International Research Journal of Biotechnology (ISSN: 2141-5153) Vol. 2(5) pp.085-092, April, 2011
Available online http://www.interesjournals.org/IRJOB
Copyright © 2011 International Research Journals
Full Length Research Paper
Molecular detection and subtyping of human influenza
A viruses based on multiplex RT-PCR assay
Witthaya Poomipak1, Piyathida Pongsiri2, Jarika Makkoch2, Yong Poovorawan2, Sunchai
Payungporn1*
1
Department of Biochemistry, Faculty of Medicine, Chulalongkorn University, Thailand
Center of Excellence in Clinical Virology, Faculty of Medicine, Chulalongkorn University, Thailand.
2
Accepted 22 April, 2011
Influenza virus infections have been causing major public health concerns worldwide. Therefore, rapid
and accurate diagnostic methods for typing and subtyping of influenza virus are crucial both for patient
management and to limit dissemination. In this study, multiplex RT-PCR was developed, optimized and
evaluated for detection, typing and subtyping of influenza viruses. The typing assay consisted of
primers specific for GAPDH (491 bp), matrix gene of influenza A (125 bp) and matrix gene of influenza B
(295 bp). The subtyping assay included primers specific for the HA gene of each subtype of influenza A
virus including H1N1 human pandemic (210 bp), H1N1 seasonal (362 bp), H3N2 seasonal (183 bp) and
avian H5N1 (127 bp). The assay yielded acceptable detection limits (104-10 copies/µL) and high
specificity for detection without any cross amplification of other respiratory viruses or other subtypes
of influenza A virus. Moreover, the assay showed 95% detection efficiency in clinical samples compared
to the real-time RT-PCR described previously. In conclusion, this multiplex RT-PCR is valuable because
of its rapidity, specificity, sensitivity, reproducibility, cost-effectiveness and acceptable detection
efficiency. Therefore, it would be feasible and attractive for large-scale detection and subtyping of
influenza virus in patients with respiratory diseases.
Key words: detection, subtyping, influenza virus, multiplex RT-PCR
INTRODUCTION
Respiratory tract infections have been raising major
concern worldwide. Every year, there have been several
reports of infection especially viral infection caused by
influenza virus (Taubenberger and Layne, 2001).
Influenza virus is a member of the family
Orthomyxoviridae containing 8 segmented genes coding
for at least 10 viral proteins (Ghedin et al., 2005). The
proteins that play important roles in classifying subtypes
of influenza virus, A, B and C, are nucleoprotein (NP) and
matrix protein (M). Several reports and studies have
shown that the major subtype of influenza virus that
causes health problems is influenza subtype A (Fleming
et al., 1995). Influenza virus A can be classified into subtypes based on hemagglutinin (HA) and neuraminidase
(NA). These two proteins which are important for viral
*Corresponding author E-mail : sp.medbiochemcu@gmail.com ,
Tel. +66 2256 4482, Fax: +66 2256 4482
infection and viral release, respectively are expressed on
the surface of viral particles. At the present time, 16
subtypes of HA and 9 subtypes of NA can be found in
naturally infected aquatic birds (Fouchier et al., 2005).
However, a few subtypes have been reported to infect
humans.
Human influenza A viruses subtypes H1N1 and H3N2
are seasonally found to infect and cause illness in
humans annually. In 2004, there was an outbreak of
highly pathogenic influenza A virus subtype H5N1 in
birds. The reports also showed that this virus can be
transmitted to mammals such as human, tiger, leopard,
domestic cat and dog (Keawcharoen et al., 2004; Tiensin,
2004; Thanawongnuwech et al., 2005; Chutinimitkul et
al., 2006; Munster et al., 2006; Williams et al., 2009.).
Moreover, the H5N1 avian influenza virus was also
reported to infect patients in Hong Kong in 2010
(Available-online-at
http://healthland.time.com/2010/11/18/bird-flu-pops-up-
086 Int. Res. J. Biotechnol.
again-in-hong-kong-is-a-pandemic-on-its-way/). In April
2009, the large outbreak of the human pandemic
influenza A virus subtype H1N1 (pH1N1) started in
Mexico and spread all over the world causing several
deaths and illness (Dawood et al., 2009). Molecular
research on the human pandemic influenza virus showed
that this virus has evolved from genetic reassortment
among human, swine and avian influenza A virus strains.
(Garten et al., 2009)
Influenza infection causes several signs of illness
including coughing, sneezing, nasal congestion, running
nose, fever, pneumonia and diarrhea. Those symptoms
can be found with other viral infections as well such as
human rhinoviruses (HRV), human metapneumovirus
(hMPV), respiratory syncytial virus (RSV), adenoviruses
(ADV), and parainfluenza viruses (PIV) so that laboratory
confirmation of specific viral infection is crucial. In the
present, there are several methods available for detecting
influenza
A
virus
such
as
virus
isolation,
immunofluorescence
assay
(IFA),
enzyme-linked
immunosorbent assay (ELISA), hybridization, polymerase
chain reaction (PCR) and real-time PCR. The virus
isolation method is laborious and time consuming while
IFA and ELISA yield lower sensitivities. Molecular
methods are reliable because these techniques provide
high specificity and sensitivity for virus detection. Among
those techniques, reverse transcription-polymerase chain
reaction (RT-PCR) is commonly used for detection of
influenza A virus due to its high efficiency. Usually, RTPCR yields high sensitivity and specificity, is less time
consuming and more cost effective for detection and
thus, this technique has been developed for specific
detection of influenza viruses by converting the RNA
template into complementary DNA (cDNA) and then
amplifying the cDNA in a single tube. Besides RT-PCR,
multiplex RT-PCR has also been developed for multiple
target gene detection and subtyping of influenza virus
(Elnifro et al., 2000; Payungporn et al., 2006)
The advantage of multiplex RT-PCR is that this assay
comprises more than one primer set in a single reaction
for detecting the presence of multiple target genes.
Previous studies described multiplex RT-PCR methods
for influenza virus detection in several objectives
including subtyping of H5N1 avian influenza A virus
(Payungporn et al., 2004), subtyping of H7 and H9 avian
influenza A virus (Thontiravong et al., 2007) and typing of
A/B or subtyping of H1/H3/H5 (Boonsuk et al., 2008).
However, the human pandemic influenza A virus was
emerged in 2009 and continue to infect in human
population at the present times. Moreover, naturally
influenza virus has high rate of mutation within its
genomic RNA that may cause mismatches between
primers from previous studies and the target gene of
current outbreak influenza viral strain resulting in
misdiagnosis. Therefore, the aim of this study was to
develop an update method based on multiplex RT-PCR
for typing (influenza A and influenza B) and subtyping of
influenza A virus that potentially infect to human at the
present time (pH1N1, seasonal H1N1, seasonal H3N2
and avian H5N1 subtypes). Two multiplex RT-PCR
assays were developed for typing and subtyping of
influenza virus. The multiplex RT-PCR for typing assay
included glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) as the house-keeping gene, matrix (M1) gene
of influenza A, matrix (M1) gene of influenza B. For
subtyping assay, the multiplex RT-PCR for subtyping of
influenza A virus includes the human pandemic (pH1N1),
human seasonal (sH1N1), human seasonal (H3N2) and
avian influenza viruses (H5N1). The multiplex RT-PCR
assays developed in this study were evaluated in terms
of specificity, accuracy and detection limit to ensure the
efficiency of the technique.
MATERIALS AND METHODS
Specimens for evaluation
Nasopharyngeal suction samples (n=100) collected from
patients with respiratory tract disease admitted to
Bangpakok 9 International Hospital Thailand during 20092010 were used for the evaluation of the multiplex RTPCR assay. Moreover, known samples positive for
influenza B virus (N=10), H1N1 seasonal human
influenza A virus (N=20), H3N2 seasonal influenza A
virus (N=20), H1N1 human pandemic influenza A virus
(N=40) and H5N1 avian influenza A virus (N=20) were
used for positive specificity test. In addition, positive
samples for other subtypes of influenza A viruses (H2, H4
and H6-H15) and other respiratory viruses including
human rhinovirus (N=1), human metapneumovirus (N=1),
human bocavirus (N=4), adenovirus (N=2), parainfluenza
virus (N=1), respiratory syncytial virus (N=6) and WU/KI
polyomaviruses (N=4) were used for negative specificity
test. The specimens were processed immediately upon
arrival. RNA extraction was performed using the Viral
Nucleic Acid Extraction Kit (RBC Bioscience Co, Taipei,
Taiwan) according to the manufacturer’s specifications.
All experiments were performed in a Bio-safety Level 2
plus (BSL2+) laboratory at the Center of Excellence in
Clinical Virology, Faculty of Medicine, Chulalongkorn
University, Bangkok, Thailand. This study has been
approved by the ethics committee, faculty of medicine,
Chulalongkorn University.
Primer design
Nucleotide sequences (N>100) of the matrix (M1) and
hemagglutinin (HA) genes were taken from the Influenza
Virus
Resource
of
the
NCBI
database
(http://www.ncbi.nlm.nih.gov/genomes/FLU/FLU.html).
The M1 genes of the 2005 to 2010 influenza A and
Poomipak
et al. 087
Table1. Primer sets used for typing and subtyping of influenza virus
System
Target
GAPDH
Typing
Subtyping
Flu A
M gene
Flu B
M gene
H1 pandemic
HA gene
H1 seasonal
HA gene
H3 seasonal
HA gene
H5 avian
HA gene
Primer
Sequence (5'→3')*
GAPDH_F
GAPDH_R
FluA_M_F
FluA_M_R
FluB_M_F
FluB_M_R
pH1_F
pH1_R
sH1_F
sH1_R
sH3_F
sH3_R
aH5_F
aH5_R
GTGAAGGTCGGAGTCAACGG
GTTGTCATGGATGACCTTGGC
CATGGARTGGCTAAAGACAAGACC
AGGGCATTYTGGACAAAKCGTCTA
ATGTCGCTGTTTGGAGACACAAT
TCAGCTAGAATCAGRCCYTTCTT
CTTGTCAGACACCCAAGGGTG
CATCCATCTACCATCCCTGTCCA
CTTAGGAAACCCAGAATGCG
ACGGGTGATGAACACCCCA
TGCTACTGAGCTGGTTCAGAGT
AGGGTAACAGTTGCTGTRGGC
AACAGATTAGTCCTTGCGACTG
CATCTACCATTCCCTGCCATCC
Nucleotide
position
112-132
603-582
151-175
276-253
25-47
320-298
916-936
1126-1104
266-285
627-609
194-215
377-357
1001–1026
1128–1108
Size
(bp)
491
125
295
210
361
183
127
*Degeneracy bases: K=G/T; R=A/G; Y= C/T
influenza B viruses were subjected to multiple alignments
using the BioEdit Sequence Alignment Editor Software
version-7.0-(http://www.mbio.ncsu.edu/
BioEdit/bioedit.html). Then the specific primers targeting
the M1 gene of influenza A and influenza B viruses were
selected for typing of influenza virus. The HA genes of
the 2005 to 2010 human pandemic (pH1), human
seasonal (H1), human seasonal (H3) and avian influenza
(H5) were multiple aligned and specific primers were
selected for subtyping of influenza A viruses.
Primers
were analyzed for secondary structure formation using
the primer design software (OLIGOS Version 9.1 by
Ruslan Kalendar, Institute of Biotechnology, University of
Helsinki, Finland). Primers for GAPDH detection have
been published previously (Boonsuk et al., 2008). The
primers used in this study are summarized in table 1.
Construction of positive control plasmids
RNA extracted from samples previously identified as
influenza B virus [strain B/Thailand/CU243/2006], human
seasonal influenza A virus [strains A/Thailand/CU41/2006
(H1N1) & A/Thailand/CU46/2006 (H3N2)] human
pandemic influenza A virus [strain A/Thailand/CUH340/2009 (H1N1) were used as a template for reverse
transcription and polymerase chain reaction by using the
primers shown in table 1. The resulting PCR products
were separated by 2% agarose gel electrophoresis and
purified using the Perfect Prep Gel Cleanup Kit
(Eppendorf, Hamburg, Germany). The purified products
were inserted into the pGEM-T Easy Vector System
(Promega, Madison, WI) by TA-cloning methodology
according to the manufacturer’s instruction. The
recombinant plasmid was introduced into competent cells
(E. coli strain DH5α) by heat shock (42°C for 45 sec)
transformation. The positive white colonies were selected
and cultured in 2 ml of LB broth containing 100 µg/ml of
amplicillin by overnight incubation at 37°C. Plasmids
were extracted using the Fast Plasmid Mini Kit
(Eppendorf,
Hamburg,
Germany)
following
the
manufacturer’s recommendation. All plasmids were
subjected to nucleotide sequencing to ensure the correct
target sequences.
In vitro transcribed RNA
Each positive control plasmid was used as a template for
in vitro transcription. RNA was in vitro transcribed by
using the SP6/T7 Transcription Kit (Roche, Germany)
according to the manufacturer’s specification. The
resulting RNA was extracted with phenol/chloroform
followed by ethanol precipitation. These RNAs were used
as positive controls for optimization of the real-time RTPCR assay. The concentrations of in vitro transcribed
RNA were determined by spectrophotometer at 260 nm.
The copy numbers of RNA were calculated by the
formula:
number of RNA copy (copy/µl) = [RNA
23
concentration (g/µl) × 6.02 × 10 ] / [Length of in vitro
RNA (bp) × 340]. Standard RNAs were then prepared by
10-fold serial dilution, ranging from 107 to 10 copies /µl
and used for sensitivity test.
Multiplex RT-PCR condition
The multiplex RT-PCR reaction was performed with the
superscript III Platinum One-Step RT-PCR system
088 Int. Res. J. Biotechnol.
(Invitrogen, Carlsbad, USA) in a Mastercycler personal
(Eppendrof, Hamburg, Germany). The multiplex RT-PCR
conditions were tested and optimized in terms of
annealing temperature (ranging from 58°C to 62°C)
profile, primer concentrations (ranging from 0.25-0.75
µM) and additional magnesium concentration (ranging
from 0.75 mM to 3 mM). The optimized multiplex RT-PCR
reaction mixture comprised 1 µl of RNA, 0.25 µM final
concentration of each primer, additional 2.25 mM MgSO4,
12.5 µl of 2× reaction buffer (Invitrogen, Carlsbad, CA),
0.2 µl of SuperScript III RT Platinum® Taq Mix
(Invitrogen, Carlsbad, CA) and DEPC-treated water to a
final volume of 25 µl. The optimized thermal profile
included a reverse transcription step at 50°C for 45 min.
After an initial denaturation step at 95°C for 10 min,
amplification was performed during 40 cycles including
denaturation (94°C for 30 sec), annealing (60°C for 30
sec) and extension (72°C for 40 sec) and was concluded
by a final extension step at 72°C for 7 min. After PCR
amplification, 15 µl of PCR products were mixed with
loading dye and subjected to 2% agarose gel
electrophoresis at 100 Volts for 45 min. After
electrophoresis, the agarose gel was stained with 10%
ethidium bromide solution for 10 min (FMC Bioproducts,
USA) and visualized on a UV transilluminator. The
expected sizes of each PCR product are indicated in
table 1.
Evaluation of the multiplex RT-PCR assay
The efficiency of the multiplex RT-PCR assays was
evaluated against 100 RNA samples obtained from
nasopharyngeal suction of patients with respiratory
disease. The results of typing and subtyping were
subsequently compared with the result obtained from the
real-time RT-PCR assay (Suwannakarn et al., 2008 and
CDC, 2009).
RESULT
Interpretation of Multiplex RT-PCR
For typing assay, the expected DNA bands obtained from
multiplex RT-PCR, therefore; 125 bp for the M1 gene of
influenza A virus, 295 bp for the M1 gene of influenza B
virus and 491 bp for glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) (Figure 1A). Presence of the
house keeping gene confirmed suitable specimen
collection and RNA extraction processes. If the GADPH
band was absent in a sample, this could imply
inadequate specimen collection or low integrity of the
extracted RNA. The result showed that there were 24
samples (24%) showing the GAPDH negative results. If a
sample yielded only the 491 bp band of the GAPDH
gene, this could be interpreted as negative specimen.
Samples infected with influenza B virus yielded 2 positive
bands of GAPDH gene and M1 gene of influenza B virus.
Samples infected with influenza A virus (pH1N1) yielded
2 positive bands of GAPDH gene and M1 gene of
influenza A virus. Thus, rapid diagnosis of influenza virus
typing (A/B) and detection of the house keeping gene can
be performed simultaneously in a one-step single-tube
reaction. In subtyping assay, primers specific for the HA
gene were used for specific amplification and subtyping
of influenza A viruses. Expected DNA bands for
subtyping of influenza A viruses (Figure 1B) included 210
bp for pH1N1, 361 bp for H1N1, 183 bp for H3N2 and
127 bp for H5N1. Moreover, multiple DNA bands can be
detected in samples co-infected with different subtypes of
influenza A virus.
Specificity test of multiplex RT-PCR
For positive specificity test, RNA extracted from
specimens positive for influenza B virus (N=10) or
influenza A viruses (N=100) including pH1N1 (N=40),
H1N1 (N=20), H3N2 (N=20) and H5N1 (N=20) were
amplified by the multiplex RT-PCR as a positive
specificity test. All samples were amplified as expected
by the multiplex RT-PCR assay developed for detection
and subtyping of influenza viruses (lane 4 -5 of Figure 1A
and Figure 2C).
For negative specificity test, nucleic
acids extracted from samples positive for other
respiratory viruses such as human rhinovirus (HRV),
human metapneumovirus (hMPV), human bocavirus
(HBoV), respiratory syncytial virus (RSV), adenovirus,
WU/KI polyomaviruses and parainfluenza virus (PIV)
were subjected to the multiplex RT-PCR developed for
detection of influenza virus. The result showed that only
the GAPDH gene (491 bp) was amplified (Figure 2A),
indicating that no cross amplification occurred against
other respiratory viruses when using this multiplex RTPCR system. Moreover, RNA extracted from 15 subtypes
of influenza A viruses (H1-H15) were tested with
multiplex RT-PCR for subtyping of influenza A viruses.
The results from multiplex RT-PCR showed specific
amplification of pH1N1, H1N1, H3N2 and H5N1 subtypes
(Figure 2B). Cross amplification with other subtypes of
influenza A virus by this multiplex RT-PCR system was
not observed.
Limit of detection
The result showed that the minimum template
concentration detectable by this assay were 10 copies/µl.
In the typing assay, the detection limit for the M gene of
influenza
A
virus
[strain
A/chicken/NakornPatom/Thailand/CU-K2/2004 (H5N1)], M gene of
influenza B virus (strain B/Thailand/CU243/2006) and
Poomipak
et al. 089
Figure1. Multiplex RT-PCR assay for typing and subtyping of influenza viruses by using in vitro transcribed RNA as template. The
representative pattern of PCR product size from typing system (A) included lane M=100-bp DNA marker, lane 1= positive control for
GAPDH (491 bp), lane 2= positive control for M gene of influenza A virus (125 bp), lane 3= positive control for M gene of influenza B
virus (295 bp), lane 4= represent to specimen infected with influenza A virus, lane 5= represent to specimen infected with influenza B
virus and lane 6= negative control. The pattern of PCR product obtained from subtyping system (B) of Influenza A virus consisted of
lane M= 100-bp DNA marker, lane 1= HA gene of H1N1human pandemic influenza A (210 bp), lane 2= HA gene of H1N1 seasonal
influenza A (361 bp), lane 3= HA gene of H3N2 seasonal influenza A (183 bp), lane 4= HA gene of H5N1 avian influenza A (127 bp),
lane 5= represent co-infections (pH1N1, sH1N1, H3N2 & H5N1) and lane 6= negative control.
GAPDH gene was 102, 10 and 103 copies/µl,
respectively. In the subtyping assay, the detection limit
for the HA gene of human pandemic influenza A virus
[strain A/Thailand/CU-H340/2009 (H1N1)], human
seasonal influenza A virus [strain A/Thailand/CU41/2006
(H1N1)], human seasonal influenza A virus [strain
A/Thailand/CU46/2006 (H3N2)] and avian influenza A
virus
[strain
A/chicken/Nakorn-Patom/Thailand/CUK2/2004 (H5N1)] was 10, 104, 102 and 10 copies/µl,
respectively.
Clinical evaluation
Multiplex RT-PCR for typing and subtyping was
performed on each sample. The results showed that 42
samples were positive for influenza A virus, 9 samples
were positive for influenza B virus and 49 samples were
negative. Compared to the results obtained from realtime RT-PCR described previously (Suwannakarn et al.,
2008 and CDC, 2009), the result of real-time RT-PCR
showed that 47 samples were positive for influenza A
virus, 9 samples were positive for influenza B virus and
44 samples were negative indicating that with 5 samples
there were discrepancies between multiplex RT-PCR and
the real-time RT-PCR described previously. All 5 samples
were negative by multiplex RT-PCR whereas positive for
influenza A virus (pH1N1) by real-time RT-PCR. The
results of the clinical evaluation are summarized in table
2. In conclusion, the efficiency of detection by multiplex
RT-PCR was 95%, implying acceptable detection
efficiency.
090 Int. Res. J. Biotechnol.
Figure 2. Specificity test for multiplex RT-PCR assay. (A) Negative specificity test for typing assay with other
respiratory viruses included lane 1= human rhinovirus, lane 2= human metapneumovirus, lane 3= human
bocavirus , lane 4= polyomavirus, lane 5= parainfluenza virus, lane 6= adenovirus, lane 7= GAPDH gene, lane
8= M gene of influenza A virus, 9= M gene of influenza B virus and 10= negative control. (B) Negative specificity
test for subtyping assay with 15 subtypes of influenza A virus (H1-H15). Viral subtypes were shown on top of
each lanes (pH1= H1N1 pandemic influenza A virus, sH1= H1N1 seasonal influenza A virus, H2-H15= influenza
A virus subtype H2-H15 and N= negative control. (C) Positive specificity test of subtyping assay with pH1N1,
sH1N1, H3N2 and H5N1 influenza A virus.
Table 2. Comparative influenza virus detection between multiplex real-time RT-PCR and multiplex RT-PCR
Method
Negative
Multiplex real-time RT-PCR
Multiplex RT-PCR
44
49
DISCUSSION
A rapid and accurate diagnostic method for influenza
virus is crucial for appropriate treatment. Among various
techniques for influenza virus detection, multiplex RTPCR was found to be one of most attractive in terms of
rapidity, sensitivity, specificity and cost-effectiveness for
Influenza B
virus
9
9
Influenza A virus
pH1
sH1
H3
46
0
1
41
0
1
H5
0
0
Total
100
100
detection of respiratory virus in clinical samples (Ellis et
al., 1997; Fan et al., 1998; Osiowy, 1998; Grondahl et al.,
1999; Liolios et al., 2001; Xie et al., 2006; Bellau-Pojul et
al., 2005 and Thontiravong et al., 2007).
In this study, The multiplex RT-PCR provided very
accurate detection of influenza B virus and influenza A
virus subtypes pH1N1, sH1N1, H3N2 and H5N1 without
Poomipak
et al. 091
Figure 3. Detection limit of each gene in multiplex RT-PCR for typing and subtyping assays. In vitro transcribed
RNAs were 10-fold serially diluted from 107-10 copies/µl as indicated on top of each lane. The lowest concentrations
that can be detected represent the limit of detection for each gene.
cross amplification of other subtypes of influenza A virus
or other respiratory viruses. The specificity of multiplex
RT-PCR obtained from this study was as good as the
multiplex RT-PCR or multiplex real-time RT-PCR
methods for influenza virus detection from previous
studies (Thontiravong et al., 2007; Boonsuk et al., 2008;
Suwannakarn et al., 2008). The detection limit of
multiplex RT-PCR in this study was approximately 10-104
copies/µl depending on each gene which potentially
better than the detection limit of multiplex RT-PCR for
3
4
influenza virus (10 -10 copies/µl) described from other
studies (Payungporn et al., 2004; Lisa et al., 2006;
Thontiravong et al., 2007; Boonsuk et al., 2008).
However, the detection limit of multiplex real-time RTPCR described previously (Suwannakarn et al., 2008;
3
Shisong et al., 2011) was 10-10 copies/µl which slightly
better than the detection limit of multiplex RT-PCR in this
study. The results showed acceptable detection limits in
comparison with previous studies.
The feasibility of the multiplex RT-PCR assay for
clinical diagnosis was validated by testing 100
nasopharyngeal suction specimens from patients with
respiratory tract infection. Our method was compared to
multiplex real-time RT-PCR as a gold standard, showing
95 % detection efficiency. The false negative result
obtained by the multiplex RT-PCR might be due to very
low quality or quantity of the viral RNA in those
specimens. Because the multiplex real-time RT-PCR
described previously (Suwannakarn et al., 2008) yielded
higher sensitivity for influenza A virus detection than
multiplex RT-PCR in this study. However, the multiplex
RT-PCR is more cost-effective compared to the real-time
RT-PCR assay.
CONCLUSION
The multiplex RT-PCR described here is advantageous
because it is rapid, specific, sensitive, reproducible, costeffective and of acceptable detection efficiency.
Therefore, it would be feasible and attractive for largescale diagnosis and monitoring of influenza virus infection
in patients with respiratory symptoms.
ACKNOWLEDGEMENTS
This work was supported by grant thesis from Graduate
School, Chulalongkorn University, the CU Centenary
Academic Development Project, the National Research
University project of CHE and the Ratchadaphiseksomphot Endowment Fund (HR1155A), Thailand Research
092 Int. Res. J. Biotechnol.
Fund (TRF), Office of the National Research Council of
Thailand (NRCT), Center of Excellence in Clinical
Virology, and the MK Restaurant Company Limited,
Thailand. The authors would like to thank all scientists,
Ph.D. candidates, and Master Degree students of the
Centre of Excellence in Clinical Virology, Faculty of
Medicine, Chulalongkorn University for their generous
support and cooperation in the emerging diseases
research. We also would like to thank Ms. P. Hirsch for
reviewing of the manuscript.
REFERENCES
Boonsuk P, Payungporn S, Chieochansin T, Samransamruajkit R,
Amonsin A, Songserm T, Chaisingh A, Chamnanpood P,
Chutinimitkul S, Theamboonlers A, Poovorawan Y (2008). Detection
of influenza virus types A and B and type A subtypes (H1, H3, and
H5) by multiplex polymerase chain reaction. Tohoku J Exp Med.
215(3):247-55.
Chutinimitkul S, Bhattarakosol P, Srisuratanon S, Eiamudomkan A,
Kongsomboon
K, Damrongwatanapokin S,
Chaisingh A,
Suwannakarn K, Chieochansin T, Theamboonlers A, Poovorawan Y
(2006). H5N1 influenza A virus and infected human plasma. Emerg
Infect Dis. 6:1041-3.
Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, Garten RJ,
Gubareva LV, Xu X, Bridges CB, Uyeki TM (2009). Emergence of a
novel swine-origin Influenza A (H1N1) virus in humans. N Engl J Med
360:2605-2615.
Ellis JS, Fleming DM, Zambon MC (1997). Multiplex reverse
transcription-PCR for surveillance of influenza A and B viruses in
England and Wales in 1995 and 1996. J. Clin. Microbiol.35:2076–
2082.
Elnifro EM, Ashshi AM, Cooper RJ and Klapper PE (2000). Multiplex
PCR: optimization and application in diagnostic virology. Clin.
Microbiol. Rev.13:559-570.
Fan J, Hendrickson KJ, Savatski LL (1998). Rapid simultaneous
diagnosis of infections with respiratory syncytial viruses A and B,
influenza viruses A and B, and human parainfluenza virus types 1, 2,
and 3 by multiplex quantitative reverse transcription-polymerase
chain reaction-enzyme hybridization assay (Hexaplex). Clin. Infect.
Dis.26:1397–1402.
Fleming DM, Chakraverty P, Sadler C, Litton P (1995). Combined
clinical and virological surveillance of influenza in winters of 1992 and
1993-4. BMJ. 311(7000):290–291.
Fouchier RA, Munster V, Wallensten A, Bestebroer TM, Herfst S, Smith
D, Rimmelzwaan GF, Olsen B, Osterhaus AD (2005).
Characterization of a novel influenza A virus hemagglutinin subtype
(H16) obtained from black-headed gulls. J. Virol.79:2814–2822.
Garten RJ, Davis CT, Russell CA, Shu B, Lindstrom S, Balish A,
Sessions WM, Xu X, Skepner E, Deyde V, Okomo-Adhiambo M,
Gubareva L, Barnes J, Smith CB, Emery SL, Hillman MJ, Rivailler P,
Smagala J, de Graaf M, Burke DF, Fouchier RA, Pappas C, AlpucheAranda CM, López-Gatell H, Olivera H, López I, Myers CA, Faix D,
Blair PJ, Yu C, Keene KM, Dotson PD Jr, Boxrud D, Sambol AR,
Abid SH, St George K, Bannerman T, Moore AL, Stringer DJ, Blevins
P, Demmler-Harrison GJ, Ginsberg M, Kriner P, Waterman S, Smole
S, Guevara HF, Belongia EA, Clark PA, Beatrice ST, Donis R, Katz J,
Finelli L, Bridges CB, Shaw M, Jernigan DB, Uyeki TM, Smith DJ,
Klimov AI, Cox NJ (2009). Antigenic and genetic characteristics of
swine-origin 2009 A (H1N1) influenza viruses circulating in humans.
Science.325: 196-201.
Grondahl B, Puppe W, Hoppe A, Kuhne I, Weigl JA, Schmitt HJ (1999).
Rapid identification of nine microorganisms causing acute respiratory
tract infections by single-tube multiplex reverse transcription-PCR:
feasibility study. J. Clin. Microbiol. 37:1–7.
Keawcharoen J, Oraveerakul K, Kuiken T, Fouchier RA, Amonsin A,
Payungporn S, Noppornpanth S, Wattanodorn S, Theambooniers A,
Tantilertcharoen R, Pattanarangsan R, Arya N, Ratanakorn P,
Osterhaus DM, Poovorawan Y (2004). Avian influenza H5N1 in tigers
and leopards. Emerg Infect Dis. 2189-91.
Liolios L, Jenney A, Spelman D, Kotsimbos T, Catton M, Wesselingh S
(2001). Comparison of a multiplex reverse transcription-PCR–
enzyme hybridization assay with conventional viral culture and
immunofluorescence techniques for the detection of seven viral
respiratory pathogens. J. Clin. Microbiol. 39:2779–2783.
Lisa Ng LF, Barr I, Nguyen T, Noor SM, Tan RS, Agathe LV, Gupta S,
Khalil H, To TL, Hassan SS, Ren EC (2006). Specific detection of
H5N1 avian influenza A virus in field specimens by a one-step RTPCR assay. BMC Infect Dis. 2:6-40.
Munster VJ, Veen J, Olsen B, Vogel R, Osterhaus AD, Fouchier RA
(2006). Towards improved influenza A virus surveillance in migrating
birds. Vaccine.24:6729–6733.
Osiowy C (1998). Direct detection of respiratory syncytial virus,
parainfluenza virus, and adenovirus in clinical respiratory specimens
by a multiplex reverse transcription-PCR assay. J. Clin. Microbiol.
36:3149–3154.
Payungporn S, Chutinimitkul S, Chaisingh A, Damrongwantanapokin
S, Buranathai C, Amonsin A, Theamboonlers A, Poovorawan Y
(2006). Single step multiplex real-time RT-PCR for H5N1 influenza A
virus detection. J. Virol. Methods.131:143–147.
Payungporn S, Phakdeewirot P, Chutinimitkul S, Theamboonlers A,
Keawcharoen J, Oraveerakul K, Amonsin A, Poovorawan Y
(2004). Single step multiplex reverse transcription-polymerase chain
reaction (RTPCR) for influenza A virus subtype H5N1 detection. Viral
Immunol.17: 588–593.
Shisong F, Jianxiong L, Xiaowen C, Cunyou Z, Ting W, Xing L, Xin
W, Chunli W, Renli Z, Jinquan C, Hong X, Muhua Y. (2011)
Simultaneous detection of influenza virus type B and influenza A
virus subtypes H1N1, H3N2, and H5N1 using multiplex real-time RTPCR. Appl Microbiol Biotechnol. 12.
Suwannakarn K, Payungporn S, Chieochansin T, Samransamruajkit R,
Amonsin A, Songserm T, Chaisingh A, Chamnanpood P,
Chutinimitkul S, Theamboonlers A, Poovorawan Y (2008). Typing
(A/B) and subtyping (H1/H3/H5) of influenza A viruses by multiplex
real-time RT-PCR assays. J Virol Methods.152:25-31.
Taubenberger JK, Layne SP (2001). Diagnosis of influenza virus:
coming to grips with the molecular era. Mol. Diagn. 6 (4):291–305
Thanawongnuwech
R,
Amonsin
A,
Tantilertcharoen
R,
Damrongwatanapokin S, Theamboonlers A, Payungporn S,
Nanthapornphiphat K, Ratanamungklanon S, Tunak E, Songserm T,
Vivatthanavanich V, Lekdumrongsak T, Kesdangsakonwut S,
Tunhikorn S, Poovorawan Y (2005). Probable tiger-to-tiger
transmission of avian influenza H5N1. Emerg Infect Dis. 5:699-701.
The CDC: Seasonal Influenza: The Disease. Available online at
www.cdc.gov/flu/about/disease.htm
Thontiravong
A, Payungporn
S, Keawcharoen
J, Chutinimitkul
S, Wattanodorn
S, Damrongwatanapokin
S, Chaisingh
A,Theamboonlers A, Poovorawan Y, Oraveerakul K. (2007) The
single-step multiplex reverse transcription- polymerase chain reaction
assay for detecting H5 and H7 avian influenza A viruses. Tohoku J
Exp Med. Jan; 211 (1):75-9.
Tiensin T, Chaitaweesub P, Songserm T, Chaisingh A, Hoonsuwan W,
Buranathai C, Parakamawongsa T, Premashthira S, Amonsin A,
Gilbert M, Nielen M, Stegeman A (2005).Highly pathogenic avian
influenza H5N1, Thailand, 2004. Emerg Infect Dis. 11:1664-72.
Williams RA, Peterson AT (2009). Ecology and geography of avian
influenza (HPAI H5N1) transmission in the Middle East and
northeastern Africa. Int. J. Health Geogr.8:47.
Xie Z, Pang YS, Liu J, Deng X, Tang X, Sun J, Khan MI (2006). A
multiplex RT-PCR for detection of type A influenza virus and
differentiation of avian H5, H7, and H9 hemagglutinin subtypes. Mol.
Cell. Probes. 20:245–249.