Biochimica et Biophysica Acta 1656 (2004) 177 – 188
www.bba-direct.com
Stark effect measurements on monomers and trimers of reconstituted
light-harvesting complex II of plants
Miguel A. Palacios a,*, Stefano Caffarri b,c, Roberto Bassi b,c,
Rienk van Grondelle a, Herbert van Amerongen d
a
Department of Biophysics and Physics of Complex Systems, Division of Physics and Astronomy, Faculty of Sciences, Vrije Universiteit,
De Boelelaan 1081, 1081 HV Amsterdam, The Netherlands
b
Facoltà di Scienze, Università; di Verona, Strada Le Grazie 15, I-37134 Verona, Italy
c
CEA/Cadarache, DSV, DEVM, Laboratoire de Génétique et Biophysique des Plantes, UMR 163 CEA-CNRS-Univ. Méditérranée,
163 Avenue de Luminy, Marseille, France
d
Laboratory of Biophysics, Department of Agrotechnology and Food Sciences, Wageningen Universiteit, Dreijenlaan 3,
6703 HA Wageningen, The Netherlands
Received 19 December 2003; received in revised form 30 March 2004; accepted 1 April 2004
Available online 20 April 2004
Abstract
The electric-field induced absorption changes (Stark effect) of reconstituted light-harvesting complex II (LHCII) in different
oligomerisation states—monomers and trimers—with different xanthophyll content have been probed at 77 K. The Stark spectra of the
reconstituted control samples, containing the xanthophylls lutein and neoxanthin, are very similar to previously reported spectra of native
LHCII. Reconstituted LHCII, containing lutein but no neoxanthin, shows a similar electrooptical response in the Chl a region, but the Stark
signal of Chl b around 650 nm amounts to at most f 25% of that of the control samples. We conclude that neoxanthin strongly modifies the
electronic states of the nearby Chl b molecules causing a large electrooptical response at 650 nm stemming from one or more Chls b in the
control samples. Ambiguities about the assignment of several bands in the Soret region [Biochim. Biophys. Acta 1605 (2003) 83] are
resolved and the striking difference in electric field response between the two lutein molecules is confirmed. The Stark effect in the
carotenoid spectral region in both control and neoxanthin-deficient samples is almost identical, showing that the neoxanthin Stark signal is
small and much less intense than the lutein Stark signal.
D 2004 Elsevier B.V. All rights reserved.
Keywords: LHCII; Xanthophyll; Lutein; Neoxanthin; Charge-transfer state; Nonphotochemical quenching; Exciton interaction
1. Introduction
Photosynthesis is the process in which sunlight energy is
converted into organic compounds to be used as a source of
energy by all living organisms on earth. To perform this
process, plants are equipped with the so-called Photosystem
I and II (PSI and PSII) [1,2]. Every photosystem is comAbbreviations: Mon-Ctr, reconstituted monomeric LHCII containing
lutein and neoxanthin; Mon-Lut, reconstituted monomeric LHCII containing only lutein; Trim-Ctr, reconstituted trimeric LHCII containing lutein and
neoxanthin; Trim-Lut, reconstituted trimeric LHCII containing only lutein;
Chl, chlorophyll; CD, circular dichroism; LD, linear dichroism; TmS, triplet
minus singlet; w/v, weight per volume; v/v, volume per volume
* Corresponding author. Tel.: +31-20-444-7935; fax: +31-20-4447899.
E-mail address: miguelan@nat.vu.nl (M.A. Palacios).
0005-2728/$ - see front matter D 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.bbabio.2004.04.002
posed of several pigment – protein complexes, whose main
function is to absorb sunlight and to transfer excitation
energy efficiently to the reaction center, where a charge
separation is initiated [1,3]. In order to be able to absorb
light, these light-harvesting complexes are disposed with
Chl and carotenoid (xanthophyll) pigment molecules, which
absorb light over a wide spectral range. Carotenoids also
have a protective role by preventing the formation of
harmful singlet oxygen and, in addition, a structural role
has been suggested for some complexes [4,5]. Chl and
carotenoid molecules work in a cooperative way and are
often strongly coupled, influencing their mutual spectroscopic properties [6 –8].
The light-harvesting complex II (LHCII) comprises more
than 50% of the Chl content in PSII of green plants and
algae [5]. Besides chlorophyll molecules, it binds four
178
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
xanthophylls—carotenoids with oxygen functions—, namely two luteins, one neoxanthin and one violaxanthin per
monomeric subunit, which is easily lost upon isolation (for a
review about xanthophylls in LHCII, see Ref. [9]).
The crystal structure of LHCII was resolved at 3.4 Å
resolution by Kühlbrandt et al. [5] and the obtained model
allowed determination of the positions of most of the pigments, but at the same time their identities and exact
orientation could not be determined, hampering a direct
correlation between the spectroscopic features and the
functioning of LHCII, although many of the experimental
observations have been modeled quite successfully [6,10,
11]. The model shows 12 Chl molecules and two central
xanthophylls (lutein) having an important role in stabilizing
the complex [12,13]. Concerning the identities of the pigments, three different research groups carried out point
mutation and/or reconstitution experiments aimed at specific
Chl binding sites [14 –17], leading to the conclusion that for
several Chls their initial assignment was questionable.
Interestingly, mutation of the binding sites of Chls a6, b5
and b6 (notation as in Ref. [5]) led to a concomitant (partial)
loss of neoxanthin molecules [14,15]. This led Croce et al.
[18] to the conclusion that the neoxanthin binding site is
located between the helix C and the helix A/B cross in the
structural model of LHCII, in close contact with Chls b5 and
b6. Furthermore, the authors concluded from linear dichroism (LD) measurements that neoxanthin makes an angle of
57 F 1.5j with respect to the normal of the membrane plane
[18 – 20]. The corresponding binding site appears to be
highly specific for neoxanthin and not essential for protein
folding [12,19].
The two central lutein molecules transfer singlet excitedstate energy quite efficiently ( f 80 – 100%) to the Chl a
molecules in trimeric LHCII from spinach [21 – 25]. Neoxanthin, which predominantly transfers excited-state energy
towards the Chl b molecules shows a lower transfer efficiency [21,22,25], whereas violaxanthin, located at the
outside of the complex, is unable to transfer excitation
energy to the Chl molecules [26,27].
Apart from light-harvesting, carotenoid molecules are
also essential for photoprotection, serving as quenchers of
the excited triplet states of the Chl molecules and as singlet
oxygen scavengers [28,29]. Both luteins quench Chl a
triplets efficiently, but no triplet transfer has been observed
towards the neoxanthin molecule [7,21,30,31]. This is easily
explained by the fact that efficient and fast singlet energy
transfer from Chl b to Chl a only leads to the formation of
excited triplet states on the Chl a molecules [8,24,32],
which are further away from the neoxanthin binding site
than the Chl b molecules (see also above). It was recently
proposed by Croce et al. [19] that neoxanthin is actively
involved in the scavenging of singlet oxygen.
Recently, Stark effect measurements on native LHCII in
different oligomeric states showed that the red most lutein
absorbing at f 510 nm in trimers and oligomers exhibits a
big Stark signal characterized by a large difference in dipole
moment between ground and excited states (jD!
l j f 15 D/
f), whereas the lutein absorbing at 494 nm has a jD!
l j value
of f 5 D/f [33]. It was suggested that the enhancement of
the Stark signal and red shift in absorption for one of the
two luteins was probably caused by the presence of Mg2 +
ions in trimers, since a trimer to monomer transition
accompanied by the release of up to 2.5 Mg2 + ions has
recently been reported [34]. Regarding neoxanthin, it
appeared to be troublesome to ascertain its Stark signal
due to strong overlap in the absorption and Stark spectra of
the neoxanthin, lutein and Chl b absorption bands [8,35].
Moreover, the origin of the experimentally observed minima
located at 457 and 427 nm in the Stark spectra, presumably
due to one or more xanthophylls, could not unambiguously
be deciphered. Exact knowledge of the electrooptical response of the xanthophylls present in LHCII is of great
importance in understanding what is the difference between
the two luteins and, for their assignment in the crystal
structure of LHCII [5]. In an attempt to find out the
contribution of lutein and neoxanthin to the Stark spectra,
Olszówka et al. [36] tried to model the Stark signal of
LHCII in the carotenoid region by taking the Stark spectrum
of lutein in glassy solvents, and shifting it to match the
approximate location of the vibrational absorption transitions of the S2 state of lutein and neoxanthin in LHCII. They
concluded that lutein and neoxanthin exhibit a comparably
strong Stark signal of similar magnitude as that of carotenoids in glassy solvents [37].
In the Qy absorption region marked changes occur
around 650 nm (Chl b) in the absorption, circular dichroism
(CD) and LD spectra upon ‘‘removal’’ of neoxanthin [18 –
20], suggesting strong interactions between neoxanthin and
some Chl b molecules. The Stark spectrum of LHCII shows
a remarkably strong Stark effect at 650 nm, which has been
hypothesized to be due to a strong interaction between
neoxanthin and one or more Chl b molecules [33]. However,
in Ref. [36] it was hypothesized that the main Stark signal
from Chl b is indirectly caused by neoxanthin through a
structural modification on the protein leading to strong Chl
b – Chl b coupling, rather than by direct coupling of neoxanthin with Chl b.
In order to obtain more insight into the interactions
between xanthophylls and chlorophylls and to unravel the
abovementioned unsolved questions, we have performed
Stark measurements on reconstituted monomeric and trimeric LHCII samples with different xanthophyll contents
(only lutein or both lutein and neoxanthin). Our results show
that, whereas the Chl a molecules exhibit similar electrooptic properties in all the samples, the electrooptic response
from the Chls b in the Qy absorption region is much less
intense in neoxanthin-deficient samples, behaving like that
of monomeric uncoupled Chl b molecules. In the Soret
region, clear absorption changes were observed due to the
absence of neoxanthin, whereas the Stark signals turned out
to be similar for both neoxanthin-deficient and neoxanthincontaining samples. Finally, we have been able to distin-
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
guish between the two luteins, since they exhibit different
behaviors upon optical excitation in the presence of an
electric field.
2. Materials and methods
2.1. Protein expression and complex reconstitution
The DNA construct for overexpression of the LHCII
apoprotein in E. coli was made using a barley gene
(TC65915, BE411686), amplified for PCR (primers:
CAGGATCCCGCAAGACGGCGGCAAAGGC and GGAAGCTTGCCGGGCACGAAGTTGG ) and cloned in a
modified pQE50 vector carrying a sequence for an histidine
tag at the C-term of the encoded protein.
Complex reconstitution was performed using a ratio of
420 Ag of apoprotein, 240 Ag of chlorophylls (Chls a/b
ration 2.9) and 60 Ag of carotenoids (30 Ag of lutein and 30
Ag of neoxanthin for the control sample), modifying the
procedure described in Ref. [38] for the Ni+ + column
purification by affinity chromatography [39] followed by
ultracentrifugation in a glycerol gradient. The trimerization
was induced by adding 0.1 mg/ml PG (L-a-phosphatidic
acid dipalmitoil C16:0).
The pigment complement of the holoprotein was analyzed by fitting the absorption spectrum of the acetone
extract with the spectra of the individual pigments [40,41]
and by HPLC analysis [42].
179
depends on the difference in dipole moment and polarizability, D!
l and Dã, between the ground and excited states
upon excitation (for a review about Stark spectroscopy
and its applications, see for instance Ref. [43]).
Quantitatively, the observed absorption spectral changes
experienced by randomly oriented and spatially fixed molecules in the presence of an electric field can be described
by the equation [43,44]:
Bv
d AðmÞ
!
m
DAðmÞ ¼ ðf F ext Þ2 Av AðmÞ þ
15hc dm m
2
Cv
d AðmÞ
þ
m
ð1Þ
m
30h2 c2 dm2
!
In Eq. (1), F ext is the externally applied electric field and
f is the local-field correction factor, which takes into account
the enhancement of the applied electric field at the site of the
molecule due to the environment. The terms Av, Bv and Cv
are dependent on the macroscopic angle v between the
polarization direction of the light and the electric field. Bv
and Cv are related to the molecular properties AD!
l A and Tr
(Dã) according to the expressions:
!
1
p Dã !
p
2
Bv ¼ TrðDãÞ 5 þ ð3cos v 1Þ 3
1
2
TrðDãÞ
ð2Þ
l A2 ½5 þ ð3cos2 v 1Þ ð3cos2 f 1Þ
:
Cv ¼ AD!
ð3Þ
2.2. Sample preparation
Table 1 shows the pigment composition in every sample
normalized to the total chlorophyll content. For the measurements, all the samples were diluted in a medium containing 20 mM Hepes buffer at pH 7.7 and 60% (v/v)
glycerol to ensure a transparent sample at low temperatures.
The n-dodecyl-h-D-maltoside concentration is 0.03% (w/v).
2.3. Stark spectroscopy: basic principles
In the presence of an electric field, a molecule exhibits a
shift in its transition energy. The magnitude of the shift
Table 1
Pigment stoichiometry on reconstituted monomers and trimers of LHCIIa
Pigment/Sample
Mon-Ctr
Mon-Lut
Trim-Ctr
Trim-Lut
Chl a/Chl b
Neoxanthin
Violaxanthin
Lutein
Chl/Car
Total Chls
Total Cars
1.8
0.94
0.00
1.82
4.35
12.00
2.76
1.8
0.00
0.00
2.37
5.06
12.00
2.37
1.4
0.91
0.00
1.79
4.43
12.00
2.71
1.4
0.00
0.00
2.38
5.03
12.00
2.38
a
The pigment contents were normalized to a total amount of 12 Chl
molecules.
Tr(Dã) and AD!
l A can easily be obtained by setting v to
magic angle (54.7j). AD!
l A and Tr(Dã) values associated to
the observed Stark signals were obtained by performing an
analysis based on a nonlinear least-squares fitting program
of the absorption and Stark spectra, as described before in
Refs. [33,45]. All the estimated values are given in terms of
D/f and Å3/f 2, respectively, because the local-field correction factor f is not known exactly.
2.4. Stark setup
Stark measurements were performed at 77 K (Oxford
cryostat, DN1704). The Stark cell consisted of two indium
tin oxide (ITO)-coated glass plates glued together with
double-sided sticky tape, resulting in a cell with an optical
pathlength of 100 Am. Excitation was provided by a 150 W
Xenon lamp (Oriel). The Stark effect was detected by lockin amplification at 2x, with x being the frequency of the
modulated applied field to the sample which was set to 310
Hz. Stark and absorption spectra were recorded simultaneously. Separate absorption spectra were obtained with the
lock-in amplifier (EG&G Model 5210)locked to the frequency of a chopper at 312 Hz. The OD of the samples
ranged from 0.45 to 0.60 at the Qy absorption maximum and
180
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
the Stark signal scaled quadratically with the applied field in
the range 1.0 –2.1 105 V/cm.
3. Results
3.1. Monomers
Fig. 1A shows the absorption spectrum of reconstituted
monomeric LHCII containing lutein and neoxanthin (MonCtr, solid line) and of reconstituted monomeric LHCII lacking neoxanthin (Mon-Lut, dashed line), together with the
absorption difference spectrum enlarged by a factor of two
(dashed-dotted line). Spectra were normalized at the Chl a Qy
maximum, the spectral region where the absorption spectrum
Fig. 1. (A) 77 K absorption spectra of reconstituted monomeric LHCII
containing lutein and neoxanthin (Mon-Ctr, solid line), reconstituted
monomeric LHCII containing only lutein (Mon-Lut, dashed line) and the
difference between them enlarged by a factor of 2 (Mon-Ctr minus MonLut, dashed-dotted line). Spectra were normalized at the Chl a Qy
absorption maximum. (B) Stark spectra in the Qy region of reconstituted
monomeric LHCII containing lutein and neoxanthin (Mon-Ctr, solid line)
and reconstituted monomeric LHCII containing only lutein (Mon-Lut,
dashed line) at 77 K recorded at v = 54.7j. Spectra were normalized to
OD = 1 at the Chl a peak and to a field strength of F = 1.0 105 V/cm. (C)
Stark spectra in the Soret region of reconstituted monomeric LHCII
containing lutein and neoxanthin (Mon-Ctr, solid line) and reconstituted
monomeric LHCII containing only lutein (Mon-Lut, dashed line) at 77 K
recorded at v = 54.7j. Spectra were normalized to OD = 1 at the Chl a peak
and to a field strength of F = 1.0 105 V/cm.
is expected to be hardly affected by the lack of neoxanthin.
Major differences are observed in the Chl b Qy region and in
the Soret region, as reported previously [18 – 20]. In the Qy
region, a blue shift for part of the 650 nm band seems to occur
upon ‘‘removal’’ of the neoxanthin, whereas in the Soret
region an overall decrease in absorption can also be observed
for Mon-Lut, with the exception of a rise in absorption for the
472 nm peak. This can be seen most clearly in the absorption
difference spectrum (Mon-Ctr minus Mon-Lut), which
depicts three distinct peaks in the Soret region at 488, 453
and 433 nm. These peaks are roughly located close to the
expected absorption bands associated with the three vibronic
transitions of the S2 excited state of neoxanthin [18,21,33,
46]. However, the negative contribution of the 472 nm band
to the absorption difference spectrum, probably makes the
first two red peaks appear further apart than their actual
separation. The hyperchromic effect at 472 nm is probably
caused by a blue shift in the absorption of one or more Chl b
molecules located in the surroundings of neoxanthin, i.e.
from f 485 to f 472 nm. Inspection of the second derivative of both spectra reveals only small changes in the Chl b
Qy and Soret regions (450 –500 nm), reflected by the change
(gain or decrease) in intensity of some absorption bands,
together with a slight red shift of the main Chl a Qy band ( < 1
nm) (not shown). No big changes are observed in the
positions of the minima, which coincide with those of
previously reported bands in LHCII [18,46 –49].
The Stark spectra of Mon-Ctr (solid line) and Mon-Lut
(dashed line) at 77 K recorded at v = 54.7j are depicted in
Fig. 1B ( Qy region) and Fig. 1C (Soret region). In the Qy
region, a decrease in intensity and a blue shift of the main
Chl b signal is observed for Mon-Lut with respect to MonCtr, whereas the Chl a Qy region remains more or less
unaltered. Similar observations were reported by Croce et al.
[18] with regard to the LD of both samples. These two
observations clearly point out that the lowest excited state of
some of the Chl b molecules in LHCII is strongly influenced
by the presence/absence of neoxanthin. The minimum at
649 nm in the Mon-Lut sample scales to only f 25% of the
signal at 651 nm in the Mon-Ctr sample. The blue shift in
the position of some of the minima is in agreement with the
qualitatively described differences in absorption for both
samples in the Qy region (see above).
The Stark signal of the Chl b molecules in the Mon-Ctr
sample resembles the second derivative of the Qy absorption
band as observed before for native LHCII, which is expected
if the main contribution to the Stark spectrum stems mainly
from a change in dipole moment, D!
l upon excitation.
Surprisingly, only small differences between the Mon-Ctr
and Mon-Lut samples are observed in the Stark spectra in
the Soret region. The slightly higher amount of lutein leads
to a small increase of the lutein Stark signal. On the other
hand, the absence of neoxanthin does not lead to the
disappearance of any spectral features that are specific for
neoxanthin. Therefore, it can be concluded that the Stark
signal of neoxanthin is small and much less intense than that
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
of lutein. The position of the minima and zero crossings are
very similar to those in previously reported Stark spectra for
LHCII in the Soret region [33,36,50]. Lutein, which absorbs
at 494, 466 and 435 nm (S2 state, vibrational transitions
[33,46]), dominates the observed Stark signal in this spectral
region (see Discussion).
3.2. Trimers
The absorption spectra of reconstituted trimeric LHCII
with lutein and neoxanthin (Trim-Ctr, solid line), reconstituted trimeric LHCII containing only lutein (Trim-Lut,
dashed line) and the corresponding difference absorption
spectrum enlarged by a factor of two (dashed-dotted line) are
plotted in Fig. 2A. The spectra are again normalized to the
181
Chl a Qy maximum. As in the case of reconstituted LHCII
monomers (see above), the main differences in absorption are
the blue shift in the Chl b Qy region and the relative decrease
in absorption in the Soret region for the Trim-Lut sample.
Fig. 2B and C show the Stark spectra of Trim-Ctr (solid
line) and Trim-Lut (dashed line) at 77 K recorded at
v = 54.7j in the Qy and Soret regions, respectively. Again,
a strong decrease of the main Chl b signal at around 651 nm
is observed for Trim-Lut, whereas the red part of the Chl a
Qy region exhibits no substantial changes, although a small
red shift for the Trim-Lut sample with respect to Trim-Ctr is
noticeable. In this case, the signal at f 651 nm for TrimLut scales to only f 12% of the observed signal for TrimCtr, which suggests that neoxanthin, when it is bound,
modifies the electronic properties of some Chl b molecules,
giving rise to an intense Stark signal at f 650 nm. The
enhancement of the signal at 642.5 nm probably corresponds to the blue shift observed in absorption for some Chl
b spectral subbands (see above). Finally, the signal at f 651
nm resembles the second derivative of the absorption
spectrum in Trim-Ctr samples.
Both spectra are again very similar in the Soret region
(Fig. 2C). Apart from a small increase of the lutein signal
for the Trim-Lut sample, no difference is observed that can
be ascribed to neoxanthin. It can thus be concluded that
neoxanthin shows a rather small Stark signal. The positions
of the intense Stark signals at 507 and 478 nm correspond
with the pronounced minima observed at 509 and 481 nm in
Stark measurements on native trimers and oligomers of
LHCII, which are due to the red-most lutein absorbing at
f 510 nm [33]. Their strong electrooptic response in native
LHCII becomes even stronger in reconstituted LHCII lacking neoxanthin. As in Refs. [33,36,50], minima are observed
at f 492, f 457 and f 427 nm for both samples, which
should most likely be ascribed to lutein (see Discussion).
4. Discussion
4.1. Chl a Qy region
Fig. 2. (A) 77 K absorption spectra of reconstituted trimeric LHCII
containing lutein and neoxanthin (Trim-Ctr, solid line), reconstituted
trimeric LHCII containing only lutein (Trim-Lut, dashed line) and the
difference between them enlarged by a factor of two (Trim-Ctr minus TrimLut, dashed-dotted line). Spectra were normalized at the Chl a Qy
absorption maximum. (B) Stark spectra in the Qy region of reconstituted
trimeric LHCII containing lutein and neoxanthin (Trim-Ctr, solid line) and
reconstituted trimeric LHCII containing only lutein (Trim-Lut, dashed line)
at 77 K recorded at v = 54.7j. Spectra were normalized to OD = 1 at the Chl
a peak and to a field strength of F = 1.0 105 V/cm. (C) Stark spectra in the
Soret region of reconstituted trimeric LHCII containing lutein and
neoxanthin (Trim-Ctr, solid line) and reconstituted trimeric LHCII
containing only lutein (Trim-Lut, dashed line) at 77 K recorded at
v = 54.7j. Spectra were normalized to OD = 1 at the Chl a peak and to a
field strength of F = 1.0 105 V/cm.
The Stark effect in the Chl a Qy region shows an overall
similarity in shape and intensity for all the samples. Only a
slight red shift ( f 0.5 nm) can be observed for neoxanthindeficient samples. Also the absorption spectrum is not
markedly affected in the Chl a Qy region when neoxanthin
is not bound.
In order to estimate the magnitude of the electrooptic
parameters of the chlorophylls in LHCII, we performed a
simultaneous fit of the absorption and the Stark spectra
(670 –705 nm) with a Bspline function [45] and its first
and second derivatives. Fig. 3 depicts the fit for reconstituted trimers of LHCII lacking neoxanthin and the
obtained values for AD!
l A and Tr(Dã) for all the samples
are summarized in Table 2. The AD!
l A and Tr(Dã) values
are in agreement with previously reported values for the
182
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
Fig. 3. Simultaneous fit of the 77 K absorption and Stark spectra of
reconstituted trimeric LHCII lacking neoxanthin (Trim-Lut) recorded at
v = 54.7j in the Chl a Qy region (705 – 670 nm) with a polynomial function
for the absorption (A), and its first (dotted line) and second (dashed line)
derivatives for the Stark spectrum (B). The residuals from the fit are
included in the insets.
change in dipole moment and polarizability in native LHCII
[33,51] and close to the published values for monomeric
uncoupled Chl a (see for instance Ref. [51]). Therefore, we
conclude that the Chl a molecules in LHCII are weakly
excitonically coupled and no charge-transfer states are
present, in agreement with previously reported results
[6,51 –54].
The Stark signal at f 662 nm in reconstituted trimers is
more intense when compared to native trimers of LHCII.
However, the relative absorption is also more pronounced at
those wavelengths with respect to native trimers and the
obtained AD!
l A value using a Gaussian fit for a band
located at this wavelength, is similar to the previously
reported AD!
l A value (1.4 D/f in reconstituted and 1.3 D/f
in native trimers).
4.2. Chl b Qy region
The Stark effect in the Chl b Qy region for reconstituted
control monomeric and trimeric LHCII is very similar to that
of native LHCII, characterized by a pronounced minimum
at f 650 nm. The Stark signal for neoxanthin-deficient
samples is much less intense and scales only up to 25% of
the native. In addition, a shift of part of the Chl b absorption
bands (mainly to the blue) is observed in reconstituted
LHCII lacking neoxanthin. Although the most straightforward explanation is that in native LHCII neoxanthin strongly interacts with one or more Chls b giving rise to the
experimentally observed intense Stark signal at f 650 nm,
it remains striking that no substantial changes are observed
in the carotenoid region when neoxanthin is not bound. This
fact leaves us with a second possibility: the Stark signal at
650 nm is due to strong Chl b –Chl b interactions. In a recent
work, Olszówka et al. [36] reported a decrease and a blue
shift in the Chl b Stark signal when this pigment is photobleached, whereas no changes below 500 nm were noticed,
i.e. where neoxanthin absorbs. Therefore, they concluded
that neoxanthin does not strongly interact with any Chl b
molecule, ascribing the observed intense Chl b signal to
strong Chl b– Chl b interactions. Our data clearly invalidate
the argument of Olszówka et al. because neoxanthin does
not contribute significantly to the Stark spectrum in the Soret
region, thereby explaining that no changes would be noticeable if this pigment becomes photobleached. However, on
the basis of the present data, we cannot actually rule out the
possibility that Chl b– Chl b interactions cause the large
Stark effect at 650 nm. In the atomic model proposed by
Kühlbrandt et al. [5] for LHCII, the shortest Chl b –Chl b
distance is 14.6 Å (B5 – B6 pair). Nevertheless, recent
reconstitution experiments have led to the conclusion that,
probably, the original assignment of the identities of the Chl
molecules is not fully correct and that there could be some
binding sites where either a Chl a or a Chl b can be bound.
This fact can cause the shortest Chl b –Chl b distance to
become 10 Å (A7 – B6 pair). Although the presence of
mixed binding sites in LHCII and which ones they are is
still a matter of debate, the fact that in some cases a Chl b
can replace a Chl a, implies that Chl b –Chl b interactions
could account for the observed Stark signal at 650 nm. In
such a case, only the pair of Chls bound at positions A7 and
B6 could account for the pronounced Stark signal at
650 nm—Remelli et al. [14] reported that A7 is indeed a
Chl b—, because the pair of Chls bound at sites A3 and B3
should give rise at the same time to strong Chl a and Chl b
signals, since these sites bind either Chl a or Chl b [14] and
according to Rogl et al. [15,55], B3 only binds Chl a.
Table 2
Stark parameters of Chl a in reconstituted trimers and monomers of LHCII
estimated using a fit with a polynomial function, and its first and second
derivativesa
Sample
AD!
l A (D/f )
Tr(Dã) (Å3/f 2)
Mon-Ctr
Mon-Lut
Trim-Ctr
Trim-Lut
a
0.69 F 0.06
0.66 F 0.06
0.63 F 0.06
0.60 F 0.06
47 F 6
49 F 6
55 F 6
60 F 6
The fitted spectral region ranged from 705 to 670 nm except for
monomers, where a satisfactory fit could not be obtained when wavelengths
below 675 nm were included.
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
183
Fig. 4. Simultaneous Gaussian fit of the 77 K absorption and Stark spectra of reconstituted trimeric control LHCII (Trim-Ctr, left) and of reconstituted trimeric
LHCII deficient in neoxanthin (Trim-Lut, right) recorded at v = 54.7j. Only the first (dotted line) and second (dashed line) derivatives of the bands peaking at
f 677 and f 650 nm to facilitate comparison of the difference in magnitude of the Stark effect are shown. The insets show the residuals from the fit.
Fig. 4 shows a Gaussian fit of the whole Qy region for
both absorption and Stark spectra for reconstituted trimers
of LHCII. The D!
l and Dã contributions from the Chl a
absorption band peaking at ca. 677 nm and from the main
Chl b located at ca. 650 nm to the Stark spectra are depicted
to clearly show the difference in magnitude of both Stark
signals. The resulting AD!
l A and Tr(Dã) values for the
bands associated with Chl b are summarized in Table 3.
Both (monomeric and trimeric) reconstituted control samples are characterized by AD!
l A f 2.2 D/f for the band at
f 650 nm. The neoxanthin-deficient samples show lower
AD!
l A values, which are typical for monomeric uncoupled
Chl b molecules [50]. These values are in agreement with
the observed experimental Stark signals and clearly show
that neoxanthin affects the electronic excited states of the
nearby Chl b molecules.
There are no reported values for Tr(Dã) of monomeric
Chl b, but the obtained values are not much larger than the
typical values for the Chl a molecules bound to the protein
˜
LHCII (Tr(Da) f 60 Å3/f 2), with the exception of the band
at 645 nm in reconstituted control trimers of LHCII, which
is substantially higher. The fit also shows the broadening of
the main Chl b band, especially towards the blue side. In
Fig. 5, the Stark difference spectrum for reconstituted
monomeric LHCII (Mon-Ctr minus Mon-Lut) in the Qy
region is plotted. It clearly shows the strong Stark effect at
Table 3
Stark parameters for reconstituted monomeric and trimeric LHCII in the region below 662 nm (mainly Chl b)a
AD!
l A (D/f )
Tr(Dã) (Å3/f 2 )
Gaussian
Relative
Gaussian
Relative
b
( F 10%)
band (nm)
area (%)
( F 10%)
band (nm)
areab (%)
AD!
l A (D/f )
( F 10%)
Mon-Ctr
658.5
651.0
645.5
638.5
13.3
12.5
10.4
2.3
–
2.1
1.7
0.8
–
28
90
–
Mon-Lut
661.0
652.5
646.0
636.5
15.1
14.3
10.1
5.7
1.1
1.2
1.2
1.4
–
99
20
41
Trim-Ctr
656.0
650.5
645.5
640.0
3.6
19.2
5.6
4.5
1.7
2.2
0.9
0.8
80
85
219
17
Trim-Lut
656.0
650.5
643.5
638.0
6.6
14.6
10.8
3.1
0.9
1.2
1.3
0.8
107
47
84
–
Tr(Dã) (Å3/f 2)
( F 10%)
Only the values associated to the Chl b bands are shown. The Chl a bands showed typical values characterized by AD!
l A f 0.6 D/f and Tr (Dã) f 60
Å /f , in agreement with previously reported results [33,51].
b
The relative area was also estimated taking into account the contribution of the Chl a bands to the fit.
a
3
2
184
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
Fig. 5. 77 K Stark difference spectrum in the Qy region of reconstituted
monomeric LHCII containing lutein and neoxanthin (Mon-Ctr) minus
reconstituted monomeric LHCII containing only lutein (Mon-Lut). Original
spectra were normalized to OD = 1 at the Chl a peak and to a field strength
of F = 1.0 105 V/cm.
f 650 nm with a second derivative-like shape in monomeric LHCII containing neoxanthin, and the small red shift
of a few Chl a subbands in Mon-Lut samples.
4.3. Carotenoid region
The main difference between the control and neoxanthindeficient samples in the pigment stoichiometry is the presence/absence of neoxanthin and the relative higher amount
of lutein when it is the only carotenoid bound (see Table 1).
However, for all samples, the Stark effect in the carotenoid
region is almost identical. This is quite surprising, because
carotenoids usually give rise to strong Stark signals [37,56]
and, therefore, if neoxanthin would exhibit a big Stark
signal, pronounced differences in the Stark spectra should
be readily noticeable. Thus, neoxanthin when bound to the
protein LHCII, shows a much less intense Stark signal than
for instance lutein. The result is at odds with the conclusion
from a previous study on native trimers of LHCII, where it
was concluded from a modeling of the Stark signal that the
electrooptical parameters of lutein and neoxanthin do not
substantially differ from each other [36].
We performed a simultaneous Gaussian fit of the absorption and Stark spectra in the carotenoid region for all the
samples. The results of the fit for the three red-most bands
are presented in Table 4. Fig. 6 shows the fits of the
absorption and Stark spectra of reconstituted LHCII monomers lacking neoxanthin. Monomers of LHCII show a redshifted absorption band located at ca. 507 nm when compared to the f 494 nm lutein band, but its relative area
compared to that of the 494 nm band seems to be smaller.
The AD!
l A value of the 507 nm band is rather large for
trimers, but lower than the previously reported AD!
l A value
for the 509 nm lutein of native trimers. However, for
reconstituted LHCII the Tr(Dã) values are higher. The rest
of the bands associated with the lutein molecules ( f 494
and f 506 nm in monomers), show AD!
l A values which are
typical for monomeric lutein as measured in glassy solvents
[37]. The absence of any additional trace of Mg2 + ions in the
reconstitution procedure followed to form the trimers
excludes the possibility pointed out in the Introduction that
the large Stark signal and red shift in trimers for one of the
luteins (most likely L2 [57]), is indeed due to the presence of
Mg2 + ions in the surroundings. Probably, a close charge
residue in the protein backbone is responsible for the
enhancement in the Stark signal for the red lutein. Still, it
remains striking that the absorption band associated to the
red lutein appears to be less intense than that of the other
lutein. One explanation could be that not all the genes of
which LHCII is composed, i.e. lhcb1, lhcb2 and lhcb3, lead
to a red shift of one of the luteins. However, the reconstitution was performed with lhcb1 alone, which rules out this
possibility. Alternatively, it might be possible that the extinction coefficient of the red-shifted lutein is lower that that
of the other lutein. This effect, i.e. lower extinction coefficient when the absorption maximum shifts to longer wavelengths, has already been observed for lutein in solution [58].
Table 4
Stark parameters for reconstituted monomeric and trimeric LHCII in the carotenoid regiona
Gaussian
Relative
Gaussian
AD!
l A (D/f )
Tr(Dã) (Å3/f 2)
b
band (nm)
area (%)
( F 10%)
band (nm)
( F 10%)
Relative
areab (%)
Mon-Ctr
555.0c
507.5
496.0
487.0
34.4
7.8
19.9
15.4
–
5.3
3.5
2.5
–
1475
880
520
Mon-Lut
555.0c
505.5
494.0
485.5
35.1
8.8
23.4
11.5
–
6.0
3.9
1.9
–
1355
850
432
Trim-Ctr
548.5c
507.5
496.0
488.5
15.1
7.6
14.5
7.3
–
9.7
4.3
2.9
–
1170
839
755
Trim-Lut
548.0c
506.5
495.0
486.5
16.0
6.8
12.5
4.4
–
10.6
4.9
3.6
–
825
1020
805
a
AD!
l A (D/f )
( F 10%)
Only the values associated to the red-most carotenoid bands are shown.
The relative area was estimated also taking into account the contribution of the rest of the bands to the fit.
c
This Gaussian band was included to minimize the error due to the baseline and contributions from the Chl molecules.
b
Tr(Dã) (Å3/f 2)
( F 10%)
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
185
Fig. 7. 77 K Stark difference spectrum in the Soret region of reconstituted
monomeric LHCII containing lutein and neoxanthin (Mon-Ctr) minus
reconstituted monomeric LHCII containing only lutein (Mon-Lut). Original
spectra were normalized to OD = 1 at the Chl a peak and to a field strength
of F = 1.0 105 V/cm.
Fig. 6. Simultaneous fit of the 77 K absorption (A) and Stark (B) spectra
recorded at v = 54.7j of reconstituted monomeric LHCII without neoxanthin (Mon-Lut) in the carotenoid region with Gaussian functions for the
absorption (top), and the first (dotted lines) and second (dashed lines)
derivatives of these functions for the Stark. The residuals from the fits are
included in the insets.
A band between 486 and 489 nm was always needed for
the fitting, which is slightly red-shifted in reconstituted
control samples compared to reconstituted samples lacking
neoxanthin. The AD!
l A values calculated for these bands
are similar in all the samples, showing that the contribution
of neoxanthin to the Stark spectra is at most of the same
order of magnitude of that of the other chromophores
absorbing mainly at f 486 nm, i.e. Chl b [35]. The relative
areas of these bands are higher in the control samples,
reflecting the presence of neoxanthin. From the fits, it can
be estimated that the Stark signal of neoxanthin is characterized by AD!
l A values which should be lower than 2 D/f.
Frank et al. [59] studied the effect of solvent environment
on the lowest excited state of neoxanthin and several other
carotenoids. It turned out that neoxanthin and spheroidene,
both of them lacking carbonyl functional groups were
hardly affected by the solvent environment, in contrast to
the other carotenoid molecules with carbonyl functional
groups. Furthermore, the dipole moment of the ground state
of neoxanthin was calculated to be 2.1 D, which is rather
low compared to that of other carotenoids (5.7 D for
peridinin and 8.8 D for fucoxanthin [59]).
In Fig. 7 the Stark difference spectrum of reconstituted
monomeric LHCII (Mon-Ctr minus Mon-Lut) in the Soret
region is depicted. There are no indications of minima
located at the presumably first vibrational levels of the S2
excited state of neoxanthin, i.e. at 486– 9 and 457 nm,
confirming that neoxanthin shows a weak response to an
applied electric field upon optical excitation. On the contrary, the Trim-Lut minus Mon-Lut Stark difference spectrum (Fig. 8) does show two pronounced minima. However,
these are located at 507 and 479 nm, and should be ascribed
to the red-most lutein.
Because of the small contribution of neoxanthin to the
Stark spectra, it can be concluded that the Chl b molecules
absorbing at f 486 nm [8,35] are mainly responsible for
the Stark minimum at 485 nm observed in trimers. The
minima at 457 and 429 nm should be ascribed to the blue
lutein, which is reported to absorb in LHCII at 494, 466
Fig. 8. 77 K Stark difference spectrum in the Soret region of reconstituted
trimeric LHCII deficient in neoxanthin (Trim-Lut) minus reconstituted
monomeric LHCII deficient in neoxanthin (Mon-Lut). Original spectra
were normalized to OD = 1 at the Chl a peak and to a field strength of
F = 1.0 105 V/cm.
186
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
and 435 nm [21,33,46]. Thus, a substantial contribution to
the Stark signal from Dã should be expected, characterized
by a first derivative-like shape, with a zero-crossing close
to the maximum of the corresponding absorption band and
a negative minimum towards the high energy side. However, a possible contribution from some Chl a molecules
absorbing at f 435 nm in the Soret region cannot be
discarded.
5. Conclusions
The results in this study are completely consistent with
the idea that neoxanthin is in close contact with Chl b
molecules, which could lead to strong interactions with
them.
The red shift of one of the luteins (probably L2) when
present in the trimer is not due to the close proximity of
Mg2 +, and therefore is seems most likely that upon trimerization L2 comes in contact with a charged residue of a
neighbouring monomeric LHCII subunit.
The Stark signals and the electrooptical values (AD!
lA
and Tr(Dã)) obtained for all the pigments (Chl a, Chl b,
lutein and neoxanthin) present in the control samples, are
very similar to those reported previously for native LHCII.
The Stark effect of neoxanthin bound to LHCII is much
less intense than that of lutein, which dominates the Stark
signal in the carotenoid spectral region.
Neoxanthin, when it is bound, substantially modifies the
electronic excited states of one or more Chl b molecules and
gives rise to a strong signal at 650 nm due to Chl b. The
most straightforward explanation is that neoxanthin strongly
interacts with the nearby Chl b molecules, but on the basis
of our present data we cannot rule out that Chl b –Chl b
interactions cause such a large Stark signal.
When neoxanthin is absent, some Chl b absorption
subbands shift from f 486 to f 473 nm, which agrees
with previous conclusions stating that the band at 486 nm is
due to both neoxanthin and Chl b molecules [8] and with the
concomitant blue shift observed in the Qy region.
All Stark spectra for LHCII trimers—native and reconstituted with and without neoxanthin—exhibited a strong
signal around 507 nm, which is due to one of the lutein
molecules. This Stark signal is characterized by a rather
large change in dipole moment between ground and excited
states.
We ascribe the observed Stark minima located at 457 and
428 nm to the blue lutein absorbing at f 494 nm. These
Stark signals can be qualitatively described by a change in
polarizability, rather than by a change in dipole moment,
which clearly shows the different behavior of the two lutein
molecules upon optical excitation in the presence of an
electric field.
Finally, the Stark and absorption spectra for the Chl a
molecules are not substantially influenced by the presence/
absence of neoxanthin.
Acknowledgements
R.B. thank MIUR Projects FIRB No. RBAU01E3CX
and FIRB No. RBNE01LACT for financial support.
References
[1] R. van Grondelle, J.P. Dekker, T. Gillbro, V. Sundström, Energy
transfer and trapping in photosynthesis, Biochim. Biophys. Acta
1187 (1994) 1 – 65.
[2] S. Jansson, The light-harvesting chlorophyll a/b-binding proteins,
Biochim. Biophys. Acta 1184 (1994) 1 – 19.
[3] H. van Amerongen, L. Valkunas, R. van Grondelle, Photosynthetic
Excitons, 1st ed., World Scientific, Singapore, 2000.
[4] H.Y. Yamamoto, R. Bassi, Carotenoids: localization and function, in:
D.R. Ort, C.F. Yocum (Eds.), Advances in Photosynthesis, Oxygenic
Photosynthesis: The Light-Reactions, vol. 4, Kluwer Academic Publishers, The Netherlands, 1996, pp. 539 – 563.
[5] W. Kühlbrandt, D.N. Wang, Y. Fujiyoshi, Atomic model of plant
light-harvesting complex by electron crystallography, Nature 367
(1994) 614 – 621.
[6] H. van Amerongen, R. van Grondelle, Understanding the energy
transfer function of LHCII, the major light-harvesting complex of
green plants, J. Phys. Chem., B 105 (2001) 604 – 617.
[7] E.J.G. Peterman, F.M. Dukker, R. van Grondelle, H. van Amerongen,
Chlorophyll a and carotenoid triplet states in light-harvesting complex
II of higher plants, Biophys. J. 69 (1995) 2670 – 2678.
[8] C.C. Gradinaru, R. van Grondelle, H. van Amerongen, Selective
interaction between xanthophylls and chlorophylls in LHCII probed
by femtosecond transient absorption spectroscopy, J. Phys. Chem., B
107 (2003) 3938 – 3943.
[9] R. Bassi, S. Caffarri, Lhc proteins and the regulation of photosynthetic light harvesting function by xanthophylls, Photosynth. Res. 64
(2000) 243 – 256.
[10] E.I. İsßeri, D. Gülen, Chlorophyll transition dipole moment orientations
and pathways for flow of excitation energy among the chlorophylls of
the major plant antenna, LHCII, Eur. Biophys. J. 30 (2001) 344 – 353.
[11] V. Novoderezhkin, J.M. Salverda, H. van Amerongen, R. van Grondelle, Exciton modeling of energy-transfer dynamics in the LHCII
complex of higher plants: a redfield theory approach, J. Phys. Chem.,
B 107 (2003) 1893 – 1912.
[12] S. Hobe, H. Niemeier, A. Bender, H. Paulsen, Carotenoid binding
sites in LHCIIb-relative affinities towards major xanthophylls of
higher plants, Eur. J. Biochem. 267 (2000) 616 – 624.
[13] E. Formaggio, G. Cinque, R. Bassi, Functional architecture of the
major light-harvesting complex from higher plants, J. Mol. Biol.
314 (2001) 1157 – 1166.
[14] R. Remelli, C. Varotto, D. Sandonà, R. Croce, R. Bassi, Chlorophyll
binding to monomeric light-harvesting complex, J. Biol. Chem. 274
(1999) 33510 – 33521.
[15] H. Rogl, W. Kühlbrandt, Mutant trimers of light-harvesting complex
II exhibit altered pigment content and spectroscopic features, Biochemistry 38 (1999) 16214 – 16222.
[16] C. Yang, K. Kosemund, C. Cornet, H. Paulsen, Exchange of pigmentbinding amino acids in light-harvesting chlorophyll a/b protein, Biochemistry 38 (1999) 16205 – 16213.
[17] S. Hobe, H. Fey, H. Rogl, H. Paulsen, Determination of relative
chlorophyll binding affinities in the major light-harvesting chlorophyll a/b complex, J. Biol. Chem. 278 (2003) 5912 – 5919.
[18] R. Croce, R. Remelli, C. Varotto, J. Breton, R. Bassi, The neoxanthin
binding site of the major light harvesting complex (LHCII) from
higher plants, FEBS Lett. 456 (1999) 1 – 6.
[19] R. Croce, S. Weiss, R. Bassi, Carotenoid-binding sites of the major
light-harvesting complex II of higher plants, J. Biol. Chem. 274
(1999) 29613 – 29623.
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
[20] R. Croce, G. Cinque, A.R. Holzwarth, R. Bassi, The Soret absorption
properties of carotenoids and chlorophylls in antenna complexes of
higher plants, Photosynth. Res. 64 (2000) 221 – 231.
[21] E.J.G. Peterman, C.C. Gradinaru, F. Calkoen, J.C. Borst, R. van
Grondelle, H. van Amerongen, Xanthophylls in light-harvesting complex II of higher plants: light harvesting and triplet quenching, Biochemistry 36 (1997) 12208 – 12215.
[22] C.C. Gradinaru, I.H.M. van Stokkum, A.A. Pascal, R. van Grondelle,
H. van Amerongen, Identifying the pathways of energy transfer between carotenoids and chlorophylls in LHCII and CP29. A multicolor, femtosecond pump-probe study, J. Phys. Chem., B 104 (2000)
9330 – 9342.
[23] E.J.G. Peterman, R. Monshouwer, I.H.M. van Stokkum, R. van Grondelle, H. van Amerongen, Ultrafast singlet excitation transfer from
carotenoids to chlorophylls via different pathways in light-harvesting
complex II of higher plants, Chem. Phys. Lett. 264 (1997) 279 – 284.
[24] P.J. Walla, J. Yom, B.P. Krueger, G.R. Fleming, Two-photon excitation spectrum of light-harvesting complex II and fluorescence upconversion after one- and two-photon excitation of the carotenoids,
J. Phys. Chem. 104 (2000) 4799 – 4806.
[25] R. Croce, M.G. Müller, R. Bassi, A.R. Holzwarth, Carotenoid-tochlorophyll energy transfer in reconstituted major light-harvesting
complex (LHCII) of higher plants: I. Femtosecond transient absorption measurements, Biophys. J. 80 (2000) 901 – 915.
[26] A.V. Ruban, P.J. Lee, M. Wentworth, A.J. Young, P. Horton, Determination of the stoichiometry and strength of binding of xanthophylls
to the photosystem II light-harvesting complexes, J. Biol. Chem. 274
(1999) 10458 – 10465.
[27] S. Caffarri, R. Croce, J. Breton, R. Bassi, The major antenna complex
of photosystem II has a xanthophyll binding site not involved in light
harvesting, J. Biol. Chem. 276 (2001) 35924 – 35933.
[28] D. Siefermann-Harms, The light-harvesting and protective functions
of carotenoids in photosynthetic membranes, Physiol. Plant. 69
(1987) 561 – 568.
[29] H.A. Frank, R.J. Cogdell, Carotenoids in photosynthesis, Photochem.
Photobiol. 63 (1996) 257 – 264.
[30] D. Siefermann-Harms, A. Angerhofer, Evidence for an O2-barrier in
the light-harvesting chlorophyll a/b – protein complex LHC II, Photosynth. Res. 55 (1998) 83 – 94.
[31] V. Barzda, E.J.G. Peterman, R. van Grondelle, H. van Amerongen,
The influence of aggregation on triplet formation in light-harvesting
chlorophyll a/b pigment – protein complex II of green plants, Biochemistry 37 (1998) 546 – 551.
[32] C.C. Gradinaru, S. Özdemir, D. Gülen, I.H.M. van Stokkum, R. van
Grondelle, H. van Amerongen, The flow of excitation energy in
LHCII monomers: implications for the structural model of the major
plant antenna, Biophys. J. 75 (1998) 3064 – 3077.
[33] M.A. Palacios, R.N. Frese, C.C. Gradinaru, I.H.M. van Stokkum, L.L.
Permvardhan, P. Horton, A.V. Ruban, R. van Grondelle, H. van
Amerongen, Stark spectroscopy of the light-harvesting complex II
in different oligomerisation states, Biochim. Biophys. Acta 1605
(2003) 83 – 95.
[34] G. Garab, Z. Cseh, L. Kovács, S. Rajagopal, Z. Várkonyi, M. Wentworth, L. Mustárdy, A. Dér, A.V. Ruban, E. Papp, A. Holzenburg, P.
Horton, Light-induced trimer to monomer transition in the main lightharvesting antenna complex of plants: thermo-optic mechanism, Biochemistry 41 (2002) 15121 – 15129.
[35] C.C. Gradinaru, I.H.M. van Stokkum, R. van Grondelle, H. van
Amerongen, Ultrafast absorption changes of the LHCII carotenoids
upon selective excitation of the chlorophylls, in: G. Garab (Ed.),
Photosynthesis: Mechanisms and Effects, vol. 1, Kluwer Academic
Publishers, Dordrecht, 1998, pp. 277 – 280.
[36] D. Olszówka, W. Maksymied, Z. Krupa, S. Krawczyk, Spectral analysis of pigment photobleaching in photosynthetic antenna complex
LHCIIb, J. Photochem. Photobiol., B Biol. 70 (2003) 21 – 30.
[37] S. Krawczyk, D. Olszówka, Spectral broadening and its effect in Stark
spectra of carotenoids, Chem. Phys. 265 (2001) 335 – 347.
187
[38] E. Giuffra, D. Cugini, R. Croce, R. Bassi, Reconstitution and pigment-binding properties of reconstituted CP29, Eur. J. Biochem. 238
(1996) 112 – 120.
[39] H. Rogl, K. Kosemund, W. Kühlbrandt, I. Collinson, Refolding of
Escherichia coli produced membrane protein inclusion bodies immobilised by nickel chelating chromatography, FEBS Lett. 432 (1998)
21 – 26.
[40] K. Razi Naqvi, T.B. Melø, B. Bangar Raju, T. Jávorfi, I. Simidjiev, G.
Garab, Quenching of chlorophyll a singlets and triplets by carotenoids
in light-harvesting complex of photosystem II: comparison of aggregates with trimers, Spectrochim. Acta, Part A 53 (1997) 2659 – 2667.
[41] R. Croce, G. Canino, F. Ros, R. Bassi, Chromophore organization in
the higher plant photosystem II antenna protein CP26, Biochemistry
41 (2002) 7334 – 7343.
[42] A.M. Gilmore, H.Y. Yamamoto, Zeaxanthin formation and energydependent fluorescence quenching in pea-chloroplasts under-artificially mediated linear and cyclic electron-transport, Plant Physiol.
96 (1991) 635 – 643.
[43] G.U. Bublitz, S.G. Boxer, Stark spectroscopy: applications in chemistry, biology, and materials science, in: H.L. Strauss, G.T. Babcock, S.R.
Leone (Eds.), Annu. Rev. Phys. Chem., vol. 48, 1997, pp. 213 – 242,
Palo Alto, CA.
[44] W. Liptay, Dipole moments and polarizabilities of molecules in excited states, in: E.C. Lim (Ed.), Excited States, vol. 1, Academic
Press, New York, 1974, pp. 129 – 229.
[45] R. Frese, U. Oberheide, I. van Stokkum, R. van Grondelle, M. Foidl,
J. Oelze, H. van Amerongen, The organization of bacteriochlorophyll
c in chlorosomes from Chloroflexus aurantiacus and the structural
role of carotenoids and protein, Photosynth. Res. 54 (1997) 115 – 126.
[46] A.V. Ruban, A.A. Pascal, B. Robert, Xanthophylls of the major photosynthetic light-harvesting complex of plants: identification, conformation and dynamics, FEBS Lett. 477 (2000) 181 – 185.
[47] A.V. Ruban, A.A. Pascal, B. Robert, P. Horton, Configuration and
dynamics of xanthophylls in light-harvesting antennae of higher
plants, J. Biol. Chem. 276 (2001) 24862 – 24870.
[48] S. Nussberger, J.P. Dekker, W. Kühlbrandt, B.M. van Bolhuis, R. van
Grondelle, H. van Amerongen, Spectroscopic characterization of
three different monomeric forms of the main chlorophyll a/b binding
protein from chloroplast membranes, Biochemistry 33 (1994)
14775 – 14783.
[49] H. van Amerongen, S.L.S. Kwa, B.M. van Bolhuis, R. van Grondelle,
Polarized fluorescence and absorption of macroscopically aligned
light harvesting complex II, Biophys. J. 67 (1994) 837 – 847.
[50] S. Krawczyk, Z. Krupa, M. Maksymiec, Stark spectra of chlorophylls
and carotenoids in antenna pigment – proteins LHC-II and CP-II, Biochim. Biophys. Acta 1143 (1993) 273 – 281.
[51] M. Rätsep, T.W. Johnson, P.R. Chitnis, G.J. Small, The red-absorbing
chlorophyll a antenna states of photosystem I: a hole-burning study of
Synechocystis sp. PCC 6803 and its mutants, J. Phys. Chem., B 104
(2000) 836 – 847.
[52] J. Pieper, M. Rätsep, R. Jankowiak, K.-D. Irrgang, J. Voigt, G.
Renger, G.J. Small, Qy-Level structure and dynamics of solubilized light-harvesting complex II of green plants: pressure and
hole burning studies, J. Phys. Chem., A 103 (1999) 2412 – 2421.
[53] E.J.G. Peterman, T. Pullerits, R. van Grondelle, H. van Amerongen,
Electron-Phonon coupling and vibronic fine structure of light-harvesting complex II of green plants: temperature dependent absorption and
high-resolution fluorescence spectroscopy, J. Phys. Chem., B 101
(1997) 4448 – 4457.
[54] M.A. Palacios, F.L. de Weerd, J.A. Ihalainen, R. van Grondelle, H.
van Amerongen, Superradiance and exciton (de)localization in lightharvesting complex II from green plants? J. Phys. Chem., B 106
(2002) 5782 – 5787.
[55] H. Rogl, R. Schödel, H. Lokstein, W. Kühlbrandt, A. Schubert, Assignment of spectral substructures to pigment-binding sites in higher
plant light-harvesting complex LHC-II, Biochemistry 41 (2002)
2281 – 2287.
188
M.A. Palacios et al. / Biochimica et Biophysica Acta 1656 (2004) 177–188
[56] W. Liptay, R. Wortmann, R. Böhm, N. Detzer, Excited state dipole
moments and polarizabilities of centrosymmetric and dimeric molecules: II. Polyenes, polyynes and cumulenes, Chem. Phys. 120 (1988)
439 – 448.
[57] S.S. Lampoura, V. Barzda, G.M. Owen, A.J. Hoff, H. van Amerongen, Aggregation of LHCII leads to a redistribution of the triplets
over the central xanthophylls in LHCII, Biochemistry 41 (2002)
9139 – 9144.
[58] G. Britton, UV/Visible Spectroscopy, in: G. Britton, S. Liaaen-Jensen,
H. Pfander (Eds.), Carotenoids, Spectroscopy, vol. 1B, Birkhäuser
Verlag, Berlin, 1995, pp. 13 – 62.
[59] H.A. Frank, J.A. Bautista, J. Jossue, Z. Pendon, R.G. Hiller, F.P.
Sharples, D. Gosztola, M.R. Wasielewski, Effect of the solvent
environment on the spectroscopic properties and dynamics of the
lowest excited states of carotenoids, J. Phys. Chem., B 104 (2000)
4569 – 4577.