A polymerase chain reaction for the detection of the take-all fungus, Gaeumannomyces graminis, in
infected wheat seedlings
by Kurt Robert Schesser
A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in
Microbiology
Montana State University
© Copyright by Kurt Robert Schesser (1990)
Abstract:
Gaeumannomvces araminis var. tritici. a filamentous ascomycete, causes the wheat and barley disease
take-all. Symptoms of take-all include blackened roots, sterile heads, and evential death of the plant, all
of which can be caused by other plant pathogens or environmental conditions. Currently diagnosis of
G. araminis var. tritici as the etiologic agent of take-all involves culturing the fungus on a highly
selective medium which is variable in its ability to recover the fungus from infected tissue. In this
project I used the polymerase chain reaction (PCR) to detect the presence of G. araminis var. tritici
DNA in infected wheat seedlings.
PCR is a method of DNA amplification which is both highly specific and extremely sensitive. The
specificity arises from the use of two oligonucleotide primers which are made complementary to
sequences of the DNA fragment of interest. Sensitivity is a result of the amplification process which
proceeds exponentially. Here I describe the use of PCR to amplify a G. araminis-specific DNA
fragment which was present in wheat seedlings inoculated with the fungus. The fragment was not
produced in uninfected seedlings or seedlings infected with other phytopathogenic fungi. This method
of detection has potential use in soil assays for the take-all fungus which would facilitate disease
forecasting. A POLYMERASE CHAIN REACTION
FOR THE DETECTION OF THE TAKE-ALL. FUNGUS,
GAEUMANNOMYCES GRAMINIS.
IN INFECTED WHEAT SEEDLINGS
by
Kurt Robert Schesser
A thesis submitted in partial fulfillment
of the requirements for the degree
of
Master of Science
in
Microbiology
MONTANA STATE UNIVERSITY
Bozeman, Montana
September 1990
Sestsc"'^
ii
APPROVAL
of a thesis submitted by
Kurt Robert Schesser
This thesis has been read by each member of the thesis
committee and has been found to be satisfactory regarding
content, English usage, format, citations, bibliographic
style, and consistency, and is ready for submission to the
College of Graduate Studies.
Date
Chairperson, Graduate Committee
Approved for the Majo^ Department
Date
Approved for the College of Graduate Studies
Date
Graduate"Dean
iii
STATEMENT OF PERMISSION TO USE
In presenting this thesis in partial fulfillment of the
requirements for a master's degree at Montana State
University,
I agree that the Library shall make it available
to borrowers under rules of the Library.
Brief quotations
from this thesis are allowable without special permission,
provided that accurate acknowledgment of source is made.
Permission for extensive quotation from or reproduction
of this thesis may be granted by my major professor, or in
her absence, by the Dean of Libraries when,
in the opinion
of either, the proposed use of the material is for scholarly
purposes.
Any copying or use of material in this thesis for
financial gain shall not be allowed without my written
permission.
Signature
Date
S
iv
TABLE OF CONTENTS
LIST OF T A B L E S .............................................. V
LIST OF FIGURES ................................... ..
. . . vi
A B S T R A C T .................................................. vii
INTRODUCTION
..............................................
I
<N CN 'd* t''
C--CTl
Take-all and its Control . . . .
Disease Cycle .............
Disease Control ...........
Take-all Diagnosis
. . . .
Pathogen Isolation
and Disease Forecasting
Molecular Diagnosis
...........
DNA P r o b e s ................................ .. . 10
The Polymerase Chain Reaction
...................... 14
PCR for D i a g n o s i s .............................. . 1 5
MATERIALS AND METHODS .....................................
19
Fungi, DNA Isolation, and Plant Infections .......... 19
Restriction Mapping and Subcloning ................. 20
S e q u e n c i n g ............................................. 22
P C R ....................................................23
Product A n a l y s e s ................................ .. . 24
RESULTS
................................... .
26
Restriction Mapping and Subcloning . . . . . . '. . . 2 6
Sequencing and Primer Selection
................... 28
PCR Generated Fragments
.............................. 32
D I S C U S S I O N ................................................. 37
Diagnostic P C R ................................
38
Nested P C R ............... ............................ 4 0
A p p l i c a t i o n s ...................
41
■LITERATURE CITED
. . ....................................... 43
V
LIST OF TABLES
Table
Page
1.
Related PCR t e c h n i q u e s ......................... 16
2.
Detection of pathogens using P C R ................ 17
3.
Fungi used in this s t u d y ....................... 20
4.
Sequence of PCR primers used in this study
. .23
vi
LIST OF FIGURES
Figure
Page
1.
Partial restriction map of p M S U 3 1 5 ...........27
2.
Sequence of the 587 bp within pMSU31 5 ...........30
3.
Location of PCR p r i m e r s .......................... 31
4.
First and second round amplification
products and products of amplificaion
of DNA from infected wheat seedlings . . .
33
Agarose and Southern blot of PCR products . . .
36
5.
vii
ABSTRACT
Gaeumannomyces araminis v a r . tritici. a
filamentous ascomycete, causes the wheat and barley
disease take-all.
Symptoms of take-all include
blackened roots, sterile heads, and evential death of
the plant, all of which can be caused by other plant
pathogens or environmental conditions.
Currently
diagnosis of G . araminis var. tritici as the etiologic
agent of take-all involves culturing the fungus on a
highly selective medium which is variable in its
ability to recover the fungus from infected tissue.
In
this project I used the polymerase chain reaction (PCR)
to detect the presence of G . araminis var. tritici DNA
in infected wheat seedlings.
PCR is a method of DNA amplification which is both
highly specific and extremely sensitive.
The
specificity arises from the use of two oligonucleotide
primers which are made complementary to sequences of
the DNA fragment of interest.
Sensitivity is a result
of the amplification process which proceeds
exponentially. Here I describe the use of PCR to
amplify a G. araminis-specific DNA fragment which was
present in wheat seedlings inoculated with the fungus.
The fragment was not produced in uninfected seedlings
or seedlings infected with other phytopathogenic fungi.
This method of detection has potential use in soil
assays for the take-all fungus which would facilitate
disease forecasting.
I
INTRODUCTION
Gaeumannomvces graminis is a soilborne,
filamentous
ascomycete of worldwide distribution in the north and south
temperate zones (22) .
In the field the fungus is associated
almost exclusively with root and crown tissue of many
members of the Gramineae plant family.
Colonization of
roots and crowns of susceptible plants by G. graminis can
lead to either a pathogenic or nonpathogenic condition for
the plant, depending on both the variety of the fungus and
the species of the host plant (73).
G. graminis var.
tritici is the etiologic agent of take-all disease of wheat
and barley, which economically is the most important root
disease for these cereals worldwide.
It is characterized by
penetration of the root cortical layers and colonization of
the stele by the pathogen which leads to blackened roots,
stunted growth, sterile heads, and eventual death of the
plant.
G. graminis var. avenae causes take-all in oats as
well as in wheat and barley.
G. graminis var. graminis,
which causes crown sheath rot disease of rice and spring
dead spot of bermuda, is considered a nonpathogenic parasite
of wheat and barley since it does not extend into the stele
or cause symptoms characteristic of take-all.
This project
concerns the take-all,fungus, G. graminis var. tritici, and
its detection in infected wheat seedlings.
2
Take-All and its Control
The disease take-all was first recognized in South
Australia in 1852 and the first recorded assignment of G.
qraminis var. tritici as the etiologic agent of the disease
was made in France in 1890 (22) .
In 1913 take-all was first
recognized in England and by the late 1940's it had become a
significant, yield-limiting disease in England as well as the
rest of Europe, Australia, and the United States.
This
dramatic increase in take-all's destructiveness was for the
most part due to a change in farming practices, as a shift
towards monoculturing and away from rotational farming
techniques had occurred (30).
The reason monoculturing has
increased the relative success of G. araminis var. tritici
can best be understood in terms of its disease cycle.
Disease cycle .
The pathology of take-all can be divided into threje
somewhat overlapping phases; parasitism and infection,
spread of the fungus through a stand of wheat or barley
within a growing season, and saprophytic survival of the
fungus providing inoculum for the next growing season (31).
Under laboratory conditions 2-3 germ tubes emerge from each
ascospore.
These pigmented germ tubes, or runner hyphae,
give rise to infection.hyphae anywhere along the length of
the former in response to the presence of susceptible plant
roots.
Infection hyphae penetrate the epidermal or root
3
hair, cells by forming an appressorium-like swelling termed
an infection peg (77).
It is believed that this penetration
is mostly an enzymatic process since cell wall material is
observed to dissolve just ahead of the infection peg (65).
In response to this insult the host plant thickens its
secondary cell wall with lignin or ligneous material,
forming stuctures called lignitubers in an effort to contain
the invading fungus.
Infection hyphae eventually are able
to penetrate the lignitubers which subsequently leads to the
cell's death.
When the infection hyphae reach the
epidermis, blockage of the xylem occurs both by hyphae and
lignitubers which results in the breakdown of stelar tissue
and extensive host cell death.
the dead tissue.
The fungus grows 'freely in
How far the fungus is able to proceed
through the cell layers of the host determines the extent of
pathogenicity of the disease.
Weakly pathogenic isolates of
G. cframinis var. tritici are more often found in the
cortical layer while more pathogenic strains are isolated
from the stele (14).
The overall effects of infection on
the plant include blackened roots, stunted growth, and
whiteheads
(65).
How the spread of G. crraminis var. tritici occurs
within the soil is not well understood due to the almost
complete lack of a reliable soil isolation method (discussed
below).
Samual and Garrett (56) demonstrated that moistened
perithecia, when present in whiteheads, eject ascospores at
4
a rate of several hundred per min from a single diseased
wheat culm.
This observation agreed w i t h .epidemiological
data which suggested that production of whiteheads is
influenced by precipitation and wind.
These dispersed
ascospores survived 3-4 days in dry conditions and about a
week in wet conditions.
For longer term survival G.
araminis mycelia appears to remain associated with wheat
residue by which inoculum for the next growing season is
provided.
Soil within planted wheat and barley rows are
more infectous than the soil between rows suggesting that
the fungus survives better as a parasite than as a
saprophyte (29) .•
Brown and Hornby (7) showed that G.
graminis var. tritici grew very little, if at a l l , in soil
without wheat seedlings being present and other studies
demonstrated a strong relationship between pathogenicity of .
the fungus and its survival on wheat stubble (11).
These
studies suggest how monoculturing increases the severity of
take-all by increasing the amount of plant residue harboring
the fungus.
The fungus survives poorly in soil conditions
which favor microbial growth, such as highly aerated and
moist soils, due to its low competitive saprophytic ability
(21 ) .
Disease control
Presently the only completely effective control
strategy for take-all involves crop rotation, of susceptible
5
hosts away from the infested fields for a period of one or
two years.
The success of this control measure is due to
the poor saprophytic survival of the fungus, as outlined
above, and the activity of both self-inhibitory strains of
G. crraminis var. tritici and other fungi and bacteria.
The
microbiological basis of the latter was demonstated by
showing that the suppressive properties of inhibitory soils
were lost upon heat treatment or irradiation (62,64).
Romanos, et a l .,(52) described a factor released by certain
cultures of G. crraminis var. tritici grown at pH 3.5-4.5
which was both self-inhibitory for the take-all fungus and
inhibitory for the growth of other fungi.
Highly pathogenic
strains, when grown at pH 4, produced very little of this
inhibitory compound while weaker pathogenic strains produced
relatively more and as a result grew slower (45).
The pH
dependency of the production of this compound suggests the
basis for work which showed that field treatments.which
decreased the soil pH reduced the severity of the disease
and increased the pathogen-suppressiveness of the soil
(12,24,63).
G. crraminis var. crraminis, a nonpathogenic
parasite of cereals, to some extent confers cross-protection
to host plants against take-all attack (79).
The grassland
fungus, Phialoohora radicicola. has an infection habit
almost indistinguishable to G. crraminis var. tritici
infection, covering the roots with dark, branching hyphae,
but penetrating mostly senescent or dead cells and thus
6
causing little lignituber formation or vascular
discoloration (28,60,66).
P. radicicola is considered an
avirulent parasite of wheat which provides some protection
against take-all when cross-inoculated with G. crraminis var.
tritici
(60).
P. radicicola was once believed to be the
main microbial agent responsible for the phenomenon of takeall decline (T.A.D.)
(30) which is currently believed to be
caused by fluorescent pseudomonads
(76).
T.A.D. follows the
maximum development of the disease in soils which have grown
cereals continuously for 7-8 years.
The bacterium
responsible for T.A.D., Pseudomonas fluorescens, produces a
phenazine antibiotic which is active in vitro against the
take-all fungus.and other root rotting fungal pathogens
(69).
Weller et al.
(76) were able to show that isolates of
P. fluorescens from roots grown in suppressive soils were
more inhibitory for G . araminis var. tritici growth in vitro
than those isolated from roots growing in noninhibitory
soils.
Further work showed that the presence of antibiotic-
producing strains of P. fluorescens could be correlated with
the lack of take-all disease symptoms displayed by field
grown plants (70).
Treatment of wheat seeds with antibiotic
producing stains of P. fluorescens resulted in plants with
fewer disease symptoms when challenged with G. crraminis var.
.tritici in both greenhouse and field tests (75).
Yields
were increased 147% in fumigated soil and 27% in natural
soil over nontreated seeds.
I
Take-all diagnosis
The traditional approach of diagnosis of plant diseases
has been based on identification of the pathogen either by
its isolation or by symptoms displayed by the host (10,32).
G. araminis var. tritici is difficult to isolate from
diseased tissue and causes disease symptoms similar to those
caused by other fungal plant pathogens or environmental
conditions.
Traditionally, take-all has been diagnosed when
plants display blackened roots, stunted growth, prematurely
ripened heads
grain (15).
(whiteheads), and ears containing shriveled
Whiteheads, which may not occur on all G.
araminis infected plants, may be caused by poor soil
conditions,
insects, or other microbial pathogens.
Black
roots may be caused by Cochliobolus sativus or mycorrhizae
and stem base blackening by Fusarium spp. or Leptosphaeria
narmair (30) .
As previoulsy discussed,. Phialophora
radicicola covers roots with dark, branching hyphae which
penetrate the plant cell wall inducing the plant to form
lignitubers to a limited extent (60).
a field diagnosis,
Therefore, to confirm
isolation of the fungus is required.
Pathogen isolation and disease forecasting
Direct isolation of G . araminis var. tritici from
infected plants is difficult due to its slow growth rate
relative to other soil and plant tissue microorganisms (16).
In addition, the fungus in culture does not normally produce
8
characteristic asexual or sexual spores which aid in
identification.
One isolation technique takes advantage of
G. graminis penetration of host tissue and involves the
surface sterilization of a small section of infected root
tissue followed by plating on potato dextrose agar (PDA)
containing streptomycin (2).
Juhnke, et a l ., (33) developed
a medium which is able to isolate the fungus directly from
plant material.
The medium includes a variety of
antibiotics and synthetic antimicrobics specific for other
soil and plant microorganisms.
Also included in this medium
is L-beta-3,4-dihydroxyphenylalanine (L-DOPA) which G.
graminis uses as a substrate for production of a melanin
pigment.
On such a highly selective medium the growth of
the fungus is relatively slower than on a nonselective
medium and there is variability in recovering viable G.
graminis from infected plant tissue (Henson, unpub.
observations).
Establishing that G. graminis is the causative agent of
take-all-like symptoms is important for crop-loss appraisal
and forecasting of the disease.
The forecasting of take-all
is very difficult due to the fact that an epidemic is a
process that involves several growing seasons and can be
discontinuous in time (30).
Additionally very little is
known about the biology of the saprophytic phase of the
fungus (discussed above) and our ability to detect G.
graminis in soil either directly or using host reponse
9
assays is very limited (discussed below).
Environmental
factors such as the past weather have been somewhat
successful in the USSR and East Germany for disease
prediction (30).
Take-all epidemics appear to be associated
with warm dry periods in winter, probably because competing
microorganisms are somewhat inhibited
under these
conditions.
Molecular Diagnosis
Recently some of the techniques of molecular biology
have been used in detecting plant pathogens in diseased
plants.
These methods involve the detection of pathogen-
specific molecules, either unique antigens or DNA sequences,
in standardized assays.
The detection of pathogen-specific
antigens or DNA sequences is not dependent on an observable
host reponse or the development of disease symptoms.
Antigens specific for a given phytopathogen are detected
immunologically with either polyclonal or monoclonal
antibodies (PAbs and MAbs, respectively).
Both viral and
bacterial plant pathogens have been detected directly in
infected tissue using enzyme-linked immunosorbent assays
(ELISA's).
A MAb raised against citrus tristeza virus was
able to differentiate viral pathovars (48).
Using ELISA's
and immunogold siver stain dot-immunobinding assays
Xanthomonas camnestris can be detected in infected geranium
plants with a PAb although there was some degree of cross­
10
reactivity with other X. camoestris pathovars and
phytopathogenic bacteria and fungi (I).
DNA Probes
The detection of pathogen-specific DNA sequences
potentially has a greater degree of specificity, and when
used in conjunction with the polymerase chain reaction,
sensitivity.
Deoxyribonucleic acid (DNA) serves as the
genetic material and exists in two complementary strands
hydrogen-bonded together.
Under appropriate conditions such
as high temperature or low salt concentrations the two
complementary strands denature and exist as single-stranded
molecules.
When the temperature is lowered or the salt
concentration raised, each DNA single-stranded molecule will
rehybridize with its complementary strand.
Cloned or
chemically synthesized DNA may hybridize to genomic DNA if
the two sequences are complementary and if the conditions
are appropriate.
If DNA is extracted from diseased plant
tissue and immobilized on a solid support such as
nitrocellulose filter paper, then the blotted DNA can be
probed with radioactively-labeled cloned DNA which will
hybridize to strands with sufficient homology.
After
washing off unhybridized DNA, the blot is exposed to X-ray
film and any radioactive DNA bound to the filter paper can
be detected.
Cloned DNA derived from a pathogen with little
homology to DNA sequences found in the host plant or other
11
microorganisms can be used diagnostically for plant disease
detection.
DNA probes have been developed for the detection
of bacterial,
pathogens.
fungal, nematodal, and mycoplasma-like plant
Thompson, et a l . (71), cloned a 5 kilobase (kb)
probe from the bacterium Clavibacter michiaanense subsp.
michicranense which did not hybridize, under the conditions
tested, to DNA from a closely related avirulent C.
michiaanense strain.
The virulent strain was detected
directly .in sap of infected tomato plants.
The degree of
hybridization can also be used to distinguish between
closely related pathogens.
A DNA probe directed against
Pseudomonas svrinaae pv. tomato could differentiate, based
on the strength of hybridization, this pathogen from P.
syringae pv. svrinaae (18).
An internal probe which
hybridized to both strains equally well was used to
differentiate between weakly hybridizing P. syringae pv.
svrinaae and small amounts of P . syringae pv. tomato DNA.
The detection limit of this assay was 2 ng of purified P.
svrinaae pv. tomato DNA which corresponds to the in situ DNA
released from IO5 bacterial cells.
Besal et al.,
(5) was
able to detect single nematode cysts with a mitochrondialderived probe when cyst homogenates were applied directly to
nitrocellulose filters.
The direct detection of pathogens
using DNA probes make it possible to detect microbes which
are difficult or impossible to culture in vitro such as
mycoplasma-like organisms
(MLOzS).
In this case the
12
development of the probe is difficult since purified D N A .
from the pathogen is unobtainable.
Kirkpatrick et al . , (34)
cloned random fragments of DNA derived from infected tissue
and was able to isolate a fragment which hybridized only to
DNA from infected tissue and not to DNA from healthy
tissues.
DNA probes have been used successfully for detection of
fungal plant pathogens and for epidemiological studies.
Probes for the latter purpose are able to genetically
separate closely related populations.
Restriction fragment
length polymorphic (RFLP's) probes hybridize to fragments of
different sizes generated after the fungal DNA is digested
with a restriction enzyme and subjected to electrophoresis
through an agarose gel.
Hybridization patterns can be
compared between closely related fungi and in some cases a
specific pattern can be correlated to some other
characteristic of the pathogen such as host range.
The
molecular basis for the differential hybridization pattern
is probably due to a single base change which either creates
or abolishes a restriction.enzyme site.
■Manicom, et al.,
(41) cloned a 3.4 kb probe from Fusarium oxvsporium which
produced hybridization patterns that correlated to
vegetative compatibility groups
(VCQ's) and therefore could
be used to assign Fusarium forma specialis.
Currently the
VCG assignment of a Fusarium isolate is determined by
pathogenicity tests on a number of possible hosts requiring
13
a considerable amount of time and labor.
A number of DNA probes have been developed for use in
the diagnosis of fungal plant pathogens.
A probe directed
against a very highly repeated DNA sequence (approximately
4% of the genome) of Phoma tracheiohila. a fungal pathogen
of lemon, was able to detect the pathogen directly in
infected seedlings (50).
The detection of lower-copy
pathogen-specific DNA directly in infected tissue may
require amplification of the target DNA sequence.
A probe
specific for Phvtophthora citroohthora. which causes a
citrus root disease, could not detect the pathogen-specific
DNA sequence in hybridization assays with total DNA
extracted from infected roots (25).
The probe could detect
p. citroohthora after the infected root was plated on a
semiselective medium which allowed a limited amount of
growth of the fungus.
Recently a 4.3 kb DNA fragment was cloned from the
mitochondrial genome of G. araminis var. tritici
(26).
Although this probe specifically hybridized to purified
Gaeumannomvces DNA, it was unable to detect fungal DNA in
diseased tissue by direct hybridization of the probe with
DNA extracted from infected wheat seedlings.
In order to
detect G. araminis infection it was necessary to subculture
the fungus from infected seedlings and extract DNA from the
subculture for hybridization with the probe.
Thus,
amplification of the target sequence for the detection of
14
the pathogen directly in infected tissue can be accomplished
either by culturing diseased tissue on a medium selective
for the pathogen (25,26) or as described here by using the
polymerase chain reaction (PCR).
The Polymerase Chain Reaction
PCR involves the denaturing of the target DNA followed
by hybridization of two oligonucleotide primers which are
homologous to opposite strand sequences that flank the DNA
to be amplified.
Primed template DNA is then extended with
DNA polymerase and deoxynucleotides to produce two copies of
the target D N A . ■ Completed strands of one primer extension
become a template for the other primer.
Repetition of
denaturation, primer annealing, and. primer extension result
in exponential amplification of the fragment of interest
which can be visualized on a stained agarose gel.
The
specificity of PCR is a function of the primers, which are
usually 20-30 base pairs in length, and the annealing
temperature, which usually ranges from 37 C to 65 C .
Pairs
of chemically synthesized primers that hybridize to many
regions of template DNA will result in a large number of PCR
products.
A low annealing temperature will allow the
primers to hybridize to sequences with less homology which
likewise will result in a number of nonspecific PCR
products.
The theoretical basis of primer directed DNA
15
amplification was first proposed a number of years ago (35)
and only recently shown to be possible.
The first published
research using PCR involved using a pair of primers which
flanked the single base polymorphic site which causes Sickle
Cell Anemia (54).
The single base change alters a
restriction site and therefore its presence can be detected
by the 'hybridization pattern of the amplified DNA in
southern blots.
The use of PCR increased the level of
sensitivity by two orders of magnitude by reducing the
amount of starting DNA required for the detection of the
base change.
The specificity of PCR increased dramatically
with the use of the thermostable DNA polymerase of Thermus
aouaticus (Tag)
(53).
Previously the Escherichia coli
Klenow fragment polymerase I was used and had to be added
fresh after each denaturing step and had a maximum activity
at 37 C .
The Tag polymerase can withstand extended and
repeated incubations at 95 C and has maximum activity at 72
C.
In addition to simplifying the procedure and increasing
the specificity of the products, the use of Tag polymerase
also was reported to increase both the yield of PCR products
and the maximum length product which could be obtained, 2-3
kb (53) .
PCR-for diagnosis
In a relatively short time PCR has become a widely used
tool in molecular biology research and the basic
16
amplification process has given rise to a large array of
related techniques, some of which are outlined in Table I.
Table I. Related PCR techniques.
Technique
Purpose
Ref.
Inverse PCR
Chromosome crawling
46
Competitive nucleotide
priming
Mutation analysis
23
MOPAC
cDNA amplification
37
Anchored PCR
cDNA amplification
39
RACE
cDNA synthesis
20
Asymmetric PCR
Single-strand synthesis
55
Multiplex PCR
Genetic screening
9
In the area of diagnostics of infectous and genetic diseases
the technology has spawned a growth industry.
Plant and
animal pathogens which were before too few in number to
detect in the infected host have become assessable in situ.
This detection is not dependent on isolating or culturing
the pathogen and requires only a minute amount of DNA to b e ■
present in the diseased tissue or sample.
PCR has been used
successfully for detecting a wide range of microbial
pathogens in a variety of sample types (Table 2).
17
Table 2. Detection of pathogens using PC R .
Microbe
Sample
Reference
Viral
Pseudorabies
HTLV-I
HIV-I
Hepatitis B
Cytomegalovirus
Cell culture
Spinal fluid
Blood
Serum
Urine
4
3
47
40
17
Bacterial
Shiaella flexneri
Lettuce
36
Protozoan
Trvnanosoma brucei
Blood
44
Fungal
Phoma tracheinhila
Lignified tissue
51
To date there has been only one published account of
using PCR for the detection of a phytopathogen in infected
plant material.
This involved the amplification of the
highly repeated sequence of Phoma tracheiphila discussed
above (51).
Although the probe containing a portion of the
repeated sequence could detect the fungus in the soft tissue
of infected lemon trees it performed poorly with lignified
branch samples.
The use of PCR allowed for the direct
detection of the pathogen in the woody tissue as well as the
infected soft tissues without hybridizations and
radioactivity.
Fungal DNA has been amplified for
phylogenetic studies in which PCR was used to facilitate
sequencing of a portion of the 16S-like rDNA gene of a
18
variety of fungal species (78).
Also PCR has been
successfully used to amplify DNA from dried fungal herbarium
specimens which had been stored for 1-50 years under a
variety of conditions
(8).
Here I describe the use of the
polymerase chain reaction for the amplification of G.
qraminis-specific D N A .
This method was successful in
detecting G. graminis var. tritici DNA in infected wheat
seedlings directly without subculturing the fungus.
The PCR
products were visible on stained agarose gels and they were
shown to be G. qraminis-specific by southern blot analysis.
The method described here has potential use for diagnosis of
diseases caused by Gaeumannomvces and the detection of the
fungus in soil which would aid in take-all forecasting.
19
MATERIALS AND METHODS
Fungi, DNA Isolation, and Plant Infections
Fungi used in this study are listed in Table 3.
Cultures were grown on L medium (43) at 24 C and DNA was
isolated as previously described (26).
DNA from infected
and uninfected control plants (six seedlings, approximately
0.6 g/DNA extract) was isolated by a fungal DNA protocol
(38) except that whole roots were used as starting material.
Ponderosa spring wheat seeds were surface sterilized in a
solution of bleach (10%) and ethanol
(10%) for 20 min,
washed with distilled water, and placed in 200 ml volume
glass jars containing 25 ml 1.2% agar.
Seeds were
inoculated at the time of planting with a single agar plug
taken from a fungal culture with a pasteur pip e t .
Seedlings
usually displayed disease symptoms within two weeks of
planting and DNA extracted either three weeks or one month
after planting.
20
Table 3.
Fungi used in this study.
Strain
Source
Cochliobolus sativus
D. Mathre
Fusarium cuImorum
D. Mathre
Gaeumannomvces araminis
var. avenae
S. Wong via D . Mathre
v a r . araminis
C. Rothrock via D . Mathre
var. tritici
D. Mathre
Rhizoctonia
D. Mathre
Trichoderma
D. Mathre
Restriction Manning and Subcloning
Restriction enzymes were obtained from Stratagene (La
Jolla, CA) and USB (Cleveland, OH) and were used according
to the directions of the manufacturers.
For large scale
plasmid preparations the alkali/SDS isolation method was
used (6) followed by Sephacryl S-1000 chromatography
(Pharmacia, Uppsala) using a high salt column buffer (10 mM
Tris [pH 8], I mM EDTA, I M NaCl).
The DNA concentration of
the collected fractions was determined by measuring the
absorbance at 260 nm.
The second A260 peak fractions were
pooled and precipitated with one volume isopropanol and
resuspended in TE buffer (10 mM Tris [pH 8], I mM EDTA) at a
concentration of 70-1185 ug/ml.
Plasmid minipreps for
transformant screenings also utilized alkali\SDS starting
21
with 2 ml overnight bacterial cultures.
Restriction mapping of pMSU315, a pUC18 plasmid with a
4.3 kb Gaeumannomvces.-specific insert (26), was done by
digesting 2 ug of the plasmid with a variety of restriction
enzymes in separate 20 ul reactions.
Digests were analyzed
by electrophoresis using 0.75% agarose gels with a running
voltage of 4.4 V/cm.
A lambda HindIII digest was used as a
molecular weight marker and restriction fragment sizes were
calculated with the GEL computer program written by.
Fristensky and based on the method of Schaffer and Sederoff
(59) .
Subtraction subcloning was accomplished by digesting 20
ug of pMSU315
with restriction enzymes in separate
reactions that cut within the 4.3 kb insert as well as the
multiple cloning site.
The plasmid was then religated and
approximately I ug used to transform Escherichia coli strain
DH^alpha (Bethesda Research Laboratories)
(13).
Transformants were screened and those with plasmids of the
appropriate size (i.e. pMSU315 minus the fragment which was
removed by the restriction enzyme digestion as predicted by
the restriction map) were cultured for large-scale plasmid
preparations.
Restriction enzymes used for deletion plasmid
constructions were EcoR I , HindI I I , PstI . SacI , and XbaI, and
their corresponding plasmids were named pMSU542, pMSU543,
pMSU544, pMSU54I , and pMSU540, respectively.
22
Sequencing
DNA sequencing was performed using the Sanger chaintermination method (58) .
The plasmids constructed above,
plus the parent plasmid pMSU315, were prepared for
sequencing by the alkaline-denaturation method (72) which
involved denaturing the plasmid in 0.2 M NaO H , 0.2 mM EDTA
for 5 min at room temperature.
The solution was then
neutralized with 0.1 volume of 3 M sodium acetate (pH 5) and
the DNA was precipitated with 2 volumes 95% ethanol. After
incubation on ice for 10 m i n , a 5 min spin in a microfuge
was used to pellet the D NA.
The supernatant was decanted
and the DNA pellet was washed with 160 ul cold 70% ethanol
and allowed to dry.
The DNA pellet was resuspended in 7 ul
of distilled water.
Sequencing was performed using a
Sequenase version 2.0 kit (USB, Cleveland)
instructions of the manufacturer.
following the
Labeling reactions were
done at 18 C for 10 min and the termination reactions were
performed at 40 C for 5 min.
Three oligonucleotide
sequencing primers were used; M13 -20 forward, M13 Reverse
(Stratagene), and KS2R (described below):
Electrophoresis
was done on a BRL model SO sequencing apparatus with 6%
polyacrylamide gels as described by Mann (42,57).
The gels
were fixed in 5% acetic acid, 5% methanol overnight, bonded
to 3MM Whatman paper, and vacuum dried at 65 C for one hour.
XO-MAT AR film (Kodak) was exposed 4 days and processed with
GBX developer and fixer (Kodak) according to the
23
manufacturer's instructions.
Sequencing ladders were read
manually and sequence comparison was made by searching
GENEMBL and GENEBANK (19).
PCR
Oligodeoxyribonucleotide primers were chosen from the
pMSU540 and pMSU541 sequencing data.
Primers KSlF and KS2R
flanked a 407 bp fragment containing nested primer sequences
KS4F and KS5R which encompassed a 138 bp fragment (see Table
4 for sequences).
Primers were prepared on an ABI 38IA DNA
synthesizer (Applied Biosystems, Foster City, CA) followed
by cleavage of the trityl group.
The primers were
resuspended in 150 ul distilled water and the concentration
was determined by reading the A260 (I A260 unit equals 20
ug/ml of single-stranded oligonucleotides).
Master PCR reaction mixes were prepared in 1.5 ml
microcentrifuge tubes placed on ice.
The mixtures contained
distilled water, primers (100 pmol each), all four
nucleotides (0.125 mM each)
(USB), Tag polymerase (3
Table 4. Sequences of oligodeoxyribonucleic PCR primers used
in this study.
Primer
Sequence
KSlF
5'-TACGGCTGTACCGCATGATCTACTA-31
KS2R
5'-ATGAGGCCAGAGGTCCCGTCAAAA-3'
KS4F
5'-CTGTCGGCAAGCGAAGAAGTAC-3'
KS SR
5 1- G T A A G T C T A C G C G T A G T T G G C - 3 '
24
units/100 ul)
(Perkin-Elmer-Cetus, Norwalk, CT ) , and PCR
buffer (50 mM K C l , 10 mM Tris [pH 8.3], 15 iaM MgCl2, and 0.1%
gelatin, final concentration).
The mixtures were gently
mixed and 100 ul were aliquoted into 0.5 ml microcentrifuge
tubes containing the template D N A .
Two drops of light
mineral oil (Sigma, St. Louis) were added to the reaction
tubes which were kept on ice until placed in the thermal
cycler.
Template DNA, in I ul volumes, used per reaction
was I ng pMSU315,
0.2 ug purified total fungal, or 0.02-0.1
ug from infected or uninfected plants.
PCR reactions,
unless otherwise specified, were started with the outside
primers, KSlF and KS2R, and after 20 cycles (I min at 92 C,
2 min at 42 C, and 4 min at 72 C) reaction products were
diluted 50-fold, and I ul was amplified another 30 cycles (I
min at .92 C, 2 min at 52 C, and 4 min at 72 C) with the
inside primers, KS4F and KS4R.
Automated PCR was performed
with a Perkin-Elmer-Cetus thermal cycler (Norwalk, CT) and
manual temperature cycling with three heat blocks (55).
Product Analyses
PCR reaction samples (20 ul per lane) were run on a 2-5
NuSieve (FMC, Rockland, ME), 1% agarose gel at 4.4 V/cm for
3.5 h.
A BstNI digest of pBR322 purchased from New England
Biolabs
(Beverly, MA) was used as a molecular weight
standard, yielding fragments of 1857, 1060, 929, 383, and
121 base pairs.
Gels were stained with ethidium bromide and
25
photographed with type 57 high speed film (Polaroid).
PCR
products were transferred directly without depurination to a
nylon membrane (Zeta-Probe, Bio-Rad, Richmond, CA) by
alkaline capillary transfer (49).
Nick translations were
done with a kit purchased from Bethesda Research
Laboratories
(Gaithersburg, M D ) .
Overnight,
65 C
hybridizations were performed with labeled pMSU315
(67).
(IO8 cpm)
Membranes were washed according to the instructions
of the manufacturer (Bio-Rad) and X-ray film (X-Omat AR,
Kodak) was exposed for 8 h before development.
26
RESULTS
Restriction Mapping And Subcloninq
Plasmid pMSU315, which contains a 4.3 kb fragment
cloned from G. araminis v a r .. tritici. was mapped with a
variety of restriction endonucleases which have sites within
the pUC18 multiple cloning site.
This simplified the
analysis-by making it possible to quickly assign the
polarity of the restriction sites.
For example, digesting
pMSU315 with SacI , which has a restriction site in the
multiple cloning site 3' of the insert, generated fragments
of approximately 5.2 kb and 2.0 kb.
Since pUCIS is 2.8 kb
in length, the SacI site within the insert must be located
2.0 kb from the multiple cloning restriction site (Fig. I).
When restriction enzyme digestion resulted in more than two
fragments or in two closely sized fragments it was necessary
to digest the plasmid with two restriction enzymes
simultaneously.
For example, KpnI digestion generated a 3.8
kb and a 3.2 kb fragment, and it was impossible to
distinguish the fragments since either one could contain the
vector.
Performing a KpnI, SacI double digest generated
fragments of 3.2 kb, 2.0 kb, arid 1.9 kb, which indicated
that the 3.2 kb fragment generated in the KpnI digestion
contained the vector and about 500 base pairs of the insert.
The KonI site is therefore located 3.8 kb 5' of the right
27
multiple cloning site.
Other pMSU315 restriction sites are
diagrammed in Fig. I.
Fig. I
Partial restriction map of pMSU315. Numbers in
parenthesis refer to distance, in kilobase pairs,
of the restriction site from the lefthand border
of the insert.
Multiple cloning restriction sites
are shown in bold. Double bar portion is
sequenced.
4.3 kb
pMSU315
PstI
HindIII
iKpnl
HindIII
(1.4)
1(0 . 6 )
EcoRI
(0.3)
SacI
(2.3)
XbaI
(2 .6 )
HindIII
(2.7)
PstI
(4.2)
SacI
EcoRI
XbaI
In order to obtain DNA sequence data of regions within
the cloned fragment with one set of primers, subtraction
subcloning was performed.
This involved digesting pMSU315
with a restriction enzyme that cuts within the insert as
well as in the multiple cloning site.
The cut plasmid is
then religated and used to transform E . coli.
Religation of
the plasmid minus the cut out fragment is a first-order
reaction which is favored over the second-order reaction of
pMSU315 reforming intact after digestion (55).
For example,
pMSU315 digested with SacI generates 5.2 kb and a 2.0 kb
fragments and when plasmids were recovered from ampicillinresistant bacteria transformed with the religated DN A , they
were of the predicted size of 5.2 kb.
The newly constructed
28
plasmid,
in this case pMSU541, could be used in sequencing
reactions using a universal primer (below) which hybridizes
to the flanking region of the right multiple cloning site
and is extended 250-350 base pairs into the insert during
the sequencing reactions.
Therefore, the sequencing of
pMSU541 generates approximately 330 base pairs of sequencing
data in a region, as predicted from the restriction map, 2.0
kb 5' of the right multiple cloning site of the parent
plasmid, pMSU315.
In addition to S a d , PstI, EcoR I ,
HindIII, and XbaI, were used to generate the derivative
plasmids pMSU544, pMSU542, pMSU543, and pMSU540,
respectively.
Sequencing And Primer Selection
The target DNA fragment must be partially sequenced
before
selection and subsequent synthesis of primers for
amplification of PGR.
The plasmids, pMSU540, pMSU541,
pMSU544, pMSU543, and pMSU542, were sequenced with either
the M l 3 forward or reverse oligonucleotide primer depending
on where the corresponding restriction site used to
construct the derivitive plasmid appears.
The parent
plasmid, pMSU315, was sequenced with both the forward and
reverse primers to obtain sequence information at both ends
of the cloned fragment.
Plasmid pMSU544, when sequenced
with the forward primer, yielded 48 bp of insert sequence
which defined the 3' end of the cloned fragment (Fig. I).
29
Priming pMSU315 with the forward oligonucleotide resulted in
a sequence ladder which corresponded to 265 bp at the 5 ' end
of the cloned fragment.
When the reverse primer was used,
pMSU315 yielded 232 bp of sequence information 5' of the
PstI restriction site.
Plasmid pMSU543 primed with the
forward oligonucleotide generated 221 bp of sequence located
approximately 2.7 kb downstream of the 5' end of the insert.
For unexplained reasons, sequencing pMSUS42 with the reverse
primer did not result in a readable sequencing ladder.
Plasmids pMSU540 and pMSU541 were partially sequenced
with the reverse primer.
As already mentioned, 330 bp of
sequence, located approximately 2.0 kb 5 ' of the right
multiple cloning site, was obtained when pMSU541 was
sequenced.
Plasmid pMSU540 generated 246 bp, including the
SacI site near the 3' end, of sequence information located
approximately 1.7 kb upstream of the right muliple cloning
site (Fig. 2).
Restriction mapping predicted the XbaI and
SacI sites to be approximately 300 bp apart which closely
agrees with the sequencing data which suggests that these
sites are about 275 bp apart.
Ten unsequenced bases, as was
determined later by sequencing with the primer KS2R (below),
separated the 3' of the pMSU540 and the 5' end of the
pMSU541 sequencing data.
The beginning of the pMSU540
. sequence to the end of the pMSU541 sequence encompassed a
587 bp region which was judged to be appropriate for the
synthesis of PCR oligonucleotide primers.
30
Fig. 2.
Sequence of the 587 bp located within pMSU315.
Primer locations are indicated by brackets. The
SacI restriction site is underlined.
5'-ATTCAATGTCTAGAGACTCAAACTCAGTAAAAATAAACCAGACATTCTTTTTTTTAT
ATTTATTAAAGGGAGTGCTATTTGTGCTTGAAAAAACTAATAAATAAAAAAAAAACCAAA
AAAATAT[KS1F->TACGGCTGTACCGCATGATCTACTA]TTACATCCTACCCNNNNNNC
CCCCCNTCGCNTNTTCGCTTGCGCAGCAACAYCTACCCCCCCCCTT[KS4F->CTGTGCG
CAAGCGAAGAAGTAC]TACTTCGTACTTCTAATACATATTAGAAGTACGAAGTAAGCAAC
CAGGTTCATTTACGTATACCAGGGTGGTAGTGCTATATTTATATTAGTACGAGTAATATA
CGCTAGAGCTCTATATAATATCATATAATTTATA [GCCAACTACGCGTAGACTTAC<-KS
SR]AATCTTTTTTTTTTATTTTGTTTTTTTTTTTTACCACTAATNTTTTTCCATTTAAAA
TCCTCAATAGACGCCATTCTACTCCAAATATCCCATAAGACCACCACCAAACATATCACC
CAGATCTTTAAGACCATTATCCATCAATCTCATTTTAGTTATA[TTTTGACGGGACCTCT
GGCCTCATC-HS 2R ]ATTTAATCTA-3'
The dominant criterion used for the selection of a set
of PCR primers is a GC content of about 50-60% in a 20-30 bp
stretch of sequence.
Sequencing data demonstrated (Fig. 2)
many long tracts of A 1s , T 1s, and occasionally C s , imposing
limitations on the sequences which could be used as primers.
Another consideration for primer selection is the distance,
measured in the number of nucleotides, between the two
opposing primers.
The polymerase chain reaction has been
used successfully to amplify nucleotide sequences of less
than 100 bp to approximately 3 kb (55).
Two primers, KSlF
31
and KS2R, were chosen from the pMSU540 and pMSU541
sequencing data which demarcates a 456 bp fragment of the
Gaeumannomvces-specific insert of pMSU315 (Fig. 3).
This
456 bp had no open reading frame and did not show strong
homology to any Genebank or Genembl sequence.
A nested set
of primers, KS4F and KS5R, which were contained within the
456 bp sequence were also synthesized.
To facilitate PCR
product analyses, primers which flanked the SacI restriction
site were chosen.
SacI
XbaI
pMSU315
SacI
KSlF
Fig. 3
KS4F
KSSR
KS2R
Partial restriction map of pMSU315 and location
and direction of the oligodeoxyribonucleotide
primers used in this study.
Distances are in
kilobase pairs.
PCR Generated Fragments
When the outside primers KSlF and KS2R were used in one
round of amplification (25 cycles), two PCR products were
generated when G. araminis var. tritici purified DNA was
used as a template (Fig. 4, lane 13).
When pMSU315 was used
as a template, a single PCR product was produced which
appeared to be identical to the larger fragment generated
when total G. araminis DNA was amplified.
The higher
molecular weight products contained the SacI restriction
site and both fragments hybridized to labeled pMSU315 in
southern blots.
The larger fragment was sized, using DNA
molecular weight standards, as approximately 550 bp in
length.
The reason for the discrepancy between the actual
product size and the predicted length of 456 bp was not
determined.
Under these same conditions a number of PCR
products were generated when other purified fungal DNA were
amplified.
Cochliobolus sativus and Fusarium culmorum
products are shown in Fig. 4, lanes 11 and 9, and although
these products did not hybridize with labeled pMSU315 it was
felt that this high level of nonspecific'background products
could lead to ambiguities when evaluating results from PCR
reactions with DNA extracted from infected plants.
In
addition, the major amplification products using DNA
extracted from G . araminis infected seedlings did not
33
appear, as judged from their size, to correspond to the
amplification products of purified G . graminis or pMSU315
DNA.
Fig.4
PCR products generated after first and second
rounds of amplification of purified fungal DNA
(lanes 8-13) and amplification of DNA from wheat
seedlings infected with G .graminis v a r .tritici
(Ggt) and other fungi (lanes 2-7).
Lanes:
13,11,9, G g t , C.sativus. and F .culmorum, after one
round of amplification,respectively; 12,10,8, Ggt,
C .sativus and F .culmorum after two rounds of
amplification, respectively; amplification of
wheat seedling DNA infected with Ggt (7),
C. sativus (6) . F. culmorum (5)_, Rhizoctonia— LU/
and Trichoderma (3); lane 2, uninfected; lane I,
pBR322 BstNI standard molecular weight markers.
A second set of primers (KS4F and KS5R) were
synthesized and tested for their ability to reduce the
number of nonspecific amplification products.
The inside
nested primers were predicted to generate a 181 bp fragment
containing the SacI restriction site (Fig. 2 and 3).
Also,
34 '
they prime inside the long tracts of C s
and T 1s in the 456
bp fragment which could possibly be-involved in some of the
discrepancies noted above.
Sometimes when G. graminis DNA
was amplified with the inside primers alone in one round of
amplification there were multiple products detected on the
agarose gel, only one of which contained the SacI
restriction site.
To reduce the number of nonspecific
products generated during amplification, a second round of
amplification with the nested set of primers was performed
using the diluted products from the first round as the
template.
Using two rounds of amplification, there were no C .
sativus and F . culmorum PCR products detected on agarose
gels following the second round (Fig. 4, lanes 10 and 8).
When purified G. graminis var. tritici or pMSU315 DNA was
subjected to two rounds of amplification, two fragments,
approximately 188 and 280 bp in size, were visible on
stained gels (Fig. 4, lane 12 and Fig. 5A, lanes 1,2).
The
smaller fragment was the predicted product from the inside
primers but the origin of the 280 bp product was unclear.
Both products contained a SacI restriction site and
hybridized to labeled pMSU315
(Fig. SB, lanes 1,2).
Identical PCR products were obtained with DNA extracted from
G . graminis var. tritici-infected wheat seedlings (Fig. 5A
and SB, lanes 3,4).
Other related varieties of
Gaeumannomvces. var. graminis and var. ayenae, produced PCR
35
fragments identical in size to those derived from Saraminis var. tritici.
No PCR products were detected in
gels after amplification of DNA from uninfected seedling
controls
(Fig. 4, lane 2 and Fig. 5A, lane 5), purified
wheat DNA (Fig. 5A, lane 6), or seedlings infected with
other root colonizing fungi (Fig. 4, lanes 3-6).
Labeled
pMSU315 did not hybridize to any products which might be
undetected in the ethidium bromide-stained agarose gels
(Fig. 5A, lane 6; autoradiogram of the gel shown in F i g . 4,
not shown).
Automated and manual temperature cycling
produced identical results (data not shown).
36
oco
coco
CNf
1
2
B3
4
5
6
I
A
Fig 5. Agarose gel (A) and Southern blot probed with pMSU315
(B) of PCR products from the following templates; I,
pMSU315; 2, Ggt; 3,4, DNA extracted from wheat seedlings
infected with Ggt; 5, DNA from uninfected wheat seedlings;
and 6, purified Chinese Spring wheat DNA; lane 7, pBR322
BstNI molecular weight marker.
37
DISCUSSION
Although the cereal disease take-all can be diagnosed
visually, unambiguous assignment of G. graminis var. tritici
as the etiological agent is complicated by the fact that
many of the disease symptoms may be caused by other
microorganisms or environmental conditions.
Here is
described the use of the polymerase chain reaction for
detection of Gaeumannomvces-specific DNA in infected wheat
seedlings.
This method generated microgram quantities of
DNA products which could be readily identified as to their
specificity.
Primer-directed DNA amplification has the
potential to become a routine laboratory technique used in
the field of diagnostics for both animal and plant diseases.
The technique is not equipment intensive as was shown in
this project with the use of three heating blocks for
temperature cycling.
Decreasing the temperature ramp time
in manual temperature cycling (an automated temperature
cycler has a ramp time of about I C/sec) appeared to have no
effect on the results.
If an automated temperature cycler
is used, the technique requires little more labor than
preparing a crude DNA extract of the sample tissue,
pipetting the reaction components, and after the reactions
are completed, product analysis.
Care does have to be
exercised in the handling of the reaction components.
38
including the preparation of the template DN A , due to the
inherent sensitivity of this technique.
Theoretically one
molecule of the target DNA sequence is sufficient to produce
a positive result.
Also, another important consideration is
the relative concentration of any PCR products, in terms of
the number of molecules (molarity), which are visible on an
ethidium bromide-stained gel.
These products may serve as
templates for subsequent reactions.
In spite of the
enormous.threat of contamination no extra precautions were
taken in this study since the negative controls
(no added
DNA template added or uninfected seedlings) never produced
products visible on stained gels or which hybridized to
labeled pMSU315.
This may be a reflection of the relative
efficiency of the amplification under the conditions used in
this work rather than any skill possessed by the
experimenter.
Diagnostic PCR
Two fragments of approximately 188 and 280 bp were
generated with G. oraminis total DN A , pMSU315, and DNA
extracted with G . graminis-infected seedlings.
Although
only one 181 bp PCR product was predicted, two fragments
were produced.
Both fragments hybridized with labeled
pMSU315, the plasmid bearing a 4.3 kb mitochondrial fragment
cloned from G . oraminis var. tritici.
Initially it was
thought.that the larger fragment was a product of KS1F/KS5R
39
priming which would be predicted to generate a 272 bp PCR
product.
Outside primer KSlF, according to this
explanation, was in sufficient concentration following
dilution of the first round products to produce enough
product to be visible on stained agarose gels.
Calculations
of the maximum yield of KS1F/KS5R priming products (i.e. how
much 272 bp product could be generated from KSlF carried
over from the first round of amplification)
showed that only
nanogram amounts of the 272 bp product could be produced.
In addition, digestion of the 280 bp fragment with SacI did
not produce restriction fragments which would be expected
had either of the outside primers been used to generated the
280 bp fragment.
Perhaps one or both of the inside primers
anneals to a second sequence(s) on pMSU315, extension from
which would generate the 280 bp fragment.
Regardless of its
origin, this fragment is consistently produced during
amplificaton of G.araminis DNA and hence is diagnostically
useful.
Identical PCR products were obtained with other
varieties of Gaeumannomvces graminis indicating that this
technique may be useful for diagnosis of other diseases such
as spring dead spot of bermuda and crown rot of rice caused
by G. araminis var. graminis and take-all of oats caused by
G. graminis var. avenae.
In addition, this technique would
probably be useful for other G . graminis var. tritici
40
strains isolated thoughout the world since they also contain
the 4.3 kb DNA sequence (Henson, unpublished observations).
Nested PCR
To reduce the number of nonspecific PCR products
generated during the amplification reactions, two sets of
primers were used.
The outside primers, KSlF and KS2R, were
used in a first round of amplification which consisted of 20
cycles with a relatively low annealing temperature (42 C ) .
The first round products were then diluted and added to a
second reaction mixture containing the inside primers, KS4F
and KS5R.
The second round of amplification used a higher
annealing temperature (52 C) and ran for 30 cycles.
This
approach increased both the specificity, as judged by the
decrease in nonspecific products observed in the gels
compared to products generated after one round of
amplification, and the sensitivity.
Theoretically the use
of nested primer sets in two rounds of amplification would
not be expected to produce a nonspecific product since the
probability of both sets of primers hybridizing to a
heterologous site, in the proper orientations, would have to
be exceedingly small.
Sensitivity is increased by two
rounds of amplification simply by the increased number of
cycles used and the addition of fresh Tag polymerase after
20 cycles.
The polymerase is reported to lose a significant
amount of its activity after 20-30 cycles (55).
Sensitivity
41
is an important consideration when one is- starting with a
relatively small number of copies of the template.
The 181
bp fragment that was amplified in this project is contained
in a larger sequence which is nonrepeated (26) , therefore
only one template per mitochrondrial genome is present.
The
relative number of template copies is greatly decreased when
DNA is extracted from infected plant tissue compared to when
purified fungal DNA is used.
Applications
The technique described in this project has possible
applications for detecting the fungus in field-grown plants
and in soil.
Primer directed amplification of G. qraminis
DNA might possibly find use in early diagnosis of the takeall in seedlings which are not displaying obvious disease
symptoms.
Currently, diagnosis of take-all is done on the
basis of the host response and definitive identification of
G. qraminis v a r . tritici as the etiological agent requires
isolating the fungus from diseased plants.
Since G.
qraminis is a relatively poor competitor, a highly selective
medium which is also somewhat inhibitory for G . qraminis is
required for isolation of the fungus from plant samples and
therefore may not recover all viable hyphae (33; Henson, and
Mathre, unpublished observations).
Use of the polymerase chain reaction may allow the
development of a Gaeumannomvces soil detection assay.
The
42
use of nested primer sets, with their increased specificity,
may make it possible to detect the fungus in soil where many
microorganisms exist.
Currently one cannot reliably detect
the presence o f .G. graminis var. tritici in known infested
soils.
Bioassays,
in which seedlings are grown in soil from
suspect plots, were shown to be unreliable and were
discontinued by the late 1960's (30).
Hyphae isolation
methods only rarely detect the take-all fungus in soil (74)
and the highly selective medium described above is
inconsistent in its ability to isolate G. graminis from soil
(33).
PCR has been successful in detecting as few as one
bacterial cell per gram soil sediment from environmental
samples
(68) which is over a four log increase in
sensitivity compared to the number of bacterial cells
detected when a DNA probe was used alone (27) .
A soil
detection assay for Gaeumannomvces would greatly facilitate
forecasting of take-all which currently has a reputation as
being an unpredictable disease (33).
43
LITERATURE CITED
1. Anderson, M. J., and S. T . Nameth. 1990. Development of
a polyclonal antibody-based serodiagnostic assay for the
detection of Xanthomonas camoestris pv. pelargonii in
Geranium plants. Phytopathology 80:357-360.
2. Asher, M. J. C. 1978. Isolation of Gaeumannomyces
araminis var. tritici from roots. Trans. Br. mycol. So c .
71:322-325.
3. Bhagavati, S., G. Ehrlich, R. Kula, S . Kwok, J.
Sninsky, V. Udani, and B. Poiesz. 1988. Detection of human
T-cell lymphoma/leukemia virus-type I (HTLV-I) in the spinal
fluid and blood of cases of chronic progressive myelopathy.
N. Engl.-J. Med. 318:1141-1147.
4. Belak, S., A. Ballagi-Pordany, J. Flensburg, arid A.
Virtanen. 1989. Detection of pseudorabies virus DNA
sequences by the polymerase chain reaction. Arch. Virol.
108:279-286.
5. Besal, E . A., T . 0. Powers, A. D. Radice, and L. J.
Sandall. 1988. A DNA hybridization probe for detection of
soybean cyst nematode. Phytopathology 78:1136-1139.
6. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline
extraction procedure for screening recombinant plasmid D N A .
Nucleic Acid R e s . 7:1513-1523 .
7. Brown, M., and D. Hornby. 1971. Behavior of Ophiobolus
araminis on slides buried in soil in the presence or absence
of wheat seedlings. Trans. Br. mycol. Soc. 56:95-103.
8. Bruns, T . D., R. Fogel, and J . W. Taylor. 1990.
Amplification and sequencing of DNA from fungal herbarium
specimens. Mycologia 82:175-184.
9. Chamberlain, J. S., R. A. Gibbs, J. E . Ranier, P. N.
Nguyen, and C. T . Caskey. 1988. Deletion screening of the
Duchenne muscular locus via multiplex DNA amplification.
Nucleic Acids Res. 16:11141-11156.
10. Chambers, S.C. 1970. Nuclear distribution in vegetative
cells of Onhiobolus araminis and other cereal root
pathogens. Au s t . J . biol. S c i . 2,3 :1105-1107.
11. Chambers, S ., and N . Flentje. 1967. Studies on
variation with Ophiobolus araminis. Aus t . J. biol. S c i .
20:941-951.
44
12. Christensen, N. W . , R.. L. Powelson, and M. Brett. 1987.
Epidemiology of wheat take-all as influenced by soil pH and
temporal changes in inorganic soil N. Plant and Soil
98:221-230.
13. Chung, C . T., S . L. Niemela, and R. H. Miller. 1989.
One-step preparation of competent Escherichia
coli :Transformation and storage of bacterial cells in the
same solution. Proc. Natl. Acad. Sci. USA 86.: 2172-2175.
14. Clarkson, D. T., M. C. Drew, I. B. Ferguson, and J.
Sanderson. 1975. The effect of the take-all fungus,
Gaeumannomvces crraminis, on the transport of ions in wheat
plants. Physiol. Plant Path..6:75-84.
15. Clarkson, J. D. S., and R. W. Polley. 1981. Diagnosis,
assessment, crop-loss appraisal and forecasting, p. 251-269.
In M. J. C . Asher and P. J. Shipton (ed.), Biology and
Control of Take-All. Academic Press, Inc. (London), Ltd.,
London.
16. Cunningham, P. C. 1981. Isolation and culture, p. 103123. In.M. J. C . Asher and P. J. Shipton (ed.), Biology and
Control of Take-All. Academic Press, Inc. (London), Ltd.,
London.
17. Demmler, G. J., G. J. Buffone, C. M. Schimbor, and R.
A. May. 1988. Detection of cytomegalovirus in urine from
newborns by using polymerase chain reaction DNA
amplification. J. Infect. Dis. 158:1177-1184.
18. Denny, T . P. 1988. Differentation of Pseudomonas
svringae pv. tomato from P. s. syringae with a DNA
hybridization probe. Phytopathology 78:1186-1193.
19. Devereux, J., P . Haeberli, and 0. Smithies. 1984. A
comprehensive set of sequence analysis programs for the VAX.
Nucleic Acid Res. 12:387-395.
20. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988.
Rapid production of full-length cDNA]s from rare
transcripts: Amplification using a single gene-specific
oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85,:89989002.
21. Garrett, S. D. 1938. Soil conditions and the take-all
disease of wheat. Ann. appl. Biol. 25:742-766.
22. Garrett, S. D. 1981. Introduction, p. 1-14. In M. J. C.
Asher and P. J. Shipton (ed.), Biology and Control of TakeAll . Academic press, Inc. (London), Ltd. London.
45
23. Gibbs, R. A., P.-N. Ngnyen, and C. T . Caskey. 1989.
Detection of single DNA base differences by competitive
oligonucleotide priming. Nucleic Acids Res. 17:2437-2443♦
24. Glynne, M. 1935. Incidence of take-all on wheat and
barley on experimental plants at Woburn. Ann. appl. Biol.
22:225-235.
25. Goodwin, P. H., J. T . English, D. A. Neher, J . M.
Duniway, and B . C. Kirkpatrick. 1990. Detection of
Phvtoohthora parasitica from soil and infected host tissue
with a species-specific DNA probe. Phytopathology 80:277281.
26. Henson, J. M. 1989. DNA probe for identification of the
take-all fungus, Gaeumannomvces qraminis. A p p l . Envir.
Microbiol, 55:284-288.
27. Holben, W. E., J. K. Jansson, B. K. Chelin, and J. M . _
Tiedje. 1988. DNA probe method for the detection of specific
microorganisms in the soil bacterial community. App l . Envir.
Microbiol. 54:703-711.
28. Holden, J. 1976. Infection of wheat seminal roots by
varieties of Philaloohora radicicola and Gaeumannomvces
qraminis. Soil Biol. Biochem. 8.: 109-119.
29. Hornby, D. 1969. Methods of investigating populations
of the take-all fungus COnhiobolus qraminis) in soil. Ann.
appl. Biol. 64:503-513.
30. Hornby, D. 1978. The problems of trying to forecast
take-all, p.151-158. In P. R. Scott and A. Bainbridge (ed.),
Plant Disease Epidemiology. Blackwell Scientific
Publications, London.
31. Hornby, D. 1981. Inoculum, p. 271-293. In M. J. C.
Asher and P. J. Shipton (ed.) , Biology and Control of Take.A l l . Academic Press, Inc. (London), Ltd., London.
32. James, W. 1974. Assessment of plant diseases and
losses. Ann. Rev. Phyto. 12:27-48.
33. Juhnke, M. E., D. E . Mathre, and D. C. Sands. 1984. A
selective medium for Gaeumannomvces qraminis var. tritici.
Plant D i s . 68:233-236.
34. Kirkpatrick, B., D. Stienger, T . Morris, and A.
Pincell. 1987. Cloning and detection of DNA from a
nonculturable plant pathogenic mycoplasma-like organism.
Science 238:197-200.
46
35. Kleppe, K . , E . Ohtsuka, R. Kleppe, I. Molineux, and H.
G. Khorana. 1971. Studies on polynucleotides. XCV I . Repair
replication of short synthetic DNA's as catalyzed by DNA
polymerases. J . Mol. Biol. 56:341-361.
36. Lampel, K. A., J. A. Jagow, M. Trucksess, and W. E.
Hill. 1990. Polymerase chain reaction for detection of
invasive Shigella flexneri in food. App l . Envir. Microbiol.
56:1536-1540.
37. Lee, C. C., X. W u , R. A. Gibbs, R. G . Cook, D. M.
Muzny, and C. T . Caskey. 1988. Generation of cDNA probes
directed by amino acid sequence: Cloning of urate oxidase.
Science 239:1288-1292.
38. Lee, S. B., and J. W. Taylor. 1990. Isolation of DNA
from fungal mycelia and single spores, p. 282-287. In M. A.
Innis, D. H. Gelfand, J. J. Sninsky, and T . J. White (ed.),
PCR protocols:A guide to methods and applications. Academic
Press, Inc. (London), Ltd., London.
39. L o h , E . Y., J. F. Elliott, S. Cwirla, L. L. Lanier, and
M. M. Davis. 1989. Polymerase chain reaction with single­
sided specificity: Analysis of T cell receptor delta chain.
Science 243:217-220.
40. Mack,
method for
related to
Proc. Nat.
D. H., and J. J. Sninsky. 1988. A sensitive
the identification of uncharacterized viruses
known virus groups: Hepadnavirus model system. .
Acad. Sci. USA 85:6977-6981.
41. Manicom, B. Q., M. Bar-Joseph, J . M. Kotze, and M. M.
Becker. 1990. A restriction fragment length polymorphism
probe relating vegetative compatibility groups and
pathogenicity in Fusarium oxysporum f . sp. dianthi.
Phytopathology 80:336-339.
42. Mann, L. M. 1990. The molecular basis of Mengoyirus
hemagglutination. PhD Thesis, Montana State University,
Bozeman MT.
43. Miller, J. H. 1972. Experiments in molecular genetics,
p.431-433 . Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.
44. Moser, D. R., G. A. Cook, D. E . Ochs, C. p. Bailey, M.
r . McKane, and J. E . Donelson. 1989. Detection of
Trypanosoma conoolense and Trypanosoma brucei subspecies by
DNA amplification using the polymerase chain reaction.
Parasitology 99:57-66.
47
45. Naiki, T., and R. J. Cook. 1983. Relationship between
production of a self-inhibitor and inability of
Gaeumannomvces araminis var. tritici to cause take-all.
Phytopathology 73.: 1657-1660.
46. Ochman, H., A. S. Gerber, and D . L. Hartl. 1988.
Genetic applications of an inverse polymerase chain
reaction. Genetics 120:621-623.
47. O u , C.-Y., S . Kwok, S . W. Mitchell, D. H. Mack, J . J .
Sninsky, J. W. Krebs, P. Feorino, D. Warfield, and G.
Schochetman. 1988. DNA amplification for direct detection of
Hiv-1 in DNA of peripheral blood mononuclear cells. Science
238:295-297.
48. Permar, T . A., S . M. Garnsey, D. J. Gumph, and R. F.
Lee. 1990. A monoclonal antibody that discriminates strains
of citrus tristeza virus. Phytopathology 80:224-228.
49. Reed, K. C., and D . A. Mann. 1985. Rapid transfer of
DNA from agarose to nylon membranes. Nucleic Acids Res.
13:7207-7221.
50. Rollo, F., A. Amici, F . Foresi, and I. Silvestro. 1987.
Construction and characterization of a cloned probe for the
detection of Phoma tracheiohila in plant tissue. Ap p l .
Microbiol. Biotechnol. 26:352-357.
51. Rollo, F., R. Salvi, and P. Torchia. 1 9 9 0 . Highly
sensitive and fast detection of Phoma tracheiohila by
polymerase chain reaction. A p p l . Microbiol. Biotechnol.
32:572-576.
52. Romanos, M. A., C. Rawlinson, M . _Almond, and K. Buck.
1980. Production of fungal growth inhibitors by isolates of
Gaeumannomvces araminis var. tritici. Trans. Br. mycol. Soc.
74:79-88.
53. Saiki, R., D. H. Glenfand, S. Stoffel, S. J. Scharf, R.
Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988.
Primer directed enzymatic amplification of DNA with a
thermostable DNA polymerase. Science 239^487-494.
54. Saiki, R., S. Scharf, F . Faloona, K. B. Mullis, G.
T.Horn, H. A. Erlich, and N . Arnheim. 1985. Enzymatic
amplification of and restriction site analysis for diagnosis
of sickle cell anemia. Science 23 0 :1350-1354.
55. Sambrook, J., E . F . Fritsch, and T . Maniatis. 1989.
Molecular Cloning:A laboratory manual. Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.
48
56. Samual, G., and S. Garrett. 1933. Ascospore discharge
in Oohiobolus graminis. and its probable relation to the
development of white heads in wheat. Phytopathology 2J3:721728.
57. Sanger, F., and A. R. Coulson. 1978. The use of thin
polyacrylamide gels for DNA sequencing. FEES Letters 82:107110.
58. Sanger, F., S . Nicklen, and A. R. Coulson. 1977. DNA
sequencing with chain terminating inhibitors. Proc. Natl.
Acad. S c i . USA 74:5463-5467.
59. Schaffer, H. E., and R. R. Sederoff. 1981. Improved
estimation of DNA fragment lengths from agarose gels. Anal.
Biochem. 115:113-122.
60. Scott, P. R. 1970. Phialophora radicicola, an avirulent
parasite of wheat and grass roots. Trans. Br. my c ol.' S o c .
55:163-167.
61. Shipton P. J. 1981. Saprophytic survival between
susceptible crops, p. 295-316. In M. J. C . Asher and P. J.
Shipton (ed.), Biology and Control of Take-All. Academic
Press, Inc. (London), Ltd. , London.
62. Simon, A., and K. Sivasithamparam. 1988a. Crop rotation
and biological suppression of Gaeumannomvces graminis var.
tritici in soil. Trans. Br. mycol. Soc. 91:279-286.
63. Simon, A., and K. Sivasithamparam. 1988b. Effect of
application to soil of nitrogenous fertilizers and line on
biological suppression of Gaeumannomvces graminis var.
tritici. Trans. Br. mycol. Soc. 91:287-294.
64. Simon, A., K. Sivasithamparam, and G. MacNish. 1987.
Biological suppression of the saprophytic growth of
Gaeumannomvces graminis var. tritici in soil. Can. J.
Microbiol. 33:515-519.
65. Skou, J. P. 1981. Morphology and cytology of the
infection process, p. 175-197. In M. J. C. Asher and P. J.
Shipton (ed.), Biology and Control of Take-All. Academic
Press, Inc. (London), Ltd., London.
66. Slope, D., G. Salt, E . Broom, and R. Gutteridge. 1978.
Occurrence of Phialophora radicicola v a r . graitiinicola and
Gaeumannomvces graminis v a r . tritici on roots of wheat in
field crops. Ann. appl. Biol. 88:239-246.
49
67. Southern, E . M. 1975. Detection of specific sequences
among DNA fragments separated by gel electrophoresis. J.
Mol. Biol. 98:503-517.
68. Steffan, R. J., and R. M. Atlas. 1988. DNA
amplification to enhance detection of genetically engineered
bacteria in environmental samples. Appl. Envir. Microbiol.
54:2185-2191.
69. Thomashow, L. S., and D. M. Weller. 1988. Role of a
phenazine antibiotic from Pseudomonas fluorescens in
biological control of Gaeumannomvces graminis var. tritici.
J. Bacteriology 170:3499-3508.
70. Thomashow, L. S., D.' M. Weller, R. F . Bonsall, and L.
5. Pierson III. 1990. Production of the antibiotic
phenazine-l-carboxylic acid by fluorescent Pseudomonas
species in the rhizosphere of wheat. A p p l . Envir. Microbiol.
56:908-912.
71. Thompson, E., J. V. Leary, and W. W. C. Chun. 1989.
Specific detection of Clavibacter michiganense subsp.
michiganense by a homologous DNA probe. Phytopathology
79:311-314.
72. Tonnequzzo, F., S . Glynn, E . Levi, S . Mjolsness, and A.
Hayday. 1988. Use of a chemically modified T7 DNA polymerase
for manual sequencing of supercoiled DN A . Biotechniques
6, :460—4 69.
73. Walker, J. 1972. Type studies on Gaeumannomyces
graminis and related fungi. Trans. Br. mycol. S o c . 58:427457.
74. Warcup, J. H. 1957. Studies on the occurrence and
activity of fungi in a wheat-field soil. Tran. Br. mycol.
S o c . 40:237-259.
75. Weller, D. M., and R. J. Cook. 1983. Suppression of
take-all of wheat by seed treatments with fluorescent
Pseudomonads.
Phytopathology 73.: 463-469.
76. Weller, D. M., W. J. Howie, and R. J. Cook. 1988.
Relationship between jin vitro inhibition of Gaeumannomvces
graminis var. tritici and suppression of take-all of wheat
by fluorescent pseudomonads. Phytopathology 78.: 1094-1100.
77. Weste, G. 1972. The process of root infection by
Oohiobolus graminis. Trans. Br. mycol. Soc. .59.:133-147.
50
78. White, T. J., T. Burns, S . Lee, and J. Taylor. 1990.
Amplification and direct sequencing of fungal ribosomal RNA
genes for phylogenetics. In M. A. Irtnis, D. H. Gelfand, J.
J. Sninsky, and T. J. White (ed.), PCR Protocols: A guide to
methods and applications. Academic Press, Inc. (London),
Ltd., London.
79. Wong, P. T . W., and R. J. Southwell. 1980. Field
control of take-all by avirulent fungi. Ann. appl. Biol.
94:41-49.
MONTANA STATE UNIVERSITY ITROAOTP;
762 10072621 3