid hormone effects related to the potential functions of specific mRNAs and the observed abnormalities in process growth
and motoric behavior. Alterations of thyroid hormone levels as seen in the hvt/hvt mouse lead to alterations in the levels of
specific developmentally regulated tubulin isotype mRNAs and their translation products, which are precursors of tubulin.
This occurs in neurons, such as the pyramidal layer V neurons of the mouse sensorimotor cortex, that are differentiating at
this time and whose axons form the corticospinal tracts. Microtubule associated proteins (MAPs) that complex with tubulin
isotype proteins to form microtubules may also be altered. The delivery of the tubulin isotype proteins to the growing axon
is also reduced. These reductions in tubulin isotype levels and transport may lead to alterations in number, composition,
assembly, stability, and potential function of the microtubules. Similarly, actin polymerization, microfilament axonal transport,
and neurofilament expression, transport, and phosphorylation are altered. The results of these events may be alterations in the
extent and timing of process outgrowth, elongation, and branching, in process maintenance, and of connectivity, with noted
abnormalities in growth of the corticospinal tracts and other tracts. The potential results of these neuroanatomical alterations
are delayed, abnormal, and irreversibly changed reflexive, locomotor, and adaptive behaviors. These behaviors may be
predicated on normal sensorimotor cortex and corticospinal tract development and function, and other components on the
motor system, as well as the hippocampus and visual and auditory systems. (Modified from Stein, 1994.)
s y n a p t i c c o m p o n e n t s by a l t e r i n g SCb. In fact, the
ATPase), clathrin, spectrin, and calmodulin.
rate o f n e u r i t e e l o n g a t i o n m a y be directly r e l a t e d
C l a t h r i n , s p e c t r i n , actin, a n d H S C 7 0 s h o w e d
p r o t e i n s are
s i g n i f i c a n t r e d u c t i o n s in t r a n s p o r t velocity. A c t i n
i m p o r t a n t in g r o w t h c o n e f u n c t i o n and, using a
to S C b
transport. Many
SCb
is a m a j o r c o m p o n e n t o f the m i c r o f i l a m e n t s that
s i m i l a r p a r a d i g m as above, a x o n a l t r a n s p o r t w a s
f u n c t i o n in the g r o w t h c o n e to p r o m o t e p r o c e s s
e v a l u a t e d for actin, H S C 7 0 (clathrin u n c o a t i n g
g r o w t h . Its r e d u c e d t r a n s p o r t distally, c o m b i n e d
Biology of the congenitally hypothyroid hyt/hyt mouse
with the effects of hypothyroidism on increasing
actin depolymerization, may contribute to
observed process growth abnormalities. Spectrin
interdigitates with actin in the growth cone and
with other cytoskeletal structures in the axon. As
observed here, changes in spectrin may influence
axonal receptors and process growth.
Calmodulin was not significantly reduced in
terms of transport velocity but, unlike the other
proteins, calmodulin levels significantly increased
in the axon. Although calmodulin works in many
ways on the neuron, it is involved with regulation
of microtubule assembly in vitro. Increases in
synthesis of calmodulin mediate reduction in
microtubule assembly. Elevations in calmodulin
in the hyt/hyt mouse may contribute to alterations
in the numbers and stability of microtubules.
The transport velocity of both the clathrin heavy
chain, a major component of coated vesicles, and
HSC70, an uncoating ATPase for clathrin coated
vesicles, was significantly slowed in hyt/hyt nerves
(Stein et al., 1991b). Axonal HSC70 was also
reduced in terms of its level. Clathrin coated
vesicles function in the recycling of synaptic
vesicles, uptake of materials at the presynaptic
terminal, and in receptor mediated endocytosis
and secretion. Changes in clathrin may affect
synaptic function, retrograde transport of trophic
substances, and process maintenance. HSC70 and
free clathrin have roles in protein trafficking and
transport in the neuron, which may be altered in
undefined ways by changes in transport and level
of HSC70. Changes in clathrin, when combined
with changes in fast axonal transport, may effect
the supply of membrane organelles for process
maintenance. Changes in SCb may underly reductions in neurite outgrowth, synaptogenesis, synaptic efficacy, and neuronal plasticity.
Since the molecular mechanisms of SCa and
SCb are poorly understood, it is difficult to mechanistically relate reductions in thyroid hormone in
the hyt/hyt optic nerve to these events. However,
alterations in SCa and SCb provide one basis for
understanding observed alterations in process
growth and connectivity in hypothyroid humans
and animals. Axonal transport and tubulin isoform abnormalities, in combination with other
339
molecular effects of hypothyroidism on cytoskeletal and other critical molecules, give a tentative
road map of how reductions in thyroid hormones
may affect process growth and maintenance,
growth cone motility, synaptic function, process
stability, functional and anatomical connectivity,
and excitability. This is emphasized by thyroid
hormone effects on the following genes and gene
products and their potential associated functions:
(1) tubulins, MAPs, i.e. tau, MAP1B, MAP1A,
N-CAM, NGF, preproEGF, calbindin, calmodulin (neuronal process growth and maintenance);
(2) synapsin I, NaK ATPase, CaATPase, RC3/
neurogranin, acetylcholinesterase (synaptogenesis and synaptic function including dendritic
spine functions; and (3) myelin basic protein,
myelin associated glycoprotein (myelination)
(Porterfield et al., 1994; Munoz et al., 1991;
Farsetti et al., 1991 ; Bernal et al., 1992; CorthesyTheulaz etal., 1991; Iniguez etal., 1993; Stein,
1994). The wide range of these molecules provides
a broader base of evidence, suggesting that the
observed neuroanatomical abnormalities may be
predicated on alterations by thyroid hormones of
many different molecules that act to produce a
"normal" event. Furthermore, taken with our
molecular observations, a common mechanism
for thyroid hormones in the developing nervous
system is to act on molecules that have critical
functions. The hyt/hyt mouse provides a model to
evaluate the effects of thyroid hormones during
the life-cycle from a molecular, neuroanatomical, and behavioral standpoint. Work on this
mouse emphasizes that initial molecular effects
of thyroid hormones form the basis for both
normal and abnormal neuroanatomical and behavioral and cognitive function that may be general
across the phylogenetic scheme.
Thyroid hormone regulates process growth
and connectivity, synaptogenesis and
myelination by regulating critical molecules
at the molecular level: the hyt/hyt mouse
has direct relevance for clinical
management and pathophysiology of SCH
The appropriate diagnosis, follow-up and treatment of human SCH is predicated on a better
340
Advances in Neuroimmunology
understanding of the fetal and post-natal effects
of hypothyroidism. Compilation of human and
rodent clinical and basic research suggests that
there are several critical p e r i o d s o f t h y r o i d
dependence for normal molecular and anatomical development and maintenance of the nervous
system. This including the human fetal period,
corresponding to 15 d pc to 10 d a b in the hyt/hyt
mouse. Since the SCH continues throughout the
life of the animal, this mouse can be used to
determine: (1) the critical periods and dependence of fetal, neonatal, juvenile, and adult brain
on thyroid hormones; (2) potential diagnosis,
pathophysiology, and therapy of fetal thyroid
deficiency; and (3) the proper timing and dose of
T 4 to normalize and maintain euthyroid brain
thyroid hormone levels and to prevent molecular,
neuroanatomical, and behavioral/cognitive effects
in the motor system, the auditory system, and the
hippocampus and other brain regions.
Acknowledgements
This work was supported in part by N I N D S
NS36301 (S.A.S.), N I M H / A O A M H A , by N I M H /
ADAMHA MH43017 (S.A.S.), MH42469
(S.A.S.) and by Children's Hospital of Orange
County
(CHOC)-CHOC
Research
and
Educational Foundation (S.A.S.); United Cerebral
Palsy Foundation (S.A.S.); NIH grant NS3045
(G.S.B.); Robert A. Welch Foundation Grant
1-1236 (G.S.B.).
References
Adams, P. M., Armstrong, L. and Stein, S. A. (1997).
Sensorimotor development in the hyt/hyt mouse:
effects of congenital hypothyroidism (in preparation).
Adams, P. M., Stein, S. A., Palnitkar, M., Anthony, A.,
Gerrity, L. and Shanklin, D. R. (1989). Evaluation
and characterization of the hypothyroid hyt/hyt
mouse. I: somatic and behavioral studies. Neuroendocrinology 49:138-143.
Aniello, E, Couchie, D., Bridoux, A-M., Gripois, D.
and Nunes (1991). Splicing of juvenile and adult
tau mRNA variants is regulated by thyroid hormone.
Proc. Natl Acad. Sci. USA 88:4035-4039.
Almazan, G., Honegger, R and Matthieu, J. M. (1975).
T3 stimulation of oligodendroglial differentiation
and myelination. Dev. Neuro. 7:45-54.
Almli, C. and Fisher, R. (1977). Infant rats: sensorimotor, ontogeny and effects of substantia nigra
destruction. Brain Res. Bull. 2,425-459.
Altman, J. and Sudarshan, K. (1975). Postnatal development of locomotion in the laboratory rat. Anim.
Beha~: 23:896-920.
American Academy of Pediatrics (1993). Newborn
screening for congenital hypothyroidism, recommended guidelines. Pediatrics 91:1203-1209.
Anthony, A., Adams, E M. and Stein, S.A. (1993).
The effect of congenital hypothyroidism using the
hyt/hyt mouse on locomotor activity learned behavior. Horm. Behav. 27-418-433.
Asai, D.J. and Remolona, N.M. (1989). Tubulin
isotope usage in vivo: a unique spatial distribution
of the minor neuronal-specific tubulin isotope in
pheochromocytoma cells. Dev. Biol. 132:398-409.
Audebert, S., Koulakoff, A., Berwal-Netter, Y., Gros,
E, Denoulet, E and Edde, B. (1994). Developmental
regulation of polyglutamylated b tubulin in mouse
brain neurons. J. Cell Sci. 107:2313.
Bachurski, C. J., Theodorakis, N. G., Coulson, R. M.
and Cleveland, D. W. (1994). An amino-terminal
tetrapeptide species cotranslational degradation of
[3tubulin but not ~ tubulin mRNAs. Mol. CellBiol.
14:4076-4086.
Bahn, R. S., Dutton, C. M., Heufelder, A E. and Sarkar,
G. (1994). A genomic point mutation in the extracellular domain of the thyrotropin receptor in the
patients with Graves' ophthalmopathy. J. Clin.
Endocr. Metab. 78:256-260.
Beamer, W. G. and Cresswell, L. A. (1982). Defective
ontogenesis in fetal hypothyroid (hyt/hyt) mice.
Anat. Rec. 202:387-393.
Beamer, W. G., Eicher, E. M., Maltais, L. J. and Southard, J.L. (1981). Inherited primary hypothyroidism in mice. Nature 212:61-63.
Bernal, J., Rodriguez-Pena, A., Iniguez, M. A., Ibarrola, N. and Munoz, A. (1992). Influence of thyroid
hormone on brain gene expression. Acta Med. Aust.
19(Suppl. 1):32-35.
Bloom. G. S., Schoenfeld, T. A. and Vallee, R. B.
(1984). Widespread distribution of the major
polypeptide component of MAP1 (microtubuleassociated protein 1) in the nervous system. J. Cell
Biol. 98:320-330.
Bloom, G. S. and Vallee, R. B. (1983). Association of
microtubule-associated protein 2 (MAP2) with
Biology of the congenitally hypothyroid hyt/hyt mouse
microtubules and intermediate filaments in cultured
brain cells. J. Cell Biol. 96:1523-1531.
Bond, J. and Farmer, S. (1983) Regulation of tubulin
and actin mRNA production in rat brain. Mol. Cell
Biol. 33:1333-1342.
Bradley, D. J., Towle, H. C. and Young Ill, W. S. (1992).
Spatial and temporal expression of t~ and 13thyroid
hormone receptor mRNAs, including the 132 subtype, in the developing mammalian nervous system.
J. Neurosci. 12:2288-2302.
Bradley, D.J., Young, W. S. Ill and Weinberg, C.
(1987). Differential expression of ~ and 13thyroid
hormone receptor genes in rat brain and pituitary.
Proc. NatI Acad. Sci. USA 86:1-6.
Brady, S. T. (1988). Cytotypic specialization of the
neuronal cytoskeleton and the cytomatrix. In: Celhdar and Molecular Aspects of Neural Development and Regeneration, pp. 311-331. eds Goria,
A. et al. Springer-Verlag, New York.
Brent, G. A., Moore, D. D. and Larsen, E R. (1991).
Thyroid hormone regulation of gene expression.
Annu. Rev. Physiol. 53:17-35.
Burgoyne, R.D., Cambray-Deakin, M. A., Lewis,
S.A., Sarkar, S. and Cowan, N.J. (1988). Differential distribution of tubulin isotypes in cerebellum. EMBO J. 7:2311-2319.
Chaudhari, N. and Hahn, W. E. (1983). Genetic expression in the developing brain. Science 220:924-928.
Chin, W. W. (1992). Current concepts of thyroid
hormone action: progress notes for the clinician.
Thyroid Today 3:1-9.
Cleveland, D. W. (1989). Autoregulated control oftubulin synthesis in animal cells. Curr. Opinion Cell
Biol. 1:10-14.
Cleveland, D. W., Monteiro, M. J., Wong, P. C., Gill,
S. R., Gearhart, J. D. and Hoffman, P. N. (1991).
Involvement of neurofilaments in the radial growth
of axons. J. Cell Sci. 15:85-95.
Codaccioni, J.L., Carayon, P., Michel-Bechet, M.,
Foucault, F., Lefort, G. and Pierron, H. (1980).
Congenital hypothyroidism associated with thyrotropin unresponsiveness and thyroid cell membrane
alterations. J. Clin. Endocrinol. Metab. 50:932937.
Conel, J. L. (1938-42). The Postnatal Development of
the Human Cerebral Cortex, Vols I-VII. Harvard
University Press, Cambridge, MA.
Corthesy-Theulaz, I., Merillat, A. M., Honegger, P.
and Rossier, B. C. (1991). Differential regulation
of Na-K-ATPase isoform gene expression by T3
341
during rat brain development. Am. J. Physiol.
261:C124-131.
Cowan, N. J. and Dudley, L. (1983). Tubulin isotypes
and the multigene tubulin families. Intl Rev. Cytol.
85:147-173.
Crawford, I. and Stein, S. A. (1992). Audiogenic
seizures in the hypothyroid hyt/hyt mouse. American
Epilepsy Society.
Cumming, D. W., Burgoyne, R. D. and Lytton, N. A.
(1983). Axonal sub-populations in the central nervous system demonstrates using monoclonal antibodies against o~-tubulin. Eur. J. Cell Biol. 31:241248.
De Esbobar, G., Ruiz de Ona, C., Obregon, M. J. and
Escobar del Rey, E (1989). Models of fetal iodine
deficiency. In: Iodine and the Brain, pp. 187-202.
eds Delong, G. R., Robbins, J. and Condliffe, P. G.
Plenum Press, New York.
deMeyer, W. (1967). Ontogenesis of the rat corticospinal tract. Arch. Neurol. 16:203-21l.
de Waegh, S. and Brady, S. T. (1990). Altered slow
axonal transport and regeneration in a myelindeficient mutant mouse: the trembler as in vivo
model for Schwann cell-axon interactions. J. Neurosci. 10:1855-1865.
Diamond, D. J. and Goodman, H. M. (1985). Regulation of growth hormone messenger RNA synthesis
by dexamethasone and triiodothyronine:
transcriptional rate and mRNA stability changes in
pituitary tumor cells. J. Mol. Biol. 181:41-62.
Donatelle, J. M. (1977). Growth of the corticospinal
tract and the development of placing reactions in
the postnatal rat. J. Comp. Neur. 175:207-232.
Dryja, T. P., Hahn, L. B., Crowley, G. S., McGee, T. L.
and Berson, E. L. (1991 ). Mutation spectrum of the
rhodopsin gene among patients with autosomal
dominant retinitis pigmentosa. Proc, Natl Acad.
Sci. USA 88:9370-9374.
Eayrs, J. T. (1955). The cerebral cortex of normal and
hypothyroid rats. Acta Anat. 25:160-183.
Eayrs, J. T. (1968). Developmental relationships
between brain and thyroid. In: Endocrinology and
Human Behavior.
Farmer, C., Robinson, G., Mbangkollo, D., Bond, J.,
Knight, G., Fenton, M. and Berkowitz, E. (1986).
Differential expression of the tubulin multigene
family during rat brain development. Ann. NYAcad.
Sci. 466:41-50.
Farsetti, A., Mitsuhashi, T., Desvergne, B., Robbins, J.
and Nikodem, V. M. (1991). Molecular basis of
thyroid hormone regulation of myelin basic protein
342
Advances in Neuroimmunology
gene expression in rodent brain. J. Biol. Chem.
266:23226-23232.
Fernyhough, E, Mill, J. E, Roberts, J. L. and Ishii,
D. N. (1989). Stabilization of tubulin mRNAs by
insulin and insulin-likegrowth factor I during neurite formation. Mol. Brain Res. 6:109-120.
Foley, T. (1991). Congenital hypothyroidism. In: Adv.
Peri. Thyroid, pp. 209-266, eds Bercu, B. and Shulman, D. Plenum Press, New York.
Fox, S. R. and Pfaff, D. (1987). Differential expression within neurons and glia of mRNA encoding a
putative thyroid hormone receptor (cErbA1). Soc.
Neurosci. Abstr. 13:376.
Fuggle, E W. (1991). Intelligence, motor skills and
behavior in early-treated congenital hypothyroidism. Eur. J. Ped. 150:570-574.
Garza, R., Dussault, J. H. et al. (1988). Influence of
triiodotfiyronine on the morphological and
biochemical development of fetal brain
acetylcholinesterase-positiveneurons cultured in a
chemically defined medium. Dev. Brain Res.
43:287-297.
Germain, D. L. St. and Galton, V. A. (1983). Comparative study of pituitary thyroid hormone economy in
fasting and hypothyroid rats. J. Clin. Invest. 75:679688.
Giroud, M., Tenenbaum, D., D'Athis, P. D., Dumas, R.
and Nivelon, J. L. (1988). L' exploration neurophysiologique des nerfs peripheriques des nouveax-nEs
porters d'une hypothyroidie congenitale. Arch. Fr.
Pediatr. 45:175-179.
Glorieux, J., Dussault, J. and Van Vnet, G. V. (1992).
Intellectual development at age 12 years of children
with congenital hypothyroidism by neonatal screening. J. Ped. 121:581-584.
Gordon-Weeks, P. R. (1991). Control of microtubule
assembly in growth cones. J. Cell Sci. 15:45-49.
Gottesfeld, Z., Garcia, C.J. and Chronister, R.B.
(1987). Perinatal, not adult, hypothyroidism suppresses dopaminergic axon sprouting in the deafferented olfactory tubercle of adult rat. J. Neur. Res.
18:568-573.
Gould, E. and Butcher, L. L. (1989). Developing cholinergic basal forebrain neurons are sensitive to thyroid
hormone. J. Neurosci. 9:3347-3358.
Gu, W-X., Du, G-G., Kopp, E, Rentoumis, A., Albanase, C., Kohn, L. D., Madison, L. D. and Jameson, J. L. (1995). The thyrotropin (TSH) receptor
transmembrane domain mutation (Pro556-Leu) in
the hypothyroid hyt/hyt mouse results in plasma
membrane targeting but defective TSH binding.
Endocrinology 136:3146-3153.
Hammerschlag, R., Cyr, S. L. and Brady, S. T. (1994).
Axonal transport and the neuronal cytoskeleton. In:
Basic Neurochemistry: Molecular, Celhdar, and
MedicalAspects, pp. 545-572, 4th Edn, eds Siegel,
G. J. et al. Raven Press, New York.
Hargreaves, A., Yusta, B., Aranda, A., Avila, J. and
Pascual, A. (1988). Triiodothyronine (T3) induces
neurite formation and increases synthesis of a
protein related to MAP IB in cultured cells of neuronal origin. Dev. Brain Res. 38:141-148.
Hoffman, R N., Thompson, G., Griffin, J. and Price,
D. (1985). Changes in neurofilament transport
coincide temporally with alteration in the caliber of
axons in regenerating motor fibers. J. Cell Biol.
101:1332-1340.
Hoyle, H. D. and Raft, E. C. (1990). Two drosophila
beta tubulin isoforms are not functionally
equivalent. J. Cell Biol. 111:1009-1026.
llaria, R., Wines, D., Pardue, S., Jamison, S., Ojeda,
S.R., Snider, J. and Morrison, M.R. (1985). A
rapid microisolation procedure for isolation RNA
from multiple samples of rat and human brain. J.
Neurosci. Meth. 15:165-174.
lniguez, M. A., Rodriguez-Pena, A., Ibarrola, N., Aguilera, M., Munoz, A. and Bernal, J. (1993). Thyroid
hormone regulation of RC3, a brain-specific gene
encoding a protein kinase-C substrate. Endocrinology 133:467-473.
Ipina, S. L., Ruiz-Marcos, A., Escobar del Rey, E and
Morealle de Escobar, G. (1987). Pyramidal cell
morphology studied by multivariate analysis: effects
of neonatal thyroidectomy, aging and thyroxinesubstitution therapy. Dev. Brain Res. 37:219-229.
Jeantet, C. and Gros, F. (1981). One tubulin subunit
accumulates during neurite outgrowth in mouse
neuroblastoma cells. Biochem. Biophys. Res. Commun. 103:1035-1043.
Jones, E. G., Schreyer, D. J. and Wise, S. E (1982).
Growth and maturation of the rat corticospinal tract.
Prog. Br. Res. 57:361-379.
Joshi, H. C. and Cleveland, D. W. (1990). Diversity
among tubulin subunits: toward what functional
end? Cell Motil. Cytoskel. 16:159-163.
Joshi, H. C., Yen, T. Y. and Cleveland, D. W. (1987).
In vivo coassembly of a divergent [3 tubulin subunits (cB60) into microtubules of different function. J. Cell Biol. 105:2179-2190.
Kedzierski, W. and Porter, J. C. (1990). Quantitative
Biology of the congenitally hypothyroid hyt/hyt mouse
study of tyrosine hydroxylase mRNA in catecholaminergic neurons and adrenals during development and aging. Mol. Brain Res. 7:45-51.
Klein, R. Z. (1985). Infantile hypothyroidism then and
now: the results of neonatal screening. Curt Prob.
Ped. 15:1-58.
Koolstra, L., Laane, C., Vulsma, T., Schenekens, J. M.
H., vad der Meerre, J. J. and Dalverboer, A. E
(1994). Motor and cognitive development in
children with congenital hypothyroidism. J. Pediat.
124:903-909.
Laksmanan, M. H., Mansfield, M., Weischel, M. E. Jr.,
Hoath, S., Scott, S., Shapshak, P. and Fisher, D. A.
(1981). Neonatal hypothyroidism-- a biochemical
disorder of ~-tubulin metabolism. Biochem. Biophys. Res. Commun. 100:1587-1596.
Lasek, R. J. (1988). Studying the intrinsic determinants
of neuronal form and function. In: Intrinsic
Determinants of Neuronal Form and Function,
pp. 3-58, ed. Lasek, R. J., A. R. Liss, Inc., New
York.
Latronico, A. C., Anasti, J., Arnhold, I. J. P., Mendoca,
B. B., Domenice, S., Albano, M. C., Zachman, A. K.
and Wajchenberg, B. L. (1995). A novel mutation
of the luteinizing receptor gene causing male
gonadotropin-independent precocious puberty. J.
Clin. Endocr. Metab. 80:2490-2494.
Lauder, J. M. (1989). Thyroid influences on the
developing cerebellum and hippocampus of the rat.
In: Iodine and the Brain, eds Delong, G. R., Robbins, J. and Condliffe, P. G., pp. 70-90. Plenum
Press, New York.
Laureau, E., Vanasse, M., Hebert, R., Letarte, J., Glorieux, J., Desjardins, M. and Dussault, J. H. (1986).
Somatosensory evoked potentials and auditory
brainstem responses in congenital hypothyroidism.
Electro. Clin. Neuro. 64:501-510.
Lazar, M.A. (1993). Thyroid hormone receptors:
multiple forms, multiple possibilities. Endocr. Rev.
14:184-193.
Legrand, J. (1982-83). Hormones thyroidiennes et
maturation du systeme nerveux. J. Physiol. Paris
78:603-652.
Lee, G., Neve, R. L. and Kosik, K.S. (1989). The
microtubule binding domain of tau protein. Neuron
2:1616-1624.
Lewis, S. A. and Cowan, N. J. (1988). Complex regulation and functional versatility of mammalian a- and
b tubulin isotypes during the differentiation of testis
and muscle cells. J. Cell. Biol. 106:2023-2033.
Lewis, S. A., Lee, M. G. and Cowan, N. J. (1985).
343
Five mouse tubulin isotypes and their regulated
expression during development. J. Cell Biol.
101:852-861.
Lewis, S. A., Sherline, P. and Cowan, N. J. (1986). A
cloned cDNA encoding MAP 1 detects a single copy
gene in mouse and grain-abundant RNA whose
level decreases during development. J. Cell Biol.
102:2107-2114.
Luduena, R. E (1993). Are tubulins isotypes functionally significant? Mol. Biol. Cell 4:445-457.
Luduena, R. E, Roach, M. C., Lee, M. K., Banerjee,
A., Trcka, E E, Frankfurter, A. and Bulinski, J. C.
(1989). Are certain cy,/13combinations preferred in
formatting the tubulin heterodimer? J. Cell Biol.
109 (abstract): 338a#1861.
Mackay-Sim, A. and Beard, M. D. (1987). Hypothyroidism disrupts neural development in the olfactory epithelium of adult mice. Dev. Brain Res.
36:190-198.
Macfaul, R., Borner, S., Brett, E. M. and Grant, D. B.
(1978). Neurological abnormalities in patients
treated for hypothyroidism from early life. Arch.
Dis. Child. 53:611-619.
Mandelkow, E. and Mandelkow, E. M. (1989). Microtubular structure and polymerization. Curr. Opin.
Cell Biol. 1:5-9.
Mansfield, S. G., Diaz-Nido, J., Gordon-Weeks, P. R.
and Avila, J. (1992). The distribution and phosphorylation of the microtubule-associated protein
MAP1B in growth cones. J. Neurocytol. 21:10071022.
Mansfield, S.G. and Gordon-Weeks, P.R. (1991).
Dynamic posttranscriptional modification of tubulin in rat cerebral cortical neurons extending neurites in culture: effects of taxol. (1991) J. Neurocytol.
20:654-666.
Marinesco, M. G. (1924). Contribution a l'etude des
lesions du myxoedeme congenital. Encephale
19:265-293.
Marc, C., Clavel, M. and Rabie, A. (1986). Nonphosphorylated and phosphorylated neurofilaments in the cerebellum of the rat: an
immunocytochemical study using monoclonal
antibodies, development in normal and thyroiddeficient animals. Dev. Brain Res. 26:249-260.
Mary, J., Redeker, V., Le Caer, J., Prome, J. and Rossier,
J. (1994). Class I I] tubulin isotype in mouse brain
is glutamylated FEBS Letts 353:89-94.
Matus, A. (1988). Microtubule-associated proteins:
their potential role in determining neuronal
morphology. Ann. Rev. Neurosci. 11:29-44.
344
Advances in Neuroimmunology
Medeiros-Neto, G. A., Knobel, M., Bronstein, M. D.,
Simonetti, J., Filho, E E and Mattar, E. (1979).
Impaired cyclic-AMP response to thyrotropin in
congenital hypothyroidism with thyroglobulin
deficiency.Acta Endocrinol. (Copenhagen) 92:6272.
Miller, M. W. (1987). The origin of corticospinal projection neurons in rat. Exp. Brain Res. 67:339-351.
Miller, M. W. (1988). Development of projection and
local circuit neurons in neocortex. In: Cerebral
Cortex, Vol. 7: Development and Maturation of the
Cerebral Cortex, eds Peters, A. and Jones, E. G.,
pp. 133-175. Plenum, New York.
Miller, E D., Naus, C. C., Durand, M., Bloom, E E.
and Miller, R. J. (1987). Isotypes of ~-tubulin are
differentially regulated during neuronal maturation. J. Cell Biol. 105:3065-3073.
Mitchison, T. and Kirschner, M. (1988). Cytoskeletal
dynamics and nerve growth. Neuron 1:761-772.
Morris, J. C. (1996). Editorial: activating mutation of
the thyrotropin receptor - - unanswered questions.
J. Clin. Endocr. Metab. 81:2121-2022.
Munoz, A., Rodriguez-Penz, A., Perez-Castillo, A.,
Sutcliffe, J. G., Bernal, J. and Ferrerio, B. (1991).
Effects of neonatal hypothyroidism on rat brain
gene expression. Mol. Endocrinol. 5:273-280.
Nagayama, Y. and Rapoport, B. (1992). The thyrotropin receptor 25 years after its discovery: new insights
after its molecular cloning. Mol. Endocrinol. 6:145156.
Narayana, C. H. and Narayanan, Y. (I 985). Cell formation in the motor nucleus and mesencephelic nucleus
of the trigeminal nerve of rats made hypothyroid by
propylthiouracil. Exp. Brain Res. 59:257-266.
Narayanan, T. and Towle, H. C. (1985). Stabilization
of a nuclear mRNA precursor by thyroid hormone.
Mol. Cell. Biol. 5:2643-2646.
New England Congenital Hypothyroidism Collaborative (1985). Neonatal hypothyroidism screening:
status of patients at 6 years of age. J. Ped. 107:915919.
New England Congenital Hypothyroidism Collaborative (1990). Elementary school performance of
children with congenital hypothyroidism. J. Ped.
116:27-32.
Noguchi, T. (1988). Brain development in dwarf mice.
Progr. Neurobiol. 31:149-170.
Noguchi, T., Kudo, M., Sugisaki, T. and Satoh, I. (1986).
An immunocytochemicaland electron microscopic
study of the hyt mouse anterior pituitary gland. J.
Endroc rinol. 109:163-168.
Nunez, J., Couchie, D. and Brion, J. E (1989). Microtubule assembly: regulation by thyroid hormones.
In: Iodine and the Brain, eds Delong, G. R., Robbins, J. and Condliffe, E G., pp. 103-112. Plenum
Press, New York.
Pachter, S., Yen, T. J. and Cleveland, D.W. (1987).
Autoregulation of tubulin expression is achieved
through specific degradation of polysomal tubulin
mRNAs. Cell 51:283-292.
Panda, D., Miller, H. E, Banerjee, A., Luduena, R. E
and Wilson, L. E (1994). Microtubule dynamics in
vitro are regulated by the tubulin isotype composition. J. Cell Biol. 91:11358-11362.
Paschal, B. M., Obar, R. A. and Vallee, R. B. (1989).
Interaction of brain cytoplasmic dynein and MAP2
with common sequence at the C-terminus of tubufin. Nature 342:569-572.
Paternostro, M. and Meisami, E. (1989). Selective effect
of thyroid hormonal deprication on growth and
development of olfactory receptor sheet during the
early postnatal period: a morphometric and cell count
study in the rat. Int. J. Dev. Neurosci. 7:243-255.
Porterfield, S. E and Hendrich, C. E. (1991). The thyroidectomized pregnant rat: an animal model to
study fetal effects of maternal hypothyroidism. In:
Advances in Perinatal Thyroidology, pp. 107-132,
eds Bercu, B. B. and Shulman, D. I. Plenum, New
York.
Porterfield, S. E and Stein, S. A. (1994). Thyroid
hormones and neurological development: update
1994. Endocr. Rev. 3:357-363.
Quirin-Stricker, C., Nappey, V., Simoni, P., Toussaint,
J.L. and Schmitt, M. (1994). Transactivation by
thyroid hormone receptors of the 5x flanking region
of the human ChAT gene. Mol. Brain Res. 23:53-65.
Rami, A., Patel, A. J. and Rabie, A. (1986a). Thyroid
hormone and development of the rat hippocampus:
cell acquisition in the dentate gyrus. Neurosci.
4:1207-1216.
Rami, A., Patel, A. J. and Rabie, A. (1986b). Thyroid
hormone and development of the rat hippocampus:
morphological alterations in granule and pyramidal
cells. Neurosci. 4:1217-1226.
Rasool, C. G., Bradley, W. G. and Reichlin, S. (1985).
Reduced axoplastic somatostatin transport in
hypothyroid rats. J. Neurochem. 45:973-976.
Rochiccioli, E, Alexandre, E and Roge, B. (1989).
Neurological development in congenital hypothyroidism. In: Research in Congenital ttypothyroidism, pp. 301-310, eds Delange, E etal. Plenum
Press, New York.
Biology of the congenitally hypothyroid hyt/hyt mouse
Rochiccioli, R, Roge, B., Alexandre, E and Tauber,
M. T. (1992). School achievement in children with
hypothyroidism detected at birth and search for
predictive factors. Horm. Res. 38:236-240.
Rosman, N.P. (1976). Neurological and muscular
aspects of thyroid dysfunction in childhood. Ped.
Clin. NA. 23:575-594.
Rovet, J., Ehrlich, R. and Sorbara, D. (1987). Intellectual outcome in children with fetal hypothyroidism. J. Ped. 110:700-704.
de Roux, N., Polak, M., Couet, J., Leger, J., Czernichow, P., Milgrom, E. and Misrahi, M. (1996). A
new mutation of the thyroid-stimulating hormone
receptor in a severe neonatal hyperthyroidism. J.
Clin. Endocr. Metab. 81:2023-2026.
Ruiz-Marcos, A. (1989). Quantitative studies of the
effects of hypothyroidism on the development of
the cerebral cortex. In: Iodine and the Brain, eds
Delong, G, R., Robbins, J. and Condliffe, P. G.,
pp. 91-102. Plenum Press, New York.
Sarlieve, L. L., Bouchon, R., Koehl, C. and Nescovic,
N. M. (1983). Cerebroside and sulfatide biosynthesis in the brain of small dwarf mouse: effects of
thyroxine and growth hormone in the early postnatal
period. J. Neurochem. 40:1058-1062.
Schoenfeld, T. A., McKerracher, L., Obar, R. and Vallee, R. B. (1989). MAP1Aand MAP1B are structurally related microtubule associated proteins with
distinct developmental patterns in the CNS. J. Nearosci. 9:1712-1730.
Schreyer, D. J. and Jones, E. G. (1982). Growth and
target finding by axons of the corticospinal tract in
prenatal and postnatal rats. Neuroscience 7:18731853.
Shanklin, D. R. and Stein, S. A. (1988). The ultrastructural component phasing of developing fetal and
early neonatal mouse thyroid cells. FASEB J.
2:A394.
Shenker, A., Lane, L., Kosugi, S., Merendino Jr, J. J.,
Minegishi, T. and Cutler Jr, G.B. (1993). A
constitutively activating mutation of the luteinizing hormone receptor in familial male precocious
puberty. Nature 365:652-654.
Sher, E. S., Xu, X. M., Adams, P. M. and Stein, S. A.
(1997). The effects of thyroid hormone level are the
targets for the actions of polychlorinated biphenyl
and dioxins. Toxicology and Industrial Health (in
press).
Siegrist-Kaiser, C. A., Juge-Aubry, C., Tranter, M. P.,
Ekenbarager, D.M. and Leonard, J. L. (1990).
Thyroxine-dependent modulation of actin
345
polymerization in cultured astrocytes. J. Biol. Chem.
265:5296-5302.
Sidman, R. L. and Rakic, E (1974). Development of
the human central nervous system. In: Histology
and Histopathology of the Nervous System, eds
Haymaker, W. and Adams, R. D., pp. 3-145.
Smith, S. J. (1988). Neuronal cytomechanics: the actin
based motility of growth cones. Science 242:708715.
Spiegel, A. M. (1996). Genetic basis of endocrine
disease. Mutations in G proteins and G proteincoupled receptors in endocrine disease. J. Clin.
Endocrinol. Metab 81:2434-2342.
Stanbury, J. B. (1968). Congenital hypothyroidism with
impaired thyroid response to thyrotropin. New Engl.
J. Med. 279:1132-1136.
Stein, S. A., Adams, P. M., Shanklin, D. R., Mihailoff,
G. A. and Palnitkar, M.B. (1989a). Thyroid
hormone regulation of specific mRNAs in developing brain. In: Iodine and the Brain, eds Delong,
G. R., Robbins, J. and Condliffe, P. G., pp. 59-78.
Plenum Press, New York.
Stein, S. A., Adams, P. M., Shanklin, D. R. and Palnitkar, M. B. (1991c). Thyroid hormone control of
brain and motor development: molecular, neuroanatomical, and behavioral studies. In: Advances in
Perinatal Thyroidology, eds Bercu, B. and Shulman, D., pp. 47-101. Plenum Press, New York.
Stein, S. A., Kirkpatric, L. L., Shanklin, D. R. and
Adams, P. M. (1993). Hypothyroidism affects the
neuronal cytoskeleton and neuronal process growth
at multiple levels: models of thyroid hormone action
generated with the hyt/hyt mouse cerebral cortex
and optic nerve. Proc. lntl Thyroid Congress,
pp. 881-890, eds Gordon, Gross and Hennemann.
Stein, S. A., Kirkpatrick, L. L., Shanklin, D. R., Adams,
P.M. and Brady, S.T. (1991a). Hypothyroidism
reduces the rate of slow component A (SCa) axonal
transport and the amount of transported tubulin in
the hyt/hyt mouse optic nerve. J. Neurosci. Res.
28:121-133.
Stein, S. A., Mclntire, D. D., Kirkpatrick, L. L., Adams,
P.M. and Brady, S. T. (1991b). Hypothyroidism
selectively reduces the rate and amount of transport
for specific SCb proteins in the hyt/hyt mouse optic
nerve. J. Neurosci. Res. 30:28-41.
Stein, S. A., Oates, E. L., Hall, C. R., Grumbles, R. M.,
Fernandez, L. M., Taylor, N. A., Puett, D. and Jin,
S. (1994a). Identification of a point mutation in the
thyrotropin receptor of the hyt/hyt hypothyroid
mouse. Mol. Endocrinol. 8:129-138.
346
Advances in Neuroimmunology
Stein, S. A., Shanklin, D. R., Krulich, L., Roth, M. G.,
Chubb, C. M. and Adams, P. M. (1989b). Evaluation and characterization of the hypothyroid hyt/hyt
mouse. II: abnormalities of TSH and the thyroid
gland. Neuroendocrinology 49:509-519.
Stein, S. A., Zakarija, M., McKenzie, J. M., Shanklin,
D. R., Palnitkar, M. andAdams, R M. (1991d). The
site of the molecular defect in the thyroid gland of
the hyt/hyt mouse: abnormalities in the TSH
receptor-G protein complex. Thyroid 1:257-266.
Stein, S. A. (1994). Molecular and neuroanatomical
substrates for abnormal motor behavior and cognitive dysfunction in fetal thyroid disorders. In: The
Damaged Brain and Iodine Deficiency, ed. Stanbury, J. B., pp. 67-109. Cognizant Communication
Corp., Elmsford, New York.
Stein, S.A. (1988). 9A6 mRNA, a mouse and rat
thyroid regulated brain mRNA. Soc. Neuro. Abst.
14:1326.
Strait, K. A., Schwartz, H. L., Perez-Castillo, A. M. and
Oppenheimer, J. H. (1990). Relationship of c-erbA
mRNA content to tissue triiodothyronine nuclear
bindingcapacity and function in developing and adult
rats. J. BioL Chem. 265:10514-10521.
Sullivan, K. E (1988). Structure and utilization oftubulin isotopes. Ann. Re~: Cell. Biol. 4:687-716.
Sunthornthepvarakul, T., Gottshalk, M. E., Hayashi,
Y. and Refetoff, S. (1995). Resistance to thyrotropin caused by mutations in the thyrotropin receptor gene. New Engl. J. Med. 332:155-160.
Takamatsu, J., Nishikawa, M., Horimoto, M. and
Ohsawa, N. (1993). Familial unresponsiveness to
thyrotropin by autosomal recessive inheritance. J.
Clin. Endocrinol. Metab 77:1569-1573.
Theodorakis, N. G. and Cleveland, D. (1992). Physical evidence for cotranslational regulation of
[3-tubulin mRNA degradation. Mol. Cell. Biol.
12:791-799.
Tucker, R. R (1990). The roles of microtubuleassociated proteins in brain morphogenesis. Brain
Res. Rev. 15:101-120.
Vallee, R. B. and B loom, G. S. (1984). High molecular
weight microtubule-associated proteins (MAPs).
Modern Cell Biol. 3:21-75.
Van Sande, J., Parma, J., Tonacchere, M., Swillens,
S., Dumont, J. and Vasart, G. (1995). Genetic
basis of endocrine disease. Somatic and germline
mutations of the TSH receptor gene in thyroid
diseases. J. Clin. Endocrinol. Metab. 80:25772585.
Vassart, G., Parma, J., van Sande, J. and Dumont, J. E.
(1994). The thyrotropin receptor and the regulation
of thyrocyte function and growth: update 1994.
Endocrinol. Rev. 3:77-80.
Wise, S. R and Jones, E. G. (1983). Cells of origin and
terminal distribution of descending projections of
the rat somatic sensory cortex. J. Comp. Neurol.
175:129-158.
Wise, S. R, Murray, E. A. and Coulter, J. D. (1979).
Somatotopic organization of corticospinal neurons
in the rat. Neuroscience 4:65-78.
Wolter, R., Noel, R, de Cock, R, Crean, M., Ernould,
C. H., Malvau, R, Verstraeten, E, Simomns, J.,
Mertens, S. and Van Broeck, N. (1979). Neuropsychological study in treated thyroid dysgenesis. Acta
Paed. Scand. Suppl. 277:41-45.
Yen, T. J., Gay, D. A., Pachter, J. S. and Cleveland,
D. W. (1988). Autoregulated changes in stability of
polyribosome-bound 13tubulin mRNAs are specified by the first 13 translated nucleotides. Mol. Cell.
Biol. 8:1224-1235.