MIT Biology Department
7.012: Introductory Biology - Fall 2004
Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel
NAME_____________________________________________________________TA__________________ SEC____
7.012 Problem Set 7 FRIDAY December 3, 2004
Not due unless you have had a prior agreement with Claudette Gardel
Solutions will be posted on the web.
Question 1
Leukemia is type of cancer characterized by the uncontrolled proliferation of white blood
cells (leukocytes). Chronic Myelogenous Leukemia (CML) is a type of leukemia primarily
caused by a translocation that relocates an oncogene, called abl, from the long arm of
chromosome 9 to the long arm of chromosome 22 in the bcr region (breakpoint cluster
region). The resulting bcr-abl fusion protein encodes a constitutively active tyrosine
kinase, which when expressed, leads to the CML phenotype.
a) Gleevec is an effective drug treatment of CML. What design principles were applied to
the development of Gleevec? How is this approach different from that used to develop
conventional cancer therapies?
Rational drug design was applied to the development of Gleevec. The idea is to design a drug that
specifically targets the underlying molecular defect, rather than nonspecifically target all
dividing cells, as do many conventional cancer therapies
b) How does Gleevec work at the molecular level?
Gleevec works by binding to the ATP binding site of bcr-abl thus inhibiting its tyrosine kinase
activity.
c) How many protein targets does Gleevec have? Name each target.
Gleevec does bind to two other tyrosine kinases: kit and the PDGF receptor.
d) Besides target specificity, what other characteristics of a drug should you consider
when designing a therapy?
Toxicity, absorption efficiency, is it metabolized, possible reactivity of metabolites, etc.
In contrast to drug treatments, gene therapy attempts to correct the defect by
introducing a functional copy of the malfunctioning gene that is responsible for the
disease phenotype. The functional gene copy can be introduced directly into the diseased
organ or can be used to genetically modify isolated tissue that is later re-introduced into
the patient.
e) What do you need to know about the target disease in order to apply gene therapy?
You need to know the gene involved in the disease. In particular, the disease should be caused by
a defect in a single gene.
f) How could you deliver the functional gene into the diseased cells?
A viral vector could be used (example: adenovirus).
g) What do you think are some of the challenges facing gene therapy?
Challenges include efficient uptake of the functional gene, stability of the gene,
long term expression, side effects of viral vector.
h) Based on your understanding of oncogenes, why would bcr-abl be a particularly
challenging target for gene therapy?
You would have to replace the fused bcr-abl gene with a functional copy of the
abl tyrosine kinase, not simply introduce the functional copy into the cell.
2
Question 2
Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder caused by mutations in the
gene encoding dystrophin, a protein involved in maintaining membrane integrity in muscle cells.
The dystrophin gene spans roughly 2.5 Mb and is spliced to form a 14 kb mRNA transcript
consisting of 79 exons.
a) Is dystrophin is a typical human gene in terms of its size and exon count?
Dystrophin is encoded by one of the largest human genes. Although there is great variation both
in gene size and exon count in the human genome, the average human gene length is roughly
10-15 kb and average exon count is approximately 4-8 exons per gene.
b) Why is DMD much more common in boys than in girls?
The gene is on the X chromosome and confers a recessive phenotype. Females have 2 X chromosomes
c) The DMD phenotype results from mutations that disrupt the reading frame of the dystrophin
mRNA. What is the impact of such mutations on the dystrophin protein?
A frameshift mutation in the gene would result in a truncated protein product
d) Based on what you know of dystrophin’s normal function described above, what do you think are
characteristics of the DMD disease phenotype?
Muscle cells would be severely damaged in response to the normal pressures exerted on them.
Symptoms of DMD include severe muscle damage and muscle weakness.
The dystrophin protein contains several functionally distinct regions (domains). The N-terminal domain
interacts with proteins inside the muscle cell, while the C-terminal domain enables dystrophin to bind to
membrane-associated proteins. The long rod-like central part of the protein is composed of 24 identical
rod domains (internal repeats). As a consequence of the modular structure of dystrophin, proteins missing
some of the internal repeats can be fully functional or at least partly active.
N-terminal
domain
C-terminal
domain
One therapeutic strategy involves excluding, or skipping, an internal exon during splicing. In
particular, skipping the exon that contains the frame-shift mutation in the DMD individual can
result in a shorter than wild type but functional dystrophin protein. This exon-skipping therapy
involves introducing a small RNA molecule that is complementary to the exon to be skipped.
Binding of the RNA to the pre-mRNA prevents proper recognition of the exon by the splicing
machinery and results in specific exon skipping.
e) In order for this therapy to work, what properties must this small RNA have? (Think about
cellular localization.)
The therapeutic RNA would need to localize to the site of splicing to cause efficient exon skipping.
Not only does the RNA need to enter the nucleus, but it must bind to its target exon on the premRNA. In fact, the small RNA can be engineered to bind to a specific protein that localizes to the
spliceosome! It is also important the RNA be stable and resistant to rapid degradation in the cell.
f) How would you deliver the RNA molecule into the target cell?
You could use a viral vector to introduce a gene encoding the therapeutic RNA into the cell
(allows for efficient uptake and expression).
3
g) How is this therapeutic approach different from gene therapy?
This approach is different from gene therapy in that it modifies the spliced mRNA rather than just
counteracting the genomic defect by introducing a functional copy of the whole gene.
h) What challenges do gene therapy and exon-skipping therapy have in common?
Efficient uptake, stability and expression of the foreign molecule, side effects due to viral vector,
etc.
Question 3
a) What percentage of genomic nucleotides do you expect two randomly chosen people to
have in common?
99.9 % DNA sequence identity
Genome sequencing has revealed that the average genome nucleotide difference between
two randomly selected chimpanzees is roughly four times greater than between two
humans.
Images removed due to copyright reasons.
Based on population genetic theory, levels of genetic variation within species should
correlate positively with population size. However, the human population numbers in the
billions and the population size of chimpanzees is fewer than a hundred thousand.
b) How can you explain the comparatively little variation between human individuals?
The human population likely experienced a severe, but short-lived, population
bottleneck, where the population was likely reduced to a few thousand, which in itself
may have reduced variation. In such a reduced population size, genetic drift can act as
a strong force to reduce genetic variation.
c) What is genetic drift?
Genetic drift refers to the changes in allele frequency in a population as a result of the role of
chance in the production of offspring (genes in offspring are not a perfectly representative
sampling of parental genes). Genetic drift has a stronger effect on genetic diversity in small
populations.
4
A few years ago, an international consortium was formed to uncover the locations of
genetic variation in the human genome. In particular, the consortium worked to identify
single nucleotide polymorphisms (SNPs) within the human population.
d) Is the genomic variation between individuals randomly distributed across the genome
or does such variation occur at common sites?
Variation tends to occur at common sites
e) What is a haplotype?
SNPs that are close together tend to be inherited together. A set of associated SNP alleles in a
region of a chromosome is called a haplotype. Most chromosome regions have only a few common
haplotypes that account for most of the variation between people. While a chromosome region may
contain many SNPs, only a few SNPs need to be recorded to capture most of the information about
the genetic variation in that region.
f) Why is an understanding of genomic variation useful for the study human health?
The 0.1 % that is different between individuals is important because it contains the genetic
variants that may play a role how people differ in their risk of disease or response to drugs. Many
common diseases, such as diabetes, are the result of many affected genes. Comparing the variation
between a group of diabetic individuals and a group of non-diabetic individuals may reveal
regions of the genome that are different between these groups and may help to reveal the many
genetic changes underlying the disease.
5
Question 4
Now that the first draft of the complete* genomic sequence of the Chicken is available
on the web (http://www.genome.ucsc.edu/cgi-bin/hgGateway?org=Chicken) you decide to
start analyzing the sequence.
* except for the sex chromosomes! (We’re waiting on Winston for this.)
Luckily, there are a lot of resources available. After all, Chicken is an important model
organism for the study of viruses, cancer, and developmental biology (and it’s finger
lickin’ good…)
a) Genbank (available from http://www.ncbi.nlm.nih.gov) lists 559394 mRNA sequences
derived from Chicken. Explain how you could use these sequences to find genes in the
Chicken genome.
Align mRNA sequences to the Genomic sequences, Exons (in the mRNA) will align
to the genome at genes.
b) Does your method also provide information about the structure of genes (i.e.
intron/exon boundaries, splice sites)? What are the possible limitations of your method?
Yes, introns will appear as gaps in the alignment where there is no sequence in the mRNA
corresponding to the genomic sequence. The method is limited to those mRNAs found in
the database, many alternatively spliced exons may be missed.
c) Now that you know the locations of all of the autosomal genes in the Chicken genome,
you would like to start trying to predict regulatory sequences. Unfortunately, Chicken is
the only bird that has been sequenced. Why might this be a problem? How have
regulatory sequences been found in other organisms, such as yeast and mammals?
The alignment of genomes of multiple organisms that are closely related allows the
prediction of regulatory elements. Non-genic sequences 5’ to genes that align across
several species are likely regulatory sequences. Because no other bird sequences are
available, only the most conserved elements will show up in alignments with other
species.
d) You talk to Eric about your problem, and he offers to sequence 3 bird species to help
you out. He’s been thinking about sequencing some birds anyway, so he offers to let you
help him decide which ones to pick. He is considering sequencing the ostrich, finch, quail,
turkey, condor, pheasant, and guinea fowl. Which ones do you pick and why? (It is okay to
use physical characteristics as an indicator of relatedness.)
Turkey, Pheasant, Quail, and Guinea Fowl are all very closely related to
chicken. You should pick the Ostrich, finch, and condor, since they are the birds
on the list most distantly related to chicken. This will maximize the signal to
noise ratio while trying to detect possible regulatory sequences.
6
Images removed due to copyright reasons.
7
Question 5
There are several subspecies of the mouse, Mus musculus, living throughout the world.
You decide to study their spread from an ancestral population using sequences from
mitochondria and Y chromosomes.
a) Why are mitochondria and Y chromosomes often used for this purpose?
Mitochondria and Y chromosomes are inherited clonally, without recombination, from
one generation to the next. Mitochondria are inherited through the maternal lineage,
Y chromosomes through the paternal lineage. Recombination scrambles up
polymorphisms between chromosomes. Mitochondria evolve quickly enough to date
divergences within a species.
You isolate mitochondrial DNA from 10 mice from geographically diverse locations, and
then sequence an essential mitochondrial gene. Dashes indicate bases that are identical
to the top sequence.
England
Japan
South Africa
India
China
United States
Philippines
New Zealand
Russia
Yemen
AAAGCAGAAGAAATAGATGCAAAGGCAGAAGAAGAGTTCAA
--GCAT---------------C---------------AATT
------C----------------------TA---------GG-CG--C------------GGG-----GG-------CGGG
TTT---T--------------TT--------T-----GGTT
------C--------------T------------------TTT---T--------------TC--------T-----GGTT
------C----------------C-----TA-----------GCAT---------------CC--------------A-TT
---------------------------------C-------
b) Circle the region above that is most likely to be important for the function of the
mitochondrial gene.
Should circle the region with the most dashes
c) Construct a tree based on these mitochondrial DNA sequences. How many major subspecies of mice do you suppose that there are?
((YE,(EN,(US,(SA, NZ)))),IN,((RU,JA),(CH,PH)))
Any number between 3 and 10 is acceptable, but we’re hoping for three.
IN
RU
NZ
SA
JA
US
PH
CH
YE EN
8
Next you decide to look at markers on the Y chromosome in mice. You study a highly
polymorphic locus called Mick-Y (for Many Interesting Changes Known on the Y). You find
that populations of mice in different locales have different alleles.
Population
Alleles of Mick-Y
England
Japan
South Africa
India
China
United States
Philippines
New Zealand
Russia
Yemen
A,B,C
L,M
B
G,H,I
J,K,L
C
K,L
B
L,M,N,O
A,B,C,D,E,F
d) Based on this information (and a little bit of knowledge about history) what do you
think is the origin of the mouse populations in the United States, New Zealand, and South
Africa?
Mice probably came along with European colonists, each descended from a
small founder population of English mice.
9