Genetic variation in Montana populations of the rangeland grasshopper, Melanoplus sanguinipes
by Paul Joseph Parrinello
A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in
Biological Sciences
Montana State University
© Copyright by Paul Joseph Parrinello (1995)
Abstract:
Several methods were evaluated for effectiveness in revealing spatial and temporal genetic variation in
three Montana populations of the rangeland grasshopper, Melanoplus sanguinipes (F.). Samples were
from the annual collections of the U.S.D.A. Rangeland Insect Lab in Bozeman, MT, and taken at sites
near Broadus, Havre, and Three Forks. The methods used to assess genetic variability were Restriction
Fragment Length Polymorphism (RFLP) analysis of Southern blots, Random Amplification of
Polymorphic DNA (RAPD), RFLP analysis of Polymerase Chain Reaction (PCR) products, and DNA
sequencing. RFLP's of Southern blots and RAPD trials revealed little information. RFLP's of PCR
products did not show variability in a 2500 base pair (bp) fragment with partial sequences of the
cytochrome b gene and the large subunit of rRNA (16S) gene, and the complete NADH dehydrogenase
subunit 1 (ND-1), tRNAleu, and tRNAser genes. Incomplete digests made results difficult to interpret
in this application of RFLP techniques. DNA sequencing did not reveal significant variation between
populations in an ND-1 region sequence. However, novel sequences in the ND-1 and 16S genes were
revealed. These sequences were compared with homologous ND-1 and 16S sequences in 11 species of
insects representing 6 different orders, and consensus trees were constructed using the Phytogeny
Inference Package (PHYLIP) Programs. The trees showed high levels of genetic similarity between M
sanguinipes and another Orthopteran, Locusta migratoria. The trees also supported the grouping of two
Lepidopteran and two Hymenoptera species, but offered limited resolution for the Dipterans,
Homopterans, and Coleopterans. These results concur with previous phylogenetic studies based on
insect mitochondrial DNA (mtDNA). Although no genetic differences were uncovered in this study, a
potentially useful methodology for discovering polymorphic sequences was determined. By testing
more insect mtDNA PCR primers, regions that have useful polymorphisms could be amplified and
subsequently sequenced. f
I
\
GENETIC VARIATION IN MONTANA POPULATIONS OF THE RANGELAND
GRASSHOPPER, Melanoplus sanguinipes
by
Paul Joseph Parrinello
A thesis submitted in partial fulfillment
o f the requirements for the degree
of
Master of Science
in
Biological Sciences
MONTANA STATE UNIVERSITY
Bozeman, Montana
November 1995
APPROVAL
o f a thesis submitted by
Paul Joseph Parrinello, J r
This thesis has been read by each member of the thesis committee and has been found to be
satisfactory regarding content, English usage, format, citations, bibliographic style, and consistency, and is ready
for submission to the College of Graduate Studies.
r
Date
C
Chairperson, Graduate
Gradi
Committee
Approved for the Major Department
X
Date
pmmi
Head, Major Department
Approved for the College of Graduate Studies
Graduate Dean
STATEMENT OF PERMISSION TO USE
In presenting this thesis in partial MQUment o f the requirements for a master’s degree at Montana State
University-Bozemani I agree that the Library shall make it available to borrowers under the rules o f the Library.
I further agree that copying o f this thesis is allowable only for scholarly purposes, consistent with “fair use” as
prescribed in the U.S. Copyright Law. Requests for extensive copying or reproduction o f this thesis should be
referred to University Microfilms International, 300 North Zeeb Road, Ann Arbor, Michigan 48106, to whom
I have granted “the exclusive right to reproduce and distribute my abstract in any format in whole or in part.”
S ig n a tu r % % ^ ^ d ^ ^ ^ J -^
Date / / / 2 2
/W '
iv
1
i
ACKNOWLEDGMENTS
I would like to gratefully acknowledge Emie Vyse for his time and patience in teaching me
molecular biology from the ground up. I would also like to acknowledge Bill Kemp for initiating this project, and
more importantly for the encouragement given along the way. M att Lavin, for his efforts in showing me how to
use the PHYLlP programs and for teaching a fascinating class in evolution^ and Dave Cameron for teaching a
great class in evolutionary genetics and for coming but o f retirement and providing input on this thesis.
Chris Simon, Rob DeSalle, Ann Gerber, and William Chapco also deserve recognition for sharing their
expertise and materials with us.
TABLE OF CONTENTS
INTRODUCTION
MATERIALS AND METHODS ............................. ...................................
Grasshopper Samples .....................................................................
DNA extraction ................................................................................
DNA Purification.............................................................................
DNA Analysis with Restriction Fragment Length Polymorphisms
DNA R estriction.................................................................
Southern T ransfer...............................................................
Transformation o f mt DNA P ro b e s ..................................
Radiolabeling P r o b e s ............................... .....................
Hybridization ........................................ .......... ..................
Polymerase Chain Reaction (PCR) Methods ..................................
Random Amplification of Polymorphic DNA (R A PD )..
PCR with Mitochondrial Primers ......................................
P C R /R F L P ..........................................................................
L igations................................................................... ........................
DNA S equencing..............................................................................
Polymorphisms in mtDNA Sequence................... ........
Analysis of Sequence D a ta .........................
..........
RESULTS ................... ...............................................
DNA extraction ...............................................
DNA Purification................... .....................
DNA Analysis with RFLP’s .........................
Southern T ransfer.............................
Transformation of m t DNA Probes .
RFLP’s ..............................................
PCR M eth o d s...................................................
R A P D P C R ..................... ..................
PCR with Mitochondrial Primers . . .
P C R /R F L P ........................................
L igations....................... ■......... .........................
DNA S equencing............................................
Polymorphisms in mtDNA Sequence
DNA Sequence Analysis .................
D IS C U S S IO N .............,..............................
DNA Extraction and Purification
DNA Analysis with R F L P 's........
PCR M eth o d s...............
L igations........................
DNA S equencing.........
DNA Sequence Analysis
CO N C LU SIO N S.......................
LITERATURE C IT E D .............
vii
LIST OF TABLES
1. Oligonucleotide Sequences for primers used in amplification o fMelanoplus mtDNA ..
15
2. Species used in mitochondrial DNA comparisons .............................................................
26
3. Bands produced by non-polymorphic restriction enzymes ,.................................................
29
4. Bands produced by hybridization o f EcoRV b l o t s ............................................
• ...........
30
5. Bands produced by hybridization of AluI blots .................................................................
30
6. Bands produced by restriction of 25681/25682 PCR p ro d u c t..........................................
32
7. Bands produced by restriction of 23944/25682 PCR p ro d u c t..........................................
33
8. Oligonucleotide Sequences for primers used for sequencing 23944/25682 PCR product
34
viii
LIST OF FIGURES
1. Partial sequence o f the ND -I gene ................................. .......... ; ........... ................................
35
2. The partial sequence o f the 16S re g io n ........................................................................................................... 36
3. The mtDNA sequence resulting from priming with PPl .....................
..................................................... 37
4. Aligned sequences used to calculate genetic distances......................... ........................................................ 37
5. Genetic distances between 11 insect species, based on partial ND -I and 16S sequences......................... 43
6. A consensus tree generated from neighbor-joining trees .............................................................................. 44
7. A consensus tree generated from UPGMA trees ...................................................................................... .... 45
ix
ABSTRACT
Several methods were evaluated for effectiveness in revealing spatial and temporal genetic variation in
three Montana populations of the rangeland grasshopper, Melanoplus sanguinipes (F.). Samples were from the
annual collections o f the U.S.D.A. Rangeland Insect Lab in Bozeman, MT, and taken at sites near Broadus,
Havre, and Three Forks. The methods used to assess genetic variability were Restriction Fragment Length
Polymorphism (RFLP) analysis of Southern blots, Random Amplification o f Polymorphic DNA (RAPD), RFLP
analysis o f Polymerase Chain Reaction (PCR) products, and DNA sequencing. RFLP's o f Southern blots and
RAPD trials revealed Uttle information. RFLP's of PCR products did not show variability in a 2500 base pair (bp)
fragment with partial sequences of the cytochrome b gene and the large subunit o f rRNA (16S) gene, and the
complete NADH dehydrogenase subunit I (ND-1), IRNAleu, and IRNAser genes. Incomplete digests made results
difficult to interpret in this appUcation o f RFLP techniques. DNA sequencing did not reveal significant variation
between populations in an ND -I region sequence. However, novel sequences in the N D -I and 16S genes were
revealed. These sequences were compared with homologous ND -I and 16S sequences in 11 species of insects
representing 6 different orders!, and consensus trees were constructed using the Phytogeny Inference Package
(PHYLIP) Programs. The trees showed high levels of genetic similarity between M sanguinipes and another
Orthopteran, Locusta migratoria. The trees also supported the grouping o f two Lepidopteran and two
Hymenoptera species, but offered limited resolution for the Dipterans, Homopterans, and Coleopterans. These
results concur with previous phylogenetic studies based on insect mitochondrial DNA (mtDNA). Although no
genetic differences were uncovered in this study, a potentially useful methodology for discovering polymorphic
sequences was determined. By testing more insect mtDNA PCR primers, regions that have useful polymorphisms
could be amplified and subsequently sequenced.
I
INTRODUCTION
Rangeland grasshoppers (Orthoptera: Acrididae) have been studied extensively in Montana with regard
to changes in community structure (Kemp, 1992a) and density dependence (Kemp and Dennis, 1993) over time.
Periodic outbreaks of grasshoppers have damaged agricultural and range areas (Hewitt, 1983). The relationship
between climate and outbreaks has been asserted (for example, Fielding and Brusven, 1990), but is too variable
to use in forecasting (Kemp and Dennis, 1993). Also, little is known about the genetic characteristics o f the
species that make up these communities. Two major concerns in assessing these characteristics are genetic
variability over time, and genetic variability between geographically distinct populations.
We chose to examine Melanoplus sanguinipes because of its important role in grasshopper communities
as the greatest contributor to fluctuations in rangeland grasshopper density (Kemp, 1992b). The study began as
an effort to test the hypothesis that genetic variation occurs temporally and spatially in M ontana populations of
this species. The molecular techniques used to show this variation were restriction analysis using Southern blots,
restriction analysis o f PCR products, and DNA sequencing. The two RFLP methods were generally unreliable
and uninformative. Sequencing did not expose significant variation but did reveal novel 16S nbosomal RNA and
N D -I mtDNA sequences. These were compared to other available homologus insect sequences from various
orders and entered in the GenBank database.
These and other molecular techniques have been implemented to reveal clear quantitative differences
between closely related species, subspecies, and populations. Allozyme analyses, for example, have been used
to study variation in Drosophila (Lewontin and Hubby, 1966), to conduct phylogenetic anaylses between and
within seven species.of the Coleopteran genus Chauliognathus (Howard and Shields, 1990), and to differentiate
between populations of the weevil Rhinocyllus conicus (Klein and Seitz, 1994). Allozymes are proteins that vary
in amino acid sequence without changes in identity or fimction. By electrophoretically separating several
allozymes from different individuals, a quantitative measure of genetic distance (that is ultimately reflective o f
DNA sequence differences) between the individuals can be attained. However, redundance in the amino acid code
and other translational factors can affect the utility of this technique.
Random amplification o f polymorphic DNA (RAPD) is a PCR technique that uses small (8-12 bp)
arbitrary primers to produce amplified DNA fragments o f various sizes. The presence or absence o f a given
fragment is determined by the presence or absence o f a template DNA sequence complementary to two o f the
primers. Differences in DNA sequence between samples are evidenced by the differing band patterns that result
when randomly primed samples are compared electrophoretically. This technique has been used to distinguish
colonies o f predatory Coccinellids (Roerdanz and Flanders, 1994) and its potential for use in systematics and
population genetics studies of grasshoppers was asssessed by Chapco, et al. (1992). The technique is facile, but
artifactual results from inconsistent priming are a potential problem.
Since the 1980's, the use of mitochondrial DNA (mtDNA) has become widespread in phylogenetic and
taxonomic studies. The study o f mtDNA has several distinct advantages over other molecular techniques. The
mtDNA molecule has a finite size (around 16 kb for most species) and exhibits conservation in overall sturcture.
It is commonly thought to evolve more rapidly and have a greater proportion of coding sequences compared to
nuclear DNA, which has many repeated and non-coding regions (Brown, et. al., 1979), although there is recent
evidence to the contrary (Lynch and Jarrell, 1993). MtDNA is generally inherited maternally and cytoplasmically,
and thus is not subject to recombinations during meiosis (Avise, et. a l, 1979). With a few exceptions (Harrison,
et a l, 1985), mtDNA is homoplasmic in each individual.
Until recently, most mtDNA studies employed restriction fragment length polymorphisms (RFLP's).
These polymorphisms were revealed by hybridizing labeled mtDNA probes to digested DNA on Southern Blots
(Southern, 1975). Phylogenetic resolution between and within species could be detected in many instances. Martel
and Chapco (1995) used these techniques to study genetic variation and population structure of banded-wing
grasshoppers (subfamily Oedipodinae) and Chapco, et. al. (1994) examined variation within and among members
3 •
.
.
o f the genus Melcmoplus. Harrison, et al., (1987) used RFLP's o f mtDNA to investigate hybridization of two
cricket species, Gryllus firmus and G. pennsylvanicus, in relation to geographib location and soil type.
Intraspecific variation between two subspecies of honey bee {Apis mellifera mellifera and A. m. camica) has also
been revealed (Smith and Brown, 1990). Distinction between broods of 17-year cicadas was accomplished by
applying RJFLP techniques to a large mitochondrial PCR fragment (Simon, et. al., 1993).
In the last few years, advances in technology have allowed the sequencing o f mtDNA (Sanger, et a l,
1977) to become a widely used tool for phylogenetic and taxonomic studies. Generally, the template DNA is a
mitochondrial PCR fragment. The DNA sequence of an individual can be directly compared to a homologous
sequence from another individual or group of individuals, and sequence similarities and differences may be used
to determine phytogenies. Several regions o f the mitochondrial genome have been shown to have high
phylogenetic utility at various taxonomic levels. Sequences in the cytochrome oxidase I (COI), cytochrome
oxidase II (COII), and cytochrome oxidase HI (COIII) genes are the most commonly examined. An interesting
cladistic analysis often insect orders was conducted using 673 bp of the COH gene (Liu and Beckenbach, 1992)
and phylogenetic relationships between 6 species of spruce budworm (genus Choristoneura) were determined
iiging COI and COH sequences and the tRNA leucine gene that lies between them (Sperling and Hickey, 1994).
Tprm iin and Crazier (1994) compared the cytochrome b sequence of the ant (Tetraponera rufomger) to those
O fD m M fW b y a W a (ClaiyandWolstenhome, 1985) a n d # ; , m g # r a (Crozier and Crozier, 1993). The large
ribosomal RNA gene (16S) is another frequently sequenced mitochondrial region. Hymenopteran phytogeny was
analyzed using 16S sequences (Derr, et al., 1992) and variation within and among blackflies (Diptera: Siinuliidae)
has been studied in detail by Xiong and Kocher (1991, 1993). SevenNADH dehydrogenase subunit genes are
distributed throughout the mitochondrial genome; subunit one (ND-I) is frequently sequenced. Weller, et al.
(1994), compared phytogenies based on ND-1 sequences to phytogenies based on nuclear sequences that code
for the 28S ribosomal KNA, and created a phytogeny based on. both sequences. Sequence data from 3
mitochondrial regions (COIII, ND-1, and 16S) were combined to provide an intraspecific phytogeny for
4
geographically and morphologically distinct subspecies of Cicindeld dorsalis Say, a North American tiger beetle
(Vogler and DeSalle, 1993).
The number o f published mtDNA sequences for insect species is increasing rapidly as new PCR primers
are found. Improved access to sequence databases (such as GenBank) through the Internet have made searching
for homologous sequences much easier. Widely available programs such as PHYLIP (Phytogeny Inference
Programs; Felsenstem, 1993) allow sequence data to be quickly converted into phylogenetic data.
From this research, it is evident that sequencing gives clearer and more useful results than the RFLP
techniques, and that future efforts studying the genetics ofMelanoplus sanguinipes should be, directed at finding,
amplifying, and sequencing a more variable region of the mtDNA.
MATERIALS AND METHODS
Grasshopper Samples
Melanoplus sanguinipes samples were obtained from the annual collections o f the USDA Rangeland
Insect Laboratory in Bozeman, MT. These collections were made at several sites throughout Montana from 1986
to 1992. To attain maximum geographical separation, grasshoppers from sites near Broadus, Havre, and Three
Forks were used. The collections were maintained a t-15° C, but were transferred to a -20° C freezer upon arrival.
Live samples (a non-diapause strain from Colorado) were also used to determine if freezing at -15° C caused
DNA degradation. Live grasshoppers were maintained for several days in a plastic tube that contained grass and
sawdust, and had a removable screen on one end.
DNA extraction
Three protocols for DNA extraction were tried. The first (Davis, et al., 1980) entailed homogenizing
grasshoppers either on dty ice with a mortar and pestle or by chopping finely with a razor blade, then placing the
homogenate on ice in a 2.0 ml centrifuge tube. Both live and frozen grasshoppers were used. Additionally, various,
body parts were removed (head, abdomen, and intestinal tract) from some samples to determine effects on
extraction efficiency. Six hundred and fifty pi buffer (0.1 M EDTA, 0.2 M Tris), 100 pi 10% SDS, and 20 pi
proteinase K (10 mg/ml) were added to the sample tubes, which were then incubated 2 hours at 65° C, followed
by 3-24 hours incubation at 37° C. Four hundred pi of 5 M potassium acetate were then added to each sample,
prior to a 45 minute incubation on ice. The sample tubes were centrifuged at 14,000 RPM for 10 minutes, and
600 pi of the resulting supernatant were decanted into 1.5 ml centrifuge tubes. The tubes were filled with phenol-
chloroform-isoamyl alcohol (25:24:1) and spun 12 minutes at 14,000 K PM The top, aqueous layer was decanted
into a new tube, to which was added I volume phenol-chloroform-IAA. This mixture was centrifuged 2.5 minutes
at 14,000 RPM, and the aqueous layer was decanted into a new tube. The DNA was precipitated by adding I
volume isopropanol and freezing (-20° C) for 2 hours, then pelleted by spinning 15 minutes at 14,000 KPM.
Pellets were rinsed by adding 30 pi 70% ethanol and centrifuging 3 minutes at 14,000 RPM. The ethanol was
then discarded and any that remained was allowed to evaporate at room temperature. The dried pellet was
resuspended in 150 pi double-distilled water (ddH20).
The second procedure (Rand and Harrison, 1989) started with homogenization in liquid nitrogen using
a mortar and pestle. Whole grasshoppers and grasshoppers without intestinal tracts and heads were used. The
homogenate was placed in a 1.5 ml tube and 500 pi of buffer (0.1 M Tris, 0.05 M EDTA, 0.2 M sucrose, 0.5 /o
SDS) were added. The procedure called for the addition o f 5 pi diethylpyrocarbonate, which was unavailable, so
2-mercaptoethanol was substituted. Sample tubes were incubated at 70° C for 30 minutes prior to additional
homogenization \yith a glass pestle. The tubes were then filled with 5 M potassium acetate, and placed on ice for
I hour. Using a glass pestle, the solid contents o f the tube were compressed, and the supernatant was decanted
into new tubes, which were then filled with isopropahol and frozen overnight. Samples were then spun 10 minutes
at 14,000 RPM. The supernatant was decanted into new tubes and incubated 10 minutes at 37° C, with 100 pi
TE buffer and 2 pi RNAase (10 pg/pl). One volume of phenol was added, then samples were briefly vortexed
and spun 10 minutes at 14,000 RPM. The aqueous layer was decanted and extracted as above, first with phenolchloroform-IAA, then with chloroform-IAA. The chloroform extraction was spun for 3 minutes at 14,000 RPM.
DNA was precipitated by adding I volume of 95% ethanol to the supernatant and freezing for I hour, then
pelleted by centrifugation (15 minutes at 14,000 RPM). DNA pellets were rinsed in 70% ethanol and resuspended
in water as in the first protocol.
The third extraction protocol was modified from Gustincich, ,et al. (1991). Grasshopper leg muscles were
ground in 300 pi TE buffer (pH 8.8) in 2.0 ml microcentrifuge tubes. Six hundred pi DTAB (8%
dodecyltrimethylammonium bromide, 1.5 M NaCl, 100 mM Tris-HCL [pH 8.8], 50 mM EDTA) were mixed in,
and sample tubes were incubated 15 minutes at 68° C. Six hundred pi chloroform were mixed in, and tubes were
centrifuged 2 minutes at 10,000 RPM. The aqueous layer was decanted, re-extracted with chloroform, and
transferred to 1.5 ml centrifuge tubes containing 1.0 ml o f CTAB (5% hexadecyltrimethylammonium bromide.
0.4 M NaCl) diluted 1:10 with ddH20. The tubes were inverted gently and centrifuged 2 minutes at 10,000 RPM.
The supernatant was decanted and pellets were resuspended in 300 pi 1.2 M NaCl, then precipitated in 750 pi
ice-cold ethanol. The DNA was re-pelleted by centrifugation for 2 minutes at 10,000 RPM. The supernatant was
decanted and pellets rinsed in 300 pi 70% ethanol. Pellets were air-dried and dissolved in 100 pi ddH20.
DNA Purification
Several purification methods were tried in an effort to facilitate PCR amplification of more samples. The
procedure for use o f the Rapid Pure Miniprep Kit (Bio 101), began with the mixing o f 70 pi DNA sample with
250 pi Glassmilk Spinbuffer, and the placement of the mixture in a spin filter. Centrifugation was for I minute
at 14,000 RPM, and the filtrate was discarded. The DNA in the filter was rinsed twice by adding 250 pi o f wash
solution (provided) and centrifuging for I minute at 14,000 RPM. The DNA was then eluted into a 1.5 ml
centrifuge tube with 50 pi TE buffer, and centrifuged for 30 seconds at 14,000 RPM.
DNA was also purified using a Prep-A-Gene (Bio-Rad Laboratories) Kit. One hundred pi o f DNA
sample were vortexed with 315 pi binding buffer (provided), and the mixture was allowed to incubate 5 minutes
at room temperature. Five pi Prep-A-Gene powder were added, and the tube was spun 30 seconds at 14,000
RPM. The supernatant was discarded, and the resulting pellet was resuspended in 50 pellet volumes of binding
buffer. The tube was spun again, and the pellet re-suspended in binding buffer. Fifty pellet volumes o f wash
buffer were added, and the sample tube was vortexed and spun 30 seconds at 14,000 RPM; this was repeated
twice. One pellet volume o f elution buffer was added, and the sample tube was incubated for 5 minutes at 37°
C. The tube was spun 30 seconds at 14,000 RPM and the supernatant transferred to a new tube; this was done
8
three times. Twenty-five |al (IdH2C) were added to the 6 (xl extracted DNA.
Another procedure, using Chelex (Bio-Rad), was also tried. Twenty jxl sample DNA and 20 pi Chelex
100 (5%) were added to a centrifuge tube and incubated with shaking at 37° C for 45 minutes. The sample tube
was gently shaken by hand and placed in a heat block at 95° C for 5 minutes. It was shaken again by hand, then
spun for 30 seconds at 14,000 RPM. The supernatant was transferred to a new tube.
A Sepharose (Pharmacia) column was also used for purification. The column was prepared by puncturing
the bottom s o f 0.5 ml and 1.5, ml centrifuge tubes with a small-gauge hypodermic needle tip, and placing the
smaller tube inside the larger. Twenty-five pi of glass beads suspended in TE buffer were pipetted into the smaller
tube (using a cut-off tip). A layer o f 500 pi Sepharose CL-6B was pipetted in a similar manner over the glass
beads. The two tubes were placed inside a glass test tube that fit into a metal sleeve in a swinging bucket rotor
centrifuge, and the column was spun 5 minutes at 1800 RPM. The punctured 1.5 ml tube was replaced with a
new, intact tube. Fifty pi DNA sample were added and spun through the column for 5 minutes at 1800 RPM, and
the treated sample was collected in the new 1.5 ml tube.
Several methods for gel-purifying DNA were tested. The first used a polyester plug spin insert (PEPSI,
Glenn and Glenn, 1994). A I ml pipette tip cut at the wider end was placed inside a 1.5 ml centrifuge tube, with
the tapered end o f the tip in the bottom of the tube. A small amount of polyester fiberfill was inserted into the tip
and a slice o f agarose gel containing the desired DNA fragment was placed on top of the fiber. Then 50 pi TBE
was placed in the bottom o f the tube, and tubes were spun I minute at 4000 g.
Also, methods for gel-purification o f DNA using low melting point agarose were used, A procedure
modified from Sambrook, et. al. (1989), began with melting the gel slice containing the fragment o f interest in
2 volumes 20 mM Tris-Cl, I mM EDTA (pH 8.0), for 5 minutes at 65° C. An equal volume of phenol
(equilibrated to pH 8.0 with 0.1 M Tris-Cl) was added, and the mixture vortexed for 20 seconds. The sample tube
was spun for 10 minutes at 7000 RPM. The aqueous layer was removed, and again incubated 5 minutes at 65°
C, then re-extracted with phenol. The aqueous phase was re-extracted (without heating) with phenol-chloroform-
IAA, and again with chloroform-IAA. The aqueous layer was then transferred to a new tube, and DNA was
precipitated by freezing for 1-4 hours in 2 volumes ethanol and 0.2 volumes 10 M ammonium acetate. DNA was
pelleted by centrifiigation at 14’000 RPM for 25-30 minutes. The pellet was rinsed by spinning for 2.5 minutes
at 14,000 RPM with 25 pi 70% ethanol. The ethanol was removed with a disposable glass pipette (pulled over
a flame to create a narrow opening) and the pellet was suspended in 15 pi ddH20 .
DNA from low melting point agarose gels was also recovered using a Magic Miniprep Kit (Promega).
The gel slice containing the desired DNA fragment was melted in a 1.5 ml centrifuge tube at 70° C. One ml of
PCR Preps Resin was added, and the tube was vortexed for 20 seconds. A Magic Mini-Column was attached
by a Luer-Iock to a 3 ml syringe barrel, and the column tip was placed in a vacuum manifold. The resin/DNA
m ixture was pipetted into the syringe barrel, then drawn into the column with the vacuum. Washing was
facilitated by drawing 2 ml o f 80% isopropanol through the column, then the column was dried by vacuuming
for an additional two minutes. Anyremaining isopropanol was removed by centrifuging the column in a new 1.5
ml tube for 20 seconds at 12,000 g. DNA was eluted out of the column with 25 pi TE buffer by spinning for 20
seconds at 12,000 g.
DNA Analysis with Restriction Fragment Length Polymorphisms
DNA Restriction
Samples with DNA concentrations greater than 0.25 pg/pl were digested in reactions using 5.0 pg o f
DNA, 40 U o f restriction endonuclease, the appropriate buffer at a IX concentration, and ddH20 to 20 pi.
Enzymes with 4-base and 6-base recognition sites were used. Restriction reactions were incubated overnight at
37° C. Digested samples were mixed with 3.5 pi loading dye and run on a 1% agarose gel in IX TBE buffer. A
lane of 20 pi IHinHTn standard was also loaded into the gel. Electrophoresis was generally done overnight at 20
MA. Gels were stained in IX TBE (enough to cover the gel) with 10 pi ethidium bromide (EtBr) for 30 minutes
under agitation at room temperature. The gel was then photographed with UV light, and the positions o f the
10
IHinHTTT bands were noted relative to a ruler placed next to the standard lane. Thd gel was trimmed with a sterile
razor blade at the 564 bp band and near the 23,130 bp band and along the extreme top and bottom edges (to
remove any upturned areas). The upper left hand comer was removed to mark the orientation o f the gel. The
following enzymes were used: A M , ApaI, Aval, BamHI, BanI, BglII, CM , DdeI, DpnII, DraI, EcoRI, EcoRV,
HaeIII, HhaI, HindIII, Hinfl, H indi, HpaI, KpnI, MspI, PstI, PvuII, RsaI, Sad, Sail, SmaI, TaqI, and XbaL
Southern Transfer
The DNA in the trimmed gel was denatured by agitation and immersion in 0.2 M NaOH, 0.6 M NaCl
for 30 minutes. The gel was briefly rinsed in ddH20 , then immersed and gently agitated in 0.5 M Tris, 1.5 M
N aC l, pH 7.5 for 30 minutes (to reduce alkalinity), using an orbit shaker. Concurrently, a Zetabind nylon
membrane was prepared for blotting as follows: the membrane was cut to the dimensions o f the gel and soaked,
first in ddH20 for 5 minutes, then for 5 minutes in 20X SSC. Vertical, upward transfer was in 20X SSC, using
three sheets of Whatman 3MM Chromatography filter paper cut to gel size and a stack o f paper towels about 3 0
cm thick as a wick. Following overnight transfer, the membrane was rinsed in 2X SSC, twice for 15 minutes with
gentle agitation. DNA was fixed to the membrane by baking in a vacuum oven. The membrane was placed
between two sheets of filter paper and baked for 2 hours at 80° C under 20 lbs. pressure. The membrane was then
soaked in a hybridization tube with 30 ml 0. IX SSC, 0.5% SDS. The tube was rotated for one hour at 65° C. The
membrane was removed from the tube, blotted dry between two sheets of filter paper and stored in a sealed plastic
bag at 0° C.
A more efficient procedure using ammonium acetate as a transfer agent was used for later blots. The
DNA on the trim m ed gel was denatured by two 15 minute soaks in 1.5 M NaCl, 1.5 M NaOH with gentle
agitation, followed by two 15 minute soaks in 0.2 M NaCl, 0.1 M NaOH, also with gentle agitation. The gel was
then washed twice in I M ammonium acetate, with gentle agitation (15 minutes per wash). The membrane was
soaked for 5 minutes in ddH20 , then for 5 minutes in I M ammoniurii acetate. Membrane transfer was as above,
substituting I M ammonium acetate for 20X SSC. DNA was fixed to the membrane by baking for 2 hours at 80°
11
C.
'
Transformation o f m t DNA Probes
Several different mtDNA probes were used in hybridizations. An 8.0 kb fragment from Gryllus afflrmus
(pGA 8.0), 6.0 kb (pDS 6.0) and 3.6 kb (pDS 3.6) fragments from Drosophila silvestris, and a 900 bp PCR
fragment (900 RL) that could be generated from any Drosophila template (with included primers) were received
from Dr. Rob DeSalle at the Museum o f American History. Probes o f Melanoplus sanguinipes mtDNA were
sent by Dr. W illiam Chapco from the University of Regina. They were: pD M l (8.0 kb), pDM2 (6.8 kb), and
pDM3 (1.2 kb). All probes were sent in pUC 18 plasmids. Two transformation procedures were tried, in order
to insure an adequate supply of probes. A heat-shocking procedure began with preparation of competent cells
using the following procedure: Two 500 ml flasks with 50 ml LB media were autoclaved. One was inoculated
(using a flame-sterilized inoculation loop) with JM 101 E. coli cells, the other with JM 109 A1, coli cells, and both
were incubated overnight at 37° C with shaking at 225 RPM. (A. coli. strains were prepared by streaking minimal
media plates with glycerol cultures and incubating at 37° C for 1-2 days.) Two dilutions (1:50 and 1:500) o f each
bacteria strain were prepared by adding overnight culture to new 50 ml LB media aliquots in 500 ml flasks. Cells
were incubated at 37° C with shaking at 225 RPM, until the optical density at 600 nm reached 0.5-0.6 (around
3 hours for the 1:50 dilution). The cells were then transferred to ice-cold 50 ml polypropylene tubes and placed
on ice for 5-10 minutes. Cells were centrifuged at 4000 RPM for 10 minutes at 4° C in a Sorvall Rotor. The
resulting supernatant was discarded and drained off by inverting the tube for I minute, and the pellet of cells was
suspended by vortexihg in 10 ml ice-cold 0.1 M CaCl2. Cfclls were stored on ice 5-10 minutes before
centrifugation at 4000 RPM for 10 minutes at 4° C. The supernatant was decanted as before, and the pellet was
resuspended by vortexing in 2 ml 0 .1 M CaCl2. Two hundred pi of competent cell suspension were aliquoted to
sterile 1.5 ml centrifuge tubes. One pi o f each probe DNA in pUC plasmids was added to separate cell aliquots,
and the tubes were placed on ice for 30 minutes, along with an aliquot of cells with no DNA added (negative
control). The tubes were heated in a 42° C water bath for 90 seconds, then chilled on ice 1-2 minutes. Cells were
allowed to recover by incubation at 37° C in 800 pi SOC media. Recovered cells were poured on LB agar plates
with 35 mg/ml ampicillin. Twenty-five pi Bluo-gal and 20 pi isopropylthio-P-D-galactoside (IPTG) were spread
on the plates with a sterile bent glass rod prior to plating. Agar plates were incubated overnight at 37° C. White
colonies were selected and transferred to liquid LB media by dabbing with a toothpick, which was then dropped
into 3 ml sterile LB media in 15 ml glass test tubes. Liquid cultures were incubated overnight at 37° C with
shaking at 225 RPM. DNA minipreps (Sambrook, et. al„ 1989) were started by filling 1.5 ml centrifuge tubes
with the overnight liquid cultures, and spinning for I minute at 14,000 RPM. The media was decanted, and any
that remained after drainage by inversion was removed by aspiration. The pellet was resuspended by vortexing
in 100 ml o f Solution I (50 mM glucose, 25 mM Tris-Cl pH 8.0, and IOmM EDTA pH 8.0). Two hundred pi
Solution ft (0.2 N NaOH, 1% SDS) were added, and tubes were gently inverted several times to mix. The tubes
were stored on ice 5-10 minutes prior to the lysis of cells by addition of 150 pi o f ice-cold Solution III (3 M
potassium acetate, 11.5% acetic acid). Tubes were inverted and stored 3-5 minutes on ice before centrifugation
at 14,000 RPM at 4° C for 5 minutes The supernatant was decanted into a new 1.5 ml centrifuge tube, and 2
volumes room-temperature 95% ethanol were added. The tubes were vortexed briefly, and the DNA was allowed
to precipitate for 2 minutes at room temperature. Centrifugation at 14,000 RPM for 5 minutes at 4 C pelleted
the DNA. The supernatant was removed by aspiration, then the pellet was rinsed by the addition of I ml 70%
ethanol, and centrifugation at 14,000 RPM at 4° C for 2.5 minutes. The 70% ethanol was removed by aspiration,
and the pellet was allowed to air-dry for 10 minutes. The DNA was resuspended by the addition of 50 pi TE
buffer with 20 mg/ml RNAase (DNAses were removed from the RNAase by boiling for 5 minutes.)
Another transformation procedure using electroporation of competent cells was tried. An overnight
culture o f JM 101 E. coli cells was prepared and new LB media was inoculated and grown to an OD600 o f 0.4,
as above. Cells were pelleted in ice-cold 50 ml polypropylene tubes by centrifugation for 12 minutes at 4° C at
4,000 RPM in a Sorvall Rotor. The pellet was then resuspended in 6 ml sterile 20% glycerol, and spun for 12
minutes at 4° C at 4,000 RPM. This wash repeated 3 times, then the pellet was resuspended in I ml 20%
glycerol, transferred to a 1.5 ml centrifuge tube, and spun at 4° C for 30 seconds at 10,000 RPM. The media was
decanted, and the pellet resuspended in 5 volumes of 20% glycerol. The competent cells were used in
electroporation transformations, or frozen at -70° C. Immediately before electroporation, 0.5 pl of probe DNA
in pUC 18 plasmid were added to 30 pi competent cells. This mixture was placed on an electroporation plate,
and subject to a brief 400V charge. The cells were retrieved using a pipette, by mixing them with 30 pi o f the I
ml o f SOC media used for recovery (I hour at 37° C in a shaking water bath). Cells were plated (10 pi and 100
pi) on LB agar plates with 100 mg/ml ampicillin, 25 pi Bluo-gal and 20 pi IPTG, then incubated overnight at
37° C. Colony selection and mini-preps were as above.
Radiolabelihg Probes
Probes were radiolabeled using a nick-translation procedure. In a 1.5 ml centrifuge tube, the following
were mixed: 5 pi dNTP’s without dATP, 3 pi plasmid DNA, 3 pi [a-P32]dATP, and 34 pi ddH20 . Five pi DNA
polymerase/DNAase I were mixed in; and the tube was centrifuged 5 seconds, prior to a I hour incubation at 15°
C. Stop buffer (5 pi) was then added.
Hybridization
Nylon membranes were first prehybridized in a solution o f 0.7 g SDS powder, 0 .1 g BSA, 20 ml 0.5 M
ED TA pH 8.0, 5.26 ml 0.5 M Na2HPCM pH 7.2, and 4.5 ml ddlj 0. The 10 ml obtained were adequate for
prehybridization o f 100 cm2 o f membrane area. The membranes and prehybridization solution were placed in a
seal-capped tube in a mini-oven, and incubated overnight at 60° C. Radiolabeled probes were boiled at 95 C for
five minutes, then added to the prehybridized membranes. Incubation was overnight at 60° C in a rotating oven:
Membranes were rinsed in the hybridization tubes, twice with 50 ml of 2X SSC, 0.1% SDS (15 minutes at 30
C in a rotating oven), then twice with 50 ml 0. IX SSC, 1% SDS (15 minutes at 30° C in a rotating oven). Used
rinse solutions were discarded in a liquid radioactive waste jar. Membranes were blotted dry with filter paper, and
covered with plastic wrap. Autoradiography film was placed on the membrane in a light-proof film holder, and
exposure was overnight at -70° C. Films were developed by immersing in developer (I minute), stop solution (I
minute), and in fixative solution (5 minutes).
Polymerase Chain Reaction (PCR) Methods
Fandom Amplification o f Polymorphic DNA (RAPP)
Several attempts to reveal genetic variation using random primers were made. Ten base-pair primers
from a RAPD kit (Operon Technologies) were used. Twenty-five pi reactions were prepared with the following
components: 16.75 pi ddH20 , 2.5 pi IOX Taq buffer, 3.0 pi DNTP’s, 1.5 pi 50 mM M g C l, 0.25 pi Taq
polymerase, 1.0 pi primer, and 1.0 pi sample DNA. Primers from kit "A", numbers 4 ,6 ,7 , 8,1 0 , and 12 were
used in separate reactions. DNA from sample MS9 was used because it seemed to be easily digested by many
enzymes, which indicated it might be a better preparation. It was diluted 1:100 with ddH2Q. A control reaction
with no DNA was also used. Reactions were performed in 500 pi tubes and were overlaid with approximately
25 pi sterile mineral oil prior to thermocycling, with the following parameters: profile I: 95° C for 2 minutes, one
cycle, profile 2: 94° C for I minute, 36° C for I minute, 72 °C for 2 minutes, 45 cycles, profile 3: 72° C for 5
minutes, one cycle. RAPD reactions were also done with the annealing temperature raised from 36° C to 38° C
(profile 2, second segment). Reactions were visualized on 0.7% agarose, EtBr-stained 0.5X TBE gels.
PCR with Mitochondrial Primers
Hom ology searches using mitochondrial sequences of sea urchin (Jacobs, et a l, 1988) Locusta
migrdtoria (McCracken,.et al., 1987; Uhlenbusch, et al., 1987), Apis mellifera (Crazier and Crazier, 1993),
Drosophila yakuba (Clary and Wolstenholme,,1985),Xenopus laevis (Roe, et al., 1985), mouse (Bibb, et al.,
1981), and humans (Andersoni et al., 1981), revealed many possible primers. Primer sequences from homology
searches and the literature are given in Table I.
15
Table I. Oligonucleotide Sequences for primers used in amplification o iMelanoplus mtDNA
Primer
Sequence
Region
14969
5'-TTTACTACCAAATCCACC-3'
12sc rRNA
14970
5'- GGGGTATGAACCC A/G GTAGCT-3'
IRNAmeth
23944
5'-TATCAT AACGAAAACGAGGT AA-3’
ND-I
23945
5'-T AGAAAT GAAAT GTTATTCGTTT-3'
16S RNA
25681
5'-TATGTACTACCATGAGGACA-3'
Cyt b
25682
5'-CGCCTGTTTAACAAAAACAT-3'
16S rRNA
31288
5'-CGCCTGTTTATCAAAAACAT-3'
16S rRNA
33052
5'-GT AAAT AAAACT AAAAAACC-3'
COIa
34941
5'-TCAACAAAGATGTCAGTATCA-3'
COIIIb
34942
5'-AATATGGCAGATTA A/G TGCA-3'
tRNAleu
C2-J-3696
5 '-GAAATTT GT GGAGC AAAT CA-3'
C O IIA611
37744
5'-AGCCCATGAAATCCTGTTGCGA-3'
COII
37743
5'-GAGCATCACCACTAATAGAACA-3'
com
The first primer set that was tried (14969 and 14970) flanked the A&T region, which has shown high
levels of variability in many species (Lewis, et al., 1994). Primer 14969 was based on a conserved sequence in
the 12sc rRNA, and primer 14970 was taken from a conserved region of the IRNAmeth gene. The PCR product
should have been around 2000 bp long. Oligonucleotide primers were ordered from Integrated DNA
Technologies, Inc., and on arrival were dissolved in 400 pi ddH20 To determine the concentration of primers,
OD 260 measurements were taken, and DNA concentrations calculated by the following formula:
[DNA] = (A260 x 3x104 mg/l)/N x Dilution Factor x 330 amu
(N= number of bases. Dilution Factor = 200)
The concentration of primer 14969 was found to be 104 pM, while that o f primer 14970 was 58 pM.
The desired primer concentration in the PCR reaction was approximately 10 p-M, so primers were diluted
accordingly in ddH20 .
The proper annealing temperature for the primers was calculated by the following formula:
Annealing temperature = (4 x the number of C+G bases) + (2 x the number o f A+T bases)
The annealing temperature for primer 14969 was 64° C and 54° C for primer 14970. A n annealing temperature
of 50° C (profile 2, step 2) was used to lower reaction specificity. The following thermocycling parameters were
used: profile I: 95° C for 2 minutes, one cycle, profile 2: 94° C for I minute, 50° C for I minute, 72° C for 2.5
m inutes, 40 cycles, profile 3: 72° C for 5 minutes, one cycle. The reaction mix was (per reaction): 13.25 pl
ddH20 , 2.5 pi 10X Taq buffer, 3.0 pi DNTP’s, 1.0 pi 25 mM M gQ l, 0.25 pi Taq polymerase, 2.0 pi each
primer and 1.0 pi sample DNA. Drosophila melanogaster DNA was used as a template, with ddH20 dilutions
o f 1:10,1:50,1:100, and 1:250 in separate reactions. Thereactionwas also tried with the annealing temperature
lowered to 40° C.
Primers designed to amplify a 2000 bp region of mtDNA were also tried. Primers 23944 and 23945 were
diluted to appropriate concentrations as before. PCRwas performed with the following parameters: profile 1. 95
C for 2 minutes, one cycle, profile 2: 94 ° C for I minute, 40 ° C for I minute, 72° C for 1.5 minutes, 40 cycles,
profile 3:72° C for 5 minutes, one cycle. The reaction mix was (per reaction): 16.75 pi ddH20 , 2.5 pi 10X Taq
buffer, 3.0 pi DNTP’s, 1.0 pi 25 mM MgCl2, 0.25 pi Taq polymerase, 1.0 pi each primer, and 1.0 pi sample
DNA. Template DNA was generally diluted 1:100 with sterile ddH20 . The reaction was then tested for optimum
)
magnesium concentration by trying 0.5 pi increments from 0.5 pi to 2.5 pi, and for DNA concentrations by trying
different dilutions o f the template DNA.
The primer 25681 was designed from a sequence in the cytochrome b gene (Jermiin and Crazier, 1993).
It was paired with primer 25682, a 16S rRNA sequence. PCR to attain the desired 2500 bp fragment was
performed with the following parameters: profile I: 95° C for I minute, I cycle, profile 2: 94° C for I minute,
45° C for I minute 72° C for 1.5 minutes, 40 cycles, profile 3: 72° C for 5 minutes, one cycle. The reaction m ix
was (per reaction): 16.75 pi ddH20 , 2.5 pi IOX Taq buffer, 3.0 pi DNTP’s, 1.0 pi 25 mM MgCl2, 0.25 pi Taq
polymerase, 1.0 pi each primer, and 1.0 pi sample DNA. Magnesium concentration was optimized as above, and
several different annealing temperatures were tried. Results were improved greatly by using the following
parameters: profile I: 95° C for 2 minutes, one cycle, profile 2: 94° C for I minute, 45° C for. I minute, 72° C for
1.5 minutes, 4 cycles, profile 3: 94° C for I minute, 47° C for I minute, 72° C for 1.5 minutes, 36 cycles, profile
4: 72° C for 5 minutes, one cycle. The reaction mix was (per reaction): 16.75 pi ddH20 , 2.5 pi 10X Taq buffer,
3.0 pi DN TP’s 1.0 pi 25 mM MgCl2, 0.25 pi Taq polymerase, 1.0 pi each primer, and 1.0 pi sample DNA.
New combinations of these primers were subject to P C R Primer 25682 was paired with primer 23944,
primer 23945 was paired with primer 25681, primer 25681 was paired with primer 31288 (a primer similar to
25862 but with a single substitution), and primer 14970 was paired with primer 23944.
Primers with sequences in cytochrome oxidase genes were also tried. Primer 33502
is a conserved sequence in the COIa gene. It was paired with primer 14969 to produce a putative PCR product
that would amplify the A&T rich region. PCR was first tried with a conventional reaction m ix (16.75 pi ddH20 ,
2.5 p i 10X Taq buffer, 3.0 pi DNTP’s, 1.0 pi 25 mM- MgCl2, 0.25 \i\Taq polymerase, 1.0 pi each primer, and
1.0 pi sample DNA) and PCR parameters with longer extension times (profile I: 95° C for I minute, one cycle,
profile 2: 94° C for I minute, 42° C for I minute, 72° C for 3 minutes, 4 cycles, profile 3: 94° C for I minute, 45°
C for I minute, 72° C for 3 minutes, 36 cycles, profile 4: 72° C for 5 minutes, one cycle. PCR with these primers
was also tried in a reaction mix for "long PCR" (Cheng, et. a l, 1994), which consisted o f the following: 20 mM
tricine (pH 8.7), 85 mM potassium acetate, 9.6% glycerol, 0.2 mM DNTP’s, 0.2.pM primers, 2% DMSO, 1.1
mM magnesium acetate. The paper specified the use o f rTth polymerase and Vent polymerase, which were
unavailable, so IU Taq polymerase was substituted. The reaction was also tried with Tris-Cl buffer (pH 8.4)
18
substituted for tricine. PCR parameters were: profile I: 95° C for I minute, one cycle, profile 2: 94 C for I
minute, 42° C for I minute, 72° C for 2 minutes, 4 cycles, profile 3: 94° C for I minute, 45° C for I minute, 72°
C for 2 minutes, 36 cycles profile 4: 72° C for 5 minutes, one cycle.
Another primer based on cytochrome oxidase sequences (Simon, 1993) was tried. Primer 34941 was
based on a conserved region in the COIIIb gene, and it was paired with primer 34942, a sequence in the tRNAleu
gene (Sperling and Hickey, 1994). PCR was performed using this reaction mix: 16.75 pi ddH20 , 2.5 pi IOX
buffer, 3.0 pi DNTP’s 1.0 p i 25 mM MgCl2, 0.25 pi Taq polymerase, 1.0 pi each primer, and 1.0 pi sample
DNA). Several parameter combinations were tried. The first was: profile 1: 95° C for 2 minutes, I cycle, profile
2: 94° C for I minute, 45° C for I minute, 72° C for 1.5 minutes, 40 cycles, profile 3: 72° C for 5 minutes, one
cycle. The second set o f parameters was: profile I: 95° C for 2 minutes, I cycle, profile 2: 94° C for I minute,
43° C for I minute, 72° C for 1.5 minutes, 4 cycles, profile 3: 94° C for I minute, 47° C for I minute, 72° C for
1.5 minutes, 36 cycles, profile 4: 72° C for 5 minutes, one cycle. PCR was also tried with parameters similar to
the four-profiled ones above, with annealing temperatures o f 44° C and 48° C, and 40° C and 48° C. PCR was
also attempted with a reaction mix using 4 times the usual primer concentration.
Primer 34941 was also paired withaprimer sent by Chris Simon (pers. comm.), C2-J-3696, a sequence
located in the CGI! (A611) gene. The reaction mix used was: 14.25 plddH 20 , 2.5 pi I OX buffer, 3.0 pi DNTP’s,
0.25 pi Taq polymerase, 2.0 pi each primer, and 1.0 pi sample DNA). The buffer was sent with the primer and
consisted o f the following: 3.5 ml 1.0 M Tris-Cl pH 8.8,100 pi BSA (100 mg/ml), 125 pi 1.0 M MgCl2, and
1.275 ml ddH20 . DNA fiomMagicauda septemdecim was used as a template in a positive control reaction, and
DNA from various Melanoplus m d Anabres simplex (Mormon cricket) samples were also used as prospective
templates. PCRwas performed with the following parameters: profile I: 95° C for 2 minutes, I cycle, profile 2:
94° C for I minute, 505 C for I minute, 72 C for 1.25 minutes, 40 cycles, profile 3: 72° C for 5 minutes, one
cycle. PCRwas also attempted with.these parameters using an annealing temperature o f 48° C. The primers were
also tried with a reaction mix of: 10.25 pi ddH20 , 2.5 pi Perkin-Elmer 10X PCR buffer, 3.0 pl DNTP’s, 1.0 pi
19
25 mM MgCl2, 0.25 |xl Taq polymerase, 1.0 pl each primer, and 5.0 pi sample DNA. The templates were
conventional extractions o f Melanoplus and Anabres DNA diluted 1:5, undiluted DTAB/CTAB extractions o f
Melanoplus DNA, and DTAB/CTAB extractions diluted 1:5 and 2:5. The PCRparameters were: profile I: 95°
C for 2 minutes, I cycle, profile 2:94° C for I minute, 45° C for I minute, 72° C for 1.5 minutes, 4 cycles, profile
3:94° C for I minute, 49° C for I minute, 72° C for 1.5 minutes, 36 cycles, profile 4: 72° C for 5 minutes, one
cycle. PCRwas also tried as above with annealing temperatures in the second and third profiles o f 43° C and 45°
C, respectively, using reaction volumes of 25,50, and 100 pi.
Primers sequences from lichen grasshoppers (Trimerotropis saxatilis) were sent by Ann Gerber (pers.
comm.). Primer 37744 and primer 37743 are also sequences from cytochrome oxidase genes. The reaction mix
was: 16.75 plddH20 , 2.5 pi 10X buffer, 3.0 pi DNTP’s, 1.0 pi 25 mM MgCl2, 0.25 pi Taq polymerase, 1.0 pi
each primer, and 1.0 pi sample DNA. The first set o f PCR parameters tried was: profile I: 95° C for 2 minutes,
I cycle, profile 2:94° C for I minute, 55° C for 1.5 minutes, 72° C for 2.75 minutes, 38 cycles, profile 3: 72° C
for 5 minutes, one cycle. PCR was also tried using the same parameters with the annealing temperature lowered
to 46° C. The second set of parameters tried was: profile I: 95° C for 2 minutes, I cycle, profile 2: 94° C for 1.25
minutes, 42° C for 1.5 minutes, 72°C for 2.75 minutes, 6 cycles, profile 3: 94° C for 1.25 minutes, 47° C for 1.5
minutes, 72° C for 2.75 minutes, 32 cycles, profile 4: 72° C for 5 minutes, one cycle.
PCRusing the primer combination o f 25682 and 23944 provided DNA amplification from the greatest
number of samples. The approximate size of the PCR product was 1557 bp. The reaction mix initially used was.
16.75 pi ddH20 , 2.5 pi 10X buffer, 3.0 pi DNTP’s, 1.0 pi 25 mMMgCl2, 0.25 pi Taq polymerase, 1.0 pi each
prim er, and I .Opl sample DNA, with.the following P C R parameters: profile I. 95 C for 2 minutes, 1 cycle,
profile 2: 94° C for I minute, 43° C for I minute, 72° C for 1.5 minutes, 4 cycles, profile 3: 94° C for I minute,
45° C for I minute, 72° C for 1.5 minutes, 36 cycles, profile 4: 72° C for 5 minutes, one cycle. Changing the
annealing temperatures in profiles 2 and 3 to 45° C and 47° C, respectively, improved amplification. The
m agnesium concentration in the reaction mix was optimized to 1.75 pi 25 mM MgCl2, greatly increasing the
optimized to 1.75 pi 25 mM MgCl2, greatly increasing the number o f positive reactions ior Melanoplus samples.
Re-amplification o f PCR products diluted 1:50 was also attempted.
v
PCR/RFLP
PCR products were digested with a number of restriction endonucleases to search for polymorphisms.
Fragments (approximately 2.5 kb in length) from amplification reactions using primers 25681 and 25682 were
digested by incubating the following reaction mixture overnight at 37° C: 5 pi PCR product, 2 U enzyme (for
m ost enzymes I pi of a 1:10 dilution was used), I pi appropriate IOX buffer, and 3 pi ddH20 . For enzymes
requiring BSA, I pl o f a 1:10 dilution of 10 mg/ml of BSA replaced I pi of the ddH20 . The entire digest was then
visualized on a 1.2% agarose gel stained with EtBr. Each enzyme was tested by digesting PCRproducts from
each o f the three different sites. The following enzymes were used: AluI, Aval, Avail, ApaI, BamHI, Banl, BglI,
BglII, ClaI3 PdeI, DpnII, Oral, EcoRJ, EcoRV, HaeIII, H indi, HindIII, Hinfl, HpaI, HpaII, KpnI, MspI, NotI,
PstI, PvuII, S a d i, Sail, Sau3A, SmaI, SnaBI, SstI, TaqI, XbaL
Amplification products (around 1.6 kb) from reactions using primers 23944 and 25682 were subject
to digestion in the same manner with the enzymes DpnII, DraI, and MspL
Ligations
PC R fragments from reactions using primers 23944 and 25862 were ligated into a pCR™II cloning
vector plasmid using a Stratagene kit. The amount of PCR product required for the ligation reaction was
calculated using the following formula:
X ng PCR product = (Y bp PCR product x 50 ng pCR™II vector)/ (bp in pCR™II vector) .
X ng PCR product = (1600 bp x 50 ng)/(3900 bp) = approximately 20 ng
The volume o f PC R product that yielded 20 ng DNA was approximated by comparing the brightness of PCR
fragment bands with the brightness of IHindIII bands on an EtBr-stained agarose gel. The PCR product band
m ost closely matched the brightness o f the 2.0 kb IHindIlI band. DNA concentration was approximated using
the following formula:
(2000 bp/50,000 bp) x 700 ng* = 28 ng/pl
* (Seven ml o f XHindIII at a concentration o f 100 ng/ml were loaded on the gel.)
One pi o f PCR product was used in the ligation reaction, along with I pi ligation buffer, 2 pi pCR™II vector
(25 rig/pl), 1 pi T4 DNA ligase (4.0 Weiss units), and 5 pl ddH20 . The ligation reaction was incubated overnight
at 14° C. Ligated plasmids were transformed into competent One ,Shot™ cells supplied with the kit. Two pi 0.5
M b-mercaptoethanol were mixed into vials containing 50 pi competent cells by gently stirring with a pipette tip.
Two pi of.each ligation reaction were added and mixed with the competent cells in the same manner, and the
remaining 8 ml were stored at -20° C. The vials were incubated on ice for 30 minutes, prior to a 30 second heat
shock at 42° C. Four hundred fifty pi room temperature SOC media were added to the cells, which were then
allowed to recover for I hour at 37° C with shaking at 225 RPM. Transformations were plated on LB agar with
50 mg/ml ampicillin and X-gal, and incubated 18 hours at 37° C. Plates were then stored at 4° C for 2 hours to
develop color. White colonies were selected and grown in liquid cultures and plasmid minipreps were prepared
(see Transformation of Mitochondrial Probes section). The presence o f the inserted PCR fragment was detected
by digesting plasmid DNA with EcoRI, and comparing the resultant bands on an EtBr-stained agarose gel with
bands from similar digests o f PCR products. EcoRI digests excised the fragment and cut it into two smaller
fragments approximately 700 and 900 bp long.
Several attempts were made to ligate PCR fragments from plasmids into a pUC 18 plasmid. The process
began with EcoRI digestion of pUC18 plasmid and pCR™II plasmid with 23944/25682 PCR product insert, in
the following reaction: 10 pi plasmid DNA, 6 pl ddH20 , 2 pi EcoRI, and 2 pi EcoRI buffer. Digests were
incubated overnight at 37° C. The digests were phenol/chloroform extracted by the addition o f an equal volume
o f phenql (equilibrated to pH 8.0 with 0.1 M Tris-Cl) and vortexing for 20 seconds. The sample tube was then
spun 10 minutes at 7000 RPM. The aqueous layer was removed to a new tube and extracted with phenol-
chloroform -IAA -and then with chloroform-IAA. The aqueous layer was again transferred to a new tube, and
DNA was precipitated by freezing for 1-4 hours in 2 volumes ethanol and 0.2 volumes IO M ammonium acetate.
DNA was pelleted by centrifugation at 14,000 RPM for 25-30 minutes. The pellet was rinsed with 25 pi 70%
ethanol, and suspended in 15 pi ddH20 . Ligations were also performed using pCR™II using DNA from gelpurification o f electrophoretically separated PCR inserts. Ligation reactions consisted of the following: 6 pi
pCR™n plasmid digested with EcoRI, 1 pi ligase (diluted 1:10 with New England Biolabs restriction buffer # 1),
I pi ligation buffer, and 2 pi pUC 18 plasmid digested with EcoRI. The ligation reaction was incubated overnight
at 16° C. Ligation buffer that remained in the vial was discarded. Transformation into SURE™ cells (Stratagene)
was by heat-shocking at 42° C for 90,seconds. Cells were plated onto LB agar with 50 mg/ml ampicillin, and
incubated overnight at 37° C.
Ligation and transfection into an M13 viral vector was tried. The procedure (Sambrook, et. a l, 1989)
began with the digestion o f M13 (replicative from) in EcoRI. The following mixture was incubated overnight
at 37° C: I pi EcoRI, I pi EcoRI buffer, I pi M13 (lOO ng/pl), and 7 pi H2O. Ligations were incubated 45 hours
at 16° C, and consisted of: 3 pi M l3 EcoRI, I pi ligase, I pi ligation buffer, and 5 pi gel-purified PCR product
inserts digested out of pCR™II plasmids with EcoRI. Ligation reactions for both the large and the. small
restriction fragments were prepared. Ligated DNA was transformed into competent JM101 cells by
electroporation. Onehundred pi transformed cells were added to tubes containing 3 pi melted SOB top agar, 40
pi X-gal (20 mg/ml in dimethylformamide), and 4 pi IPTG (200 mg/ml). The tubes were briefly vortexed prior
to the addition o f 200 pi o f an overnight culture of H D 5aF’ cells, and vortexed again before pouring on an LB
agar plate. The top agar was distributed evenly over the surface o f the LB agar, allowed to dry for 5 minutes, and
incubated overnight at 37° C.
M13 transfection was also attempted using competent HD5aFTQ™ cells provided in a Gibco kit. The
procedure first called for preparation o f a dry ice/ethanol bath. Competent cells were removed from storage at
-70° C, and after thawing on ice, a 100 pi aliquot was transferred to an ice-cold 1 7 x 1 0 0 mm polypropylene tube.
Unused cells were placed in the dry ice/ethanol bath for 5 minutes before they were returned to the -70° C freezer.
Five pi of a 1:10 dilution of M13 control DNA were added to one aliquot of competent cells, while I pi o f a 1:5
dilution o f ligated DNA were added to separate aliquots. Dilutions were in 10 mM Tris-HCL (pH 7.5) and I mM
Na2FDTA and the DNA was mixed into cells by gently stirring with the pipette tip. The cells were incubated on
ice for 30 minutes, then heat shocked for 45 seconds in a 42° C water bath. Cells were placed on ice for two
minutes, before the addition o f 0.9 ml room temperature SOC. Two hundred pi transformed cells were added to
3.0 ml o f YT top agar (containing 50 pi 2% X-gal and 10 pi 100 mM IPTG, and tempered at 45° C). Cells and
top agar were mixed by tapping the tubes, and 100 pi lawn cells were added, Top agar was poured on YT plates,
allowed to dry, and the plates were incubated overnight at 37° C. Unused lawn cells were returned to the -70° C
freezer.
DNA Sequencing
The pCR™II plasmids that contained PCR product inserts, and gelrpurified PCR products were both
used as templates for sequencing reactions. Sequencing reactions were rim on 6% acrylamide gels. The gels were
prepared by dissolving 3.8 g acrylamide, 0.2 gbis-acrylamrde, and 23.5 g urea in 10 ml 5X TBE and 15 ml H2O.
The resulting solution was filtered, using a conical paper filter (Whatman #3,11.0 cm diameter) and funnel, into
a 50 ml graduated cylinder. The volume was adjusted with ddH20 to 50 ml, and the solution was placed in a
beaker. Then 333 ml fresh 10% APS were added and mixed in using a stir bar, prior to the addition of 24 ml
TEMED. Immediately after adding TEMED the gel was poured in a glass plate apparatus that fit into an
electrophoresis chamber. The gel was allowed to dry before placement in the electrophoresis chamber. Buffer
tanks were filled with IX TBE, and the gel was warmed up to running temperature (55-60° C) by applying a
charge o f 1600 volts (30-50 MA) to the apparatus.
r
Sequencing reactions (Gary Ritzel, pers. comm.) were commenced by annealing the primer to the
template. Generally 12 pi of template DNA was mixed with 2 pi primer (primer concentration was 2 pM). When
plasm id DNA was used, it was first digested with HindIII or XbaI, then heated to 65° C for 20 minutes to
denature any remaining enzyme. Digestion with these enzymes linearized the plasmid to allow for sequencing.
The primer/template mixture was boiled at 95-98° C for 8 minutes in 1.5 ml tubes with sealing collars, then flash
frozen on dry ice or in a -70° C freezer.
For each reaction, 4 termination tubes were prepared. Each 1.5 ml tube contained 2.5 pi o f the 4
ddNTP’s. The lid o f each tube was punctured with a sterile, small-gauge hypodermic needle tip.
A iIahfiIing mix was prepared using (per reaction): I pi filter purified H2O, I pi 0.1 M DTT, 1.66 pi 5X
dG label mix, 0.5 pi Mn buffer, I pi dATP32, and 0.33 pi (3U) Sequenase. After addition o f dATP32, standard
radiation safety procedures of using dosimeter badges, wearing two pairs o f latex gloves, and proper disposal of
contaminated materials were used. The frozen primer/template tubes were quickly thawed by spinning in a roomtemperature centrifuge, and 5.0 pi o f labeling mix were added to each primer/template mix. The tubes were
incubated 5 minutes, either at room temperature (25-29° C), or in an 18° C water bath. During the last two
minutes o f this incubation, the termination tubes were warmed to 37° C in a water bath. When incubation was
completed, 4.2 pi o f the primer/template/labeling mix was spun into each termination tube, and the termination
reaction was completed with 5 minutes o f incubation at 37° C. Five ml of stop solution (formamide dye: 1.9 ml
formamide, 96 pi H2O, I mg xylenecyanol, I mg bromphenol blue) were spun into the tubes, which were then
boiled for 5 minutes prior to loading on the acrylamide gel. The power source for the electrophoresis apparatus
was turned off while 4 pi of each of the 4 termination reactions were loaded onto the gel, using a thin pipette tip.
The gel was run for 1.5 hours at 1500-1800 volts, then turned off and re-loaded, and run for an additional 1.5
hours. After electrophoresis was completed, the glass plates containing the gel were removed from the apparatus.
One plate was pried off using a spatula, while the other plate adhered to the gel. The gel and plate were wrapped
in Saran Wrap, and exposed to autoradiography film in a lightproof film holder at -70° C. The first primers used
were the M l 3 -40 primer and the M 13 Reverse primer, which are located on either side o f the insertion site on
the plasmid. They confirmed the base sequence in both the remainder o f the plasmid and in the PCR primer.
Sequencing in both directions using PCR primers diluted to the proper concentration (2 pM ) revealed the base
sequence o f the PCR product. By combining varying amounts (0.5-2.0 pi) o f extension mix with termination mix
(retaining the 2.5 pi volume), the known sequence was further extended.
New 20-mer primers were designed using sequences with a high certainty and a relatively high guanine
and cytosine content. The new primers were used for continued sequencing and for PCR reactions. The known
sequence was extended by designing new primers and sequencing in a similar fashion.
Polymorphisms in mtDNA Sequence
PCRproducts from reactions using 25682/23944 primers were diluted 1:10, and were subjected to re­
amplification using the same parameters and P P 1/PP2 interior primers. The yield of DNA was greatly increased,
and the re-amplification product was easily gel-purified, either with the standard low melting point agarose
procedure, or by using a Magic PCR Prep. Representative samples from each of the 3 sites were sequenced using
the P P l primer, and the resultant base pair orders in the ND -I region were compared to each other. A plasmid
template sequencing reaction was used as a positive control.
Analysis o f Sequence Data
Nucleotide sequences were compared to homologous 16S and ND-1 mitochondrial sequences in other
insects. Representative species from several orders were used, and are shown on Table 2. Some sequences were
attained using a Basic Local Alignment Search Tool (BLAST, Altschul, et al., 1990) to evaluate homology of
sequences in the GenBank data base.
26
Table 2. Species used in mitochondrial DNA comparisons
Species
Order
Region(s)
Reference
Anopheles quadrimaculatus
Diptera
ND-1, 16S
Mitchell, et al., 1993
Apis mellifera
Hymenoptera
ND-1, 16S
Crozier and Crozier, 1992
Drosophila yakuba
Diptera
ND-1, 16S
Clary and Wolstenhome, 1985
Locusta migratoria
Orthoptera
ND-I
McCracken, et al., 1987
Locusta migratoria
Orthoptera
16S
Uhlenbusch, et al., 1987
Lymantria dispar
Lepidoptera
16S
Davis, et al., 1994
Psammotettix lividellus
Homoptera
16S
Fang, et al., 1995
Myrmecia forflcata
Hymenoptera
16S
Dowton and Austin, 1994
Opharella artemisiae
Coleoptera
16S
Funk, et a l., 1995
Prosimulium fuscum
Diptera
16S
Xiong and Kocher, 1991, 1993
Spodoptera frugiperda
Lepidoptera
ND-1, 16S
Pashley and Ke, 1992
Using this sequence data and PHYLIP (Felsenstein, 1993) programs, genetic distances and consensus
trees were generated. The sequences were aligned using the ALIGN program (Scientific and Educational
Software). The SEQBOOT program resampled the data and compiled 100 replicate bootstrapped data sets. The
genetic distances were converted into trees using the NEIGHBOR program, and a consensus tree was created
using the CONSENSE program.
Sequences from two Coleopterans, Cicindelis dorsalis (Vogler and DeSalle, 1993) and Cychrus
attenuatus (Dueling, 1995) were initially used in the analysis, but were later dropped because their short
sequences showed spurious similarities to members o f other orders.
27
RESULTS
DNA extraction
To determine the yield of the extractions, 5 pi of each sample were subject to gel electrophoresis (0.7%
agarose, 0.5X TBE) and staining with EtBr. All samples showed the presence o f DNA. The relative brightness
o f the bands seemed to indicate that the Davis procedure gave a much higher yield than the Rand and Harrison
procedure. However, the Davis procedure resulted in samples with much more RNA, as evidenced by bright
smears on the gel. The DNA yield with the Davis procedure seemed to be unaffected by the removal of any body
parts, homogenization method, or whether the sample was alive or frozen.
A quantitative measure of DNA yield was attained by spectrophotometer measurements o f absorbance
at 260 nm. The absorbance at 280 run was also measured to estimate the purity of the DNA. (The ratio of
A260A 280 should be close to 2.) The concentration of DNA was determined by the following formula:
[DNA]= (A260 x 50 pg/ml x Dilution Factor)/ (1000 pl/ml)
The dilution factor was 200 (5 pi sample in a cuvette with 995 pi water). DNA concentrations obtained with the
Davis method ranged tiom 0.36 pg/pl to 5.62 pg/pl (n=7, mean=2.25, SE=2.26). DNA concentrations for the
Rand and Harrison method ranged from 0.07 pg/pl to 0.27 pg/pl (n=6, m ean-0.14, S E -0.04)
DNA obtained by the DTAB/CTAB (Gustincich, et al., 1991) extraction method was not quantitatively
measured, but rough estimates based on the appearance of EtBr-stained gels suggest lower yields than the Rand
and Harrison procedure.
. if
DNA Purification
Following purification, DNA samples were visualized1on an EtBr-stained gel and tested in PCR reactions
sing primers 25681 and 25682. Purification using the Rapid Pure Miniprep did not work well. Treated samples
did not amplify, and samples that were successfully amplified prior to treatment failed to work in PCR reactions.
Chelex and Prep-A-Gene purifications rendered samples almost invisible on EtBr-stained gels, and treated
samples did not amplify with PC R
Sepharose column purification removed reddish-brown pigments from some DNA samples and made
them clear. PCR was tried with several dilutions of samples and was unsuccessful except for undiluted^ treated
DNA. Additional amplifications o f undiluted, Sepharose-treated DNA samples showed increased yield in samples
that amplified previously, and several samples that did not amplify previously yielded some PCR product.
PEPSI elutions were also visualized on EtBr-stained agarose gels. DNA yields with this method were
inconsistent, but always fairly low. Bands on gels were faint or invisible in all cases.
Both low melting point agarose extraction procedures worked well, and provided DNA that was useful
for sequencing reaction templates and in ligation reactions. These procedures allowed PCR product DNA to be
separated from remaining primers, enzymes, and oil, and any misprimed DNA present in the sample tube was
excluded by excision.
DNA Analysis with RFLP’s
Southern Transfer
Results from Southern transfers using 20X SSC as a transfer medium were similar to results achieved
using ammnninm acetate. However, the ammonium acetate procedure was used for later blots because it did not
require time-consuming soaks prior to and following fixation by baking.
29
Transformation o f m t DNA Probes
U sing the heat-shocking procedure, only the pDM3 fragment was successfully transformed.
Electroporation allowed the transformation of all mitochondrial fragments except pGA 8.0. Transformed probes
were hybridized with homologous mtDNA probes from the complete mule deer (Odocoileus hemionus)
mitochondrial genome (Cronin, et a t, 1991), to roughly assess the amount o f the insect mitochondrial genome
covered by the probes. The results of this experiment showed that most o f the deer genome was covered by the
insect mtDNA probes.
KFLP’s
The majority of the enzymes tried failed to digest the DNA or produced blots that were unreadable. These
enzymes were ApaI, Aval, BamHI, BanI, BglI, DdeI, DpnI, H indi, Hmfl, HpaI, KpnI, PstI, PvuII-, Sad, S adi,
Sail, SmaL
Enzymes that produced readable blots with bands that revealed no polymorphisms were Oral, EcoRI,
H aein, HinHTTT HpaII, and XbaL These results are summarized in Table 3.
Table 3. Bands produced by non-polymorphic restriction enzymes
Enzyme
Band Sizes (kb)
DraI
1.6,1.7,1.9,2.0,2.3
EcoRI
1.7, 9.0
HaeIII
1.9, 5.1,5.8
Hindin
1.9,9.2,10.0
HpaII
1.5
XbaI
1.8,7.0,10.2
EcoRV showed bands that appeared to be polymorphic, as shown on Table 4.
Table 4. Bands produced by hybridization o f EcoRV blots
Sample
Band Sizes (kb)
MS2
1.9,2.0,2.2
MS5
1.9,2.0,2.2,3.0, 6.0
MS6
3.0,6.0
Results were difficult to interpret because the total sizes o f the fragments were not the same for any of
the samples. This may be due to incomplete digestion of the DNA, or problems with blotting or film exposure.
A different blot using the same enzyme and samples revealed no variation between the same samples, and bands
at 2.2, 3.8, 6.0, and 5.8 kb.
A M also revealed an apparent polymorphism, as shown on Table 5. .
Table 5. Bands produced by hybridization of A M blots
Sample
Band Sizes (kb)
MS2
0.3, 0.8,1.0,1:5,1.8
MS'S
0.3 ,0 .8 ,1 .0 ,1 .5 ,1 .8
MS6
0 .3 ,0 .5 ,0 .7 ,1 .0 ,1 .5 ,1 9
MS7
0.3,0.5,0.7,1.0,.1.5,1.9
These small bands were not well-defined, and subsequent blots were unsuccessful. The different patterns
do not correspond to different locations, as samples MS2 and MS7 were both from Colorado, and MS5 and MS6
were both samples from Three Forks, MT.
PCRMethods
RAPD PCR
The initial trial o f RAPD PCR was successful; using MS9 as a template, each primer produced 2-10
bands ranging in size from 300-1000 bp. However, several subsequent trials revealed no bands. Results may have
been adversely affected by the fact that the primers were several years old, and may have been degraded or
contaminated.
PCR with Mitochondrial Primers
Primers flanking the A+T rich region (14969 and 14970) generally did not work. Using many different
dilutions and template DNA’s, only two reactions showed weak DNA bands that may have represented the
desired mitochondrial segment. Lowering o f the annealing temperature resulted in a 600 bp band when
Melanoplus DNA was used as a template. This product was diluted 1:50 and subject to re-amplification, which
was unsuccessful.
ND-I region primers only worked for one sample, MS-6. A 1:25 dilution, combined with 0.5 ml MgCl2
in the reaction mix seemed to produce the best results. However, further attempts to produce this fragment using
MS-6 and other templates were unsuccessful.
The 2500 bp fragment from primers 25681 and 25862 was successfully produced using both Drosophila
and Melanoplus templates. Amplification was unsuccessful vnih Anabres templates, and some Melanoplus
templates. Replacing primer 25682 with primer 31288 did not change results.
The primer pair 34941 and 34942 did not work. The primer pair of 34941 and C2-J-3696 only provided
reliable amplification Wt&iMagicauda and Drosophila templates. The reaction produced a doublet band for
sample M H-I I.
32
Lichen grasshopper primers (37744 and 37743) did not amplify any samples.
The primer combination of 25682 and 23944 reliably produced a 1557 bp fragment for most Melanoplus
samples. However, re-amplifications using these primers were unsuccessful.
PCR/RFLP
The following enzymes did not digest the 25681/25682 PCR product: ApaI, Aval, BamHI, BanI, BglI,
BglII, ClaI, EcoRV, HaeIII, H indi, HpaI, KpnI, NotI, PstI, PvuII, S adi, Sail, SmaI, SnaBI, and XbaL
The bands resulting from restriction of PCR products are shown in Table 6. Amplified DNA was
generated from samples M B-17 (Broadus), MH-8 (Havre), MH-9 (Havre), and MT-15 (Three Forks).
Table 6. Bands produced by restriction of 25681/25682 PCR product
Enzyme
Band Sizes (kb)
AluI
1 .2 ,2 4
Avail
0.6, 2.0
DdeI
0.1,0.2,0.3, 0.4, 0.7
DpnII
0.2,0.6, 1.8
DraI
0.4,0.7,0.8
EcoRI
0 5 ,0 .6 , 1.8, 1.9,2.0
HindIII
0.8, 1.8
Hinfl
0.7, 1.9
HpaII
0.6, 1.8,2.0
MspI
0.5, 1.8
33
Table 6. (continued)
Enzyme
Band Sizes (kb)
Sau3A
0.8, 1.7
SstI
0 .4 ,2 2
TaqI
0.5, 2.0
Results were difficult to interpret for some enzymes because of incomplete digestion (see EcoRI, HpaII).
Also, smaller-sized restriction fragments approached the size range o f residual primers and dimers, making them
difficult to distinguish.
PCR products from reactions using 23944/25682 primers were digested using several o f the enzymes.
None of the enzymes produced polymorphic restriction fragments. The resulting band sizes are summarized on
Table 7. Amplified DNA was generated from samples MB-I (Broadus), MH-I (Havre), and M T-I (Three Forks).
Table 7. Bands produced by restriction of 23944/25682 PCR product
Enzyme
Band Sizes (kb)
DpnII
0.4,0.5, 0.6
DraI
0.3, 0.5,0.8
EcoRI
0 .7 ,0 9
HindIII
0.1, 1.5
MspI
0.5, 1.1
34
Ligations
Ligations using pCRII plasmids were successful and provided large amounts o f usable DNA
Ligations into pUC18 plasmids and transfection into M 13 vectors did not work. Several attempts at transfection
were made. Control reactions using M13 revealed extremely low transformation rates.
DNA Sequencing
Sequencing reactions generally worked well, although DNA from plasmids was superior to LMP agarose
purified PCR product. The number o f base pairs revealed by a given primer was limited to 100-200 bases.
Attempts to extend the sequence by using Sequenase buffer and extension mixes (to partially replace termination
mix) were generally unsuccessful. The primers used in sequencing reactions are given in Table 7. Odd-numbered
primers sequenced 5' to 3' starting at the 23944 (ND-I) end of the fragment, while even-numbered ones sequence
5' to 3' from the 25682 (16S RNA) end.
Table 8. Oligonucleotide Sequences for primers used for sequencing 23944/25682 PCR product
Primer
Sequence
PPl
5'-CCACCAGATCCGTATTCAAT-3'
PP2
5 '-GGCT GGAAT GAAT GGCT-3'
PP3
5'-CACGCTAAAGATAAAGGGAAAG-3'
PP4
5’-CGAGAAGACCCTATAGAGCT-3'
PP5
5'-GAATTAGATGATCAACCAGC-3'
PP6
5 '-GGGGTGAC AT GAAG AAT AA A-3'
PP7
5 '-GGAA AAAT AACCC AAAT AACC-3'
35
The partial sequences of the ND-1 gene and 16S rRNA genes are shown in Figures I and 2, repsectively.
Figure. I. Partial sequence o f the ND-I gene. The primer 23944 corresponds to positions 11840-11862 on the
D ro so p h ila yakuba mitochondrial genome (Clary and Wolstenholme, 1985). The PP series primers and the
23944 primer locations are marked in the line above the sequence.
*————2 3944--------->-------**
TATCATAACGAAAACGAGGTAAAGTACCACCGAACTCAAATAAATCCAAAGATACTAAAGCAAGCTTAAT
10
20
30
40
50
60
70
AAAAATATAAAAGATAAAATCACCTCCTAAAAAAATTAAAGTTAAAAGTATTCTACTAAAGCAAGCTTAA
80
90
100
HO
120
130
140
——P P l——
TAAAAAATGAAAATTCTTGTATATTCAGCTAAAAAAATTAAAGTAAAACCACCAGATCCGTATTCAATAT
150
160
170
180
190
200
210
TAAATCCAGAAACCAATTCAGATTCTTCAGCAAAATCAAAAGGAGTACGATTAGTTTCAGCTAAACAAGG
220
230
240
250
260
270
280
---- PP3---------->----------- *
AGCAAAACACGCTAAAGATAAAGGGAAAGAAATAATAATAAATCAACAATATATTTGATAATTTATAAAA
290
300
310
320
330
340
350
TCAAATATATTAAATCTACCAATTAAAATAATTAAAGATAATAAAATTAAAGCTAATCTTCATAAGAAAT
360
370
380
390
400
410
420
—
——————p p 5
*
AGTTGAGCAACAGAACTGAAAGAACCCAATAAAGAATAATTTGAATTAGATGATCAACCAGCAATTATAA
430
440
450
460
470
480
490
CATGATAAACACCTAATCTGTACAACATAAAAAAATAAAAATCCATAAGAAAATGAACACATATAAGTTA
500
510
520
530
540
550
560
*----------- PP7------ >------ *
AATAAGGAAAAATAACCCAAATAACCAAAGAAATTATTAAAATTAAAGACAGGAGAAAAATAATATATAA
570
580
590
600
610
620
630
TAAATAATTAGATATAATAGGAATTGGTTGCTCCTTACAAATTAATTTAATAGCATCACTAAAAGGCTGA
640
650
660
670
680
690
700
GGAATACCAGCAAA
710
36
Figure 2. The partial sequence of the 16S region. Primer 25682 corresponds to positions 13416-13397 in the
Drosophila yakuba mitochondrial genome (Clary and Wolstenholme, 1985). The PP series primers and the
25682 primer locations are marked in the line above the sequence. Unknown bases are designated by X
*———2 5862----- >---------*
CGCCTGTTTAACAAAAACATGTCCTCXXXXXXAGATTATATATAGAGGCGGCCGCTCACTGACAAGTACT
10
20
30
40
50
60
70
GACAAGTTTTAAAGAGCCGCGGTATTTTGACCGTGCAAAGGGTAGCATAATCATTAGTATCTTAATTGGC
80
90
100
HO
120
130
140
————p p 2——
—*
TGGAATGAATTGGCTTGACGAGAATTTAACTCTTTCAATTAAATTTAAAATAGAATTTAACTTTTGAGTT
150
160
170
180
190
200
210
*------- pp4---- >--------- *
AAAAGGCTTAAAATTTTCTTAAAGACGAGAAGACCCTATAGAGCTTGACATTTTXXXXXAAAATATAATT
220
230
240
250
260
270
280
*------pp6---- >----------- *
TTAGATAGTTTTATATTTTAAGATAATGTTTTGTTGGGGTGACATGAAGAATAAATAACTCTTCATTATA
290
300
310
320
330
340
350
AAATCATTGATTATGTTTATTTTCATCCATAATTTATGATCATAAGATTAAGTTACCTTAGGGATAACAG
380
390
400
410
420
370
360
CTAATTGTTTTTGAGAXXXXCATATTGACAAAGCATGATTTGCACCTCGATGTTGGACTTAGGTAATAT
450
460
470
480
489
440
430
Polymorphisms in mtDNA Sequence
Almost no sequence differences were noted between samples from Broadus (M B -2), Havre, (MH-9),
and Three Forks (MT-1, MT-14). Sequences using PCR product as a template differed slightly from sequences
using a plasmid template (Fig. 2). These differences may have arisen from incorporation errors by the Taq
37
polymerase or infidelity in plasmid replication.
The sample M T-I showed a substitution of adenine for thymine in position 332.
Figure 3. The mtDNA sequence resulting from priming with PPL The plasmid sequence is given on the numbered
line, and sequence changes in the PCR product are shown above it. The asterisk indicates the location of the
substitution in sample M T-I
c
A
CTTCAGCAAAATCAAAAGGAGTACGATTAGTTTCAGCTAAACAAGGAGCAAAACACGCTAAAGATA
240
250
260
270
280
290
300
AGGGAAAGAAATAATAATAAATCAACAATATATTTGATAATTTATAAAATCAAATATATTAAATC
310
320
330
340
350
360
365
DNA Sequence Analysis
The aligned insect sequences from 11 species are shown in figure 4. Data from the ND-I and 16S regions
were combined in the analysis to maximize the number of bases sampled. The weighting parameters used in the
ALIGN program were: mismatch penalty = 2, open gap penalty = 4. and extend gap penalty = I Unknown bases
are designated by "X".
Figure 4. Aligned sequences used to calculate genetic distances. The species codes are as follows.
Drosyak= Drosophila yakuba, Anopqu= Anopheles quadrimaculatus, Apismel= Apis mellifera, Melsan=
Melanoplus sanguinipes, Locmig= Locusta migratoria, Spodfru= Spodopterafrugiperda, Blkfly= Prosimulium
fuscum, Ophart= Opharella artemisiae, Lymant= Lymantria dispar, Psammo= Psammotettix lividellus,
Myrforf= Myrmecia forficata
N D -I Region
60
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
TATCATAACGAAACCGAGGTAATGTACCTC-GAGCTCAAATAAATACAAA------- TGAAAT
................ T ............T ................... A . . C . . A . - . . A ....................................... .......... A ...........
. . . — ---- . , . . TT. . . . . . AA • • • • • • ■ ' • • AT...................T . . A . C . AATA • • • . . .
................................A................... A...........A . C . . A. .
................. C ------ ----------. . T . C
................................A................... A........... A . - . . A . C . . C . C . . . A . A . . . --------A. . . . C
38
Figure 4. (continued) The species codes are as follows: Drosyak= D rosoph ila yaku ba, Anopqu= A noph eles
quadrim aculatus, Apismel= A p is m ellifera, Melsan= M elan oplus sanguinipes, Locmig= L ocu sta m igratoria,
Spodfru= S p o d o p te r a fru g ip e rd a , Blkfly= Prosim ulium fuscum , Ophart= O ph arella artem isiae, Lymant=
L ym a n tria d is p a r , Psammo= P sam m otettix lividellus, Myrforf= M yrm ecia fo rfic a ta
120
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
AAAAGTTAATTTTACATAAAATAATAAATTAAATACATCACAACCTAAAAAAATTACACA
............................. A . A . A ............. T A. GTC. . T . A . T . . . . . T C . . . . . . . . . . . A . . .AC
. . . ----- . . . A . . A . A ............T . T . ATTGA. C------- T . T . A . T . .A T ------- T ------ A T .T
T . . . . —C . . G
C
AT. . . . . AG. T . —. A . . . . . CT............. . . . . . . . A . GT
T • • . . AA • GC• . G . A . A * . . . AT. A . * . GA. T . A. A• . . • • C . • • C . • . * . . . *C. ATG•
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
AAACAATATTCTTATAAAT--------------------------------- AAAATTCTAGCATATTCTGCTAT
. . . rE...........A---------------- ---------------------------------- -------------- T . A.............. A . . . . A
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
AAAAATTAAAGCAAAACCACCTCTTCTATATTCTACATTAAATCCTGAAACTAATTCTGA
.....................................C. .C . .A .......................... A.......................... A................... C. .A . .
..................... TA____ TATT. T . . .ATG.............. A .T ..............A. .A . . T ................... A. .
• • • « • • • . . . . T . . . . . . . . . A G A * . CG* • . . . A . T . . . . . . . . . A. . . . . C . . . . . A. .
G ........................ T ......................AG................ C . . A . T ..............C . . A............C . . C . . G . .
.....................................G. . C .......................... C. . A. T . CC. . . C ..................................... CT
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
TTCACCTTCAGCAAAATCAAAAGGAGTTCGATTAGTTTCAGCTAATGAAATTGTTAATCA
. . * * . . * . . . . . C . . . . . AC. . GAA. C . . . C .*
T ...........T ..............................
............. TAA____ AT____ ATTC.A. .A . .CAT
T ............. ATT................... T
A. . . . . . . . . . . . . . . . . AC. . GGA. CA• • A . •
C. . G .................. T ........... A. . . GAACCA. . AA.
C . .T
..............................................CTTGA. C. . . T. . .
. . .T
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
AACTAAACTTATAGGAAATAAAATAATTAAAAATCATATATAAATTTGGTAATAAAAAAA
180
T . . A. TA. C. . . . . . . . . . ————————----—— . T. . .AT.TAT.. . . . . A . A . . A
T . . A . G ............. AC____ GCAAGCTTAATAAAAAATG...................T . T .............. A-------A
. . . T . . C .................. G .. A---------------------------------- - T ...................A.............. A . . A . G
___ ______ ______ —— —------------ —------------- ------ e . . »TT. . . . . A. . . . A
240
300
360
. . . . . . C. C. . .
C . TC. . . TA. . AT
CG. . . . . GA * *A *
. GA. . . . GC. • A .
. CA. . . T ------ A.
. . . AC• • . A. . AA. T . . . . . . G . . . . . . GA• • . A. . . CT• T . . • .
• T . C . . T . A ___ GC. . . . TTA. . . . - T . . . CT. A. . A................
G . . AG. . . . . . . A . T . . . . . . A C A . . . T . . . . . A . . * . TT• T • • .
G• • AG. . * A. . CA. T . . . . . . A C A •AT•TAA. T . A . *• TC. T . . .
.......... T T . A . . . A . T ............. A . C . . . . T . . . . A . . . AC.............
39
Figure 4. (continued) The species codes are as follows: Drosyak= D rosoph ila yak u b a , Anopqu= A noph eles
quadrim aculatus, Apismel= A p is m ellifera, Melsan= M elanoplus sanguinipes, Locmig= L ocu sta m igratoria,
Spodfru= S p o d o p te ra fr u g ip e rd a , Blkfly= Prosim ulium fuscum , Ophart= O ph arella artem isiae, Lymant=
L ym a n tria d isp a r, Psammo= P sam m otettix H videllus, Myrforf= M yrm ecia fo rfic a ta
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
420
ATAAATTATATTATAA-CTCCCAATTAAAAAAATAAATGATAATATAATTAAAGCTAATC
• • XT • AA e Ae e e e e # * ” T • X • • • • •
• • TC• • • . A . . G . A . •A e • • T • • # C
• •C• • • • • • • • • •T • • • • • • •
• • • • • GC*»*»*»A»*" #*A*«*«*
TATT. . • . A. . . . A . • -TCTAT. . .
• • • • • • • • • • • CTC• • • . A . ............. .................
TT• TT• . T
CTA. . . . CT. AA• . . AA. . .AT
• • .T . • .T . .A ............... A................................
• • .T . • . T ....................... A...................................
T . . C . . . TCTA• . . . T . . A . . . C .......................
480
TAACTTCATAAGAAATAGTTTGAGCCACAGCTCGTAAACCCCCTAATAAAGCATAATTAG
.T
• • . T . • • . A. T
.T
G
........ T..T..C...........................
TA. .GTT.AT..TAAC. ...TTGAT.... A.T ......... C
........ A ___ AA.TG. ..GAA..C...... A ..... T.
........ A ___ AA..... GAA..C .... T ....... T.
..AA.... T. .T. . C .... T ........... ..........
AATTAGAAGATCAGCCAGCTACTATAACTGTATAAACTCCTAATCTTGTA
540
CAACA
C .... A.T. ..T. .A....... C .... A. .A. ..----T...A.A.A..A...A.G........T...A.C.A A .ACTAA
A .... A.T..... ATG..... A ...... .... .....
A .... A.T.... A .......... TC .... A. ..----A ....... C ............. A ....... A. ..-----
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
600
TAAAAAAAATAATCCACCTAAATTAAAAGAGTATAATTTAACAA------AAAAAGGTATAC
................GA. C............................. A . . C . . C . . . . TT. ------ . . T . . . . A . . . .
• C . . . . . ___——. . . . . . . C. . ------. . * . . . A . . TA.. TCCA. • TC. A. G. . . .
......................... AAAT. .AT. .GA. . .T . . AC. C.TA.A.GTT. ------ . .T. . . .A.A.A
. . C___ T. A. . -----. . .GT. .GG............AC. C. TA. A. GTT. ------ . . T ------ A.A.A
..............AATT.........................CTAAT. .TA. . . .A.T------ . . T. . . .A. .CA
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
660
ATA-TTCAAACAAATAAAGATAAAAATAAAGAAAAA-ATAGG---- AGAAATATAATATCT
———* * * . . A . . . * . . AGA
* . . —. * * * . » T C • C C • • • •
TCT.T.........
A. TA. AT.
• A . A . • * . T . T . . C e • • T • ........... A . •TATT. . T - . .
.....
..........A..............
A.
TA• - C C • • • • T • • CC• • • • A. TT. T. . . .ATT.. .G.C
—T
TA• —C • • • • • TT # . C . . . . . . . T. T----- TT------- . C
• • • —A • • • • • T T • T • • • • • .........TA.. . CTT. . . . . .
40
Figure 4. (continued) The species codes are as follows: Drosyak= D rosoph ila yaku ba, A nopqu= A nopheles
quadrim aculatus, Apismel= A p is m ellifera, U d s m = M e la n o p lu s sanguinipes, Locmig= L ocu sta m igratoria,
Spodfru= S p o d o p te r a fr u g ip e rd a , Blkfly= Prosim ulium fuscum , Ophart= O ph arella a rtem isiae, Lymant=
L ym a n tria d is p a r , Psammo= P sam m otettix lividellus, Myrforf= M yrm ecia fo rfic a ta
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
720
-TAAATAATTTGATAATAATGGATAAGTTTGTTCTTTTGTAAATAATTTAATTGCATCAC
, C. . A...................... T. CA.
A. T .
- . G ................ AA.A . .A . . -----------------.CA . . . . . A. AT.........C . . T . A . . .
AA • . . . . . . . . A . . . . T A . T A . . . ATT• G. . C. .C. . ACA. .T ............. A. . .
—A■. . . . . . . A . . . . T A . . A * * . A T . . G. • . .C. .ACA......................A. .
___ A....................................
- ......................A. . A. .ATTA..........................
DROSYAK
ANOPQU
APISMEL
MELSAN
LOCMIG
SPODFRU
746
AAAAAGGTTGAGGAAT-TC--------- C
T................ — . T. . . ---------------A
T . . . . . . . . . . ——. . *A.A
.
T............C.................-A. CAGCAAA
T............................... -A. CTAAAAA
----------------------------------------
16S Region
DROSYAK
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
60
GCGGACAAATTGTTTTTGTACAGAAAAACT------TAATATATAT-TTCAGATTGGACGGG
a ___
A
................G. GXXXXXXTC............ . A.A-C. . C . —CC. G. .A.
______ Cl.
. . . ------. . .AT.
. T -----
TA. A-A. . CAGC. A. . . .A.
120
DROSYAK
ANOPQU
BLKFLY
M-RT..c^AN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
TGACTTT----------- T-AA—AATTTACCGGCGTCATAAAAGTCAGA GCTTTCCATCG
• • . . . . . . . . C. . . . . . C. . . . . . . C*GGC. ———CGC. . . . . . . .
............AAA--------. - . . — . . C. .C..............................C.G.C.
CG...................
. • • • . G. -----------. C. *——. . . . . CT . . . . . C . . . . . . . C . GGC• — CG. . . . . . . . .
......... AA-——————. —T. ——• • • • . C. . A. G. C..........T. ——. . . . CAC. T. .A. . . .G.
---------. . ............................ .......................................... C.G.C.
CGA.................
......... A .AATATTA.-.T— ......... C. . .A...............T. .C.G.C.
TG...................
. • . • • AA----------- • —
T • TT. . . . . C . . . A . . . . . . . . . . C.G.C.— TG. . . . . . . . .
AT......... A----------. - . T — ..................A...............T . . C.G.C.
CG...................
————————————————————. . . . . . T. . A . . A . .* TT. .C.G.C.
CGAAA. • • • • •
. T. . . .AA----------. - . . — ............T. .A.............. C. .C.G.C.
TG...................
41
Figure 4. (continued) The species codes are as follows: Drosyak= D rosoph ila yak u b a , Anopqu= A n oph eles
quadrim aculatus, Apismel= A p is m ellifera, Melsan= M elanoplus sanguinipes, Locmig= L o cu sta m ig ra to ria ,
Spodfru= S p o d o p te ra fru g ip e rd a , Blkfly= Prosim ulium fuscum , Ophart= O ph arella artem isia e, Lymant=
L ym a n tria d isp a r, Psammo= P sam m otettix livid ellu s, Myrforf= M yrm ecia fo rfic a ta
DROSYAK
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
180
TATTAGTAATCAGAAAATTAACTTCCGACCTTACTTACCAACCTGCTTTATAATTGACAA
T.............................................. A.......................T. AT ■C• • • • TA•
. CC. . G. AC.
A.
. C. TA. . — .
G.A.
• T.G
. C. T. . . A . .
,CC.A.
. A. G
C............. A____T.TTC. .
T. T.........A.............. T.C.
.A.T . .A.A
T.T.....A....
• . A.T . .A.A
. .T.
••.Te.A.A.•C . . . ---- T
TCCT__ A. A
GA• G
C. T .
C
.TT.A..A.••. A. TA..
• A . . T *.A.A
. .T.T.A . A. T
T
.
T T . A T . A . . . . • T . . . . . .G
__
_TT.A.A
. .T.T.A
DROSYAK
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
AGTAAATTTAAATTTTAGCTTAAAATAAAAAATCAGTTTTTCGA-TTTTAATTAAATTTT
.-A..... T ..AAA. .T.. .G............ A ....... - ..... A.T .... C
___ TT.... T.GAA.A..... TGG..GT........ C. ........T. .T.....
-T..... .... ...T..... T.G....C...A....C...A..... AA.G.A....
.
.T .A .T .TAAAA.T ..... T.G----T...A--- C
-A
-..A. .GAACC
.AAT..A.*— ...A.A.TT............T...A........—A ..... AAT......
..A. .TAA--- — A. .T..... T ....... T.A..... A.-.... T --- T --— G ........T ..ftk••T ...... T ......T ... ....*GC.—A ....T.A..T....
.A .— .••.A. •••AA ••AT ••TT ...TT..... TCAA...*A .C-AA.... CA •••AGAC
...
..A.TT••••TT *..T ...AT....T...T....AT.* —A ......A**..ACC
..
..... TAA..TA..... T.T....... A....AA..-..... A.T
ACC
DROSYAK
CTGCTCTTCTGGGATATTTAGAAATATAAAA------TAAA
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
..........................................C ..................... - . . . . ------ . . T T -----. . . T----------. . . T . — . .
..........................................C .C ..................... TT. ------ A . T . ---- . . . . ----------T . . - . — . .
..........................................C . C . . . C . G ..................
XXXXXTT
. T . T ----. . . - . — .A
..........................................C .C ........... G . . . . TAATT. . . T----- . . . . --------- . A . - . — . .
..........................................C . CA. . T . . . - . T T ------- . . . T ----- CT. . ---------. . . - . — T .
..........................................C . CA..................... T-------- .T C .----- • T . . CTCTA. . A - . — . .
G . CG................................ C .C A ............AT. . . --------. . . . ----- . T T . --------- . . . - . T A . A
...........A ...........................C .T ............T . . . TC------ GTT. ------. - . . ----------. . . - .
G.
..........................................C . TA............. GT.TT------ A TT.---- . . T . ----------T . . - T — . .
...........A ...........................C . ------------------------------ . . . . ----- - T . . --------- ----- - . — .A
240
300
TAAA-------ATT-A—AT
42
Figure 4. (continued) The species codes are as follows: Drosyak= D rosoph ila yaku ba, K noyqu= A noph eles
quadrim aculatus, Apismel= A p is m ellifera, Melsan= M elan oplus sanguinipes, Locmig= L ocu sta m igratoria,
Spodfru= S p o d o p te r a fru g ip e rd a , Blkfly= Prosim ulium fuscum , Ophart= O ph arella artem isiae, Lymant=
L ym a n tria d isp a r, Psammo= P sam m otettix lividellus, Myrforf= M yrm ecia fo rfic a ta
360
DROSYAK
ANOPQU
BLKFLY
AT— TTCTAATTAA-AT-TAAAATTAT— TTA-------- A----------- TTT— TA
. . — • • • • ——. A . . —
. TT. . A . . . ——AA. —————. ——————. . . AT. T
.A
TAAAAT
......
G .....AA..—T .— ....T.A..——AA.— ——— ,———— —,AA-— ..———.....C
MELSAN
LOCMIG
OPHART
SPODFR
LYMANT
PSAMMO
MYRFORF
APISMEL
. -------- . . . . TCA. . - . . A------------ -----------------------C------------.A . — . . ----- C . . . .C
. . -------------- . . C . . —. . —. . . . . . . . CAA. . . -------- . ------------ AAA— . . ----- C . • . • C
T . AA. C . . . . A . . . —. A -A . . T . AA. . ——. . . -------- . ————---------A——. . ----- . . . . T .
. . — . . . A . -------. . —. . —. . . TT. . . A— .A. ---------. ------------ A. . — A . ----- . . . . . C
. A— . A T ------- C. .- T A - . . . .TAG.A— . . . -------- . AAATTA. . . — AT.......................
. A— AAAAC • AA • • -T A - • • • . CA. • • — • •. ——-----. -------- ——. CG— • . —— . . . . . A
T A -—A . AA. . A . . T - T . —A. . . T
. -------- . ————— A. A— • • —— . . . . . .
. A— . .T A . . . A. .T .
.....................— . . . TATAA. -----------. . C— . .A TT. . . .C .
DROSYAK
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFR
LYMANT
PSAMMO
MYRFORF
APISMEL
A-------------ACCCCACTATAATTTTAAATTTTT----- TGAAAAT-TAAAATTTT----- TTGTA
. . . . . . C ................. . . . . . A . . ........ ................- A ........... AAA------. . . . .
................G . T . . . ..............A . . . — —.................—A........... AA. ------. G . . .
• . . . . . . G . . C . . C • —T . * » . A . ———. . . G . • G- . * • T . —• . . ———. A . . .
. . . G. . . G. . C . . C . T . T . AA. . ———. . . G. . G—. — . . . A . . —— . A . . .
.................. CCT................... AAA. — —. . . . . . A- A. . . TAAAA----- . . A . G
• ............. G. TT........... T .............. ———. . . . . . A-A. T . • . AAA----- . . . . .
. . . . . . . . . TT. . . . . . . . .
. ———. . . . . .
*T
CG-------- • . • . • . C . CTTA. . . . . . . . . . • AAA•A• . . . . —$• • • • • —————————A.
TAAAACA . . . . C . . . . T . A .......... T . A . . . ———. . . . . T . -ATTT . . . . A----- . . . . .
. . .T C . . . ACCA..................A. .
........... .......... T .......... C . AAA. . AA.
DROSYAK
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
ATTAAATACTTATTAAC-TAGGTAATTATT-------ACTAATTTTTTAATTCAATGAAATCC
. C . ..................... A A T T .-. . . .AC. .A . . A------- C. .
. .G.
• A ................... C . . AT. . —. . . . . C . AA. . A————. . . . . A . . . A ..........
. .G.
. C . —..........AA. . A . . AG. . . . . . T . A . A . -------- . . . G . A . . C .............
• • G•
..................... AA . . A . . . —...............T. A. AC------- . . . . «A . . C e . . . . .
. .G.
. . . . TTC. T . A . AA. . . —...........T . . A. AA------- . . . . . A . . C . . T . . T . . Ga
T . . . TTC. . . C . . AT. . —...........T . . A. . A------- . . . . . A. . C . TT. . T . . G a
T . . .T T C ............. A. . . - .............. TAA.A.------- . . . . . A. . C . TT. . T * *G.
. A. . C . C . T C . . AA. C T-A . AAG. . C . C . . -----------. • A.* .Ce CT. . .
. . Ga
T . . . . T . . . . G . A . T . A - . . —A.......... ..AA------- T T . . . A ................... .G.
. C . . T . .T T C ............ A -A . AC . T . A ____ TAAC. T ................. C. T. . . T ____ G
420
480
43
Figure 4. (continued) The species codes are as follows: Drosyak= D rosoph ila ya k u b a , Anopqu= A n oph eles
quadrim aculatus, Apismel= A pis m ellifera, Melsan= M elan oplus sanguinipes, Locmig= L o cn sta m ig ra to ria ,
Spodfru= S p o d o p te ra fru g ip e rd a , Blkfly= Prosim ulium fuscum , Ophart= O p h arella a rtem isia e, Lymant=
L ym a n tria d isp a r, Psammo= P sam m otettix livid ellu s, Myrforf= M yrm ecia fo rfic a ta
540
DROSYAK
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
ctattgtcgcattaaaaaaacctctcaa- gtatagctatttttt- ctaacgctggagcta
.......................................... T.............. - ............................... - ................................
......................................... A.............. - .A ............ G............- ................................
.................. - .......... C. . . .A. . . .XXXX..........A. .G. . . CG. A. . . .ACG.................
. . . . . . . . C . . . « . GT. . . . AA. G• . . . “C . T . • * . C. . * *.AC- . . . . . a . . . . . . . . .
............A . . . . C ..........T . . T .............. - . . T ................ A . . . - ................................
. . . . . . A . . . . . . . . . . . . . AAAA• • • • ■ • CT *. TT. T . . . . C . ™ . A . . . . . . . . . . . . .
....................................T. . AAAA. . . . . . . T. . TTCT. . A. C . - . A............................
..............G ..T T ... A
T
G. *AA. . . AA.* C-AA. . . . . . . . . . . . .
............................. T.................T . . T . - ......... A.................A- . A............................
............................. T . G . . . A . . A . . T . - ..........TG..........C.A-.A............................
DROSYAK
ANOPQU
BLKFLY
MELSAN
LOCMIG
OPHART
SPODFRU
LYMANT
PSAMMO
MYRFORF
APISMEL
563
CAACCTAATTCTAT---- AT-T-A
......................... CA----- ..-AA.
......................... -C--------- . . G. A. . C. . -----T A -.-.
------------------------------------.................... T . . A----- . . A . -T
............................. .......... - . - T
............................. ....................
. . . . T................ATCA.A-.-T
----- -------------------------- .-T
. . . . T ................ C----- T . - . - T
Kimura 2-parameter genetic distances (Kimura, 1980) were calculated using DNADIST and sequence
alignments in Figure 4. A table of genetic distances is shown in Figure 5.
Figure 5. Genetic distances between 11 insect species, based on partial ND-I and 16S sequences. See Fig. 4
for species codes.
DROSYAK
ANOPQU
BLKFLY
APISMEL
MYRFORF
LOCMI G
MELSAN
LYMANT
SPODFR
OPHART
PSAMMO
DROSYA
ANOPQU
BLKFLY
A P I S ME
MYRFOR
LOCMI G
MELSAN
LYMANT
SPODFR
OPHART
PSAMMO
0.0000
0.1951
0.2495
0.3859
0.4384
0.3001
0.2822
0.3145
0.2692
0.2613
0.4255
0.0000
0.2793
0.4279
0.5389
0.2961
0.2789
0.3672
0.3077
0.2937
0.4482
0.0000
0.3543
0.4766
0.3730
0.2944
0.3676
0.3054
0.3888
0.4967
0.0000
0.3548
0.5585
0.4791
0.3855
0.4714
0.3824
0.4623
0.0000
0.5621
0.5402
0.4708
0.4406
0.4581
0.4490
0.0000
0.2045
0.4294
0.3 8 9 2 .
0.4004
0.5610
0.0000
0.4569
0.3871
0.3219
0.5152
0.0000
0.2217
0.3739
0.6036
0.0000
0.3478
0.4802
0.0000
0.4538
0.0000
44
Consensus trees were generated using bootstrapped data sets and the NEIGHBOR and CONSENSE
programs. A consensus neighbor-joining tree using Opharella artemisiae (Coleoptera) as an outgroup, and a
consensus UPGMA tree were constructed. The trees are illustrated in Figures 6 and 7.
Figure 6. A consensus tree generated from neighbor-joining trees. The numbers at each node indicate the
bootstrap resampling value o f the clade. The species codes are as follows: Drosyak= Drosophila yalcuba,
Ainophqu= Anopheles quadrimaculatus, Apismel= Apis mellifera, MQtean=Melanoplus sanguinipes, Locmig=
Locusta migratoria, Spodfru= Spodoptera frugiperdis, Blkfly= Prosimulium fuscum, Ophart= Opharella
artemisiae, teymant= Lymantria dispar, Psammo= Psammotettix lividellus, Myrforf = Myrmecia forficata
+------MELSAN
+100.0
+—4 4 . O
+— —LOCMIG
I
I
+----------- —ANOPQUAD
+--------- 3 1 .0
!
j
I
I
+-------------------- —DROSYAK
—SPODFRU
I
100.0
I
!
I
I
!
I
I
I
I
I
+—40. 0
+— —MYRFORF
I
+ -56.0
I
+ -8 3 .0
+— —APISMEL
I
I
I
+- 56. 0
4------------- —PSAMMO
+
I
j
+—
+ --------------------- 1 0 0 . 0
I
I
H-- —LYMANT
I
+-------------------- —OPHART
I
+
B LC K FL Y
45
Figure 7. A consensus tree generated from UPGMA trees. The numbers at each node indicate the bootstrap
resampling value o f the clade. Species codes are as follows: Drosyak= D ro so p h ila ya k u b a , Anophqu=
A noph eles qu ad rim a cu la tu s, Apismel= A p is m ellifera, Melsan= M elan oplus sa n g u in ip es, Locmig= L ocu sta
m igratoria, Spodfru= S p o d o p te ra fru g ip e rd is, Blkfly= Prosim ulium fuscum , Ophart= O p h a rella artem isiae,
Lymant= L ym an tria d isp a r, Psammo= P sam m otettix lividellus, Myrforf= M yrm ecia fo r fic a ta
+------API SMEL
+-70. 0
+ -8 1 .0
+------ MYRFOHF
I
+-43. 0
I
I
+-------------- PSAMMO
I
I
I
+----- LYMANT
+ -3 1 .0
+--------- 97.0
I
I
+-------SPODFRU
!
I
+- 49. 0
+------------------------------ OPHART
I
I
I
I
H----- LOCMXG
+ -8 9 .0
+------------------------- 98.0
I
I
+-------MELSAN
+100.0
!
I
I
I
I
!
I
+------------------------------------------------------- ANOPQUAD
+
+------------------------------------------------ BLCKFLY
DROSYAK
46
DISCUSSION
.
DNA Extraction and Purification
The DNA extraction procedure that worked best was the Davis method. This protocol was adequate for
obtaining useful samples. However, the observed variations in yield and purity indicated that the extraction
technique could be improved to achieve more consistent results. The lack of amplification in many PCR reactions
may have been caused by proteins or other impurities in the extracted DNA inhibiting the reaction. Experimenting
with modifications o f current techniques, and trials of other extraction procedures may greatly enhance results.
A simpler and less time-consuming procedure would be helpful.
DNA purification with Sepharose columns seemed to be the most effective technique for cleaning up
previously extracted DNA. Evidence for the efficient removal o f proteins is the disappearance o f colorationcausing pigments. However, the fact that only undiluted Sepharose-treated samples worked in PCR reactions
seems to indicate that a large fraction of the DNA is lost during the procedure. Purification o f PCR products was
done best with low melting point agarose protocols. A drawback to this procedure is the high cost of low melting
point agarose. The optimization and standardization of PEPSI elutions might be worth pursuing, as it is very
quick and uses relatively inexpensive conventional agarose.
DNA Analysis with RFLP's
The probing o f Southern blots with radiolabeled mtDNA fragments was of limited value. Difficulties
in transform ing the mtDNA probes proved highly time-consuming. The use o f mitochondrial probes from
different organisms may have caused unforeseen problems. Ih e fact that a large proportion o f restrcition enzymes
did not digest the DNA might indicate that the extracted DNA was not pure enough or that there were problems
with the enzymes or restriction techniques. Inconsistencies in the sizes of bands produced by hybridization, and
the fact that none o f the hybridized blots revealed bands whose sizes added up to 16 kb, are evidence that
incomplete digestion occurred in many o f the blots.
PCR Methods
The use of RAPD PCR had a promising debut but subsequent trials did not produce results. However,
the simplicity and ease of this method, and the success of the initial trial, warrant consideration o f continued work
with this system.
Trials o f mtDNA PCR primers found two primer sets that were quite useful, 25681/25682 and
25862/23944. The 2500. bp fragment produced by 25681/25682 primers was large for a conventional PCR
product, and this may explain the difficulty in amplifying a large number o f Melanoplus samples. The smaller
size (1557 bp) o f the fragment produced by priming with the 25682/23944 pair may have allowed the reaction
to work w ith a greater number o f samples. The P P l and PP2 primers designed from the sequencing of this
fragment provided excellent re-amplification when the 25682/23944 product was used as a template, and good
amplification with the original Melanoplus templates. The primers designed for sequencing have a tremendous
poential to be used as PCR primers in future studies. The use o f mtDNA PCR will be facilitated in the future by
the continued compilation of and experimentation with new PCR primers (Simon, et al., 1994).
The restriction of PCR products, although it did not reveal polymorphisms, can be a quick, reliable, and
non-radioactive method for assessment o f genetic variation (Simon, et al., 1993). By testing many different,
primer pairs, a segment o f grasshopper mtDNA that is polymorphic could be found that reveals useful RFLP s.
However, incomplete digests can confound results, and individuals with few genetic differences could be
indistinguishable.
48
Ligations
The use of pCRII plasmids provided for transformation and harvesting o f large amounts o f DNA. M13
cloning techniques did not work well. Probable causes for this are low ligation rates with pUC18 plasmids,
inefficient transfection into M13 vectors, or lack of transformation into HDSaFTQtmcells. Control reactions
indicated that tranformation rates were low, and electrophoresis o f putative ligation reactions revealed bands that
were inconsistent with expected patterns. Optimization o f transformation and ligation protocols would greatly
benefit future research.
DNA Sequencing
Sequencing yielded the clearest results o f all the techniques tried, although no variation was evident m
the region o f the mtDNA genome that was examined. Time constraints did not allow the sequencing o f more
samples or the exploration of other areas of the fragment for polymorphic loci, or to sequence other areas o f the
mitochondrial genome for polymorphic sequences. The long period o f time required to develop films, design and
w ait for the synthesis of primers, and set up and run sequencing reactions also contributed to the incomplete
sequencing o f the PCR product.
Three areas o f blockage occurred in the 16S sequence (see Fig. 2, bases # 27-32,265-269,436-440).
These compressions are often caused by areas of strong secondary structure in the DNA molecule. Areas with
a high guanine and cytosine content often cause loop-like structures to occur that inhibit the action o f the
polymerase. Sequencing the same area with a different primer was used in other instances o f blockage to show
the base order. Sequencing the opposite strand can also provide the base order o f a blocked sequence.
The quality o f plasmid DNA used as sequencing template may also have been a limiting factor in the
success o f the reactions. The amount of DNA yielded from miniprep extractions varied somewhat, and residual
impurities from the procedure may have affected results. The variation in yield from low melting point agarose
extractions was visible on EtBr-stained gels, and this correlated with band intensity on the sequencing gels.
The inability to transfect the mtDNA sequence into a single-stranded M13 vector also restricted the
success o f the sequencing reaction. The use of this as a template allows many more bases to be delineated in a
single reaction, and would have greatly accelerated progress in sequencing.
In any further studies using these methods, it would also be worth noting that the sequences from plasmid
templates differed from those attained by direct sequencing o f a PCR product template. Comparisons between
samples would be more valid if drawn from sequence data originating from similar templates.
DNA Sequence Analysis
Once the proper format for constructing input files for sequences was determined, the ALIGN program
and the PHYLIP program package were quickly and easily executed. The alignment o f homologous ND -I and
16S sequences (see Fig. 4) made visible the similarities, insertions, and substitutions that were used by the
DNADIST program to calculate the genetic distances between the species. The consensus trees based on this data
had several interesting features. The neighbor-joining tree in Fig. 6 showed 100 out o f 100 trees supporting the
placement oiMelanoplus with the other Orthopteran included in the survey, Locusta migratoria. Representatives
of the order Lepidoptera, Spodoptera frugiperdis m d Lyamntria dispar, also were grouped into the same clade,
at a 100% rate. Myrmeciaforflcata m dApis mellifera, two Hymenopterans, also group together, but at a lower
(56% ) rate. The two orders with single representative species, Homoptera (Psammotettix lividellus) and
Coleoptefa (Opharella atemisiae) occupy separate branches. P. lividellus sequences are fairly similar to the
Hymenopteran sequences; this arrangement received a moderate level (83%) o f support. The grouping o f 0.
atemisiae with the Hymenopterans and the Homopteran was supported by 56 trees. The Dipterans {Drosophila,
yakuba, Prosimulium fuscum, and Anopheles quadrimaculatus) were unresolved as a group. Liu and
Beckenbach's (1992) arrangement of insect phytogenies, based on the COII gene, often shows a Dipteran
representative {Drosophilapseudoobscura) occupying a branch nearest to an Odonata outgroup or on a branch
with a Lepidopteran moth {Galleria mellonella). They concluded that additional insect taxa and sequence are
necessary to attain a reasonable degree o f phylogenetic resolution. Simony et al. (1994) support a similar
conclusion.
The UPGMA consensus tree clusters similar lineages in the middle clades, while lineages with relatively
different sequences are pushed to the outside clades. This method does not allow for the selection o f an outgroup.
It primarily demonstrates that the Orthopterans5 the Coleopterans5 and the Lepidopterans are less derived and
have greater similarity to each other when compared to the Dipterans5Hymenopterans5and the Homopterans.
The analysis of sequence data concurs with the findings of Simon5et al. (1994), and Liu and Beckenbach
(1992) that additional sequences and taxa are needed before a clear picture o f insect phytogenies can be drawn
from mtDNA sequence data. This study, through the addition o f a new Orthopteran sequence, makes a small but
real contibution to that goal.
CONCLUSIONS
The results and analyses compiled in this study can be used to draw the following conclusions:
1. The sequencing o f DNA proved to be a much more powerful and reliable tool for gaining new
information about the genetics o f Melctnoplus sanguinipes than RFLP's with Southern blots, RAPD PCR, and
RFLP's o f PCR products.
2. Phylogenetic analyses comparing the novel Melanoplus sequence to other insect sequences show a
high degree of relatedness to another Othopteran, Locusta migratoria. It also reveals problems encountered by
other researchers in trying to resolve insect phylogenies using mtDNA sequence data.
•3. The potential for showing spatial and teOmporal genetic variation in Montana populations o f
Melanopus sanguinipes certainly exists. A possible approach bearing this out would be to test for amplification
o f Melanoplus DNA with all available insect mtDNA primers, and search for polymorphisms in the PCR
fragments by surveying with restriction enzymes and sequencing. Even if polymorphisms were not revealed, new
sequences that will improve our understanding of insect evolution would be compiled.
LITERATURE CITED
Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D J Lipman. 1990. Basic local alignment search tool. J. Mol.
Biol. 215:403-410.
Anderson, S., A.T. Bankier, B.G. Barrell, M.H.L. de Bruijn, A.R. Coulson, J. Drouin, TC. Eperon, D P. Nierlich,
B A . Roe, F. Sanger, P.H. Schreier, A.J.H. Smith, R Staden, and LG. Young. 1981. Sequence and organization
o f the human mitochondrial genome. Nature 290:457-465. ,
Avise, TC., C. Giblen-Davidson, J. Laerm, J. Patton, and R Lansman. 1979. Mitochondrial DNA clones and
matriarchal phytogeny within and among geographic populations o f the pocket gopher, Geomys pinetis. PNAS
USA 76:6694-6698.
Bibb, M.J., R A . VanEtten, C.T. Wright, M.W. Walberg, and D.A. Clayton. 1981. Sequence and gene
organization o f mouse mitochondrial DNA. Cell 26:167-180.
Brown, W., M. George Jr., and A. Wilson. 1979. Rapid evolution o f animal mitochondrial DNA. PNAS USA
76:1967-1971.
Chapco, W. 1991. Genetic variation in three subspecies o f Melanoplus sanguinipes (F.). I. Morphometric traits.
Genome 29:793-801.
Chapco, W., N.W. Ashton, RK.B. Martel, N, Antonishyn, and W.L. Crosby. 1992. A feasibility study of the use
o f random amplified polymorphic DNA in the population genetics and systematics of grasshoppers. Genome
35(4):569-574.
.
Chapco, W., R A . Kelln, and D A . McFadyen. 1994. Mitochondrial DNA variation in North American
melanopline grasshoppers. Heredity 72:1-9.
Cheng, S., C. Fodder, W.M. Barnes, R Higuchi. 1994. Effective amplification of long targets from cloned inserts
and human genomic DNA. PNAS 91:(5695-5699).
Clary, D O., and D .R Wolstenholme. 1985. The mitochondrial DNA molecule of Drosophila yalcuba: Nucleotide
sequence, gene organization, and genetic code. J. Mol. EvoL 22:252-271.
Cronin, M A ., S C. Amstrup, G.W. Gardner, and E.R. Vyse. 1991. Interspecific and intraspecific mitochondrial
DNA variation in North American Bears (Ursus). Can. J. ZooL 69(12):2985-2992.
Crozier, R H ., and Crazier, Y.C. 1993. The mitochondrial genome of the honeybee A # mellifera\ Complete
sequence and genome organization. Genetics 133:97-117.
53
Davis, R.E., T J . Kelly, E.P. Masler, E S. Thyagaraja, C A . Rote, and R B . Imberski. 1994. Complete base
sequence for the mitochondrial large subunit ribosomal RNA o f the gypsy moth Lymantria dispar (L.). Insect
Mol. Biol. 3(4):219-228.
Davis, R.W., M. Thomas, J. Cameron, T.P. St. John, S. Scherer, R A . Padgett. 1980. Rapid DNA isolation for
enzymatic and hybridization analysis. Methods Enzymol. 65:404-411.
Derr, J.N., S.K. Davis, J.B. Woolley, and RA . Wharton. 1992. Variation and the phylogenetic utility o f the large
ribosomal subunit o f mitochondrial DNA from the insect order Hymenoptera. Molecular Phylogenetics and
Evolution 1(2): 136-147.
Dowton, M., and A.D. Austin. 1994, Molecular phytogeny of the insect order Hymenoptera: apocritan
relationships. PNAS USA91(21):9911-9915.
Dueling, A. 1995. Unpublished GenBank data.
Eberhard, W.G. 1993. Species isolation, genital mechanics and the evolution of species-specific genetalia in three
species o iMacrodactylus beetles (Coleoptera: Scarabidae:Melolonthinae). Evoluton 46:1774-1783.
Fang, Q., W.C. Black IV, H.D. Blocker, and R F . Whitcomb. 1995. Unpublished GenBank data.
Felsenstein, J. 1993. PHYLIP (Phytogeny Inference Package) Version 3.5c Manual, Seattle, Washington.
Fielding, D J., and M.A. Brusven. 1990. Historical analysis of grasshopper (Orthoptera: Acrididae) population
responses to climate in southern Idaho. Environ. Entomol. 9:1786-1791.
Funk, D.J., D.J. Futuyuma, G. Orti, and A. Meyer. 1995. Mitochondrial DNA sequences and multiple data sets:
A phylogenetic study o f phytophagous beetles (Chrysomelidae:QpA<2 re/to). Mol. Biol. Eyol. 12 (In press).
Glenn, T.C., and S.J, Glenn. 1994. Rapid elution of DNA from agarose gels using, polyester ,spin plug inserts.
Trends In Genetics 10 (10):34-35.
Gustincich S.P., Caminci, G. Manfioletti, G. Del Sal, and C. Schneider. 1991. A fast method for high quality
genomic DNA extraction from human blood. Biotechniques 11:298-301.
Harrison, R G ., Rand, D.M. and Wheeler, W.C. 1985. Mitochondrial DNA size variation within individual
crickets. Science 228:1446-1448.
Harrison, R G ., Rand, D.M. and Wheeler, W.C. 1987. Mitochondrial DNA variation in field crickets across a
narrow hybrid zone. Mol. Biol. EvoL 4(2): 144-158.
Hew itt, G.B. 1983. Control o f grasshoppers on rangeland in the United States-A perspective. J. Range
Management 36:202-207.
Howard, D J ., and Shields, W.M. 1990. Patterns of genetic variation within and among species of
Chauliognathus (Coleoptera: Cantaridae). Ann. Entom. Soc. Am.-83(3):325-334.
Jacobs, H.T., D J . Elliot, V.B: Math, and A. Farquharson. 1988. Nucleotide sequence and gene organization o f
sea urchin mitochondrial DNA. J. Mol. Biol. 202:185-217.
Jermiin, L.S., and R H. Crazier. 1994. The cytochrome b region in the mitochondrial DNA o f the
ant Tetraponera rufoniger. Sequence divergence in Hymenoptera may be associated with nucleotide content. J.
Mol: EvoL 38:282-294.
Kemp, W.P. 1992a. Rangeland grasshopper (Qrthoptera: Acrididae) community structure: A working hypothesis.
Environ. Entomol. 21(3):461-470.
Kemp, W.P. 1992b. Temporal variation in rangeland grasshopper (Qrthoptera: Acrididae) communties in the
steppe region o f Montana, USA. Can. Ent. 124:437-450.
Kemp, W.P., and B. Dennis. 1993. Density dependence in rangeland grasshoppers (Qrthoptera: Acrididae.
Oecologia 96:1-8.
TCimnra M. 1980. A simple method for estimating evolutionary rates o f base substitutions through comparative
studies o f nucleotide sequences. J. Mol. Evol. 16:111-120.
Klein, M., and A. Seitz. 1994. Geographic differentiation between populations o iRhinocyllus conicus Frolich
(Coleoptera: Curculionidae): Concordance o f allozyme and morphometric analysis. Zoological journal of the
Linnaen Society. Tl 0(2): 18 1- 19 1.
Lewis, D.L., C.L. Farr, A L ., and Farquar, L.S. Kaguni. 1994. Sequence, Organization, and Evolution o f the A&T
region o f Drosophila melanogaster mitochondrial DNA. Mol. Biol. Evol. 11(3):523-538.
Lewontin, R.C., and J.L. Hubby. 1966. A molecular appraoch to the study o f genic heterozygosity in natural
populations. II: Amount o f variation and degree of heterozygosity in natural populations of Drosophila
pseudoobscura. Genetics 54:595-609.
Liu, H., and A.T. Beckenbach. 1992. Evolution of the mitochondrial cytochrome oxidase II gene among ten orders
o f insects. Molecular Phylogenetics and Evolution l(l):41-52.
Lynch, M ., and P.E. Jarrell. 1993. A method for calibrating molecular clocks and its application to animal
mitochondrial DNA. Genetics 135:1197-1208.
M artel, R.K.B., and W. Chapco. 1995. Mitochondrial DNA variation in North American= Oedipodinae.
Biochemical Genetics 33(1): 1-11.
Mayr E. 1970. Population, species and evolution. Harvard, Belknap Press, Cambridge, MA.
McCracken, A., I. Uhlenbusch, and G. Gellissen. 1987. Structure of the cloned Locusta migratoria mitochondrial
genome: restriction mapping and sequence of its ND-I (URF- I) gene. Curr. Genet. 11.625-630.
Mitchell, S.E., A.F. Cockbum, and J. Seawright. 1993. The mitochondrial genome of Anopheles
quadrimaculatus species A: complete nucleotide sequence and gene organization. Genome 36:1058-1073.
O rr, M .R., A.H. Porter, T A . Mousseau, and H.Dingle. 1994. Molecular and morphological evidence for
hybridization between two ecologically distinct grasshoppers (Melcmoplus sanguinipes a n d M devastator) in
California. Heredity 72:42-54.
Oudman, L. 1990. Morphological and allozyme variation in the Ephigger ephigger species complex (Orthoptera:
Tettigonidae). Netherlands Journal o f Zoology 40(3):454-483.
Pashley D.P., and L.D. Ke. 1992. Sequence evolution in the large ribosomal and ND -I genes in a Lepidopteran
mitochondrial genome: Implications for phylogenetic analyses. Mol. Biol. Evol. 9:1061-1075.
Rand, D.M., and R G . Harrison. 1989. Molecular population genetics of mtDNA size variation in crickets.
Genetics 121:551-569.
Roe, B A ., D. Ma, R.K. Wilson, J.F.H. Wong. 1985. The complete nucleotide sequence of the Xenopus laevis
mitochondrial genome. J. Biol. Chem. 260(17):9759-9774.
Roerdanz, R.L., and R.V. Flanders. 1994. Detection of DNA polymorphisms in predatory coccinellids using
polymerase chain reaction and arbitrary primers. Entomaphaga 38(4): 479-491.
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, Second Edition.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Sanger, F., S. Nicklen, and A R : Coulson. 1977. DNA sequenceing with chain terminating inhibitors. PNAS
74:5463-5467.
Simon, C., C. McIntosh, and J. Deniega. 1993. Standardrestriction fragment length analysis of the mitochondrial
genome is not sensitive enough for phylogenetic analysis or identification of 17-year periodical cicada broods
(Hemiptera: Cicadidae): The potential for a new technique. Ann. Entomol. Soc. Am. 86(3):228-238.
Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu, andP. Flook. 1994. Evolution, weighing, and phylogenetic
utility o f mitochondrial gene sequences and a compilation o f conserved polymerase chain reaction primers. Ann.
Entomol. Soc. Am. 87(6): 651-701.
Sm ith, D .R., and W.M. Brown. 1990. Restriction endonuclease cleavage site and length polymorphisms in
mitochondrial’ DNA oiApis mellifera mellifera m dApis mellifera carnica. Ann. Entomol. Soc. Am. 83(1):81-
88.
Southern, E.M. 1975. Detection o f specific sequences among DNA fragments separated by gel electophoresis.
J. Mol. Biol. 98:503-17.
Sperling, F.A.H., and D A . Hickey. 1994. Mitochondrial DNA sequence variation in the spruce budworm species
complex (Choristoneura: Lepidoptera). Mol. Biol. Evol. ll(4):656-665.
Tanaka, S. 1991. Genetic compatability and geographic profile of two closely related species o f Allonemobius
(Gryllidae: Orthoptera). Ann. Entom. Soc. Am. 84(l):29-36.
Uhlenbusch, I., A. McCracken, G. Gellissen. 1987. The gene for the large (16S) ribosomal RNA from the
Locusta migratoria mitchondrial genome. Curr. Genet. 11:631-638.
56
Vbgler, A.P., and R. DeSalle. 1993. Phylogenetic patterns in coastal North American- tiger beetles {Cicindela
dorsalis Say) inferred from mitochondrial DNA sequences. Evolution 47(4): 1192-1202.
Weller, S.J., D.P. Pashley, J.A. Martin- and J.L. Constable. 1994. Phylogeny of noctuid moths and the utility of
combining independent nuclear and mitochondrial genes. Syst. Biol. 43(2): 194-211.
Xiong, B., and T.D. Kocher. 1991. Comparison o f mitochondrial DNA sequences o f seven morphospecies o f
black flies (Diptera: Simuliidae). Genome 34:306-311.
Xiong, B., and T.D. Kocher. 1993. Intraspecific variation in sibling species of Simulium venustum and Simulium
verecundum (Diptera: Simuliidae) revealed by the sequence o f the mitochondrial 16S rRNA gene. Can. J. Zool
71:1202-1206.