STUDIES OF PEPTIDE MIMICRY OF THE GROUP B STREPTOCOCCUS TYPE III
CAPSULAR POLYSACCHARIDE ANTIGEN
by
Rattanaruji Pomwised
A dissertation submitted in partial fulfillment
of the requirements for the degree
of
Doctor of Philosophy
in
Microbiology
MONTANA STATE UNIVERSITY
Bozeman, Montana
August 2007
© COPYRIGHT
by
Rattanaruji Pomwised
2007
All Rights Reserve
ii
APPROVAL
of a dissertation submitted by
Rattanaruji Pomwised
This dissertation has been read by each member of the dissertation committee and
has been found to be satisfactory regarding content, English usage, format, citations,
bibliographic style, and consistency, and is ready for submission to the Division of
Graduate Education.
Dr. Mark Young
Approved for the Department of Microbiology
Dr. Tim Ford
Approved for the Division of Graduate Education
Dr. Carl A. Fox
iii
STATEMENT OF PERMISSION TO USE
In presenting this dissertation in partial fulfillment of the requirements for a
doctoral degree at Montana State University, I agree that the library shall make it
available to borrowers under rules of the Library. I further agree that copying of this
dissertation is allowable only for scholarly purposes, consistent with “fair use” as
prescribed in the U.S. Copyright Law. Requests for extensive copying or reproduction of
this dissertation should be referred to ProQuest Information and Learning, 300 North
Zeeb Road, Ann Arbor, Michigan 48106, to whom I have granted “the exclusive right to
reproduce and distribute my dissertation in and from microform along with the nonexclusive right to reproduce and distribute my abstract in any format in whole or in part.”
Rattanaruji Pomwised
August, 2007
iv
ACKNOWLEDGEMENTS
I would first like to thank my parents, Damnern and Samroum, and my brother,
Natthakon for all the unconditional love and support during my graduate studies. Their
love and care sustained me through this endeavor. Secondly, I would like to thank the
Royal Thai government for providing me scholarships since my first step in the U.S.
Next, I would like to thank my mentor, Dr. Seth Pincus, who introduced me to the world
of microbiology and immunology, for all his support, patience and kindness. I am
extraordinarily fortunate to have him as my advisor. This work would not have been
possible without his help and support. I would like to express my gratitude to Dr. Mark
Young for his lab collaboration and providing valuable suggestions to the project. I also
would like to thank the Young lab members especially Debbie Willits and Sue Brumfield
for being such great helps. I greatly appreciate Dr. Martin Teintze for his lab
collaboration and allowing me use his lab as my lab base during the move from Montana
to New Orleans. I would also like to thank the many members of the Pincus laboratory
both in Montana and Louisiana – their friendship and assistance has been invaluable. My
thanks also go to the Microbiology Department staff, especially Kari Cargill, who have
done all of the foot-work in Montana necessary to allow me to complete my graduate
work in Louisiana and in Thailand. I would like to thank my friends Emily and Barrett
for packing me in their backpacks during hurricane seasons. I also would like to thank my
best fiends, Waranya Thibodee, Ittiphong Leevongwat and Chirawan Thana, for all the
help and support. Their help and care upheld me through all difficulties.
v
TABLE OF CONTENTS
1. INTRODUCTION .......................................................................................................... 1
Streptococcus .................................................................................................................. 1
Growth and Classification .......................................................................................... 2
Group A Streptococcus............................................................................................... 5
Pneumococcus (Streptococcus pneumoniae).............................................................. 9
Other Streptococci .................................................................................................... 11
Group B Streptococcus (GBS)...................................................................................... 12
Identification and Morphology ................................................................................. 12
Lab Test .................................................................................................................12
Capsule and Group Antigen...................................................................................13
Phase Variation ......................................................................................................14
GBS Infections.......................................................................................................... 15
Disease Caused by GBS.........................................................................................15
Epidemiology and Transmission............................................................................16
Pathophysiology of Infection.................................................................................... 17
Adherence ..............................................................................................................18
Invasion..................................................................................................................20
Host Injury .............................................................................................................23
Avoidance of Immune System...............................................................................24
Induction of Sepsis Syndrome ...............................................................................27
Use of Antibiotics to Prevent and Treat GBS Infection ........................................... 29
Protective Immunity to GBS..................................................................................... 31
Development of a GBS Vaccine............................................................................... 33
Mimotopes .................................................................................................................... 36
Antigen...................................................................................................................... 36
Epitope ...................................................................................................................... 37
Antigen-Antibody Interaction................................................................................... 38
Anti-Idiotype Antibody (Anti-Id) ............................................................................. 39
Polysaccharide Antigen ............................................................................................ 40
Epitope Mapping....................................................................................................... 42
Mimotope.................................................................................................................. 43
Phage Display Technology ....................................................................................... 45
Peptide Mimicry of Carbohydrate Structure............................................................. 48
Peptide Mimics of the Capsular Polysaccharide of
Group B Streptococcus ............................................................................................. 52
Conjugate Vaccines and Carriers.................................................................................. 54
Vaccines to Microbial Polysaccharides .................................................................... 54
Virus-Based Carrier Systems.................................................................................... 57
Plant Virus-Based Vaccine ....................................................................................... 58
Cowpea Mosaic Virus (CPMV).............................................................................60
vi
TABLE OF CONTENTS-CONTINUED
Cowpea Chlorotic Mottle Virus (CCMV) .............................................................61
Research Goals.............................................................................................................. 64
2. CCMV EXPRESSING PEPTIDES THAT MIMIC
THE GROUP B STREPTOCOCCAL EPITOPE......................................................... 66
Introduction................................................................................................................... 66
Materials and Methods.................................................................................................. 67
Engineering CCMV-Peptide S9 Chimera (Plant Expression) .................................. 67
Verifying Positive Clones......................................................................................... 68
In Vitro Transcription of CCMV cDNAs for Plant Inoculation ............................... 69
Plant Inoculation ....................................................................................................... 70
ELISA ....................................................................................................................... 70
In Vitro Transcription and Translation ..................................................................... 71
Engineering CCMV-S9 Chimeras in Pichia pastoris............................................... 71
Protein Expression and Small Scale Time Course Experiment................................ 73
Medium Scale Expression of CCMV-S9 Chimeras in P. Pastoris........................... 74
Large Scale Protein Expression ................................................................................ 74
Chimeric Virus Purification...................................................................................... 76
SDS PAGE, Western Blot, and Dot Blot Analysis................................................... 78
CCMV Wild-Type Plant Virus Purification ............................................................. 79
Chemical Linking between CCMV Virus and S9 Peptide ....................................... 79
Sucrose Gradient Analysis........................................................................................ 83
Results........................................................................................................................... 84
Plant Expression System........................................................................................... 84
Yeast Expression System.......................................................................................... 89
Chemical Linkage ................................................................................................... 102
Discussion ................................................................................................................... 120
3. MURINE IMMUNE RESPONSE TO CCMV-CONJUGATED
PEPTIDE MIMICS OF GBS CAPSULAR POLYSACCHARIDE........................... 126
Introduction................................................................................................................. 126
Materials and Methods................................................................................................ 128
Preparation of Antigens .......................................................................................... 128
Immunization .......................................................................................................... 129
Cell Purification and Culture .................................................................................. 131
Collection and Preparation of Blood ...................................................................... 133
Enzyme-Linked Immunosorbent Assays (ELISA) of Peptide-Specific
Antibodies, GBS-Specific Antibodies, and CCMV-Specific Antibody ................. 133
ELISA of S9-Specific Antibodies Subclasses in Serum......................................... 134
vii
TABLE OF CONTENT-CONTINUED
ELISA of S9-Specific and GBS-Specific IgM Antibodies in Serum ..................... 134
Assessment of Cytokines in Supernatants from
Cultured Splenocytes and CD4 T Cells .................................................................. 135
Results......................................................................................................................... 136
Antigen Titration..................................................................................................... 136
Immune Response after Immunization ................................................................... 138
The Th1/Th2 Response Is Influenced by Antigen Conjugate Carriers................... 144
Immune Response after Injection with Heat-Killed Group B Streptococcus......... 146
Cytokine Production in Primed Splenocytes after Antigen Stimulation ................ 149
Discussion ................................................................................................................... 151
4. PHAGE DISPLAY LIBRARY................................................................................... 156
Introduction................................................................................................................. 156
Materials and Methods................................................................................................ 157
Peptide Library Construction.................................................................................. 157
Plasmid Extraction.................................................................................................. 159
PCR......................................................................................................................... 159
Single Stranded DNA (ssDNA) Extraction (373)................................................... 160
Phage Amplification ............................................................................................... 161
Phage Purification................................................................................................... 161
Phage Titration........................................................................................................ 162
Affinity Selection of Phage-Displayed Peptides .................................................... 163
ELISA and Antibodies............................................................................................ 164
Conjugation of Peptides to Keyhole Limpet Hemocyanin (KLH) ......................... 166
Results......................................................................................................................... 167
Library Constructions ............................................................................................. 167
Random and Affinity Selection of Phage ............................................................... 169
Specificity and Avidity of Phage-Displayed Peptides............................................ 171
Specificity and Avidity of Peptides ........................................................................ 178
Specificity of KLH-Peptides Conjugates................................................................ 184
Sequence Analysis of Peptides ............................................................................... 186
Discussion ................................................................................................................... 189
5. CONCLUSION........................................................................................................... 196
REFERENCES CITED................................................................................................... 201
viii
LIST OF TABLES
Table
Page
1. 1 Characteristics of Medically Important Streptococci Causing
Important Disease .......................................................................................... 1
1. 2 Characteristics of Medically Important Streptococci Infrequently
Associated with Disease ................................................................................ 2
1. 3 Summary of Peptides that Mimic Carbohydrate Structure ............................ 50
2. 1 Elisa Result of Leaf Crude Extract ................................................................ 87
3. 1 Amino Acid Sequences of Peptides............................................................. 133
4. 1 Mabs Used in This Study............................................................................ 166
4. 2 Summarized DNA Sequencing Analysis ..................................................... 170
4. 3 Summary of Binding Activity and Sequence of Peptides Which
Have One Amino Acid Different from the Original S9 Peptide................ 187
4. 4 Summary of Binding Activity and Sequence of Peptides Which
Have More than One Amino Acid Different from the Original
S9 Peptide .................................................................................................. 188
ix
LIST OF FIGURES
Figure
Page
2. 1 Chemical Reaction between SPDP, CCMV and S9 ...................................... 81
2. 2 Chemical Reaction between Sulfo-SMCC, CCMV and S9........................... 82
2. 3 PCR Analysis Recombinant Constructs......................................................... 85
2. 4 RNA Products from In Vitro Transcription of pCC1, pCC2,
pCC3-wt and Recombinant pCC3-63-S9, pCC3-102-S9,
pCC3-114-S9, pCC3-129-S9, and pCC3-161-S9 ........................................ 86
2. 5 Introduction T7 RNA Polymerase to pCC3 Recombinant DNA................... 88
2. 6 In vitro Translation of RNA Construction. .................................................... 89
2. 7 Introduction EcoR1 and Sal1 Restriction Enzyme Sites to
the Ends of pCC3-wt, pCC3-63-S9, pCC3-102-S9,
pCC3-114-S9, pCC3-129-S9 and pCC3-161-S9 by PCR............................ 90
2. 8 PCR Products from Positive Recombinant E. coli Clones ............................ 91
2. 9 PCR Products from Recombinant Yeast Pichia pastoris
Chromosomal DNA ..................................................................................... 92
2. 10 In vitro Translation from pPicZa-pCC3-S9 Constructs ................................93
2. 11 Small Scale Time Course Protein Expression by Dot Blot Analysis........... 94
2. 12 Silver Staining and Western Blot Analysis of Small Scale
Expression Experiment in CCMV-S9 Transformed Yeasts ..................... 95
2. 13 Medium Scale CCMV-S9 Coat Protein Expression Experiment ................ 97
2. 14 Large Scale CCMV-S9 Chimeric Construct Expression Experiment ......... 99
2. 15 Virus Purification with or without the Presence of Urea........................... 100
2. 16 CCMV-wt Viral Particle ............................................................................ 102
2. 17 Cross-Linking between Cys of S9 and Cys of Mutant A163C.................. 103
x
LIST OF FIGURES-CONTINUED
Figure
Page
2. 18 Product of ssCCMV and S9 Peptide Cross-Linked via
the spdp Linker. ......................................................................................... 104
2. 19 The Conjugation Product of ssCCMv-S9 via spdp Linkers
at Different pH Conditions and Different spdp Concentrations. ............... 105
2. 20 ssCCMV-S9 Conjugation Products via spdp Linkers at
Different Peptide Concentrations............................................................... 106
2. 21 Characterization of CCMV-S9 by Sucrose Gradient Sedimentation......... 107
2. 22 Conjugation between SubE and S9 via spdp Linkers ................................ 109
2. 23 Conjugation Product SubE-spdp-S9 in Sucrose Gradient Velocity........... 110
2. 24 The Conjugation Products Between ssCCMV and S9
Peptide via Sulfo-smcc Linker with and without Iodoacetamide
Treatment (IA treatment) ........................................................................... 112
2. 25 Time Course Experiment and Temperature Effect on
Coupling Rreaction .................................................................................... 114
2. 26 Effect of Different Concentration of Sufo-smcc: 25, 50, 100
and 200 Molar Excess to the ssCCMV Virus in
Cross-Linking Reaction ............................................................................. 116
2. 27 Effect of Peptide Concentration on Cross-Linking.................................... 117
2. 28 Conjugation Product ssCCMV-sulfo-smcc-S9 in Sucrose Gradient ......... 119
3. 1 Comparison of CCMV Virus Antigen in Different
Antigen Preparations.................................................................................. 136
3. 2 Comparison of S9 Peptide in CCMV-S9, SubE-S9, CPMV-S9,
CPMV and KLH-S9 Antigens ................................................................... 137
3. 3 Antibody Response of Individual Mice to S9 Peptide, CCMV
and GBS ..................................................................................................... 139
xi
LIST OF FIGURES-CONTINUED
Figure
Page
3. 4 Antibody Response of Individual Mice to S9 Peptide CCMV
and GBS ..................................................................................................... 141
3. 5 Antibody Response of Individual Mice to S7 Peptide................................. 142
3. 6 Antibody Response of Individual Mice to S9-2 Peptide ............................. 143
3. 7 Antibody Response of Individual Mice to S11 Peptide............................... 143
3. 8 IgG Subclass Identification from the First Immunization Experiment........ 144
3. 9 IgG Subclass Identification from the Second Immunization....................... 145
3. 10 GBS-Specific IgG Antibodies after Injection of GBS............................... 146
3. 11 S9-Specific IgG Antibody after Injection of GBS..................................... 147
3. 12 GBS-Specific IgM and S9-Specific IgM Antibodies after
Injection of GBS ........................................................................................ 148
3. 13 Cytokine production in primed splenocytes 3, 5 and 7 days
after antigen stimulation ............................................................................ 150
4. 1 Construction of Randomly Modified S9 DNA ds Oligomer ....................... 167
4. 2 Modified S9 DNA Fragment Library .......................................................... 168
4. 3 PCR Analysis of Transfected Clones........................................................... 169
4. 4 Direct Binding of Phage by S9 and Anti-M13 Antibodies (Set I)................172
4. 5 Direct Binding of Phage by S9 and Anti-M13 Antibodies (Set II)...............173
4. 6 Direct Binding of Phage by S9 and Anti-M13 Antibodies .......................... 174
4. 7 Capture ELISA............................................................................................. 175
4. 8 Titration of mAb binding to GBS ............................................................... 177
4. 9 Inhibition Assay by Phages of S9 mAb Binding to GBS ............................ 178
xii
LIST OF FIGURES-CONTINUED
Figure
Page
4. 10 Binding Activities of Peptides to S9 mAb..................................................180
4. 11 Inhibition Assay by Peptides of S9 mAb Binding to GBS ........................ 181
4. 12 Inhibition Assay by Peptides of SIIIV18.C2 mAb Binding to GBS.......... 182
4. 13 Inhibition Assay by Peptides of SIIIS8.C3 mAb Binding to GBS ............ 183
4. 14 Binding Activity of KLH-Peptide Conjugates by a Panel of
Anti-GBS mAb .......................................................................................... 184
4. 15 Inhibition Assay by KLH-Conjugates of S9 mAb Binding to GBS .......... 185
4. 16 Views of S9 mAb Bound Structure of the Peptide
FDTGAFDPDWPA (Peptide S9) (277)..................................................... 192
xiii
ABSTRACT
Capsular polysaccharide (CPS) of Streptococcus group B (GBS) is a poor
immunogen and functions as T cell independent antigen, eliciting low IgG antibody with
deficient immunologic memory. We previously identified a peptide, S9, which mimics
CPS of type III GBS. Here we have taken steps to develop the mimetic peptide as a
vaccine against GBS group III. We enhanced the immunogenicity of the peptide by
presenting it on the coat protein of Cowpea Chlorotic Mottle Virus (CCMV). And we
searched for better mimetic peptides by constructing a secondary phage display library.
To accomplish the first goal, DNA encoding S9 was cloned into five constructions
CCMV coat protein loops using recombinant DNA techniques. The results indicated that
inserting the S9 peptide sequence into CCMV coat protein loops disrupted virus and
virus-like particle assembly. Therefore the S9 peptide was conjugated to CCMV coat
protein using chemical linkers. The CCMV-S9 conjugation products remained intact as
monomer virions. Mice were immunized with the CCMV-S9, SubE-S9 (a mutant that
does not assemble virions), CPMV-S9 (S9 conjugated to Cowpea Mosaic Virus) and S9
conjugated to the carrier protein KLH, with and without Freund’s adjuvant. The CCMVS9, CPMV-S9 and KLH-S9 induce anti-S9 antibody even without the adjuvant whereas
SubE-S9 induced an anti-S9 response only with adjuvant. The CCMV-S9 and CPMV-S9
predominantely induced a Th1 response with antigen-specific IgG2a and IFN-γ
production, whereas the KLH-S9 predominantly induced a Th2 response with antigenspecific IgG1 and IL4/IL10 production. To accomplish the second goal, a DNA
sublibrary was designed to have approximately one mutation in each displayed peptide
sequence. Peptides with higher affinity to the S9 mAb were identified by affinity
selection. ELISA analysis from randomly selected phage clones indicated that amino acid
residues 3-5 and 7-10 of S9 peptide are important in specific binding activity to S9
monoclonal antibody. These studies identified peptides with greater affinity for the
selecting antibody, i.e. enhanced antigenicity.
1
INTRODUCTION
Streptococcus
The streptococci are gram-positive spherical bacteria that characteristically form
pairs or chains during growth. They are a heterogeneous group of organisms that include
commensal bacteria as well as virulent pathogens. These organisms are of agricultural
and medical importance. Major human pathogens include group A streptococci (S.
pyogenes), group B streptococci (S. agalactiae), and the pneumococcus (S. pneumoniae),
but other species are capable of causing disease. Table 1.1 and 1.2 list the major
characteristics of the principal streptococcal species (2).
Table 1. 1 Characteristics of Medically Important Streptococci Causing Important
Disease
Name
Streptococcus
pyogenes
Group-specific
substance
(Lancefield
classification)
A
Hemolysis
Habitat
Beta
Throat, skin
Female
genital tract,
colon
Streptococcus
agalactiae
B
Alpha and
Beta
Streptococcus
pneumoniae
None
Alpha
Throat
Usually not
typed or
untypable
Alpha,
none
Mouth,
throat,
colon,
female
genital tract
Viridans
streptococci
Biochemical
Reactions,
Important
Laboratory Criteria
PYR test positive,
inhibited by
bacitracin
Hippurate
hydrolysis, CAMPpositive (Christie,
Atkins, MunchPeterson test)
Susceptible to
optochin. Colonies
soluble in bile,
Quellung reactionpositive
Optochin-resistant.
Colonies not
soluble in bile.
Carbohydrate
fermentation
patterns
Common and
Important Diseases
Pharyngitis,
impetigo, rheumatic
fever,
glomerulonephritis
Neonatal sepsis and
meningitis
Pneumonia,
meningitis,
endocarditis
Dental caries (S
mutans),
endocarditis,
abscesses
2
Table 1. 2 Characteristics of Medically Important Streptococci Infrequently Associated
with Disease
Name
Enterococcus
faecalis (and other
enterococcus) (Now
is grouped into
genus Enterococcus
(3))
Streptococcus bovis
(nonenterococcus)
Streptococcus
anginosus
Peptostreptococcus
(many species)
Group-specific
substance
(Lancefield
classification)
D
Hemolysis
Habitat
None,
alpha
Colon
D
None
Colon
F (ACG) and
untypable
Beta
None
None,
alpha
Throat,
colon,
female
genital
tract
Mouth,
colon,
female
genital
tract
Biochemical
Reactions, Important
Laboratory Criteria
Growth in presence of
bile, hydrolyze
esculin, growth in
6.5% NaCl, PYRpositive (hydrolysis
of L-pyrrolidonyl-2naphthlamide)
Growth in presence of
bile, hydrolyze
esculin, no growth in
6.5% NaCl, degrades
starch
Small colony variants
of beta-hemolytic
species. Group F are
bacitracin-resistant
and PYR-negative.
Obligate anaerobes
Associated
Diseases
Abdominal
abscess, urinary
tract infection,
endocarditis
Endocarditis,
common blood
isolate in colon
cancer
Pyogenic
infections,
including brain
abscesses
Abscesses (with
multiple other
bacterial
species)
Growth and Classification
Streptococci characteristically form chains of two or more organisms. The lengths
of the chains vary and depend upon environmental factors. They lose their gram-positive
appearance and appear to be gram-negative as the culture ages. They are facultative
anaerobes and grow best at 37°C. Most streptococci produce a capsule resulting in
mucoid colonies. Variants of the same strains may show different colony forms. For
example, in group A streptococci, strains which produce much M protein appear as matte
colonies, and strains which produce little M protein form glossy colonies. Phase variation
in colony morphology has been described for streptococcal species (4-8).
3
No one system suffices to classify all streptococci. Therefore, their classification
is based on different methods: hemolysis pattern, biochemical, physiological and
morphological characteristics, and immunological grouping according to Lancefield’s
method. This has led to a somewhat confusing nomenclature that includes species names,
immunological grouping (e.g. group A streptococci), and/or hemolysis pattern. The
hemolysis pattern is the effect that the bacteria have on sheep red blood cells when grown
on blood agar. Many streptococci hemolyze red blood cells in vitro in varying degrees.
Complete disruption of erythrocytes is called β-hemolysis, resulting in a clear zone
around a colony. Incomplete lysis of erythrocytes with a green pigment zone around a
colony is called α-hemolysis. The formation of a greenish zone around colonies on blood
agar is due to discoloration and loss of potassium from the red cells and peroxide
production by bacteria (9). Hemolysis is the result of the secretion of soluble hemolysins;
examples of streptococcal hemolysins are streptolysin O and S of group A streptococci.
Streptolysin O is an antigenic protein (MW 60,000) that is hemolytically active in the
reduced state but inactive in the presence of oxygen (10). An antibody response to
streptolysin O suggests either recent infection with streptococci or persistently high
antibody levels due to an exaggerated immune response in a hypersensitive person (11).
Streptolysin S is not antigenic. It may be inhibited by a nonspecific inhibitor present in
human sera (9, 12).
Speciation of streptococci is based on biochemical reactions. Biochemical tests
include sugar fermentation reactions, tests for the presence of enzymes, and tests for
susceptibility or resistance to certain chemical agents. PYR is the test for hydrolysis of L-
4
pyrrolidonyl-2-naphathylamide. Enzymatic hydrolysis of L-pyroglutamic acid βnaphthylamide releases free β-naphthylamine, which is detected and shown by a color
change after adding hydrochloric acid (13). This test distinguishes group A Streptococcus
from other β-hemolytic streptococci. The physiological tests include CAMP test
(Christie, Atkins, Munch-Peterson test). It was designed to aid in the identification of S.
agalactiae. This test relies on the fact that most strains produce a diffusible, extracellular
compound that will, in conjunction with a specific β -hemolysin of Staphylococcus
aureus, cause complete lysis of sheep red blood cells in an agar medium (14, 15). The
morphological tests include the Quellung reaction tests for the presence of capsule. The
test principle is based upon the fact that capsule can prevent India ink from penetrating
into bacteria. Encapsulated cells appear to have halo around them. The reaction between
bacteria and antiserum raised against the bacterial capsule causes capsular swelling and
make it easily visualized in India ink suspension (16). Streptococcal species may also be
distinguished on the basis of starch hemolysis. Bacteria are cultivated on a plate
containing starch. Gram’s iodine is then flooded onto the plate. Clear zones around
colonies that hydrolyze starch will be observed on a blue background. Group D degrades
starch while group A, B and F don’t (17). The carbohydrate fermentation test is used to
differentiate bacteria based on their ability to oxidize or ferment specific sugars. For
example S. anginosus (viridans streptococcus) is capable of a 2,3-butanediol fermentation
as a continuation of mixed-acid fermentation (18). Group E streptococci can produce acid
from lactose but are unable to ferment trehalose and sorbitol (19).
5
The Lancefield classification is based upon immunologic differences among the
group carbohydrate structures of streptococci. Classically this is performed using
precipitin reactions between hot acid or enzyme extracts of the bacteria and specific
antisera (20, 21). Using this method, Lancefield characterized streptococci into groups A
through T. The serologic specificity of the group-specific carbohydrate is determined by
an amino sugar. For group A streptococci, this is rhamnose-N-acetylglucosamine; for
group B, rhamnose-glucosamine polysaccharide, for group C, rhamnose-Nacetylgalactosamine; for group D, glycerol teichoic acid containing D-alanine and
glucose; for group F, glucopyranosyl-N-acetlygalactosamine.
Group A Streptococcus
Most streptococci that contain the group A antigen are S. pyogenes. These
organisms produce a number of factors that may serve to enhance their virulence and
cause disease. They can be further classified into serotypes based on antigenicity of M
protein (22, 23).
M protein is a major virulence factor of group A streptococci. It appears as hairlike projections of the streptococcal cell wall (24). Group A streptococci which lack M
protein are not virulent (25). Antibody to M protein is type specific. M protein binds to
fibrinogen, fibrin and their degradation products to coat the bacterial surface in order to
block complement deposition on their surface (26, 27). The secreted M protein can bind
to fibrinogen. The aggregates bind to integrin receptors on the surface of
polymorphonuclear leukocytes (PMN) leading to the activation of the host defense
mechanism of these cells, including the secretion of toxic oxygen metabolites, a variety
6
of proteolytic and glycolytic enzymes, and proinflammation cytokines, such as tumor
necrosis factor and IL-6 (27, 28). This in turn causes damage to host tissues leading to
bacteria invasion into host cells. Systemic activation of this proinflammatory pathway
may lead to toxic shock syndrome.
The capsule, which is composed of hyaluronic acid and containing repeating units
of glucuronic acid and N-acetylglucosamine is considered to be an antiphagocytic
structure (29). The capsule is also an important adherence factor because it binds to
CD44 on epithelial cells and interferes with the attachment of phagocytes (29-32).
Group A streptococci also produce plasminogen-binding proteins:
glyceraldehydes-3-phosphate dehydrogenase, enolase, and streptokinase (33-38). These
proteins bind to extracellular matrix metalloproteases or collagenases to facilitate tissue
invasion. This strategy enhances bacterial invasion through normal tissue barriers.
Streptococcus group A produces C5a peptidase, which cleaves six amino acids
from the carboxy terminus of C5a, which is the chemotactic factor generated by the
complement cascade (39). This event inhibits the recruitment of phagocytic cells to the
site of infection.
Group A streptococci also posses streptococcal proteinase (streptococcal exotoxin
B) which is an extracellular cysteine proteinase. It can convert IL-1β precursor to active
IL-1β, an inflammatory cytokine (40-42). The inflammatory cytokines in turn injure host
cells leading to increasing bacterial invasion (43). Group A streptococci produce a variety
of toxins such as streptolysins S and O and pyrogenic exotoxins A, B and C and also
mitogens such as streptococcal superantigen (SSA), streptococcal mitogenic exotoxin Z
7
(SMEZ). Streptolysins S and O are hemolysins, which lyse red blood cells and possibly
other cell types. The three streptococcal pyrogenic exotoxins (SPEs) A, B and C are T
cell superantigens, which enhance delayed-type hypersensitivity and suppress the
antibody response (9). The superantigens are capable of binding to the beta chain (Vβchain) of a characteristic set of T-cell receptors and also to the MHC class II molecule
expressed on resting B cells, monocytes and dendritic cells. Binding to the T-cell receptor
and MHC class II molecule causes T cells to proliferate and release inflammatory
cytokines involved in toxic shock syndrome(44-46).
Group A streptococci live on human skin and mucous membranes and can spread
from person to person. The first step in the establishment of a streptococcal infection is
the adherence of the bacteria to epithelial cells. Lipoteichoic acid (LTA) is an important
adhesin of group A streptococci (47). LTA can interact specifically with fibronectin, a
host protein that coats the epithelial cells of the oropharynx (48). The LTA molecules act
as an adhesin by bridging molecules on the streptococcal surface, such as the M protein,
with cell surface proteins (49). LTA interacts with the streptococcal proteins through its
negatively charged polyglycerolphosphate backbone, which is attracted to positively
charged residues of the surface proteins. The lipid moiety of LTA projects outward and
interacts with hydrophobic fatty acid-binding sites on fibronectin and epithelial cells (49,
50). The spread of organisms depends on how the infection is acquired. Infection of the
skin or mucous membranes may be localized and associated with necrosis and abscess
formation. However the bacteria are also capable of rapid spread through tissues, earning
it the lurid nickname “flesh eating bacteria”. The spread of bacteria occurs due to the
8
secretion of digestive enzymes including proteases, hyaluronidase, DNAase and
streptokinaes (51). The streptokinase binds to host plasminogen degrading it to plasmin
and leading to fibrin degradation (34, 35). Streptococcus Group A evokes an intense
inflammatory response in tissues, resulting from the production of proinflammatory
cytokines from PMNs and monocytes.
Group A Streptococci cause disease in several ways. They may cause damage by
direct infection: “Strep” throat, pyoderma (skin infections), necrotizing fasciitis and
septicemia. The elaboration of streptococcal toxins causes scarlet fever and toxic shock
syndrome (23, 44, 52). There may also be nonsuppurative sequelae of streptococcal
infections such as acute poststreptococcal glomerulonephritis and acute rheumatic fever.
The toxin-mediated and post-infectious syndromes result from inappropriate stimulation
of the immune system. Streptococci possess a number of antigens that cross-react with
human tissues; heart muscle and valvular connective tissue (23, 45, 53, 54). Some of
these epitopes are an integral part of M protein molecule. Antibodies to certain purified
M proteins react with myosin, phosphorylase and several other unidentified proteins in
heart tissue (55-57). Streptococcal antigens may also evoke cross-reactive T cells. These
antigens stimulate the production of cytotoxic T cells active against cultured cardiac
myocytes. These cardiac reactive antibodies and T cells may be involved in the
pathogenesis of rheumatic fever. The toxin SPEs are potent mitogens; they stimulate Tcell proliferation. The SPEs are superantigens interacting with conserved regions of the V
domain of the T-cell receptor rather than with hypervariable regions (46, 58, 59).
9
Therefore, polyclonal activation results in an inappropriate immune response that may be
the major cause of the toxic shock syndrome.
Pneumococcus (Streptococcus pneumoniae)
Pneumococcus is placed in the viridans group. Lancefield grouping is not useful
for discriminating between the viridans streptococci therefore subdivision of the viridans
is based on biochemical and physiological characteristics. The optochin susceptibility test
is used to differentiate the pneumococci from other viridans.
Pneumococci are the major cause of bacterial pneumonia. They are surrounded by
polysaccharide capsules. The polysaccharide capsule is a potent antiphagocytic factor.
Antibodies against capsular polysaccharide have differentiated pneumococci into 90
serotypes (60). Antibodies against capsular polysaccharide are not protective (61).
Pneumococci also contain C-substance, which contains teichoic acid, a part of the cell
wall. C-substance reacts with C-reactive protein, a nonantibody β globulin from serum,
which acts as an acute phase reactant. The complex of C-substance and C-reactive protein
induces the complement cascade, leading to the release of inflammatory mediators and
opsonizing the organisms to enhance phagocytosis (62-64). Pneumococci also contain
pneumococcal surface protein A (PspA), which is located on the cell wall. PspA is a
surface protein with variable molecular size ranging from 67 to 99 kDa. It appears to
protect against the host complement system (65). PspA is highly polar, which results in
capsular charge stabilization through the electropositive end of the molecule and
prevention of complement activation through the predominant electronegative part of
PspA (65). Pneumococcus possesses hyaluronate lyase, which is part of a group of
10
enzymes called hyaluronidases (66, 67). The hyaluronidase enzyme facilitates invasion
by breaking down the extracellular matrix. The bacteria also contain pneumolysin, which
is a cytoplasmic enzyme that is released due to the action of surface pneumococcal
autolysin (68). The enzyme is cytotoxic to ciliated bronchial epithelial cells. It disrupts
tight junctions and the integrity of the bronchial epithelial monolayer. Due to the
enzyme’s function, the ability of ciliated bronchial cells to clear mucus from the lower
respiratory tract is reduced. The cytotoxic activity of pneumolysin can directly inhibit
phagocyte and immune cell function, which leads to suppression of the host
inflammatory and immune responses (69).
Humans are reservoirs of pneumococci. Transmission occurs from direct contact
and also airbone. Colonization by bacteria occurs in the nasopharynx (70). The outcome
of colonization is determined by the bacterial virulence and the efficiency of host defense
mechanisms. Pneumococcal adherence to host cells has been proposed to be a two-step
process. The first step is targeting an anatomic niche of the host, such as the nasopharynx,
and binding to the host cell-surface glycoconjugates on respiratory epithelial and
endothelial cells (68). The second step involves cytokine production by the host cell. This
cytokine activation results in expression of novel glycans on the surface of activated cells
and increased pneumococcal adherence (71-73).
Pneumococci cause life-threatening diseases such as pneumonia, bacteremia and
meningitis. Disease rates are high in young children, the elderly and patients with
predisposing conditions such as asplenia, chronic medical conditions or
11
immunosuppressive illnesses, particularly AIDS. Vancomycin and penicillin are the
drugs of choice for treatment.
Other Streptococci
Group C and G streptococci occur sometimes in the nasopharynx and may cause
sinusitis, bacteremia or endocarditis (74-76). Group D streptococci are the divided into
two groups, enterococci and nonenterococci. Current classification groups enterococci
into a new genus Enterococcus based on 16 rRNA gene sequence analyses (3). The
enterococci are normal flora of the intestinal tract and genitourinary tract. They can grow
in high salt concentrations and in detergent including 60% bile (77). Most infections are
urinary tract infections. Antibiotic synergism (combination use of different antibiotics) is
recommended for Enterococcal infection (78). The nonenterococcal species do not grow
in high salt concentrations and are sensitive to penicillin (79). Group F streptococci such
as S. anginosus and S. milleri are part of the normal flora. Viridans streptococci include
S. mutans, S. salivarius and S. mitis (80). Typically they are α-hemolytic but they may be
nonhemolytic. The viridans streptococci are the most prevalent members of the normal
flora of the upper respiratory tract and are important for the healthy state of the mucous
membranes there. They may reach the bloodstream as a result of trauma and are a
principal cause of endocarditis on abnormal heart valves. Some viridans streptococci such
as S. mutans synthesize large polysaccharides such as dextrans or levans from sucrose
and contribute importantly to the genesis of dental caries.
12
Group B Streptococcus (GBS)
Group B streptococci cause serious disease in newborn infants and in
immunocompromised adults. Despite the fact that the bacteria are exquisitely sensitive to
antibiotics, the aggressive nature of infection leads to high morbidity and mortality. The
development of a vaccine to prevent infection in targeted groups is considered a public
health priority (81).
Identification and Morphology
Lab Tests Group B streptococci (Streptococcus agalactiae) are spherical grampositive organisms arranged in chains. GBS can be either α or β hemolytic, if β
hemolytic, then weakly so. GBS can be differentiated from other β-hemolytic
streptococci on the basis of the hippurate test, CAMP test and serological tests. GBS are
able to produce the enzyme hippuricase, which hydrolyses sodium hippurate to glycine
and sodium benzoate. Ninhydrin reagent forms a purple color when exposed to glycine
and serves as the indicator for the assay. GBS produce a diffusible extracellular
compound called CAMP factor, that will, in conjunction with a specific β hemolysin of
Staphylococcus aureus act synergistically to cause complete lysis of red blood cells (14,
15). GBS contain a group specific carbohydrate antigen, that serves to distinguish it from
other groups of streptococci, and a polysaccharide capsule, which is the basis of serotype
specificity. A variety of different immunological assays have been used to define both the
group and type of GBS, latex agglutination being the most commonly used (82).
Polymerase chain reaction (PCR) can also be used for GBS identification. Primers for the
13
cfb gene, encoding CAMP factor, were used in the PCR reaction. Real-time PCR assay
for the rapid detection of GBS was developed using the same set of primers to shorten
time and increase sensitivity (83, 84).
Capsule and Group Antigen The cell wall of GBS is composed of protein antigens
such as R, T and Rib antigen, peptidoglycan and carbohydrate (group antigen). The
capsule contains the serotyping antigen that subdivides GBS into nine subgroups and may
be a major virulence factor (85).
The group B carbohydrate is a common antigen, which is found in all strains and
serotypes of GBS. The group B carbohydrate is chemically composed of rhamnose,
galactose, N-acetylglucosamine, and glucitol. These sugars are linked by phosphodiester
bond to form four different oligosaccharide units resulting in a complex and branched
subunit structure (86). The terminal position of rhamnose is considered to be part of the
immunodominant epitope (87). Antibody to the group B carbohydrate is unable to protect
mice from lethal challenge with viable GBS (88). All strains of GBS isolated from
humans are encapsulated and can be classified on the basis of serology and capsular
polysaccharide (CPS) structure. Nine GBS serotypes have been so far identified: Ia, Ib,
II, III, IV, V, VI, VII and VIII (85). The repeating unit of CPS contains combinations of
these saccharides: glucose, galactose, N-acetylglucosamine, rhamnose, and sialic acid.
There is a different arrangement of the saccharides in the repeating unit of each CPS. The
CPSs of GBS type Ia and Ib are structurally similar, differing only in the linkage of the
side chain galactose to N-acetyglucosamine. Type Ia CPS has a β-(1→4) linkage and Ib
CPS has a β-(1→3) linkage (89). Type II CPS is composed of glucose, galactose, N-
14
acetylglucosamine, and sialic acid with ratio 2:3:1:1 (90). Type III CPS has a
trisaccharide backbone of glucose, N-acetylglucosamine and galactose and a disaccharide
side chain of sialic acid and galactose linked β-(1→4) to backbone N-acetlyglucosamine
(91). Type IV CPS is composed of glucose, galactose, N-acetylglucosamine, and sialic
acid with ratio: 2:2:1:1 (92). Type V CPS is composed of trisaccharide backbone of
glucose, galactose and glucose and two side chains; one side chain is composed of
glucose linked β-(1→3) to backbone galactose and the other side chain linked β-(1→6) to
a backbone glucose in a trisaccharide of N-acetylglucosamine, galactose and sialic acid
(93). Type VI CPS contains galactose, glucose and sialic acid in a 2:2:1 molar ratio (94,
95). Type VII CPS contains a trisaccharide backbone and trisaccharide sidechain (96).
Type VIII CPS lacks N-acetylglucosamine. The subunit contains glucose, galactose,
rhamnose and sialic acid in 1:1:1:1 molar ratio (97).
Phase Variation Group B streptococci demonstrate high-frequency phase
variation. Colony opacity variants were detected for GBS type III (8). Occasional
transparent colonies with one or more opaque regions were detected on lucid solid
medium. Opaque-transparent switches were observed in both directions. Stable opaque
and transparent variants have been isolated and compared to each other. Transparent
variants are more virulent compared to opaque variants (98). Opaque variants grow
poorly in Todd-Hewitt medium, the standard medium used to grow GBS. Opaque
variants also have differentiation among their groups. One opaque variant produces
unique or overexpressed proteins of 46 and 75 kDa. One variant has capsule alteration
with decreased type III antigen, increasing buoyant density. Another variant has a thinner
15
extracellular matrix and lacks the group B antigenic structure. Differences between
transparent and opaque variants, and the genetic mechanism responsible for phenotypic
switching, remain to be elucidated. Phase variation may play a role in the pathogenesis
of GBS infection.
GBS Infections
Disease Caused by GBS GBS is a normal member of the human vaginal and
lower intestinal flora. About 10-30% of pregnant women are colonized with GBS (81, 99,
100). GBS are important causes of serious bacterial disease in neonates, pregnant women,
and in immunocompromised adults. In newborns, GBS diseases are characterized as
either early onset or late onset. Early onset GBS disease occurs in infants less than 7 days
of age, typically 1 to 2 days old. In early-onset disease, the neonate is infected by
exposure to GBS before or during birth. The early-onset disease is probably caused by
spread of bacteria from the maternal genital tract through ruptured membranes into the
amniotic fluid. Bacteria amplify and colonize the respiratory tract of the newborn. In
some cases the spread of bacteria occurs even without premature rupture of the
membrane. Late onset, which is less common than the early-onset disease, occurs in
infants older than 7 days of age. GBS disease in newborn babies includes sepsis,
meningitis, pneumonia, cellulitis, osteomyelitis and septic arthritis. In late-onset disease,
the two most common clinical manifestations are meningitis and bacteremia. The most
common syndrome in adults are skin infections (101, 102). Bacteremia can also occur.
GBS can also lead to pneumonia, which is a severe and has a high mortality rate (103).
Endocarditis and epiglottitis also have been reported in older children (104). A
16
substantial proportion of newborns who survive GBS infection suffer from sequelae.
Neurological sequelae occur in up to 50% of the survivors and include mental retardation,
cortical blindness, deafness, uncontrolled seizures, hydrocephalus, hearing loss and
speech and language delay. In pregnant women GBS cause urinary tract infection,
amnionitis, endometritis and wound infection (105). In nonpregnant adults infection is
most commonly seen in patients with diabetes mellitus, cancer, and AIDS. In these
people GBS can cause skin or soft tissue infection, bacteremia, genitourinary tract
infection, and pneumonia. The fatality rate for GBS disease can be as high as 4 % in
newborns (106). Fatality rates are higher in adults older than 65 than in younger adults.
Epidemiology and Transmission GBS is a commensal of the genitourinary tract in
15-40% of adult women (107). It is the leading cause of serious bacterial infection in
newborn babies. Infected newborns are exposed to the microorganism carried by their
mothers either just prior to parturition or during the birth process. The risk of neonatal
colonization correlates with the intensity of maternal colonization. GBS colonization
rates in pregnant women have remained constant over the past decade (25-30%) (108,
109). When mothers were GBS culture positive at delivery, the vertical transmission rate
(of GBS colonization of the newborn) is between 29-72% with a mean rate of 51% (100).
If the maternal GBS culture is negative during labor, only 3% of infants become
asymptomatically colonized (110). Neonates are exposed to GBS either via GBS
ascension through ruptured amniotic membranes, aspiration of contaminated amniotic
fluid, or through exposure to colonized tissues while passing through the birth canal.
Bacteria crossing intact amniotic membranes have also been reported to cause disease.
17
Organism acquisition during passage through birth canal is thought to cause late onset
disease. Horizontal transmission from the environment occurs but is rare (110). GBS type
Ia, III, and V are most prevalent in early-onset disease. Serotype III GBS are important
because they account for 36% of early onset and 71% of late onset GBS infection (111).
The genetic epidemiology of disease-causing GBS has been studied by using
Hind III restriction endonuclease digest patterns (RDPs) of chromosomal DNA. Bacteria
have been classified into RDP type 1, 2, 3 for GBS type III and 1, 2, 3 and 4 for GBS
type I (112). GBS strains causing early onset septicemia belong to RDP types Ia-3 and
III-3. GBS strains of RDP type Ia-1 and III-1 have low capsular sialic acid levels and are
susceptible to tetracycline. Half of the strains in the study causing meningitis belong to
type III-2 or III-3. According to RDP typing, GBS type III shares the same clonal origins
with some strains of type II and V (112).
Pathophysiology of Infection
GBS infection in newborns can lead to death and disability. In pregnant women,
GBS causes clinical illness ranging from mild urinary tract infection to life-threatening
sepsis and meningitis. Most invasive maternal infections are bloodstream infections,
osteomyelitis, endocarditis and meningitis. Noninvasive syndromes in pregnancy include
amnionitis, endometritis, wound infections fasciitis and cellulitis. In nonpregnant adults
invasive GBS disease starts with bacteremia. The skin is the next most common site of
infection.
Newborns are easily infected by GBS because they are quantitatively and
qualitatively deficient in host defenses. The interaction between bacteria and host leading
18
to the disease can be divided into steps, including: adherence to epithelial surfaces,
invasion of epithelial and endothelial cells, direct injury to host tissues, avoidance of host
immunological defenses, and induction of the sepsis syndrome.
Adherence Adherence to epithelial surfaces is considered the first step in
pathogenesis. Adherence of GBS to epithelial cells plays an important role in
colonization of the rectum and vagina, as well as in initiating invasive infections of
newborns. GBS can adhere to multiple cell surface components through both protein and
non-protein adhesins (ligands) on the GBS surface. Interactions through opsoninmediated processes are also possible. An example of a nonprotein ligand in GBS
adherence is lipoteichoic acid (LTA). LTA is an amphiphilic glycolipid polymer
extending from bacterial cell wall. Enzymatic treatment of fetal epithelial cells with
trypsin or periodate destroys LTA binding to cells, indicating the presence of a
glycoprotein receptors on the fetal cells (113). A later study shows that the LTA may
have cytotoxic functions as well (114). Pretreatment of GBS with protease can decrease
their ability to attach to epithelial cells, implying that bacterial surface proteins are also
important in bacterial-host adherence.
Adhesins can also bind the extracellular matrix (ECM), which is a
macromolecular structure underlying epithelial and endothelial cells. ECM is composed
of a variety glycoproteins: collagen, laminin, fibronectin and fibrinogen. Several
interactions between GBS surface proteins and receptors in ECM have been reported to
play roles in the adherence process. Laminin binding protein (Lmb) has been identified in
GBS. Lmb is a putative lipoprotein, which has significant homology to group A
19
streptococcal Lra I protein family, which mediates bacterial-host cell attachment. Lmb
protein is expressed by most GBS strains. Mutation in the lmb gene has been reported to
reduce adherence to immobilized human laminin (115).
Two fibrinogen binding proteins, FbsA and FbsB, have been identified. The FbsA
has a signal peptide, a repeat region and a C-terminal wall-anchoring region with an
LPXTG motif. The repeat region is responsible for the fibrinogen binding. Deleting the
fbsA gene causes a reduction in the binding activity to soluble fibrinogen, as well as
adherence to and invasion of epithelial cells. Adherence, but not invasion, is partly
restored by reintroducing the fbsA gene (116, 117).
GBS is reported to bind to cytokeratin 8, which is a constituent of plasma
membranes (118). The bacterial protein ligands responsible for binding to cytokeratin 8
are not yet identified. Hydrophobicity of surface proteins also plays a role in mediating
adherence. Protein surface antigens are highly hydrophobic whereas polysaccharide
antigens containing sialic acid are highly hydrophilic. Hydrophobic strains adhere to
epithelial cell better than hydrophilic strains. Treatment with neuraminidase enhances the
surface hydrophobicity of hydrophilic GBS strain whereas the hydrophobic strain is
unaffected by this treatment (119).
GBS expresses a cell-surface-associated protein A (CspA) encoded by cspA gene.
Csp A contains a putative signal peptide and a cell-wall anchor motif (120). Sequence
analysis indicates that it shares functional and structural domains of the cell envelopeassociated protease (CEP) family. The 153 kDa CspA protein is a subtilisin-like
extracellular serine protease homologous to streptococcal C5a peptidase and caseinases
20
of lactic acid bacteria, but it does not cleave C5a or casein. CspA cleaves fibrinogen. It
degrades the lower α band of fibrinogen (120). The function of fibrinogen cleavage by
CspA is not clear. It has been postulated that GBS may be exploiting the adhesive
properties of a fibrin-like substance. Proteolysis of the N termini of the α and β chains of
fibrinogen lead to polymerization of cleaved fibrinogen, forming fibrin, which is highly
adhesive (120). Therefore the cleavage of fibrinogen by CspA may lead to fibrin-like
substance formation. This may promote the aggregation of GBS or the coating of GBS
with fibrin. It has been shown that cspA mutants are significantly more sensitive than
wild-type strains to opsonophagocytic killing by human neutrophils in vitro (120).
Invasion The second step in pathogenesis is invasion of epithelial and endothelial
cells. Organisms access the blood stream by direct invasion of the epithelial cell barrier.
GBS can penetrate and survive within various tissues, including placental membranes,
the alveoli and the brain microvascular endothelial cells (BMEC), the single-cell layer
which constitutes the blood brain barrier (121). GBS invade more efficiently into
pulmonary microvascular endothelial cells than endothelial cells of the pulmonary artery
suggesting a tropism for particular endothelial surfaces (122, 123) and also implying that
lung endothelium may be the original site of bacterial invasion in neonates. GBS has
been shown to invade chorion and amnion epithelial cells in vitro (124). The chorionamnion is a multilayered structure comprised of a monolayer of chorion epithelial cells
that line the maternal side of the placenta. Amniotic fluid infections most often occur
through a ruptured chorioamniotic membrane. It is also possible that bacteria go through
intact placental membranes and then replicate in amniotic fluid. Exposure to high
21
bacterial concentrations probably leads to colonization of the lung and airways, and
subsequent pneumonia, sepsis and meningitis. Even though GBS is considered an
extracellular bacterium, it can survive in the host cell in the cytoplasm or in intracellular
vacuoles (125). However, evidence of intracellular replication has yet to be reported.
Active bacterial DNA, RNA, and protein synthesis appears to be necessary for invasion
(126). The bacterial invasion mechanism also requires host microtubular and cytoskeletal
elements. Invasion is inhibited in a dose-dependent manner by decreasing extracellular
Ca2+ level and by substances known to interfere with eukaryotic calcium regulatory
systems (125). The result implies that GBS may invade cells by triggering calciumdependent phagocytosis-like internalization mechanisms.
GBS surface proteins play significant roles in the invasion process. Surface
proteins interact with host protein receptors in the ECM and on cells. Recently, it has
been reported that the alpha (α) C protein (ACP) on the surface of GBS mediates GBS
entry into cervical epithelial cells and GBS translocation across layers of these cells
(127). The ACP is characterized as one of the two proteins that constitute the C antigen.
C antigen has been found in many strains except clinical type III isolates of GBS. Based
on trypsin sensitivity, C antigen is composed of two proteins, a trypsin-resistant alphaprotein and a trypsin-sensitive betaprotein (the α-C protein, ACP, and β-C protein). The
ACP is unrelated to the β- C protein. ACP is grouped into the alpha like protein family
(Alp). The members of the Alp family are ACP, Rib, R28 and Alp2 protein. Rib is
identified from GBS type III (128), R28 is found on the surface of type V (129) and alp2
is identified in type V (130). ACP is composed of an N-terminal signal sequence
22
followed by a nonrepeated N-terminal region, a repeat region, a wall-anchored region
with an LPXTG motif, a short hydrophobic region that may span the cellular membrane,
and a charged C-terminal tail. It has been predicted that the repeats in Alp have structures
relate to immunoglobulin (Ig) implying the possible function of Alp in recognition
(ligand-host receptor recognition). ACP interacts with host cell glycosaminoglycan
(GAG). The data indicate that ACP interacts with GAG and enters the cell cytosol by a
mechanism that involves Rho GTPase-dependent actin rearrangement (127). The
predicted 53 kDa Spb1 protein (surface protein of group B streptococcus-1) may be
involved in the invasion process as well. Mutation in gene spb1 leads to less invasion in
the HeLa cervical epithelial cell, and restoration of spb1 in trans corrected the defect
(131). The other Fbs protein, FbsB (FbsA was discussed above in adherence), also
promotes invasion into epithelial cells. Deletion of the fbsB gene severely impairs the
invasion of mutant GBS into lung epithelial cells (132). C5a peptidase is a surfaceassociated serine protease that specifically cleaves the complement component C5a, a
chemotaxin for polymorphonuclear leukocytes (PMN). C5a peptidase may play roles in
both the invasion process and avoidance of the host immune system. All group A
streptococcal (GAS) serotypes, GBS, as well as groups C and G streptococci of human
origin produce the streptococcal C5a peptidase (SCP) (133). The protein is highly
conserved across species. The SCP from GAS (ScpA) is 95 to 98 % (residue) identical to
SCP from GBS (ScpB) (134). The ScpB promotes invasion by interacting with
fibronectin. Mutations cause a reduction in epithelial cell invasion that can be fully
restored by trans complementation with the cloned wild-type gene (135).
23
GBS capsular polysaccharide (CPS) may have a negative effect on the invasion
process. The main function of CPS is generally considered to be prevention of
phagocytosis by host immune cell. Wild-type encapsulated clinical isolates, an asialo and
unencapsulated isogenic transposon mutants invade epithelial cells to different degrees
(136). This observation indicates that capsular polysaccharide is not essential for invasion
of respiratory epithelial cells. The isogenic strains of GBS, which lack capsular sialic acid
or type III capsular polysaccharide, invade and injure human umbilical vein endothelial
cells three-to five fold more than the wild-type strains (126). The capsule-deficient strains
also invade lung endothelial cells more than wild-type strains (137). The results indicate
that capsular polysaccharide attenuates invasion. The attachment and invasion processes
are regulated by oxygen and bacterial growth phase (138), as is the production of CPS. It
is possible that in the beginning of the process, bacteria produce less CPS to facilitate
attachment and invasion, and then later switch to high production of CPS to mask the
surface proteins preventing them from being recognized by antibodyand to inhibit
opsonophagocytosis.
Host Injury After invasion, bacteria proliferate. The proliferation is associated
with injury to host tissues. However, proliferation is not essential for injury. Direct cell
injury facilitates penetration and spread of the organisms. GBS products, including
cytotoxins and enzymes, can directly mediate injury. GBS β-hemolysin has been shown
to be directly cytotoxic to lung epithelial cells (139). It acts as pore-forming cytolysin
(137). Nonhemolytic variants didn’t induce cell injury in this model, while
hyperhemolytic variants derived by chemical or transposon mutagenesis are extremely
24
toxic; resulting in disruption of cytoplasmic and nuclear membranes, loss of microvillus
architecture, and marked swelling of cytoplasm and organelles (139). GBS also produce
several proteinases, which can degrade tissue. Cell-associated collagenase activity has
been postulated. It has been shown that antibodies against collagenase from Clostriduium
histolyticum cross-react with cell-associated proteins produced by GBS, and inhibit GBS
hydrolysis of a synthetic peptide collagen analog (140). GBS also contain hyaluronan
lyase. This enzyme degrades extracellular hyaluronan, which is an important component
of ECM and may promote persistent colonization of the vagina (141, 142). Neutrophils
and macrophages have hyraluronan receptors, CD44. Thus this enzyme may inhibit their
ability to interact with infected host cells. A GBS hyaluronate lyase has been identified,
which shares 50.7% amino acid identity with hyaluronidases from S. pneumoniae but not
from GAS and Clostridium perfringens (141).
Avoidance of Immune System To firmly establish infection, GBS must avoid
immune clearance by both innate and acquired immune mechanisms. After penetration
into lung tissue or the blood stream, an immunological response is recruited to clear the
organism. The central elements of the response are neutrophils, although macrophages
are also involved in bacterial clearance. Effective phagocytosis of GBS by neutrophils
requires opsonization, requiring serotype-specific anti-GBS immunoglobulin, and both
classical and alternative complement pathways. In order to avoid opsonophagocytosis
GBS possess several factors that interfere with the phagocytosis mechanism. The main
factor is the type-specific polysaccharide capsule. Sialic acid rich CPS inhibits
complement alternative pathway activation, as seen in adult sera deficient in type-specific
25
anticapsular antibodies (143). Resistance of serotype III GBS to opsonophagocytosis is
proportional to the sialic acid content of the capsular polysaccharide. Removal of sialic
acid by treatment with neuraminidase or by transposon-insertional mutagenesis increases
deposition of opsonic C3 (144). A GBS type III mutant strain, which is capsule-deficient,
binds to C3b, the active form of C3, in greater amounts than the non-mutant parent strain.
The parent strain binds predominantly to C3bi, the inactive form leading to reduction of
C3b deposition on bacterial cell surface. The sialic acid rich capsule prevents C3b
deposition, presumably through acquisition of Factor H (FH) from host plasma (144).
Capsular sialic acid limits C5a production (145). As noted earlier, C5a is an important
chemoattractant that recruits neutrophils and macrophages. The mechanism by which the
capsule inhibits C5a production is yet to be defined. The ability of GBS to inhibit C5a
production was observed in type III GBS, which have high capsular sialic acid. The C5aase might not be necessary for type III strains to cause invasive disease because the high
sialic acid content inhibits C5a production.
Several GBS surface proteins are also involved in escaping host immunity. C5a
peptidase functions both in invasion, as described above, and in immune avoidance.
ScpA and ScpB cleave the human C5a molecule between residues His-67 and Lys-68,
causing the release of a short C-terminal C5a fragment (135). An ScpB-negative mutant
shows increased sensitivity to phagocytosis by immune cells in the presence of
complement. GBS surface protein Alp (alpha-like protein, described earlier under
bacterial invasion) also functions in avoiding the host immune system. The repeat regions
of Alp (described earlier) affect immune escape by reducing the immune response to the
26
whole protein and in particular to the N-terminal region. The β component of the C
protein can bind to IgA (146). This binding can interfere sterically with deposition of
opsonically active complement protein C3 on the GBS surface. The β component of the
C protein also binds to the soluble complement inhibitor factor H (fH) (147). The fHbinding sites on the β component consisted of discontinuous and partially homologous
sequences. Therefore, GBS bind multiple sites on fH, making the association more stable.
Binding of the GBS β component does not block active sites on fH. Thus active sites on
fH are free to inhibit C3b deposition and opsonophagocytosis (147).
The lipoteichoic acid (LTA) has been shown to play a role in avoidance of the
immune system. LTA mutant strains display an increased susceptibility to human
defensins. Moreover, the mutant strains are less virulent than the wild-type (148). Killing
mechanisms of phagocytic cells involve production of reactive oxygenmetabolites
(oxidative burst). The production of reactive oxygen intermediates including superoxide
anion, hydrogen peroxide and hydroxyl radicals are toxic to GBS and to host cells,
damaging DNA, RNA, protein and lipid. GBS has mechanisms to evade the oxidative
burst by using enzyme Mn-cofactored superoxide dismutase (SodA) (149). The enzyme
converts the superoxide anion to molecular oxygen and hydrogen peroxide, which can be
metabolized by bacterial catalases and/or peroxidases. SodA mutants display an increase
in susceptibility to killing by macrophages.
GBS has been shown to induce apoptosis in macrophages (150-152). GBS does
not need to be in the macrophage cytoplasm to promote apoptosis. The apoptotic pathway
initiated by GBS is dependent on host protein synthesis (but independent of caspase-1
27
and –3). Apoptosis of macrophages can decrease antigen presentation and inhibit the
generation of immune responses.
Induction of Sepsis Syndrome The last stage in disease pathogenesis is induction
of the sepsis syndrome. The sepsis syndrome arises from the body’s extreme attempts to
eliminate the GBS. While attempting to clear the pathogen, overreaction of the immune
system may cause damage to the host.
If the epithelial barrier and immunological clearance fail, GBS establish
bacteremia in newborns. These infants may develop septic shock as consequence. Severe
early-onset GBS disease is clinically different from septic shock syndrome resulting from
infection with gram-negative bacteria. GBS sepsis syndrome includes systemic
hypotension, persistent pulmonary hypertension, tissue hypoxemia and acidosis,
temperature instability, neutropenia and multiple-organ system failure. GBS induce many
cytokines. Predominant among these are Th1 and proinflammatory cytokines, and less
Th2 cytokines (153, 154). GBS infection has been reported to stimulate TNF-α,
Interleukin-1 (IL-1), IL-2, gamma-interferon, IL-6, IL-8, and IL-12 production. TNF is a
key mediator, but other cytokines also play a role in the unique GBS sepsis syndrome
(155).
GBS also induces TNF-α production from macrophages and monocytes. TNF-α
release is relevant to the pathophysiology of neonatal sepsis. TNF-α is believed to play
an important role in morbidity and mortality. It is a proinflammatory cytokine that
produces fever, metabolic acidosis, capillary leak and cardiovascular collapse leading to
systemic hypotension. TNF-α production is inhibited by monoclonal antibodies against
28
CR3 and CR4, which are receptors for C3 and C4 complement. Therefore the ability of
plasma and serum to amplify TNF-α production in response to GBS is dependent on the
activity of the complement pathway (156). It has been shown that group B polysaccharide
and GBS peptidoglycan, which are cell wall components, induce greater production of
TNF-α than CPS or LTA (156, 157). GBS induce TNF-α independently from CD14
(158). Studies have shown that heat-killed GBS type III induces host cell signal
transduction that leads to activation of transcription factors NF-kB and AP-1 that can lead
to TNF production. The MAPK (p38 mitogen-activated protein kinase) pathway is also
involved in TNF-α production by GBS (155). Mutant strains lacking CPS can induce
TNF-α production to the same degree as wide type strains (155).
GBS also induce production of other cytokines. The production of many of these
cytokines follows TNF-α release (153). IL-1 may induce septic shock. Treatment with an
IL-1 receptor antagonist can reduce the symptoms. GBS also induces nitric oxide
production in respiratory epithelial cell leading to lung injury (159). The nitric oxide may
also play an important role in meningitis because GBS induce a respiratory burst in the
CNS. The resulting production of hydrogen peroxide and superoxide leads to CNS
damage. GBS also induce human monocytes to express cyclooxygenase 2 (COX 2),
which is involved in many inflammatory states (160).
IL-12 also may play a role in the induction of neonatal sepsis and clearance of
organisms. Pretreatment with anti IL-12 increases lethality in a mouse model (161).
Administration of recombinant IL-12 improves survival time and decreases GBS in
blood.
29
GBS may induce membrane injury indirectly by alteration of host cell processes.
The presence of GBS in the lower uterine cavity promotes oxygen radical-induced
damage to adjacent fetal membranes.
Use of Antibiotics to Prevent and Treat GBS Infection
The Centers for Disease Control and Prevention (CDC) recommends screening
pregnant women for Group B strep two to four weeks before labor by using the standard
culture method. Women who have a positive GBS result will be given four hours of
antibiotic treatment during labor (162).
GBS vertical transmission can be inhibited by ampicillin chemoprophylaxis
administered at least 4 hours before delivery to achieve bactericidal effect. Giving
penicillin G 4 hours before delivery (intrapartum antibiotics) is also effective (163).
Penicillin administration to infants shortly after birth (postpartum prophylaxis) reduces
early-onset GBS. Antibiotics used preferentially are ampicillin, clindamycin, gentamycin
and penicillin. The combination of penicillin and gentamycin reduces the rate of GBS
infection (164). The CDC recommends intravenous antibiotics during labor for women
who have maternal risk factors (162). These risk factors include premature delivery,
maternal fever, and prolonged rupture of the amniotic membranes. The use of vaginal
disinfectants such as Chlorhexidine was investigated in Sweden. The result shows that
vaginal disinfectants are less effective than antibiotic prophylaxis. However, the use of
vaginal disinfectants leads to less resistance when compared to the use of antibiotics.
Penicillin is the drug of choice for known GBS infections. However, because
symptoms and clinical suspicion often precede the definitive bacteriologic diagnosis,
30
empirical therapy for neonatal meningitis is established, often with a combination of
ampicillin, a third generation cephalosporin that penetrates the CNS, and/or an
aminoglycoside. General antibiotics are administered for the first 48-72 hours until
species are identified, susceptibility testing is completed, and a clinical response is
observed. Penicillin is then used for a total of 10 to 14 days (164). In neonates, the
recovery rate is about 75-80 % without sequelae and 5-10% with sequelae (165).
Neonatal fatality rate after treatment is 5-7% (164). In adult infection with GBS and in
late-onset neonatal disease, penicillin is also the drug of choice. The recovery rate (5060%) is lower compared to the early onset disease (166).
Even though penicillin is the drug of choice for prophylaxis and treatment of GBS
disease and resistance to penicillin has not been reported, other antibiotics such as
macrolides have been recommended as secondary agents for the patients with penicillin
allergy. It has been reported that clinical GBS isolates exhibit degrees of resistance to
antibiotics such as erythromycin (18%), clindamycin (8%) and tetracycline (>80%) (167).
Resistance mechanisms include ribosomal modification by methylase encoded by an erm
gene and drug effux by membrane-bound protein encoded by a mef gene.
Hypothermia has been proposed as an adjunctive treatment for severe bacterial
meningitis in a rabbit model of severe GBS meningitis (164). The application of
hypothermia initiated shortly after antibiotic therapy improves short-term physiologic
measures associated with brain injury.
31
Protective Immunity to GBS
The absence of maternal antibody to GBS capsular antigens has been identified as an
important factor in the pathogenesis of GBS infections in newborns (168). Presumably,
transplacental transfer of maternal anti-GBS antibody results in sufficient immunity in the
neonate to protect against the development of infection. The absence of maternal antibody in
the face of vaginal colonization with GBS places the infant at highest risk. Why some women
who carry GBS fail to mount an antibody response is still a matter of conjecture. Bacterial
factors may play a role. Although host factors play an important role, it has been shown that
women whose infants have had GBS infection are able to produce anti-GBS antibodies in
response to immunization with GBS carbohydrate (169).
Lancefield originally demonstrated the protective efficacy of anti-GBS antibodies
using rabbit antisera (170). There are eight serotypes of GBS. Lancefield established that
protective efficacy is type specific (85). Antisera raised against type II or III GBS do not
protect against infection with type I bacteria (171). These experiments also show that
antibodies to group B determinants (i.e. expressed on all GBS) are not protective. Using
monoclonal antibodies Pincus, et al. have confirmed these findings, and demonstrated that the
protective epitope on the type III capsular polysaccharide (CPSIII) contains sialic acid (172174). Monoclonal antibodies directed against non-sialic acid determinants on CPSIII are not
protective (175). Although there have been reports that group specific antibodies can protect
(176), most studies confirm Lancefield’s original observation. Studies of Pincus, and those of
others, indicate that one reason for the failure of group specific antibodies to protect is that
32
there is limited expression of these epitopes on the surface of intact GBS (172). Protein
antigens of GBS can also elicit protective antibodies (177, 178).
The role of CPSIII in bacterial virulence has been studied, in part because the
protective antibody response to the capsular antigen is so well characterized. Variants lacking
the type III capsule have markedly reduced virulence (136, 144, 179). Transposon mutagenesis
has demonstrated that sialylation of CPSIII is critical for pathogenicity (179). The type III
capsule is anti-complementary, inhibiting the activation of the alternate pathway of
complement activation. Phase variants and transposon mutants lacking the capsule
spontaneously activate complement. Sialic acid plays an important role in the ability of CPSIII
to inhibit complement deposition (145, 180). It has been postulated that the reason antibodies
against sialic acid containing epitopes of CPSIII are protective is that they may block this
complement-inhibiting activity of CPSIII, thus facilitating C3 deposition, perhaps by both
classical and alternate pathways, as well as interacting with Fc receptors on neutrophils (181).
Protective antibodies to CPSIII appear to be directed at a single, repeating epitope
containing sialic acid (181). This structure also appears to function as a virulence factor, in part
because it is able to prevent activation and deposition of complement by the bacterial surface.
Antibodies that bind to this target block the anti-complementary activity, as well as serve to
opsonize GBS. The capsular polysaccharides of other GBS serotypes express similar critical
epitopes against which protective antibody is directed.
GBS surface proteins play important roles during different stages of an infection.
Several GBS surface proteins have been purified and characterized. Some of them have
been shown to induce protective antibody against GBS. The first surface protein antigen
33
identified in GBS was the C protein, which we have described earlier. Lancefield et al.
have shown that antibodies to the C antigen are protective against GBS in a mouse model
(182, 183). All of the alpha-like proteins (Alps) confer protective immunity against GBS
in animal models (184, 185). With the exception of ACP, biological functions of these
proteins still are yet to be defined. It has been shown that immunization with ScpB
induces protective antibody in mice (186). The 45 kDa Sip protein has a wall-anchoring
motif and induces protective immunity against lethal infection with GBS (187). It is
interesting that Sip from all nine GBS serotypes is highly conserved; implying Sip could
be a good candidate for vaccine development. The function of Sip protein is not known.
Another surface protein, which has been shown to elicit a protective antibody, is R
antigen. Like C antigen, the R antigen is immunogenic on intact GBS. The biological
function of R antigen is still not known. Antibodies raised against a R antigen protecte
mice against infection with R-antigen positive strain of GBS, but not from R negative
strains (188, 189).
Development of a GBS Vaccine
Protective immunity of GBS can be achieved by maternal antibodies to the CPS
of GBS, which is transferred through placenta. Like other bacterial CPS, GBS CPS is a
poor immunogen and acts as a T-independent antigen resulting in IgM production instead
of IgG and lack of immunological memory. An initial vaccine consisting of CPSIII
underwent both animal and then human testing (190). Although the vaccine elicited
antibodies in only 60% of pregnant women immunized, the passive transfer of anti-GBS
antibodies to the neonate was shown, thus demonstrating the feasibility of maternal
34
immunization (191). Due to the low immunogenicity of the purified CPS, alternative
approaches are being examined.
One strategy to improve immunogenicity of the CPS is to couple it to carrier
proteins, to obtain a CPS-protein conjugate vaccine. Different coupling strategies and
protein carriers have been proposed. Tetanus toxoid (TT), cholera toxin B subunit, and
GBS proteins have been used as protein carriers. Tetanus toxoid has been most
thoroughly evaluated. Coupling procedures include binding cyanogen bromide-activated
CPS to TT via the spacer adipic acid dihydrazide (192, 193). Another strategy is to
conjugate CPS to TT without linkers (194, 195). GBS type III CPS is treated with
periodate oxidation method to form free aldehyde groups on the sialic acid side chain.
Then the treated polysaccharide is coupled with TT via the aldehyde groups.
TT-CPS conjugates have been tested in animals and in humans. The ability of
CPSIII-TT, administered to the mother, to protect GBS-infected neonates was
demonstrated in animals (193, 196). Subsequent clinical trials of this vaccine have
demonstrated an opsonic antibody response in approximately 90% of recipients (195). At
the same time, experimental studies conjugating the CPS of other GBS serotypes to
tetanus toxoid have been performed. The protective efficacy of a tetravalent (types Ia, Ib,
II, and III, which account for >90% of clinical infections) polysaccharide-tetanus toxoid
conjugate vaccine has been demonstrated in animals (197, 198). The conjugate vaccine
produces predominantly IgG1, in a mouse model, implying a Th2 bias of the vaccine.
Prior exposure to GBS and TT can affect the antibody response (195).
35
Since colonization of genital and lower intestinal tracts is critical in GBS
transmission, effective mucosal immunity may play an important role in vaccinemediated protection by limiting GBS colonization. IgA is the main protective antibody in
mucosal immunity. CPSIII was coupled to cholera toxin B subunit (CTB) by reductive
amination (199). The conjugated vaccine was administered to mice. Immunization elicits
both mucosal and systemic immune responses with high IgA, and IgG antibody against
CPS and GBS in sera and at mucosal sites. The immunization route affects the immune
response obtained: intranasal immunization elicits the highest level of IgA and IgG in the
lungs, peroral immunization leads to highest antibody levels in the intestine, vaginal
vaccination generates highest antibody levels in vagina, and rectal administration
produces the highest response in the rectum (200, 201).
A second approach to generate a protective anti-GBS antibody response is by
using GBS antigenic surface proteins, which are expressed on most or all GBS serotypes,
as vaccine candidates. GBS surface antigenic proteins were identified and tested for
ability to elicit protective antibody against GBS, as discussed above. Surface antigenic
proteins, ACP protein, β-C protein, Sip and Rib have been tested in animals as potential
candidate antigens for a vaccine (128, 187, 202, 203). All of them confer protective
antibody against GBS, and the sera from vaccinated animals protecta mice from GBS
lethal challenge. In an effort to elicit the greatest degree of protection by using multiple
GBS antigens, vaccines have been designed in which the CPS is conjugated to a GBS
protein. The alpha-C protein is conjugated to CPSIII using the reductive amination
method (202). Low titers of antibody to type III GBS are elicited. Adjuvant is required
36
for immunization. Compared to GBS-TT vaccine, these proteins provide less impressive
protection. Moreover, some proteins are not expressed in all clinical isolates. For
example, beta-C protein is expressed in type Ia and Ib, but not in III. Even though Rib
and Sib are more abundantly expressed in clinically significant strains, not all of them
contain these proteins. Generally GBS, which do not contain Rib, do express alpha-C
protein. The ScpB protein, found in all clinical GBS isolates is also believed to be good
candidate for vaccine development. Immunization with purified ScpB increases the
bacterial clearance in lung (204).
Mimotopes
Antigen
An antigen is a substance that can be bound specifically by an antibody, T-cell
receptor, or other specific immune recognition molecule. In this thesis, we will confine
our discussion of antigenicity to recognition by antibody. Some antigens can induce
antibody production; some do not. An antigen, which is able to induce an immune
response, is called an immunogen. Thus not all antigens are immunogenic, but all
immunogens are antigenic. For example, a hapten is a small molecular weight molecule
that when bound to a carrier protein can elicit antibodies that bind to the hapten. Thus the
hapten alone is antigenic, that is it can be bound by antibody, but not immunogenic.
When coupled to a carrier it is both. Immunogenicity results from four properties of the
immunogen: foreignness, molecular size, chemical composition, and susceptibility to
antigen processing and presentation. An immunogen has to be recognized as nonself by
37
the immune system. The best immunogens generally have molecular weights greater than
25 kDa, molecules less than 5 kDa have poor immunogenicity (205). Antigens with high
complexity in chemical composition generally have high immunogenicity. Proteins are
good immunogens, simple carbohydrates with repeated chains are poorly immunogenic,
as are lipids and DNA. Molecules that are not degraded or processed by antigen
presenting cells are poorly or not at all immunogenic, for example plastics.
Epitope
Antibody binds to specific sites on the antigen, which are referred to as antigenic
determinants or epitopes. Epitopes can be bound directly by antibodies, which are also
the antigen receptors on B lymphocytes. B cells and T cells often recognize different
epitopes on the same molecule. The T-cell receptor does not recognize native antigen as
do B cells, but recognizes antigen that has been processed into antigenic peptides and
presented in association with MHC molecules. Therefore destruction of the conformation
of a protein does not affect its T cell epitopes. Antigens recognized by T cells must
possess two different interaction sites: the epitope, which interact with the T cell
receptors, and the agretope, which interacts with an MHC molecule.
Properties of epitopes for antibody/B cells include accessibility of the epitope,
hydrophilicity, and structural mobility. Antigenic sites should be accessible on the
surface of the molecule to be recognized by antibodies binding to the native protein. In
general the native conformation of proteins in aqueous environments is to fold with the
hydrophobic residues buried in the interior and hydrophilic residues exposed on the
38
surface (206). Segmental mobility of the polypeptide backbone also contributes to
antigenicity.
Antigen-Antibody Interaction
Detailed structural analyses of the interactions between epitopes and antibodies
have been reported. Here we will discuss the interaction of Fab antibody fragments to
protein antigens: hen egg white lysozyme (HEL) (207-210), influenza virus
neuraminidase (211, 212) and angiotensin II (213). Interactions of several of these
antibodies with anti-idiotypic antibodies have also been studied and compared to the
interaction with antigen (214, 215). B cell epitopes can contain sequential or
nonsequential amino acids. In the latter case, the native protein is folded to bring the
amino acids into close juxtaposition.
The interaction between antigen and antibody is influenced by the structure of the
antigen, as well as the sequence of the portions of the antibody that make contact with the
antigen, the so-called complementarity determining regions (CDRs). Angiotensin II is a
small antigen, folded into a compact structure that interacts with the antibody within a
deep and narrow cleft (216). Epitopes of globular proteins, such as HEL interact with
antibody on the surface of the protein and in a very shallow binding cleft (209). The
binding interaction between antibody and antigen requires good complementarity
between proteins and reasonable juxtapositions of polar residues to permit hydrogen bond
formation. Studies of antigen/antibody binding in HEL reveal water molecules in cavities
between the two that provide a bridge for hydrogen bonds (207, 209). Two monoclonal
antibodies (mAb) specific for the influenza neuraminidase, NC41 and NC10, have been
39
studied (211, 212). The neuraminidase epitope for NC10 overlaps that for NC41. These
two mAbs bind differently to antigen. Five of the six CDRs of NC41 make contact with
antigen while four CDRs of NC10 make contact.. Thus antibody/antigen interactions
reflect both structures (212).
Anti-Idiotype Antibody (Anti-Id)
The amino acid variability of the antibody CDRs allows them to function as
antigenic determinants that can in turn lead to the production of new antibodies, termed
anti-idiotypic antibodies (anti-Id). The interactions between the anti-lysozyme antibody
D1.3 (Ab1) and its anti-Id (Ab2) and its antigen HEL were studied (215). The anti-Id
antibody binds to 13 amino acids on D1.3 mainly from the CDRs; whereas seven amino
acids make contact with the nominal antigen, HEL. The main chain conformation of the
D1.3 CDRs in the anti-Id Ab complex shows significant differences from the complex
with HEL, especially the side chains of the CDRs. Thus the conformation of the antibody
binding site is influenced by the antigen it binds. As discussed below, anti-idiotypic
antibodies have been used as mimics of antigen, since both bind the same antibody. In
this case it has been said that the anti-idiotype carries the internal image of the antigen,
although as the HEL data show, this internal image is not perfect (215, 217). An example
of internal image mimicry is seen in the angiotensin system. The anti-anti-Id (Ab3) binds
strongly to the antigen angiotensin (218, 219). Crystallographic studies show that when
complexed with Ab3, the angiotensin adopts a conformation that resembles the CDR3 of
a light chain (220). This suggests a possible mechanism for the interactions; in which a
40
CDR of Ab2, presumably CDR3 of the light chain, would carry a similar conformation to
that of the angiotensin
Polysaccharide Antigen
The repeating polymeric structures of polysaccharide and DNA are poor
immunogens. They function as T-independent antigens eliciting primarily low affinity
IgM antibodies and failing to induce immunologic memory. Cross reactions among these
structures demonstrate how similar epitopes, having different chemical structures on very
different molecules can mimic each other. Capsular polysaccharide from group B
meningococcus and Escherichia coli K1 are poorly immunogenic (221-224). The
α(2→8)-linked N-acetyl neuraminic acid (Neu Nac) polymer, which is found in the E.
coli K1, Klebsiella, and group B meningococcus CPS component can be bound
specifically by monoclonal IgM antibody (NOV) (223, 224). The antibody is protective
against E. coli in newborn rats. The mAb also cross-reacts with polynucleotides and
denatured DNA. The cross-reactions might result from a similar distribution of negative
charges between the carboxyl group of α(2→8)Neu Nac and the phosphates of the
denatured DNA or polynucleotides (224). This finding suggests that the distribution of
negative charges on certain antigens is the basis of cross reactivity in this system. More
generally, it suggests that antibody cross reactivity is based on structural similarities
between antigens. The amino acid sequence of IgMNOV VH is 106 residues and belongs to
subgroup VB III, and VL is 109 residues and belongs to subgroup II (222).
Antigenic cross-reactions could lead to disease. A human anti-DNA monoclonal
autoantibody, 16/6, is found to share an idiotypic determinant with antibody from patients
41
with active systemic lupus erythematosus (SLE), and with other anti-DNA mAb from
unrelated patients (225). Amino acid analysis reveals that first 40 light chain amino
terminal residues are identical among the antibodies sharing this idiotype. Six mAb from
patients with Waldenstrom’s macroglobulinemia that react with Klebsiella pneumoniae
polysaccharides were tested for their ability to bind to nucleic acid antigens (225). The
study shows that one of these IgMs bound to polynucleotides and to single stranded
DNA. This antibody is also the only one to share this idiotype. The binding between this
IgM and the polynucleotides is inhibited by Klebsiella polysaccharide 30 (K30). The 16/6
mAb is found to react weakly with the K30. The results indicat that anti-polysaccharide
antibodies share an idiotypic determinant with anti-nucleic acid antibodies and
immunoglobulin from SLE and Waldenstrom‘s macroglobulinemia, a cancer of IgMsecreting plasma cells.
Dextran is a polysaccharide consisting of repeating d-glucose residues. It has also
been shown to be a T-independent antigen. In classic experiments that defined the size of
the antigen-combining site of immunoglobulin, the combining sites of antibodies to
α(1→6) dextran are shown to have an upper size limit of six to seven oligosaccharide
glucose residues (226). The lower limit, based on the ability of the antibody to cross-react
in precipitin tests with isomaltose oligosaccharide coupled to BSA, is between one and
two glucoses (226, 227). Synthetic glycolipids prepared by coupling isomaltose
oligosaccharide to steary-lamine are T-independent antigens in mice as well (228).
42
Epitope Mapping
The nature of peptide and protein antigenic determinants has also been studied
and has led to useful approaches to making specific antisera, to designing vaccines, and
for mapping the antibody response to protein antigens. A key concept underlying much of
this work is that a short peptide can serve as a surrogate for the epitope on the intact
protein. Using epitope mapping techniques, both continuous and discontinuous peptide
epitopes have been defined (229, 230). In continuous epitopes, the amino acids encoding
the antigenic determinant are adjacent to each other in the primary protein structure.
Discontinuous epitopes have amino acids that are brought together by the folding of the
native protein. Denaturation may destroy discontinuous epitopes, and monoclonal
antibodies recognizing such epitopes will not generally function in SDS-PAGE
immunoblotting techniques (Western blots) that require protein denaturation.
In the epitope mapping procedure for continuous epitopes, overlapping peptides
covering the length of a protein are designed and tested for antibody binding. For
example, a total of 208 overlapping hexapeptides covering the total 231 amino acid
sequence of the immunologically important coat protein VP1 of foot and mouth disease
virus (FMDV), type O1were synthesized on a solid phase (230) The attached peptides
were tested for antigenicity by an ELISA using a variety of antisera. The result indicates
that an immunodominant epitope is located between amino acids 146-152 of that protein.
Then 120 hexapeptides representing complete single point amino acid replacement sets
were synthesized and tested for retention of antigenicity. The result indicates that leucine
43
residues at position 148 and 151 were essential for binding of antibodies in antisera raised
against FMDV (230).
An example of a discontinuous epitope was identified with a mAb raised against
FMDV type A10 (229). The peptides mimicking the epitope were identified. No sequence
homology was found in capsid protein VP1 of FMDV type A10. The result suggests that
protein folding, in which amino acid residues from three regions distant from one another
in the primary sequence, are brought into close proximity at this epitope.
Mimotope
Identifying peptides that represent epitopes suggested the mimotope concept, in
which molecules that mimic the structure of antigenic determinants are constructed and
tested for antigenicity and for the ability to elicit cross-reactive antibodies to the original
antigen. Just as many pharmacologically active drugs are considered to be mimics of the
natural ligands for protein receptors, mimotopes are mimics of antigenic determinants for
protein antibodies. Because the universe of peptide mimotopes could not readily be
constructed from the primary amino acid sequence of a protein antigen, the attempt to
identify mimotopes requires large libraries of peptides, particularly of discontinuous
epitopes. This has been accomplished through combinatorial chemistry and through
genetic techniques such as phage display.
An alternate approach to designing mimotopes for antibodies is to use the
resemblance of anti-idiotype (anti-Id) to antigen. The idiotype (Id) of an antibody is that
part which is antigenically unique as determined by a second set of antibodies made
against the first one. Thus idiotypes are in the variable region in, at, or near the
44
combining site. Thus the combining site defines both antigen specificity and the idiotype
of an antibody. In 1964, Jerne proposed that the immune system is regulated by networks
of anti-idiotypic antibodies acting as a self-contained homeostatic network (231).
According to this hypothesis, the Id-anti-Id interactions regulate the immune response of
a host to a given antigen. The Id regulatory mechanism influences the prevalence of
different combining sites and antibody specificity. Based upon the structural studies we
have previously described, the anti-idiotype may resemble the antigen. According to the
network concept, immunization with a given antigen will generate the production of Ab1
against the antigen. When sufficient Ab1 is produced, it then induces an Ab2 (anti-Id)
against its idiotype. Some of these Ab2 can mimic the structures of external antigens.
Thus by manipulating the idiotypic network it may be possible to elicit antibodies that
cross react with the original immunogen. In this case the anti-Id is said to contain the
internal image of the antigen. Immunization with anti-Id Ab2 generates anti-anti-Id Ab3,
which recognizes the original antigen. However, there may be differences in the structure
of Ab3 and Ab1. Based upon the ability to mimic the internal image of antigen, antiidiotypic immunization has been studied extensively for vaccines against cancer (232)
and infectious agents. Anti-Ids elicit antibodies to microbial antigens, including proteins,
LPS, and capsular polysaccharides (233-235). More about the use of anti-idiotypes to
mimic microbial polysaccharides is detailed below.
Combinatorial protein-display libraries permit the examination of an extremely
large number of possible sequences (libraries), having as many as 109 individual
members. This may be done biologically using genetic approaches or chemically through
45
directed synthesis. Biological approaches include displaying peptide sequences on
phages, microbes, and even eukaryotic cells. Combinatorial design provides a
complementary approach for understanding sequence and structure compatibility and
discovering novel sequences that have a specific structure. In addition to creating a
library with a high degree of diversity, the combinatorial approach provides materials
which can be assayed for structure (e.g. sequence if protein) or function. Synthetic
combinatorial libraries are not restricted to proteins that can be made by living organisms,
but rather may be made with D-amino acids, carbohydrates, novel molecules (e.g.
dendrimers), and so forth. Thus synthetic libraries cover a larger portion of chemical
space (the range of chemical compounds that can have biological effects) than do
biological expression systems. Moreover they may be used to select for materials that
function in non-natural environments that would kill the biological vector. However, in
our studies we have used phage display technology because of the ready availability of
peptide-display libraries (e.g. Burritt (236), Smith (237)).
Phage Display Technology
Based on the mimotope concept, phage-displayed technology was introduced by
Smith (238). The construction of random peptide or gene fragment display libraries
allows researchers to map contact points in protein-protein interactions. The technology
depends upon an inserted random mutation at an appropriate location and the expression
of the mutated sequence on the viral coat protein of viable phages.
The filamentous bacteriophage M13 and its derivatives have often been used as
library vehicles. The phage consists of a stretched-out loop of single-stranded DNA
46
sheathed in a tube composed of several thousand copies of the major coat protein pVIII.
At the tips of the virion, pIII and pVI minor coat proteins are involved in host-cell
binding and in termination of the assembly process. Genes II and X encode replication
proteins. Gene V encodes a single-stranded DNA binding protein. Gene IX encodes
amino coat protein responsible for assembling pIII in the viral coat. Genes I and IV
encode morphogenetic proteins. The three structural proteins, pIII, pVI and pVIII have
been used for insertion of foreign sequences in the peptide libraries (237, 239). PIII is
most commonly used, followed by pVIII, and very rarely pVI. Proteins pVIII are
expressed at very high levels (2700 copies/phage), whereas protein pIII is expressed in
only three to five copies/phage. Because pVIII represents the majority of the virion,
marked constraints are placed on the insertions that may be placed in this protein. Either
the length of the insert or the number of copies of the pVIII expressing the mutant protein
must be limited. Insertion of greater than nine amino acid residues abolishes the viral
assembly process (239). The incorporation of peptides in the pVIII protein without
significant reduction in viral assembly requires either co-infection of the host E. coli with
a helper phage, which encodes a wild type pVIII protein or the expression of wild-type
pVIII protein on a plasmid in the infected cell (240).
The pIII protein is less critical in viral assembly and still binds to the phage
receptor even with large inserts. The pIII can bear fusion proteins containing several
hundreds residues at or near the amino terminus without significant loss of function. The
expression of foreign peptides on pIII proteins has a minimal effect on the infectivity or
assembly of virions (237, 239).
47
The assembly process of phages requires interaction between their structural
proteins and two extra non-structural proteins (pI and pIV) and also host (E. coli)
proteins (241). Displayed proteins fused to the amino-terminus of pIII and pVIII fold in
the periplasm before incorporating into the phage coat. The displayed protein, which can
contain cysteine residues, may form disulfide bonds preventing incorporation of coat
protein into the viral particle. Study of “random” insertions into pVIII indicates a bias for
certain peptides, presumably those with a suitable structural conformation (242, 243).
M13 phages infect E. coli through fertility pili (F factor). They attach to pili prior
to infection. The model for initiation of infection has been studied (244). The extreme
amino-terminal end of pIII (g3p-D1) is pulled off the next upstream domain (g3p-D2) by
interaction with the bacterial cell surface protein TolA. The interaction allows for viral
disassembly and pilus retraction. Amino-terminal inserts on pIII do not greatly affect this
process.
Construction of a phage-display library requires manipulation of the doublestranded replicative form (RF) of the vector. The RF can be harvested in the same manner
as plasmids. The DNA library is inserted into the vector and then complete RFs with the
DNA insertions are electroporated into competent E. coli cells. Peptide sequences to be
displayed are encoded by the insertions into the genes encoding the phage coat proteins.
These may be random sequences, DNA obtained from sources that one is attempting to
mimic (e.g. epitope libraries constructed from genomes of pathogenic microbes), or
mixtures of constrained and random sequences. Diversity in the library can be estimated
from the number of transfection events following the introduction of the recombinant
48
vector DNA into host cells. The estimation is based on the assumption that few
displayed-peptides are represented more than once.
Antibody has been used to select display libraries in attempts to identify antigenic
determinants recognized by these antibodies. Initially this was restricted to identifying
peptides bound by anti-protein antibodies. These approaches are able to define not just
linear epitopes, but also conformational epitopes. The results demonstrat
immunodominant regions of proteins, and also identify potential vaccine antigens.
Interestingly, phage display has also been used to identify peptides that mimic
carbohydrate and other non-protein structures.
Peptide Mimicry of Carbohydrate Structure
Although it may seem odd to seek peptides that mimic carbohydrates, naturally
occurring carbohydrate-mimetic peptides can be found. For example, the tendamistat and
other proteins that function as inhibitors of α–amylase have WRY tripeptide sequences
that bind in the enzyme’s active site (245, 246), whose “natural” substrate is the
carbohydrate amylose. Phage display technology has been use to identify peptide ligands
for the carbohydrate-binding protein concanavalin A (Con A) (247). Peptides with a
consensus sequence, YPY, bind Con A with affinity comparable to the carbohydrate
ligand. The mimetic peptide has been shown to competitively inhibit carbohydratespecific binding.
Initial studies that demonstrated peptide mimicry of microbial polysaccharides
were based upon the anti-idiotypic approach. Westerink et al. developed a monoclonal
anti-Id that contains the internal image on its combining site, which mimics
49
meningococcal group C capsular polysaccharide (248, 249). The anti-Id elicits a Tdependent antibody response in mice directed toward CPS of meningococcal group C.
The sequences of the variable regions of heavy and light chains of the anti-Id reveal that
the CDR 3 is unique, in that the sequence tract YRY is exposed on the surface.
Immunizing mice with the mimetic peptide results in significant anti-meningococcal
group C antibody response. Immunized mice are protected against infection with a lethal
dose of bacteria. On the basis of these studies, other groups, including our own, have
used a variety of methods to elicit antibodies to microbial carbohydrate and LPS antigens.
These are summarized in table 1.3.
Epitope mapping techniques and sequence analysis from anti-Id and phagedisplayed libraries demonstrate that antibodies bind to epitopes of three to five amino
acids within a sequence. The fine specificity of some carbohydrate-binding proteins maps
to peptides containing central W/YXY residues. Peptides with the aromatic motif
W/YXY are defined to mimic several carbohydrate subunits. These include YPY as a
mimic of mannose (ConA (247)), WRY found to mimic α(1→4) glucose, WLY (amylase
inhibitor (245) which mimics Lewis Y (250), and YRY as a mimic of the major C
polysaccharide α(2-9) sialic acid of Neisseria meningitidis(251). A protective antibody
against Cryptococcus neoformans glucuronoxylomanna was selected that displays a
binding motif of TPXW(M/L)(M/L) (252). The peptide doesn’t interact with nonprotective anti carbohydrate antibodies to Cryptococcus which indicates both the
specificity of selected peptides and the potential for peptide structures to differentiate
between protective and nonprotective antibodies (253).
50
Table 1. 3 Summary of Peptides that Mimic Carbohydrate Structure
Carbohydrate
α-D-Mannopyranoside
Mimetic
Peptide from phagedisplayed peptide
library
Comment
Similar consensus sequence obtained
independently by two groups
Reference
(242)
Meningococcal group C
polysaccharide
Anti-idiotype and
phage-displayed
peptide library
Elicits protective antibody when used
anti-Id and peptide derived from anti-Id
mAb as an immunogen
(248, 249)
Siayl Lewis X antigen
Peptide from phagedisplayed peptide
library
Peptide is a specific inhibitor of
neutrophil adhesion
(254)
Group A streptococcal
polysaccharide
Anti-idiotype
Elicits polysaccharide cross-reactive
antibody when used as an immunogen
(234, 255)
Group B streptococcal
polysaccharide type III
ScFv antibody (from
anti-idiotype)
Elicits protective antibody when used
as an immunogen
(256)
Group B streptococcal
polysaccharide type III
Peptide from phagedisplayed peptide
library
Elicits polysaccharide cross-reactive
antibody when used as an immunogen
(1)
Cryptococcal
glucuronoxylomannan
Peptide from phagedisplayed peptide
library
Peptides are good antigenic mimetics
but poor immunogenic mimetics
(252, 257259)
Pseudomonas
aeruginosa
lipooligosaccharide
Anti-idiotype
Elicits protective antibody when used
as an immunogen
(260)
Neisseria meningitidis
group A
lipooligosaccharide
Peptide from phagedisplayed peptide
library
Elicits protective antibody when used
as an immunogen and it is preliminary
evidence of immunogenic mimicry
(261)
Neisseria gonorrhoeae
lipooligosaccharide
Anti-idiotype
Elicits anti-lipooligosaccharide crossreactive antibodies
(262)
Adenocarcinomaassociated carbohydrate
antigens (Lewis Y)
Peptide from phagedisplayed peptide
library
Elicits antibody responses that crossreact with human tumor-associated
carbohydrate antigen.
(263, 264)
HIV carbohydrate
antigens
Peptide from phagedisplayed peptide
library
Elicits carbohydrate cross-reactive
antibodies
(265, 266)
Streptococcus
pneumoniae
Anti-idiotype
Elicits protective antibody when used
as an immunogen
(235)
Streptococcus
pneumoniae capsular
polysaccharide
Peptide from phagedisplayed peptide
library
Elicits protective antibody when used
as an immunogen
(267, 268)
51
Table 1.3-Continued Summary of Peptides that Mimic Carbohydrate Structure
Carbohydrate
Haemophilus influenza
lipooligsaccharide
Mimetic
Peptide from phagedisplayed peptide
library
Comment
Elicits protective antibody when used
as an immunogen
Reference
(269)
Brucella
lipopolysaccharide
Peptide from phagedisplayed peptide
library
Elicits weak immune response
(270)
P-selectin
Peptide from phagedisplayed peptide
library
Peptide inhibits the binding of glycosid
ligand for P-selectin.
(271)
Gal-α1,3-Gal
Peptide from phagedisplayed peptide
library
Melibiose was able to inhibit the
binding of the human natural anti-αGal
antibody to the peptide competitively
(272)
Glycosphingolipids
Peptide from phagedisplayed peptide
library
Peptide inhibits β–galactosidase
activity towards lactotetraosylceramide.
(273)
Lipopolysaccharide
Peptide from phagedisplayed peptide
library
Biopanning on LPS-conjugated epoxy
beads was used to identify peptides
(274)
Salmonella enterica
serovar Typhi
Peptide from phagedisplayed peptide
library
Biding activity between mAb to the
mimotope was blocked by CPS Vi
antigen of the bacteria.
(275)
Shigella flexnerii LPS
Peptide from phagedisplayed peptide
library
Peptide can block the binding activity
between the bacterial LPS and mAb
(276)
In conclusion, phage-displayed technology has proven to be a valuable
multipurpose tool with which to probe protein-ligand interactions. Phage libraries are a
rich source of unexpected functional diversity. Because of the very large library sizes that
can be achieved, it is tempting to maximize the number of varied positions and then carry
out many rounds of selection in order to increase the chance of identifying a rare, highly
functional clone. It also provides an economical alternative way to identify mimic
peptides. The technology requires only basic understanding of genetics to carry out
52
experiments. These reasons make the phage technology grow explosively. It has become
an indispensable tool for protein engineering. There will be further improvements in
library construction such as vector design and selection methodology that will further
enhance phage display technology.
Peptide Mimics of the Capsular Polysaccharide of
Group B Streptococcus
In the Pincus lab, we have used a highly protective mAb designated S9 to select a
phage-displayed peptide library for peptides that mimic the GBS type III CPS (1). The S9
mAb is highly protective against experimental infection. With S9 treatment, animals
survive an otherwise lethal bacterial infection. In isolating phage that bind S9, two
peptides have been identified, depending on the desorption conditions. With acidic
desorption, peptide WENWMMGNA was identified, and with the basic desorption,
peptide, FDTGAFDPDWPA. ELISA results demonstrate that these peptides bind to S9
and no other antibodies tested. Phage blocks the binding of S9 to type III GBS, but
doesnot block the binding of a group specific mab to GBS. Phage displaying peptide
FDTGAFDPDWPA shows a greater inhibition of GBS binding than WENWMMGNA.
Antibody S9, other type-specific mAbs, and polyclonal anti-GBS type III antisera bind
the synthetic peptide FDTGAFDPDWPA. The FDTGAFDPDWPA is named peptide S9
after the antibody S9, which is used for its selection. The binding of S9 to GBS is
inhibited by free S9 peptide with an IC50 of 30 ug/ml. The CPS and intact GBS could
block the binding activity between S9 peptide and polyclonal anti-GBS antibodies. The
result indicates that the S9 peptide bears antigenic properties of GBS type III capsular
53
polysaccharide. A conjugate S9 peptide with carrier proteins (KLH, BSA or OVA)
induces significant antibody responses against both GBS and purified CPS after a single
immunization. The results indicate that this peptide mimetic of the GBS capsular
polysaccharide type III is both antigenic and immunogenic.
To investigate the origins of peptide-carbohydrate mimicry, the conformational
preferences of peptides that mimic the GBS type III CPS have been investigated by NMR
spectroscopy (277). The NMR spectra of the peptide FDTGAFDPDWPA reveal that the
peptide exists in two isoforms due to cis-trans isomerization. The ratio of trans to cis
isomer is estimated to be 7:3. For the trans-isomer, a type I β–turn is deleted from
residues Asp-7 through Trp-10. The type I β-turn is not represented in the population of
structures of the cis isoform. The S9 mAb also binds at - Asp-7 through Trp-10. Two new
peptides were synthesized, the peptide 1A, FDTGAFDPDWPYD, and peptide 1B,
FDTGAFDPDWPY. The Ala-12 was replaced by a tyrosine residue in both analogues.
An extra Asp residue was incorporated at the C-terminus of the 1A sequence to test the
possibility that the negative charge imparted by the Asp residue might mimic the negative
charge of the sialic acid component of the original peptide. The peptide analogues were
tested for biological activity and investigated by NMR. Peptide 1A is shown to be able to
compete with the CPS approximately twice as effectively as either the original peptide or
peptide 1B. Thus, the addition of an Asp residue at the C-terminus appears to increase the
relative avidity of the antibody for the peptide. NMR study reveals that peptide 1A, like
the original peptide, has the propensity to form type I β-turns in solution.
54
In this thesis I further investigate the structural basis of the peptide mimicry of the
GBS type III CPS carbohydrate epitope. We designed a sublibrary, expressing a mutated
version of the S9 peptide with 3% random nucleic acids at each position of the original
S9 nucleotide sequence, creating approximately one mutation in each inserted sequence.
Peptides with higher affinity to the S9 mAb were identified by affinity selection. From
this sublibrary, we also explored effects of the amino acid changes in the antigenic S9
peptide. The relationship of antigenicity and amino acid in each position is discussed in
the thesis.
Conjugate Vaccines and Carriers
Vaccines to Microbial Polysaccharides
Capsular polysaccharide (CPS) is both a microbial virulence factor and the target
antigen of many protective antibodies. As a virulence factor, CPS functions by inhibiting
phagocytosis by host immune cells (278). CPS is often a T-independent antigen that
predominantly elicits low avidity IgM antibodies and fails to induce immunological
memory. The lack of immunogenicity is most apparent in infants less than 2 years of age.
Although the polysaccharide is recognized by the B cell receptor (i.e. antibody), it usually
cannot be presented to T cells in conjunction with major histocompatibility complex
(MHC) class II molecules. The lack of specific T cell interactions in the immune
response limits the immunogenicity of the polysaccharide, the development of memory B
cells, and class-switched antibody. On subsequent antigen exposure, maturation of the
immune response does not occur. However, anti-CPS antibodies are frequently protective
and the induction of anti-CPS antibody to certain bacteria is believed to be the hallmark
55
of prevention (279-281). Thus, polysaccharide capsule is attractive as a vaccine antigen.
Because the immune response to purified CPS vaccines is generally not satisfactory,
further approaches to this problem must be taken.
Hemophilus influenzae type b (Hib) is one of the leading causes of invasive
bacterial infection in young children (282). It possesses a polyribosyl ribitol phosphate
(PRP) capsule (283). Hib is a significant cause of bacterial infection including meningitis,
septicemia, epiglottitis, pneumonia and septic arthritis, especially in children under 5
years of age. Studies have been shown that antipolysaccharide antibody is protective
against invasive Hib disease (284). Thus PRP is attractive as vaccine antigen. However,
purified PRP induces low titers of serum antibodies that are usually insufficient to protect
against invasive disease (285-287), particularly in the target age groups. Hib conjugate
vaccines, which contain PRP conjugated to peptide carriers (Diphtheria toxoid, CRM 197
mutant C. diphtheriae toxin protein, N. meningitidis protein outer membrane complex
and tetanus toxoid) are shown to be more immunogenic and to show boosted responses
characteristic of T-dependent memory (288, 289). Estimates of efficacy for prevention of
invasive disease range from 90-100% for up to 1 year following vaccination with Hib
conjugates.
The success of Hib conjugate vaccine has led to the improvement of vaccines to
bacteria such as Streptococcus pneumoniae and Neisseria meningitidis. Recent results of
efficacy trails of heptavalent pneumococcal conjugate vaccine are promising.
Streptococcus pneumoniae is a common bacterial agent causing a variety of infections
including mucosal infections, pneumonia, arthritis, pericarditis, peritonitis and severe
56
invasive infections such as meningitis and septicemia (290). Pneumococcal
polysaccharide vaccines are not effective in children under 2 years old because they are T
cell-independent immunogens. The seven-valent pneumococcal conjugate vaccine
includes seven purified CPS of S. pneumoniae, each coupled to a CRM 197 (291). The
seven-valent pneumococcal conjugate vaccine demonstrat remarkable efficacy against
invasive pneumococcal disease (292). Neisseria meningitidis is a major cause of bacterial
meningitis and sepsis. Effective conjugate vaccines for the prevention of menigococcal
disease cause by group A, C and Y strains have been licensed (293). Immunogenicity of
these meningococcal polysaccharides is markedly improved by conjugation to carrier
proteins.
The protein carriers in conventional vaccine development induce T cell responses.
T cell memory produced by conjugate vaccines is specific for peptide sequences derived
from the carrier proteins of these vaccines. However, carrier protein specific T cells are
unable to contribute to a secondary response to an invasive disease because they are not
specific for polysaccharide antigen. This phenomenon may explain some cases of the
existence of immunological memory without protective immunity.
In an effort to induce immune responses of greater magnitude, or of different
quality, different forms of carriers are being investigated. For example, our own studies
use a novel carrier, an RNA plant virus. Such carriers present antigen in repeated forms,
and in association with virus structures.
We will now describe the development of virus carriers for presenting antigens.
Carrier structures may be used to present antigens other than bacterial polysaccharides.
57
The immune response to any material considered a hapten, because of its molecular size
or other properties, may be enhanced by conjugation to a carrier. Examples include
peptides and low molecular weight organic compounds. There are a variety of different
carrier approaches. The most popular method is chemical coupling to large proteins such
as keyhole limpet hemocyanin (KLH) or in the vaccine conjugates described in the
section above. An alternative method exists for haptenic peptide antigens, fusing the
DNA encoding the desired peptide to the gene encoding the carrier protein and producing
the protein in a genetic expression system or using it directly as a DNA vaccine.
Virus-Based Carrier Systems
Conventional carrier proteins when administered systemically may induce a
strong antibody response, but often they can be inefficient in inducing T helper (Th) or
cytotoxic T lymphocyte (CTL) responses. They are also inefficient in the induction of
mucosal responses to the immunogens. The expression of antigen on viral coat proteins
by genetically fusing to viral DNA or chemically fusing to viral capsid protein, results in
a particulate structure providing a more effective stimulus for induction of local and
systemic immune responses. Virus particles are examples of highly organized and
complex structures (294). The degree of complexity of antigens is crucial to the
efficiency and quality of B cell response. Moreover, repetitiveness of antigen is used as a
self/nonself discrimination by B cells as well as by innate defenses such as Toll receptors
(295).
There are two strategies in using viruses as delivery systems or vaccine vectors.
The first strategy is making use of viruses that replicate in the host for induction of
58
immune responses, while the second strategy immunizes with preassembled virions or
pseudovirions expressed in heterologous expression systems such as bacteria (E. coli),
yeast, mammalian cells, or the natural host (e.g. plant and insect viruses). Examples of
viral vectors suggested for the first approach include modified poliovirus (296) and
human rhinovirus (297). In these cases, live viruses are proposed for use as vaccine
vectors. Alternatively in the second approach, whole viruses or virus-like particles
(VLPs) self-assembled in heterologous systems, may be used. Intact viruses that have
been proposed for vaccines include plant viruses, such as plum pox virus (298), cowpea
mosaic virus (CPMV) (299), and others. The first VLP used was hepatitis virus surface
antigen containing particles expressed in yeast (300). Examples of VLPs obtained using
this approach include rotavirus (301), picornavirus (302), orbivirus (303), calicivirus
(304), herpesvirus (305) and parvovirus (306).
The strategy to create efficient delivery systems from virus or VLP consists of
three steps. The first step is identification of permissive sites in the virus particle that do
not interfere with virus structure and assembly and maintain the full immunogenicity of
the foreign epitope. The second step is purification and characterization of chimeric
viruses or chimeric VLPs. The third step is investigation of the immunogenic properties
of the chimeras.
Plant Virus-Based Vaccine
Recent advances in the molecular biology of plant viruses have enabled the
development of expression systems that use viral vectors to produce large amounts of
protein in a short period of time. The general approach is to insert the foreign gene into
59
the viral genome under the control of a strong subgenomic promoter. The resulting
recombinant viruses can then be introduced into the appropriate host plant by mechanical
inoculation, where the virus can spread systemically throughout the plant. If the construct
allows viable virus particles to be produced, the recombinant virus has the potential to
spread from plant to plant. Expression of recombinant protein using viral vectors is a fast
and relatively simple method for examining proteins. The infected plants can produce
high amounts of protein within 1-4 weeks of inoculation. These systems can be divided
according to the architecture of the virus capsid into helical (rod-shaped) viruses or
icosohedral viruses. Helical viruses consist of a single strand of RNA around which is
wound the capsid protein. Icosahedral viruses encapsulate their genome and associated
proteins in a 20-sided particle of a defined size. An example of a helical virus system is
tobacco mosaic virus (TMV). TMV was used as a virus vector to express epitope from
Hepatitis C virus (307). Another example is plum pox potyvirus (PPV). It has been
developed into antigen presentation system (298). One or two copies of the 15 amino acid
epitope from canine parvovirus (CPV) are inserted into the N-terminus of the capsid coat
protein. Neutralizing antibodies are detected against CPV. An example of icosahedral
viruses is tomato bushy stunt virus (TBSV) (308). A 13 amino acid peptide from HIV-1 p
120 with 3 amino acid linker sequence is expressed at the C terminus of the coat protein
from TBSV in tobacco plants. The resulting virions resembled wild-type particles. The
HIV epitope is recognized by monoclonal antibodies and the immunization of mice
results in high antibody response to both the HIV peptide and the virus vector. Cowpea
60
mosaic virus (CPMV) and cowpea chlorotic mottle virus (CCMV) are other examples of
icosahedral viruses and are the viruses used in our studies.
Cowpea Mosaic Virus (CPMV) CPMV is a positive-strand RNA virus of the
family comoviridae. It has a narrow host range. Most experimental work has been carried
out in its natural host, the legume cowpea. It is a nonenveloped virus of approximately
300 A° diameter that can be isolated from infected plants in yields of 1-2 grams per
kilogram of leaves. The genome consists of two RNA molecules, RNA-1 and RNA-2.
RNA-2 encodes the capsid proteins. A systemic infection can be achieved by mechanical
abrasion of the leaf and application of both viral RNAs. An icosahedral capsid consists of
60 copies each of the large (L) and small (S) subunits. Two capsid proteins form three
distinct β-barrel domains which are arranged in the capsid in a pseudo T=3 lattice. The
crystal structure of the virus particle has been solved (309). One of the loops on the S
protein was chosen for insertion of an epitope from the VP1 protein of foot and mouth
disease (FMDV) (310). The result indicates that the insertion of this epitope interfers with
CPMV infectivity and spread.
Johnson et al. have used a surface exposed reactive lysine on CPMV as the site
for chemical modification (311-313). CPMV possess a single uniquely reactive lysine
residue per asymmetric unit (60 per virus particle). CPMV reacts with fluorescein Nhydroxysuccinimide (NHS) ester and isothocyanate, which selectively react with
available lysine residues. At neutral pH, wild-type CPMV is found to carry up to 60 dye
molecules per virion, in a dose-dependent manner (with a maximal yield at dye:viral
protein = 200:1 ). At pH 8.3, 1.5 dye molecules per asymmetric unit (90 per virion) are
61
bound at a 200:1 ratio, whereas when the ratio was 4000:1 a maximum loading of 240
dye molecules per virion is observed. In conclusion, under maximal conditions, up to 4
lysine residues per asymmetric unit could be labeled.
CPMV has a stable structure. The half-life of particles in 80% DMSO is
approximately 30 minutes. This allows chemistry to be performed on the viruses even
with relatively hydrophobic organic compounds. The study further reveals that CPMV
can be conjugated to biotin. In this application, in this thesis, lysine residues on CPMV
were conjugated to a peptide that mimics the type III GBS epitope. We studied the ability
of this chimera to induce an immune response in mice.
Cowpea Chlorotic Mottle Virus (CCMV) CCMV is a member of the Bromovirus
genus and in the Bromoviridae family. The bromovirus group has five members: CCMV,
brome mosaic virus, broad bean mottle virus, cassia yellow blotch virus and spring
beauty latent virus. These viruses have a 28 nm icosahedral capsid. The genome consists
of four positive-sense single stranded RNA molecules encapsulated in three virions, each
with similar or identical capsid structures. RNA 1 and 2 are monocistronic and encode
nonstructural proteins involved in RNA-dependent RNA replication. The dicistronic
RNA 3 contains open reading frames for movement protein and the coat protein. The coat
protein is translated from RNA 4, a subgenomic RNA transcribed from minus-strand
RNA 3. CCMV induces an extensive systemic chlorosis in cowpea. Continuous
propagation of CCMV in cowpea results in an attenuated variant, CCMV, which induces
mild green mottle symptoms (314). Movement protein plays a crucial role in determining
host specificity (315) and also has been shown to modulate symptom expression (316).
62
The structure of CCMV was determined to 3.2 A° resolution by X-ray
crystallography (317). The capsid is composed of 180 chemically identical protein
subunits. The quaternary structure of CCMV displays a T = 3, quasi-symmetry with 32
prominent capsomers. The capsomers occur as 12 pentamers and 20 hexamers assembled
from the coat protein. Each protein subunit is comprised of an eight-stranded,
antiparallel, β-barrel core (from amino acids 52-176). The capsomers are formed from
these β barrels. The C-terminal (amino acids 176-190) and N-terminal (amino acids 1-51)
of the coat protein extend in opposite directions away from the β barrel core. The
pentameric and hexameric capsomers of the virion are linked through C-terminal
extensions originating from two coat proteins. This linkage stabilizes the noncovalent
dimer. The C-terminal extension from one coat protein subunit extends across two-fold or
quasi two-fold axes to interact with subunits in adjacent capsomers. The N-terminus from
a nearby coat protein subunit clamps the invading C-terminal arm. The N-terminal
extensions of the threefold adjacent coat proteins converge at the quasi-sixfold vertices of
the virion and form a hexameric tubular structure (β-hexamer). The β-hexamer is
proposed to stabilize virion structure. An eight-stranded, antiparallel, β-barrel core (from
amino acids 52-176) results in the outward projection of five loops. In the Mark Young
lab, the DNA encoding each loop was engineered to have BamH I restriction enzyme
sites to allow for the insertion of DNA encoding epitopes. In our study, we inserted DNA
encoding mimetic peptide of GBS type III capsular polysaccharide in the BamH I site
located on each loop of CCMV coat protein. Analysis of these chimeras was studied in
this project.
63
Wild-type CCMV is stable around pH 5.0 and sediments at 88 S. At pH 7.0 and
low ionic strength, the particle undergoes a transition state to a swollen form, where the
average size of particle increases by roughly 10%. Swelling is the result of a radial
expansion of the virion capsid around the three-fold axes, where there are divalent
calcium ion binding sites (318). Young et al. analyzed a salt stable mutant of CCMV
(ssCCMV) (319). The ssCCMV resists disassembly in 1.0M NaCl, pH 7.5, whereas the
wild-type virions completely disassemble into RNA and capsid protein under these
conditions. Sequence analysis of the ssCCMV revealed a single A to G nucleotide change
at position 1484 of RNA 3 (position 134 of RNA 4). The nucleotide change results in a
lysine (K) to arginine (R) change at position 42 of the coat protein. Expression of the
K42R mutant coat protein in E. coli and then in vitro assembly produces virions with the
salt stable phenotype. The ssCCMV was used in our study to couple with a mimetic
peptide of type III GBS epitope. Another mutant, designated SubE mutant (discussed
later), was also conjugated to the peptide. We studied the ability of these chimeras to
induce an immune response in mice.
To study CCMV as a virus-based protein carrier, Young et al. developed methods
to produce CCMV in high yield in a Pichia pastoris heterologous expression system.
Expression of the coat protein in this system results in the assembly of particles as viruslike particles (VLP). The study of VLP from this expression system indicates that the
VLP are visibly indistinguishable from virus particles produced in the natural host. This
system has the advantage of providing a method for expressing a range of viral protein
mutants using large-scale fermentation technology. They also have investigated the
64
ability of a wide variety of CCMV coat protein mutants to be expressed and assembled
into VLPs using this system. The SubE mutant, in which eight basic amino acid residues
(K and R) of the N-terminus are replaced with acidic residue glutamic acids, was
modified to express in the yeast expression system. The wild-type virus and the Sub E
mutant results in equivalent level of protein accumulation, as determined by immunoblot
assays, of about 0.05 to 0.5 mg (from a gram of wet yeast) (320). Transmission electron
microscopic analysis of CCMV VLP demonstrates intact protein cages for the wild-type
and the SubE mutant. The same system was also applied in our study to produce VLP
expressing the mimetic peptide epitope of GBS type III.
Both CCMV and CPMV were used in our study to present the peptide mimic
epitope of GBS type III CPS. CCMV were either genetically engineered or chemically
conjugated with the peptide to produce the chimera. Mice were immunized with all
chimeras and the immune response against the chimera was studied in this thesis work.
Research Goals
GBS is a major causative agent of neonatal sepsis and meningitis. Our laboratory
previously identified a peptide, S9, which is an antigenic mimic of the epitope that is the
target of protective antibody. The goals of this study were to enhance the S9 peptide
immunogenicity, for the purpose of GBS vaccine development, and to study the structural
basis of antigenic mimicry by the S9 peptide. In chapter two, we conjugated the S9
peptide to CCMV as a platform to enhance the immune response. Subsequently, in
chapter 3, the CCMV-S9 constructs were injected in to mice and the immunogenicity of
65
the constructs was characterized. Finally in chapter four, we created mutants of the S9
sequence to study the structural basis of antibody binding to the S9 peptide and to search
for better mimetic peptides.
66
CCMV EXPRESSING PEPTIDES THAT MIMIC
THE GROUP B STREPTOCOCCAL EPITOPE
Introduction
We chose to express the GBS mimetic peptide in the plant virus Cowpea
Chlorotic Mottle Virus (CCMV). The virus serves as a carrier for the mimetic peptide.
CCMV was chosen for this purpose because of its repetitive structure allowing multiple
epitopes to be expressed, because the Young lab had invested time and energy in
developing virus mutants that could be used for epitope expression, and because large
amounts of virus could be obtained in both natural and recombinant expression systems.
CCMV is a member of the Bromoviridae family of viruses. CCMV has a 28 nm
icosahedral capsid. The genome consists of four positive-sense single stranded RNA
molecules encapsulated in three virions, each with similar or identical capsid structures.
RNA 1 and 2 are monocistronic and encode nonstructural proteins involved in RNAdependent RNA replication. The dicistronic RNA 3 contains open reading frames for
movement protein and the coat protein. The coat protein is translated from RNA 4, a
subgenomic RNA transcribed from minus-strand RNA 3. CCMV induces an extensive
systemic chlorosis in cowpea. The structure of CCMV determined by X-ray
crystallography demonstrates that the virion is comprised of 180 copies of the coat
protein subunit arranged on a T = 3 icosahedral structure with 12 pentamer and 20
hexamer capsomeres (317). The Young laboratory has studied expression and assembly
of virions and virus-like particles (VLPs) based on CCMV. These were utilized in these
studies.
67
Initially, genetic approaches were taken to express the S9 mimetic peptide
FDTGAFDPDWPA, first in infectious virus, then as VLPs made in a yeast expression
system. These viruses failed to assemble and function, and so the final constructs, used
later in this thesis research were made by chemical conjugation.
Materials and Methods
Engineering CCMV-Peptide S9 Chimera (Plant Expression)
Five plasmids each encoded loop-specific BamH1 cloning sites where peptides
could be expressed on the virus coat, at amino acid positions 63, 102, 114, 129 or 161 in
the wild-type coat protein, were kindly provided by the Young lab. We inserted DNA to
encode the S9-peptide (FDTGAFDPDWPA) within the loop sequence. Plasmid vectors
for each specific loop are referred to as pCC3-63, pCC3-102, pCC3-114, pCC3-129 and
pCC3-161. Plasmids were digested with BamH1 for 2 h at 37°C. Then the digested
plasmids were dephosphorylated with a calf intestinal alkaline phosphatase (CIP). The
sense encoding the S9 peptide, 5’G ATC CCA [TTC GAT ACG GGC GCG TTC GAT
CCA GAT TGG CCA GCG] GG 3’ (IP[FDTGAFDPDWPA]) with phosphate at 5’ end
and the complementary strand (antisense strand), were purchased from Integrated DNA
Technologies. The red highlights indicate the BamHI overhang, the letters in the
parentheses indicate the S9 coding region, and blue letters indicate S9 peptide. Each
strand was heated at 95°C for 3 min and rapidly cooled down for 5 min. Sense and
antisense strands 25 ul of 50 ng/ul were mixed together, giving 1:1 molar ratio reaction.
The mixture was incubated 15 min at 50°C and then allowed to cool down to room
temperature. The S9 peptide genes were ligated into the compatible ends of restriction
68
digested BamH1 sites. The ligation reaction was performed with a ratio of 1:3, vectors:
inserts with ligation reaction composed of 1 ul T4 DNA ligase (Promega, Madison, WI)
and 1 ul of 10x ligation buffer (containing 100mM mgCl2 and 10 mM ATP, Promega) in
10 ul total volume. The reaction was incubated at 4°C overnight to facilitate ligation. The
digested plasmids alone were used as a control. The ligation reactions were then
transformed into XL2-Blue ultracompetent E. coli cells (Stratagene, Cedar Creek, TX) by
mixing 2 ul of the reaction with 100 ul of the competent cells. The transformation
reactions were incubated in an ice tub for 30 min and then briefly in 67°C for 42 sec. LB
broth was added to the transformation reactions and the mixtures were incubated at 37°C
for 1 h. The transformation reactions were spread on LB media agar with 100 ug/ul
ampicillin supplement and incubated at 37°C overnight. Single colonies were picked and
subcultured in LB broth. Clones were tested for the presence of the S9 insert by PCR and
further, by sequencing.
Verifying Positive Clones
Clones containing inserts were identified by two steps: PCR and then sequencing
analysis. Selected clones were cultured in 3 ml LB broth medium. Plasmids were
extracted from cells by alkaline lysis method (321). 3 mls of overnight culture in LB
broth with complement of ampicillin 100 ug/ml were spun down to collect a cell pellet.
Cells were resuspended in 100 ul of 20 mM Tris buffer pH 8 and then incubated at room
temperature for 5 min. 200 ul of lysis buffer were added and the mixture was mixed by
inversion. The mixture was incubated for 10 min and then 150 ul of KAC/AC (5 M
potassium acetate, 10 M (57%) acetic acid) were added. The mixture was mixed
69
vigorously and placed in ice for 30 min. Cell debris was removed by centrifugation at 12
krpm 10 min twice. Supernatant was collected and was then mixed with an equal volume
of phenol/chloroform/isopropanol. The upper phase was collected and transferred to
another eppendorf tube. DNA was precipitated by mixing the mixture well with 2X
volume of 95% ethanol and 1/10 volume of 3 M sodium acetate pH 5. The mixture was
incubated at –20°C overnight. DNA was collected by centrifuging12 krpm 10 min. The
DNA pellet was washed with 70% ethanol and resuspended in10 ul water. 2 ul of DNA
suspension was loaded in 0.8% agarose gel. Purified plasmids were amplified by PCR
using primers 20 and 21, kindly provided by the Young lab. The PCR products were run
in 1% agarose electrophoresis gels. Positives clones were sent for DNA sequencing
analysis (Davis Sequencing, Inc, Davis, CA).
In Vitro Transcription of CCMV cDNAs for Plant Inoculation
Plasmids pCC1, pCC2, pCC3-wt and pCC3-S9 constructs were prepared for in
vitro transcription by linearization with Xba1 followed by proteinase K (Sigma, St. Louis,
MO) digestion for 30 min at 65°C, phenol-chloroform extraction and ethanol DNA
precipitation. Chimeric CCMV-S9 RNAs were synthesized by in vitro transcription from
approximately 1.0 ug of linearized DNA with T7 Megascript (Ambion, Austin, TX) in a
20 ul reaction, containing RNA polymerase enzyme and its buffer and ribonucleotides,
supplied by the company. RNA quantitation and integrity were determined by UV
spectrophotometry (1OD260 = 44 ug/ml) and visualization on denatured agarose gel
electrophoresis.
70
Plant Inoculation
The 20 ul mixtures containing 1 ug of each RNA 1, 2 and wt RNA 3 or chimeric
RNA 3-S9 were spotted on carbon dusted leaf of cowpea plants (Vigna unguiculata (L.)
var California Blackeye) and tobacco plants (Nicotiana benthamiana) at the primary
stage (two leaves). The inoculation was performed on 2-4 leaves. Four weeks after
inoculation, leaves were collected and kept at –80°C. Virus from collected samples was
extracted. Collected leaves were immersed in liquid nitrogen and crushed in
homogenization buffer (0.2 M sodium acetate, 0.2 M acetic acid, 0.01 M disodium
EDTA, pH4.8). The crude extract was tested for the presence of virus by ELISA and
observation under electron microscope.
ELISA
ELISA was performed as follows. Briefly, 100 ul of 1:5000 dilution of 1 mg/ml
purified rabbit anti-CCMV polyclonal antibody with phosphate buffer was absorbed on
the surface of ELISA plates at 4°C overnight. Plates then were blocked with blocking
buffer (containing BSA) 200 ul at 4°C at least 6 h. Plates were washed with ELISA
washing buffer, 10 mM phosphate buffer pH 7.4, 150 mM NaCl, 0.05% Tween 20. Plant
crude extracts were loaded in prepared plates and then incubated at 4°C overnight. Plates
then were washed again with washing buffer. A 1:500 dilution of alkaline phosphatase
(AP)-conjugated rabbit anti-CCMV polyclonal antibody was loaded in the plates and
incubated at room temperature for 4 h. After washing with ELISA washing buffer, 100 ul
71
of substrate, p-nitrophenyl phosphate, were added (Sigma, St. Louis, MO). The resulting
color reaction was measured with ELISA plate reader at absorbance 405 nm.
In Vitro Transcription and Translation
The CCMV-S9 plasmid constructs, pCC3-63, pCC3-102, pCC3-114, pCC3-129
and pCC3-161, encoding coat protein gene were PCR amplified using upstream primer,
which contained a T7 RNA polymerase promoter element and a start codon, ATG. The
PCR reaction resulted in a PCR product, which contained T7 RNA polymerase promoter
element and a start codon at the 5’ and stop codon at 3’ end. DNA quantitation and
integrity was determined by UV spectrophotometry and visualized by agarose gel
electrophoresis. Chimeric CCMV-S9 RNA was in vitro transcribed from PCR product by
using RNA transcription kit (mMessage mMachine@T7 kit, Ambion, Austin, TX). RNA
quantitation and integrity were determined by UV spectrophotometry and visualized by
denatured agarose gel electrophoresis. Resulting 5’ capped mRNAs were then in vitro
translated using cell free wheat germ extracts translation kit (Promega, Madison, WI).
Radioactive (S35) methionine was incorporated into the reaction. The proteins then were
visualized by using gel electrophoresis and autoradiography.
Engineering CCMV-S9 Chimeras in Pichia pastoris
CCMV wt and CCMV-S9 chimeric genes were subcloned from their original
plasmid vector pCC3-wt and pCC3-S9s into the P. pastoris expression plasmid pPicZa
(Invitrogen) to construct pPicZa 63-S9, pPicZa 102-S9, pPicZa 114-S9, pPicZa 129-S9
and pPicZa 161-S9. PCR was used to amplify the DNA cassette using primers: 5’ GAT
72
AGT AAG AAT TCA TGT CTA CAG TCT T 3’ as upstream primer, and 5’ GTA ACG
GTC GAC AGC GGG C 3’ as downstream primer. The upstream primer was
complementary to a region encoding the coat protein start codon ATG (underlined
sequence), and was created to introduce an EcoR I endonuclease restriction site (red
block sequence) into the 5’ end of the amplified fragment. The downstream primer was
complementary to the region encoding the coat protein stop codon, TAG and was also
designed to contain SalI endonuclease restriction enzyme site. Thus the PCR products
contained both EcoRI and Sal1 sites. Agarose gel electrophoresis was used to follow the
PCR products. The products were purified from gels using QIAquick DNA/gel
purification kits (Qiagen, Valencia, CA).
The pPicZa plasmid vectors were digested with EcoRI and XhoI. The XhoI
digestion created SalI compatible ends. Then plasmids were dephosphorylated by CIP as
described above. The 5 digested PCR products from pCC3-S9s were ligated into digested
pPicZa plasmids. The ligation reactions were then transformed to XL-2 Blue
ultracompetent E. coli cells as described. Transformed E. coli were spread on low salt LB
agar plates containing 25 ug/ml Zeocin. Single colonies from each ligation reaction were
randomly selected and cultured overnight in low salt LB media under Zeocin selection
(25 ug/ml). Recombinant plasmids were extracted from clones by the alkaline lysis
method (321). Recombinant clones were verified by PCR and DNA sequencing.
Recombinant plasmids containing pCC3-S9 were extracted by the alkaline lysis
method (321) and then linearized with SacI. The linearized plasmids were then
electroporated into competent P. pastoris X-33 mut+ yeast (Invitrogen) using a T800L
73
Electro Cell Manipulator (BTX, San Diego, CA) electroporation unit according to the
manufacturers’ protocol. The pPicZa does not contain a yeast origin of replication.
Transformants can be obtained only if the recombination occurs between plasmid and
Pichia genome. Zeocin resistant transformants were selected after 2-3 days growth on
YPDS agar plates (1% w/v yeast extract, 2% w/v dextrose, 1M sorbitol, 2% w/v agar)
containing Zeocin (100 ug/ml). Single colonies were subcultured into 3 ml of YPDS
broth containing Zeocin (100 ug/ml) and incubated at 30 °C overnight. Direct PCR-based
screening of clones was performed (322). Briefly, 10 ul of P. pastoris culture (1:10
diluted with water) was disrupted using 25 U lytiase (Sigma). Primers for CCMV coat
protein were used to amplify DNA. The PCR products were observed by gel
electrophoresis and sent for DNA sequencing analysis (Devis Sequencing, Inc., Davis,
CA).
Protein Expression and Small Scale Time Course Experiment
Positive yeast clones were cultured in 25 ml MGY (1.34% w/v yeast nitrogen
base without amino acids (YNB), 1% v/v glycerol, 0.00004% w/v biotin) 30°C for 18 h
250 rpm. For induction of the coat protein expression, the cells were harvested by
centrifugation, washed once with MM medium (1.34% w/v YNB, 0.00004% biotin, 0.5%
methanol) and resuspended in 150 ml MM medium. During the incubation, methanol was
added to the culture at 24 h intervals, each time to give a final concentration of 0.5%.
Samples of 1 ml were collected every day for 7 days. Cells were stored at –80°C.
74
Medium Scale Expression of CCMV-S9 Chimeras in P. Pastoris
Five positive recombinant Pichia clones (pCC3-63, pCC3-102, pCC3-114, pCC3129 and pCC3-161) were cultured in 50 ml MGY for 24-48 h at 30 °C on a 250 rpm
incubation shaker. Cells were harvested by centrifugation and washed with MM medium.
The washed harvested cells were then inoculated into 500 ml of MM medium. 100 %
methanol 2.5 ml (0.5% final concentration) was added to the culture at 24 h intervals. The
culture was incubated for five days at 30°C in 250 rpm incubation shaker. Cells were
harvested by centrifugation and kept in -80°C for further analysis.
Large Scale Protein Expression
Improved overall recombinant protein yields in Pichia have been achieved by
large scale Pichia fermentation process. The fermentation method followed the
Invitrogen Pichia fermentation process guidelines. A Bioflo 3000 bench-top fermenter
(New Brunswick Scientific) with a 5L water-jacketed glass fermentation vessel was used
in the project. The fermentation procedure was separated into three phases, glycerol batch
phase, glycerol fed-batch phase and methanol fed-batch phase. Dissolved oxygen (DO)
measurement was used as the tool to observe and manipulate the metabolic rate of the
culture during all 3 phases of fermentation process.
The positive yeast clone producing the largest amount of protein was selected
based on time course data. This recombinant clone was cultured in 300 ml MGY medium
(10% of initial fermentation volume) at 30°C, 250-300 pm, 16-24 h as an inoculum seed
for the fermentation. The glycerol batch phase began with adding the inoculum seed into
75
the fermentor vessel containing 3L of fermentation basal salts medium (85% v/v
phosphoric acid, 0.93 g/L CaSO4, 18.2 g/L K2 SO4, 14.9 g/L Mg SO47H2O, 4.13 g/L
KOH and 4% v/v glycerol). The batch culture was allowed to grow until the glycerol was
completely consumed (18-24 h). The DO was set to 100% before the culture started to
grow. As the culture grew, oxygen was consumed resulting in a decrease of DO. DO was
maintained at 20% by adding oxygen and providing agitation. When glycerol in the
medium was completely utilized by culture (18-24 h), yeast stopped growing. The
oxygen in medium was not consumed. Thus the DO was close to 100%. Therefore, we
measured the DO when the agitation tool and the oxygen pump stopped. If the DO
measurement was close to 100%, the next phase was started. Next, the glycerol-fed batch
was started by pumping in a culture medium containing 50% w/v glycerol at a feed rate
of 18.15 ml/h/L initial fermentation volume. This phase improved the cellular yield from
180 to 220 g/L wet cells. Glycerol feeding was carried out for 4 h and stopped 30 min
before starting the next fermentation phase to assure that cells used up all glycerol in the
medium. The DO measurement was again used as an indicator of when to start the next
phase. DO close to 100% indicated the complete consumption of glycerol. The
methanol-fed batch phase was initiated by gradually feeding 100% methanol into the
vessel to allow cells to adapt to growth on methanol. The DO measurement was used as
the indicator to tell how cells adapted to the methanol feeding. A reduction of the DO
indicated that the culture was able to adapt to methanol. However if the DO was lower
than 20%, it indicated that the yeasts had died and the methanol feeding needed to be
stopped. After full adaptation, methanol was fed with the rate of approximately 7.3-10.9
76
ml/h/lL feed rate. The entire methanol fed-batch phase lasted approximately 70-100 h
with a total of approximately 750-1000 ml methanol fed per liter of initial volume.
Temperature during all fermentation phases was maintained at 30°C. The DO was kept
above 20% through out the fermentation process by agitating and adding oxygen. Foam
was controlled by manually adding an antifoam agent, Silwel L-7602 (Witco
Corporation, Michigan). The cellular yield could reach a final level of 350-450 g/L after
the full fermentation cycle. Cells were harvested by centrifugation and wet cells were
preserved in -80 °C for further analysis.
Chimeric Virus Purification
Frozen cells from medium scale culture were thawed and lysed using acid-washed
glass beads in an equal volume of virus buffer (0.1 M sodium acetate/acetic acid, 1 mM
sodium azide, 1 mM disodium EDTA, pH 4.8, 0.22 um filtered). The mixture was
vortexed vigorously 4 times for 5 min, with 2 min on ice in between. Cell debris and
glass beads were separated by centrifugation at low speed. Chimeric viruses in
supernatant were precipitated by adding 10% (w/v) polyethylene glycol (PEG) MW
8000. The mixture was then slowly stirred overnight at 4°C. The mixtures were
centrifuged and the pellets were resuspended in 1/10 initial supernatant volume virus
buffer. The mixture was then centrifuged at low speed. Supernatants containing virus
were kept in -80°C for further analysis.
For the fermentation experiment, 100 g of collected cells were lysed by grinding
with 235 g acid-washed glass beads in a bead-beater (BioSpec Products-BSP, model
1107900) in the presence of 200 ml homogenization buffer. The grinding cycle process
77
was to grind for 5 min and rest on ice for 3 min. To completely break cells, 5 cycles of
grinding were performed. Beads and cell debris were separated by centrifugation and
approximately 0.2 g of cell debris was kept at -80°C for further analysis. Supernatant was
added with the same buffer to a final volume of 500 ml and impurities eliminated by
using filter paper (Water/bushman) 0.6 um. 200 ul of filtrate was kept at -80°C for further
analysis and the remainder was centrifuged using a Beckman Type 30 Rotor at 25 krpm
for 2 h. Supernatant was kept at -80°C for further analysis and the pellet was resuspended
in 1 ml virus buffer. The virus mixture was centrifuged at low speed to pellet out debris
and aggregates.
To improve viral purification from the fermentation culture, diethylamino ethanol
(DEAE) was applied in the process. 100 g of collected cells were lysed by grinding in the
presence of 200 ml 50mMTris-HCl buffer pH 6.5. In one experiment the grinding process
was performed in the presence of 2 M urea to increase recombinant viral protein
solubility and disrupt noncovalent bonds between the viral coat protein and yeast cell
debris. Beads and cell debris were separated by centrifugation and approximately 0.2 g of
cell debris was kept at -80°C for further analysis. Supernatant was added to 50 mM TrisHCl buffer pH 6.5 to have final volume of 500 ml. DEAE 2 g was added to the
supernatant. The mixture was stirred slowly at 4°C for 2 h. The mixture was then filtered
(Buchner funnel and filter paper (Water/bushman 90 mm) and washed with 50 ml of the
same buffer twice. The filter cake was resuspended in 50 ml virus buffer supplement with
0.5 M NaCl. The suspension was filtered and the filtrate was collected. To elute all
chimeric constructs from the filter cake, the filter cake was resuspended one more time
78
with 50 ml of the same virus buffer supplement with 0.5 M NaCl. The suspension was
filtered. The filtrate was collected and pooled with the filtrate from the previous step and
then centrifuged using a Beckman Type 30 Rotor at 25 krpm for 2 h. The viruscontaining pellet was resuspended in 1 ml virus buffer. The virus suspension was briefly
centrifuged at low speed to pellet out debris and aggregates.
SDS PAGE, Western Blot, and Dot Blot Analysis
For [S35]-labeled in vitro protein translation products, samples were boiled with
gel loading buffer (0.5 M Tris buffer pH 6.8: 10% SDS: Glycerol (1:1:1), bromophenol
blue, 0.036% betamercaptoethanol) and then loaded onto pre-cast 12.5% SDS
polyacrylamide gel according to the manufacturer guidelines (PhastSystem, Pharmacia
Biotech, Uppsala, Sweden). For other purposes, samples were boiled in the gel loading
buffer and then loaded onto 12.5% SDS polyacrylamide gels. Gels were visualized by
silver staining or proteins in gel were transferred to polyvinylidene fluoride (PDVF)
membranes (Sigma), by using western blot apparatus (Bio-Rad, Laboratories, Hercules,
CA). For dot blot analysis, prepared boiled samples were directly dotted into membranes
and air-dried for 10 min before proceeding. Membranes from both western and dot blot
were then blocked of any nonspecific binding overnight at 4°C with blocking buffer (5%
non fat dry milk, 0.2% tween 20 in PBS buffer pH7.4). Membranes were washed briefly
with ELISA washing buffer 3 times for 1 min each. Membranes were incubated overnight
at 4°C with blocking buffer containing primary antibody: either 5 ug/ml S9 monoclonal
antibody or 1/5000 anti-ccmv antibody. After 3 washes with the ELISA washing buffer,
membranes were incubated with blocking buffer containing secondary antibody either
79
1/1000 alkaline phospatase-conjugated anti-mouse IgM antibody or 1/1000 Horseradish
peroxidase-conjugated anti-rabbit antibody. The colorimetric reaction was then
developed (Bio-Rad, Laboratories, Hercules, CA).
CCMV Wild-Type Plant Virus Purification
Frozen CCMV infected leaves 100 g were blended for approximately 3 min in
100 ml homogenization buffer. The homogenate was filtered through 2 layers of
cheesecloth. The filtrate was allowed to sit on ice for 1 h before low speed centrifugation
at 20,000 g for 20 min. The supernatant was precipitated by adding 10% (w/v) PEG MW
8000 followed by overnight stirring at 4ºC. The pellet containing CCMV virus was
collected by centrifugation and resuspended in virus buffer. A second round of viral
precipitation was carried out with 15% (w/v) PEG MW 8000 and resuspended in virus
buffer. Next the suspension containing CCMV virus was purified by centrifuging in 38%
(w/v) CsCl at 38000 rpm for 20 h (Beckman, SW41). The virus band was collected and
dialyzed against virus buffer. Viral concentration and impurity were determined by
measuring UV absorbance ratio Abs260/280 and observing the presence of virus under
transmission electron microscope (TEM). The Abs260/280 =1.5-1.7 is considered good. The
viral concentration was calculated based on absorbance at 260 nm (1Abs260 = 0.17
ug/ml).
Chemical Linking between CCMV Virus and S9 Peptide
Two approaches were used to chemically conjugate S9 peptide to CCMV. The
first was to conjugate through a thiol group by forming a disulfide bond between S9 and
80
CCMV. S9 peptide with an added cysteine at the amino terminal was synthesized for this
purpose. The CCMV mutant, CCMV A163C with cysteine substituted at position 163,
was used in the experiment. The reaction was performed in the presence of 10 mM
CuSO4, 1 mg of virus, and 1 mg of S9 peptide at room temperature for 2.5 h. For
analysis, 10 ul of the coupling reaction were loaded on SDS nonreducing PAGE gel. Gels
were silver stained to visualize the conjugation product.
The second approach used the chemical linkers N-succinimidyl 3-(2pyridyldithio) propionate (spdp) and Sulfosuccinimidyl 4-(N-maleimidomethy)
cyclohexane-1-carboxylate (sulfo-smcc), which were purchased from Pierce (Rockford,
IL).
The spdp is a heterobifunctional cross-linker. It is composed of two functional
groups, NHS ester and 2-pyridyldithio group. The NHS ester reacts with the primary
amine on the viral coat protein. The 2-pyridyldithio group reacts with sulfhydryl at the
amino terminal of S9 peptide, forming disulfide bond between the linker and S9 peptide
and releasing pyridine 2-thione (Figure 2.1).
To prepare for the cross-linking reaction, virus ssCCMV, originally kept in the
virus buffer pH 4, was dialyzed against 20 mM NaH2PO4 pH 7.5. After dialysis, the pH
of virus was measured again and adjusted with 1M NaH2PO4 pH 9 to pH 7.5. The freshly
prepared spdp linker in dimethyl sulfoxide (dmso) was used in 5-fold molar excess to
CCMV capsid protein (MW of CCMV capsid protein = 22,000). The pH of the reaction
was adjusted to pH 7.5 and the reaction was incubated at room temperature for 1 h in a
shaker. The reaction was stopped by incubating 1 h at room temperature with 50 ul of
81
hydroxylamine 1.5 M pH 8.5. The pH of the reaction was adjusted to 8.5 with 5 M
sodium acetate pH 4.5. The S9 peptide in a 50-fold molar excess to CCMV was added.
The pH of the reaction was adjusted to pH 6.5 with 5 M sodium acetate buffer pH 4.5.
The reaction was performed at room temperature for 1.5 h. Then 5 ul of reaction sample
was mixed with 5 ul of SDS loading buffer without β-mercapto ethanol and boiled for 10
min. The samples were loaded onto a 12% SDS-PAGE gel and visualized by silver
staining or transfer to a PVDF membrane for western blot analysis. The conjugation
product was also characterized by sucrose gradient velocity analysis.
O
N
O
C
O
C
H2
C
H2
S
S
N
O
SS
pH 7.5
NH 2
SS
NH
C
O
C
H2
C
H2
S
S
N
HS
Disulfide exchange
Peptide
SS
NH
pH 6.5
SS1
C
O
C
H2
+
C
H2
S
S
N
S
NH
SS 2
C
O
C
H2
S
C
H2
+
S
C
H2
S
N
C C NH
H2 O
S
N
Figure 2. 1 Chemical Reaction between SPDP, CCMV and S9
Sulfo-smcc consists of an NHS-ester and a maleimide group connected with a
spacer arm. NHS-esters react with primary amines on CCMV, and maleimides react with
the thiols on the cysteine-containing S9 peptide. Primary amines are the principal targets
for the NHS-ester. Thus the e-amine of lysine available on the capsid protein will react
82
with the NHS-ester. An amide bond is formed when the NHS ester conjugation reagent
reacts with primary amines releasing N-hydroxysuccinimide (Figure 1. 2).
Figure 2. 2 Chemical Reaction between Sulfo-SMCC, CCMV and S9
To begin the coupling process, ssCCMV in the virus buffer pH 4.8 was dialyzed
against 20 mM NaH2PO4 pH 7.5. The pH of the virus was measured again before the
coupling reaction, and adjusted to pH 7.5 with 1M pH 9 NaH2PO4. Tris (2-carboxyethyl)
phosphine (TCEP) 0.5 M was added to the virus, to a final concentration of 50 mM, to
reduce protein disulfide bonds in viral coat protein. The reaction was allowed to continue
at room temperature for 1 h. An alkylating sulfhydryl reagent 2-iodoacetamide (IA) 0.5
M was added to the virus to 50 mM final concentration and incubated at room
temperature for 30 min. The virus solution was purified to get rid of excess TCEP and the
IA by using microcon 100 filters (Millipore, Billerica, MA). The virus was washed
extensively 3 times with 20 mM NaH2PO4 pH 7.5 and eluted with the same buffer.
Freshly prepared sulfo-smcc linker was used in 25, 50, 100 or 200-fold molar excess to
83
the virus. After adding the linker, the pH of the reaction was remeasured and adjusted to
7 with 1 M NaH2PO4 pH 9. The reaction continued for 12 h at 4°C. To stop the amide
reaction between virus and the linker, lysine was added to the reaction to a final
concentration of 1 mMand kept for 15 min at room temperature. The excess linker and
lysine were removed by passing through a size-exclusion filter microcon 100, washed
extensively 3 times and eluted with the 20 mM NaH2PO4 pH 6. The S9 peptide was
pretreated with 50 mM TCEP for 1 h at room temperature prior to coupling with the
derivatized virus. The pretreated S9 peptide was used in 12.5, 25, 50, 100 and 200 molar
excess to the ssCCMV. The pH of the reaction was adjusted to pH 6 with 1 M NaH2PO4
pH 9. The reaction of maleimides with thiols was incubated for 6 h at 4°C. 5 ul of
reaction sample was mixed with 5 ul of SDS loading buffer containing β-mercapto
ethanol and boiled for 10 min. The samples were loaded into 12% SDS-PAGE gel and
visualized by silver staining technique or transfer to a nitrocellulose membrane for
western blot analysis. The conjugation product was also characterized by sucrose gradient
velocity analysis.
Sucrose Gradient Analysis
Samples were separated on 10-40% or 5-25% sucrose (w/v virus buffer)
sedimentation velocity gradients. Gradients were poured in Beckman SW41 centrifuge
tubes (10 ml/tube) using a Gradient Master (BioComp Instruments, New Brunswick,
Canada). 500 ul samples were overlaid and then centrifuged at 37,000 rpm for 3 h. The
gradients were manually carefully fractionated obtaining 1 ml/fraction. Abs280 of
gradient fractions was measured for presence of virus. 10 ul of each fraction were mixed
84
with loading dye to load into SDS-PAGE gel analysis. Gels were silver stained or/and
blotted to PVDF membranes for western blot analysis.
Results
Plant Expression System
Plasmids containing cDNA of RNA3 were kindly provided by the Young lab.
Plasmids of RNA3 were designated pCC3-63, pCC3-102, pCC3-114, pCC3-129 and
pCC3-161 according to the position of loop-specific BamH1 cloning sites. A synthetic
oligonucleotide encoding the S9 peptide sequence (FDTGAFDPDWPA) flanked with
BamHI restriction sites was inserted into the loop sequence BamH1 site of each plasmid.
The positive recombinant clones were verified by PCR and DNA sequencing analysis.
PCR products from positive clones are 677 bp compared to vectors, which all are 632 bps
resulting in the slight mobility shift for 45 bp differences (Figure 2.3).
All positive clones were sent for DNA sequencing analysis to confirm the result.
Only one positive recombinant clone from each construct was kept for further study and
were named pCC3-63-S9, pCC3-102-S9, pCC3-114-S9, pCC3-129-S9 and pCC3-161S9. Each construct needed to be transcribed in vitro to RNA. For in vitro transcription,
recombinant clones and cDNA of CCMV-RNA1 and CCMV-RNA2 (kindly provided
from Young lab) were linearized with XbaI, followed by proteinase K treatment,
phenol/chloroform extraction and ethanol precipitation. RNA1, RNA2, RNA3-wt and
chimeric CCMV-S9 RNAs were synthesized by in vitro transcription from linearized
DNA with T7 Megascipt (Ambion, Austin, TX) as described in the Materials and
85
Methods section. RNA quantitation and integrity were determined by UV
spectrophotometry and visualization on denaturing agarose gel (Figure 2.4). We obtained
approximately 100 ug of RNA1 and RNA2 and approximately 12 ug of wt RNA3 and all
chimeric RNA3-S9s from in vitro transcription process.
PCC3-63
pCC3-102
pCC3-114
pCC3-129
pCC3-161
Figure 2. 3 PCR Analysis Recombinant Constructs
S9 DNA sequences, 45 bp, was inserted into pCC3-63, pCC3-102, pCC3-114, pCC3-129,
and pCC3-161 plasmid. PCR analysis using primer 20 and 21 was applied to identify
positive recombinant clones. The first lane in each panel is 1 Kb standard DNA marker.
The second lane is the pCC3-63,pCC3-102, pCC3-114, pCC3-129 or pCC3-161 plasmid
vector. The remainders are recombinant clones. The mobility shifts indicated the positive
recombinant clones.
86
From left to right are RNA products from in vitro transcription pCC1 (cDNA of RNA1), pCC2
(cDNA of RNA2), pCC3-wt (cDNA of wt-RNA3), the recombinant clone pCC3-63 and the
recombinant clone pCC3-102 respectively.
From left to right are RNA products from in vitro transcription pCC1 (cDNA of RNA1), pCC2
(cDNA of RNA2), pCC3-wt (cDNA of wt-RNA3), the recombinant clone pCC3-114 and the
recombinant clone pCC3-129 respectively.
From left to right are RNA products from in vitro transcription pCC1 (cDNA of RNA1), pCC2
(cDNA of RNA2), pCC3-wt (cDNA of wt-RNA3) and the recombinant clone pCC3-161
respectively.
Figure 2. 4 RNA Products from In Vitro Transcription of pCC1, pCC2, pCC3-wt and
Recombinant pCC3-63-S9, pCC3-102-S9, pCC3-114-S9, pCC3-129-S9, and pCC3-161S9
Positive recombinant pCC3-S9 clones, pCC1 encoding coat protein1 and pCC2 encoding
protein 2 were in vitro transcribed to obtain RNAs. The RNA products were visualized
by gel electrophoresis.
For plant inoculation, 1 ug of RNA1, RNA2, and RNA3-wt or chimeric RNA3-S9
from in vitro transcription reaction were mixed together and 20 ul/leaf administered.
Leaves of cow pea plant (Vigna unguiculata (L.) var. California Blackeye) and tobacco
87
plants (Nicotiana benthamiana) were carbonrundum dusted at the primary stage (two
leaves) to create abrasion. The RNA cocktails were manually inoculated. Three weeks
following inoculation, infected leaves were collected. The leaf crude extract was
subjected to ELISA to detect the presence of wt CCMV and the chimeric viral particles
(Table 2.1).
Table 2. 1 Elisa Result of Leaf Crude Extract
Construct
Tobacco Plant
Wild-type
Cowpea Plant
Repetition1
Repetition2
Repetition1
Repetition2
Mean+ SD
Mean+ SD
Mean+ SD
Mean+ SD
0.672+0.002*
0.571+0.009 1.205+0.006
1.206+0.008
63-S9 chimera
0.05+0.003
0.071+0.010 0.051+0.007
0.087+0.008
102-S9 chimera
0.055+0.005
0.056+0.005 0.021+0.005
0.065+0.005
114-S9 chimera
0.061+0.007
0.091+0.004 0.029+0.007
0.098+0.005
129-S9 chimera
0.089+0.006
0.051+0.007 0.009+0.007
0.188+0.004
161-S9 chimera
0.095+0.007
0.082+0.008 0.018+0.005
0.095+0.008
PBS
0.087+0.008
0.080+0.004 0.042+0.010
0.098+0.009
*OD405 detected in ELISA well, mean of triplicate samples + SD
Inoculated leaves were collected after 3 weeks of infection. Leaves were frozen by
immersing in liquid nitrogen. Then, 20 g of frozen leaves were crushed by placing in a
blender with 20 ml of homogenization buffer. Supernatants were collected after
centrifugation. Each crude extract was diluted 1:3 with PBS buffer and 100 ul of the
dilution were loaded onto anti-CCMV coated wells. Elisa was performed as described in
the materials and methods section
88
The ELISA result indicated the absence of chimeric viral particles in the crude
extract when compared with wild type inoculation. The crude extracts were then studied
by transmission electron microscope for the presence of viral particles. Virus particles
were seen following inoculation with constructs encoding wild-type virus, but not with
the chimeric constructs (not shown). The RNA from each construct was in vitro
translated to assure that each construct was capable of expressing a translated protein.
The CCMV-S9 plasmid constructs, pCC3-63-S9, pCC3-102-S9, pCC3-114-S9, pCC3129-S9 and pCC3-161-S9, encoding recombinant S9-coat protein gene were PCR
amplified using primer, which contained T7 RNA polymerase promoter element. The
PCR amplified fragments were quantified and visualized by gel electrophoresis (Figure
2.5).
Figure 2. 5 Introduction T7 RNA Polymerase to pCC3 Recombinant DNA
The CCMV-S9 plasmid constructs, pCC3-63, pCC3-102, pCC3-114, pCC3-129, and
pCC3-161 were PCR amplified to introduce T7 RNA polymerase promoter to the 5’ end
of amplified products. From left to right are 1kb DNA marker, pCC3-wt, pCC3-63,
pCC3-102, pCC3-114, pCC3-129, pCC3-161 and negative control (water).
Chimeric CCMV-S9 RNA was in vitro transcribed from PCR products by using
T7 mMessage mMachine (Ambion, Austin, TX) resulting in 5’ capped mRNAs. The
chimeric CCMV-S9 RNAs were then in vitro translated using cell free wheat germ
89
extract translation kit (Promega, Madison, WI). Radioactive (S35)methionine was
incorporated into the reaction. The proteins then were visualized by using gel
electrophoresis and autoradiography (Figure 2.6).
pCC3-wt 61-S9
102-S9
114-S9
!29-S9
161-S9
Figure 2. 6 In vitro Translation of RNA Construction.
The RNA from each construct was able to be in vitro translated resulting in
CCMV coat protein-S9 product. This data assured that each construct is capable of
expressing a translated protein. All these data indicated that the insertion of the S9
peptide into extended loops of the CCMV viral capsid protein may inhibit viral
production in its natural host, the cow pea plant.
Yeast Expression System
Due to our failure to express infectious CCMV-S9 chimeras in plants, which are
the natural host, we chose a yeast expression system as an alternative method to create
chimeric CCMV-S9 capsids. The Pichia expression system has been used widely to
express high levels of heterologous proteins and intact virions (320, 323-325). Pichia
90
pastoris is a methylotrophic yeast cable of using methanol as a sole carbon source. It
contains the AOX1 gene responsible for alcohol oxigenase activity in the cell. We
subcloned cDNA of RNA3-wt and RNA3-S9 from each loop construct to the Pichia
expression vector, pPicZA. The insertion of recombinant and wt cassettes was
accomplished in two steps. First, the genes for the RNA3s encoding wt and recombinant
constructs were PCR amplified from the pCC3 recombinant clones, and EcoR1 and Sal1
restriction enzyme sites added to the ends of the sequences during the PCR. The PCR
products were verified by gel electrophoresis (Figure 2.7) and DNA sequencing analysis.
The slight band shifts indicated the different size between wt and CCMV-S9 construct.
Then the PCR products were digested with enzymes EcoR1 and Sal1.
1 kb
wt
63-S9
102-S9
114-S9
129-S9
161-S9
Figure 2. 7 Introduction EcoR1 and Sal1 Restriction Enzyme Sites to the Ends of pCC3wt, pCC3-63-S9, pCC3-102-S9, pCC3-114-S9, pCC3-129-S9 and pCC3-161-S9 by PCR
From left to right are 1 kb DNA marker, pCC3-wt, pCC3-63-S9, pCC3-102-S9, pCC3114-S9, pCC3-129-S9 and pCC3-161-S9
91
Second, the digested products were ligated into prepared pPicZA vector, which
was cut with EcoR1 and Xho1 and dephosphorylated with CIP. The constructs were
linearized by using Kpn1 restriction endonuclease to reduce negative clones. The Kpn1
cut only the plasmid vector not recombinant plasmids. The recombinant plasmids were
transformed into E. coli competent cells. Positive recombinant clones were verified by
PCR (Figure 2.8). Clones, which have same size PCR products as positive control pCC3161-S9 were selected and sent for DNA sequencing analysis. The positive recombinant
clones were named pPicZa 63-S9, pPicZa 102-S9, pPicZa 114-S9, pPicZa 129-S9, and
pPicZa 161-S9.
Figure 2. 8 PCR Products from Positive Recombinant E. coli Clones
From left to right are 1 kb DNA marker, positive control from pCC3-161-S9, pPicZa 63S9, pPicZa 102-S9, pPicZa 114-S9, pPicZa 129-S9, pPicZa 161-S9 and negative control
(water)
Next, the positive recombinant plasmids were extracted and linerized with Sac1
and then electroporated into Pichia pastoris competent cells. The Zeor transformants were
92
selected after 2-3 days growth on YPDS agar plates containing Zeocin 0.1 mg/ml. Direct
PCR-based screening of clones was performed as described in the Materials and Methods
section. PCR products were visualized by agarose gel electrophoresis (Figure 2.9) and
then sent for DNA sequencing analysis to confirm positive clones.
Figure 2. 9 PCR Products from Recombinant Yeast Pichia pastoris Chromosomal DNA
Transformants from YPDS plates containing Zeocin were selected and PCR amplified by
using primers 20 and 21. From left to right are DNA marker 1kb, PCR product from
pPicZa wt transformant (kindly provided by Young lab), recombinant pPicZa 63-S9,
pPicZa 102-S9, pPicZa 114-S9, pPicZa 129-S9, pPicZa 161-S9 transformants and pPicZa
wt transformant.
To show that cloning of CCMV-S9 DNA inserts into pPicZa plasmid was in
frame and able to express CCMV-S9 coat protein, in vitro translation was performed. The
yeast positive clones containing pPicZa 63-S9, pPicZa 102-S9, pPicZa 114-S9, pPicZa
129-S9, and pPicZa 161-S9 respectively, were PCR amplified using upstream primer,
which contained a bacterial phage T7 RNA polymerase promoter element and a start
codon. Chimeric CCMV-S9 RNA was in vitro transcribed from PCR products by using
T7 mMessage mMachine (Ambion, Austin, TX). Resulting 5’ capped mRNAs were then
93
in vitro translated using cell free wheat germ extracts translation kit (Promega, Madison,
WI). The proteins then were visualized by using gel electrophoresis and autoradiography
(Figure 2.10). The result showed that the cloning of CCMV-wt and recombinant CCMVS9 into Pichia plasmids were in frame and capable of being translated in vitro.
Positive pCC3-wt
61-S9 102-S9 114-S9 129-S9 161-S9
Figure 2. 10 In vitro Translation from pPicZa-pCC3-S9 Constructs
The ability of the positive yeast clones to express CCMV coat protein was
investigated. The expression of CCMV-S9 coat proteins in transformed yeast was
analyzed by adding methanol as inducer. Methanol induces the alcohol oxidase (AOX)
promoter, which controls expression of integrated coat protein construct. Small scale time
course experiments were created to observe the ability of recombinant yeasts to express
chimeric CCMV-S9 coat protein. As described in the Materials and Methods section, the
positive recombinant yeast clones were cultured in 25 ml MGY medium at 30°C for 18 h
250 rpm as inoculums for small scale time course experiments. Then, the cells were
harvested by centrifugation and washed with MM medium and resuspended in 150 ml
MM medium. The inducer of gene expression, 100% methanol, was added to the culture
94
at 24 h intervals. Samples were collected every day for 7 days. Dot blot analysis was
applied to evaluate protein expression (Figure 2.11).
1
Day
2
3
4
5
6
7
CCMV
Pichia wt
63-S9
102-S9
114-S9
129-S9
161-S9
Figure 2. 11 Small Scale Time Course Protein Expression by Dot Blot Analysis
Recombinant yeast expressing chimeric CCMV coat protein 63-S9, 102-S9, 114-S9, 129S9 and 161-S9 were cultured for 7 days in methanol inducing medium. Culture samples
were collected each day. Samples were centrifuged and resuspended in 100 ul SDS gel
loading buffer. The cell suspensions were boiled for 10 min and cooled down in an ice
tub. Samples were centrifuged. 3 ul of supernatants were dotted onto the nitrocellulose
membrane. The samples from first horizontal lane to last horizontal lane are
nontransformed Pichia wt, transformed yeast with CCMV 63-S9 102-S9, 114-S9, 129-S9
and 161-S9 respectively. From left to right, they are transformed yeasts or yeast-wt on
day 1 to day 7 respectively and the last lane is the positive control 0.5 ug/ml of CCMVwt purified from yeast, kindly provided from Young lab. The membrane was blocked
with blocking buffer at 4°C over night. After washing with washing buffer, membrane
was incubated with anti-CCMV antibody 1/5000 dilution and finally 1/1000 Horseradish
peroxidase-conjugated anti-rabbit antibody. Colorimetric detection was developed.
The dot blot result indicated that there was no CCMV protein detected from any
CCMV-S9 construct, but we easily detected product from the CCMV wild-type
95
construct. The undetectable product in the dot blot may result from insufficient CCMV
protein in samples. Western blot analysis with anti-CCMV antibody was performed using
the same samples from day 7 (Figure 2.12).
1
2
3
4
5
6
7
8
9
1
2
3
4
5
6
7
8
9
Figure 2. 12 Silver Staining and Western Blot Analysis of Small Scale Expression
Experiment in CCMV-S9 Transformed Yeasts
Recombinant yeasts expressing chimeric CCMV-S9 coat proteins, 63-S9, 102-S9, 114S9, 129-S9 and 161-S9 and CCMV-wt coat protein were cultured in methanol- inducing
media for 7 days as described in the Materials and Methods section. Samples were
collected at day 7. Cell pellets from 1.5 ml cultures were resuspended in SDS loading
buffer and boiled for 10 min and placed on ice. Samples were centrifuged and 5 ul of
CCMV-wt and 20 ul of CCMV-S9 were loaded into 2 of 10% SDS PAGE gels. From left
to right, samples are CCMV-wt day 6, CCMV-wt day 7, high molecular weight marker,
63-S9 day 7, 102-S9 day 7, 114-S9 day7, 129-S9 day 7, 161-S9 day 7 and 161-S9 day 6.
One gel was visualized by silver staining and the other was analyzed by western blot
analysis using anti-CCMV antibody 1/5000 as primary antibody and mouse anti-rabbit
IgG-HRP as secondary antibody. Colorimetric detection was developed.
The western blot result indicated that recombinant CCMV proteins were
expressed in each construct. However the expression yield of the S9 constructs might
have been too low to be detected by dot blot analysis. CCMV wt cassette was expressed
in higher yields, compared to the chimeric constructs. To prepare sufficient CCMV-S9
96
chimeric protein, a medium scale culture of 500 ml for 7 days was performed. Five
positive recombinant Pichia clones (pCC3-63, pCC3-102, pCC3-114, pCC3-129 and
pCC3-161) were cultured in non-methanol media, MGY for 24-48hs at 30 °C with 250
rpm incubation shaker, and then transferred to methanol-induced medium for 5 days.
Yeast cells were harvested by centrifugation and CCMV-S9 coat proteins were purified
from yeast cells. Samples were collected from each step of purification process for dot
blot analysis (Figure 2.13). Dot blot analysis showed that most of the CCMV-S9
construct was associated with the cell pellet. However, with the yeast transformed with
CCMV 161-S9, a detectable amount of CCMV-S9 can be visualized in the final
purification step. Samples from each purification step were observed for the presence of
viral particles by transmission electron microscopy. We could not detect any chimeric
virus particles at any step of the purification but we could detect CCMV wt viral particle
from the final purification step. The dot blot and EM data suggest two explanations. The
first is that the purification protocol was not optimized resulting in less sensitive
detection of proteins. The second is that the low production of protein may be the result
of inappropriate conditions in cell growth or protein production resulting in less biomass
or desired protein at the start of the purification process. A high density fermentation
culture was introduced to circumvent this obstruction.
97
CCMV 63-S9
1
2
3
4
5
+
CCMV 102-S9
1
2
3
4
5
CCMV 129-S9
1
2
3
4
5
+
CCMV 114-S9
1
2
3
4
5
+
+
CCMV 161-S9
1
2
3
4
5
+
Figure 2. 13 Medium Scale CCMV-S9 Coat Protein Expression Experiment
Recombinant yeasts expressing CCMV-S9 coat protein were cultured in non-methanol
medium for 2 days and transferred to methanol-inducing medium for 5 days. Cells were
harvested and kept in -80 ºC for viral purification. Samples of each purification step were
collected for dot blot analysis. Frozen cells were lysed by adding acid-washed glass beads
in equal volume virus buffer. The mixture was vortexed vigorously. Cell debris and glass
beads were separated by centrifugation at low speed. Cell debris (sample1) was kept in 80 ºC. The supernatant (sample2) was mixed with PEG 8000. The mixtures were stirred
slowly overnight at 4 °C, centrifuged and the supernatant (sample 3) stored at -80 ºC. The
pellets were resuspended in virus buffer. Mixtures were briefly centrifuged with low
speed. The pellets (sample 4) were stored at -80 ºC and the supernatants (sample 5)
containing virus were kept in -80°C for further analysis. Collected samples (number 1 to
5) were mixed with SDS loading buffer and boiled for 10 min and immediately put in an
ice tub. Then 10 ul of each sample were loaded onto nitrocellulose membranes. The
membranes were blocked with blocking buffer. Then the sample dots were determined by
anti-CCMV antibody dilution 1/5000 as a primary antibody and anti-rabbit IgG-HRP
dilution 1/1000 as a secondary antibody. Colorimetric detection was developed. The
symbol + represents a CCMV-wt positive control purified from yeast cells.
98
Yeasts transformed with pcc3-161-S9 were picked to culture in the fermenter
because they showed the highest protein expression in the small scale time course
experiment and also the medium scale experiment. The fermentation method followed the
Invitrogen Pichia fermentation process guidelines and the details are described in the
Materials and Methods section.
Cells from the fermenter were harvested by centrifugation and divided into 100 g
aliquots and kept at -80 ºC. Samples from each viral purification step were loaded onto
nitrocelluose membranes for dot blot analysis with anti-CCMV antibody (Figure 2.14).
Dot blot analysis indicated that 161-S9 chimeric protein was mostly maintained in the
yeast cell debris (Figure 2.14, sample 1). The chimeric construct can be detected in later
purification steps. However, it was still associated with pellet as seen in the dot blot
analysis. The construct was found to associate with the DEAE particles in the filter cake,
(Figure 2.14: sample 3 and sample 8). Even at the final step of viral purification, the dot
blot analysis indicated that construct was associated with the pellet, (Figure 2.14, sample
11). This data shows that the association between the chimeric CCMV-S9 construct and
the pellet or yeast cell debris was strong. A smaller amount of the chimeric construct was
found in later purification step.
In order to dissociate chimeric CCMV-S9 construct from cell debris and pellet,
urea was applied at the first step of virus purification. The presence of 2 M urea during
the breaking of yeast cell was expected to increase recombinant viral protein solubility
and disrupt noncovalent association between the viral coat protein and yeast cell debris.
As shown in figure 2.15, most of the chimeric protein was still in the cell pellet.
99
1
2
3
6
7
8
9
10
+
+
-
11
4
5
Figure 2. 14 Large Scale CCMV-S9 Chimeric Construct Expression Experiment
The recombinant yeast clone, CCMV 161-S9, was cultured in the fermenter. Cells were
harvested by centrifugation and lysed by grinding vigorously with acid-washed glass
beads in a bead-beater in the presence 50mMTris-HCl buffer pH 6. Beads and cell debris
(sample 1) were separated by centrifugation. Supernatant (sample 2) was used for further
steps. DEAE was added to the supernatant. The mixture was stirred slowly at 4°C for 2 h.
The mixture was then filtered and the filtrate (sample 4) was kept at -80°C for the dot
blot analysis. The filter cake was washed twice with the Tris buffer. The filtrate after the
first wash and the second wash were mixed together (sample 5) and kept at -80°C for the
dot blot analysis. The filter cake (sample 3) was resuspended in virus buffer supplement
with 0.5 M NaCl. The suspension was filtered and the filtrate (sample 6) was collected.
The filter cake was resuspended again with the virus buffer. The suspension was again
filtered. The filtrate (sample 7) was collected and pooled with the filtrate from earlier step
(sample 6). The filter cake (sample 8) was kept at -80°C for the dot blot analysis. The
pooled filtrate was centrifuged at 25 krpm for 2 h. The supernatant (sample 9) was kept at
-80°C for the dot blot analysis and the pellet was resuspended in the virus buffer. The
mixture was centrifuged briefly at low speed to remove impurities. The supernatant
(sample 10), which was supposed to contain virus and the pellet (sample 11) was kept at 80°C for the dot blot analysis. Collected samples (number 1 to 11) were mixed with SDS
loading buffer and boiled for 10 min and immediately put in an ice tub. Then 10 ul of
each sample were loaded onto a nitrocellulose membrane. The membranes were blocked
with blocking buffer. Then the sample dots were detected by anti-CCMV antibody and
anti-Rabbit IgG-HRP. Colorimetric detection was developed. The symbol + represents a
CCMV-wt positive control purified from yeast cells. The symbol – represents a non
transformed yeast wt as negative control.
100
Anti-CCMV antibody
Without Urea
1
2
3
7
4
5
6
8
9
10
11
12
2M Urea
1
2
3
4
5
6
7
9
10
11
CCMV
+
8
yeast
-
S9
S9
S9 antibody
Without Urea
1
2
3
4
5
6
8
9
10
11
12
2M Urea
1
2
3
4
5
6
7
9
10
11
7
8
CCMV yeast
-
S9
+
S9
+
Figure 2. 15 Virus Purification with or without the Presence of Urea
Cells were lysed by grinding vigorously with acid-washed glass beads in a bead-beater in
the presence 50mMTris-HCl buffer pH 6 without 2 M Urea (upper panel) or with 2 M
urea (lower panel). Beads and cell debris (sample 1) were separated by centrifugation.
Supernatant (sample 2) was used in further steps. DEAE was added to the supernatant.
The mixture was stirred slowly at 4°C for 2 h. The mixture was then filtered and the
filtrate is sample 4. The filter was washed with the Tris buffer twice. The filtrate after the
first wash and the second wash were mixed together (sample 5). The filter cake (sample
3) was resuspended in virus buffer supplemented with 0.5 M NaCl. The suspension was
filtered and the filtrate (sample 6) was collected. The filter cake was resuspended again
with the virus buffer. The suspension was again filtered. The filtrate (sample 7) was
collected and pooled with the filtrate from earlier step (sample 6). The filter cake was
sample 8. The pooled filtrate was centrifuged at 25 krpm for 2 h. The supernatant was
saved (sample 9) and the pellet was resuspended in the virus buffer. The mixture was
centrifuged briefly at low speed to remove impurities. The supernatant (sample 10),
which was supposed to contain virus and the pellet (sample 11) was kept at -80°C for the
dot blot analysis. Collected samples (number 1 to 11) were mixed with SDS loading
buffer and boiled for 10 min and immediately put in an ice tub. Then 10 ul of each
sample were loaded onto a nitrocellulose. The membranes were blocked with blocking
buffer. Then the sample dots were determined with anti-CCMV antibody and anti-rabbit
IgG-HRP or 5 ug/ml S9 antibody and anti-mouse IgM-AP (right panel). Colorimetric
detection was developed. The symbol + represents a CCMV-wt purified from yeast cells
using the same protocol with the absence of urea. The CCMV-wt sample at final step was
collected for the dot blot analysis with anti-CCMV antibody. The symbol – represents
crude extract from a non transformed yeast wt as a negative control. S9 peptide
concentration 0.2 ug/ml and 0.02 ug/ml were loaded onto the membrane as positive
controls for the dot blot analysis with S9 antibody.
101
The presence of 2 M urea during the breaking of yeast cells was expected to
increase recombinant viral protein solubility and disrupt noncovalent association between
the viral coat protein and yeast cell debris. As shown in figure 15, most of the chimeric
protein was still in the cell pellet. The presence of urea did not affect the interaction
between the chimeric construct and cell debris. CCMV-S9 viral particles could not be
obtained from the purification with or without urea application. Dot blot analysis with S9
mAb indicated that CCMV-S9 construct can be expressed but was found in the pellet
with cellular debris. On the other hand, the CCMV wt construct could be obtained easily
with the same protocol even without urea. These data indicated that the chimeric CCMVS9 construct can be expressed but cannot be separated from yeast cell debris or pellet
particles, probably because it failed to form intact virus-like particles, but rather
aggregates and precipitates.
Samples from each purification step were observed for the presence of viral
particles by transmission electron microscopy. We could not detect any chimeric virus
particles at any purification steps, whereas wt CCMV viral particle was observed in final
step purification (figure 2.16)
These results demonstrated that chimeric coat proteins fail to assemble virus-like
particles, just as they failed to assemble infectious virions during plant expression.
Because we are able to produce both infectious virions, and virus-like particles with wildtype constructs, we believe that these results clearly demonstrate the inability of the
CCMV carrying the S9 epitope to assemble a functional capsid.
102
To present the S9 peptide on a viral particle, chemical linkage of S9 peptides to
CCMV viral particles was pursued in our next experiment.
Figure 2. 16 CCMV-wt Viral Particle
Yeast cells transformed with CCMV-wt construct were lysed by the method described in
the Materiasl and Methods section. Next the suspension containing CCMV virus was
purified with 38% (w/v) isopycnic CsCl2 density gradient by centrifuging at 38000 rpm
for 20 h (Beckman, SW41). The virus band was collected and dialyzed against virus
buffer. Viral concentration and purity were determined by measuring UV absorbance
ratio Abs260/280 (Abs260/280 =1.5-1.7 considered good, 1Abs260 = 5.87) and observed under
transmission electron microscope (TEM).
Chemical Linkage
To present peptide S9 on the surface of the CCMV virion, we first applied a
chemical method to conjugate S9 peptide to CCMV through disulfide formation. Thus we
introduced an additional C-terminal cysteine residue to the S9 peptide, creating a thiol
group for disulfide linkage. Mutant CCMV, A163C, which has Cys instead of original
Ala at position 163, was chosen for use. The coupling reaction was performed as
described in the Materials and Methods section. The coupling products were loaded onto
SDS non-reducing gels and visualized by silver staining (Figure 2.17). CCMV A163C
mutant strain virus can conjugate with S9 peptide through disulfide bond formation. The
103
oxidizing agent CuSO4 can cause a minor improvement of the chemical reaction. The
problem experienced with this cross-linking method is that the conjugation product was
aggregated. The aggregation occurred when the product was left at 4°C in the virus
buffer. The aggregation reaction may be the result of continuous covalent disulfide bonds
forming between viruses. The insoluble conjugation product could not be utilized in the
vaccination, which is our purpose. Heterobifunctional linkers, sulfo-smcc and spdp were
then introduced in the experiment to crosslink CCMV to the S9 peptide and circumvent
the aggregation problem.
CCMV
CCMV-S9
CCMV
CCMV-S9
+ CuSO4
Crosslinking
product
{
{
Figure 2. 17 Cross-Linking between Cys of S9 and Cys of Mutant A163C
CCMV mutant, A163C, 0.5 mg/ml, 2 ml was mixed with S9 peptide 0.5 mg/ml, 2 ml in
the presence or absence of 40 ul 1 M CuSO4. The mixture was incubated at room
temperature for 2 h. 10 ul of the mixture were mixed with 10 ul SDS PAGE gel buffer
without mercaptoethanol and boiled for 10 min and then placed in the ice tub
immediately. 10 ul of the sample were loaded into 12% nonreducing SDS PAGE gel.
From left to right are mutant A163C, the cross-linked A163C-S9 without CuSO4, the
cross-linkedA163C without S9 peptide, and the A163C-S9 with CuSO4.
104
The spdp linker is composed of a N-hydroxysuccinimide (NHS-ester) group and
2-pyridyldithil group (Figure 2.1). The NHS-ester will react with lysine associated
amines of the CCMV coat protein leading to a conjugation product via amide bond
formation. The reaction occurs at pH 7-8. Thus CCMV wt is not suitable for conjugation
because it is only stable at a low pH (pH4) (317). The salt stable CCMV mutant
(ssCCMV), which can tolerate a high pH and high ionic strength (319) was used in the
experiment instead of CCMV wt.
The ssCCMV virus was first conjugated to S9 by using the spdp linker. ssCCMV
was mixed with 3-fold molar excess to CCMV at pH 7.5 and the S9 peptide with 50-fold
molar excess of spdp. The pH of the reaction was adjusted to be pH6.5 and was
performed at room temperature for 1.5 h. The conjugation product was visualized by
silver staining and characterized by western blot analysis (Figure 2.18).
1
2
3
1
2
1 = ssCCMV
2 = ssCCMV-spdp-S9 2 ul
3 = ssCCMV-spdp-S9 5 ul
Figure 2. 18 Product of ssCCMV and S9 Peptide Cross-Linked via the spdp Linker.
ssCCMV and S9 were conjugated via the linker spdp. The conjugation products were
loaded onto 12% SDS-PAGE and visualized by silver staining or transferred to
nitrocellulose membranes for western blot analysis with CCMV antibody
105
The silver staining and western blot result indicated that the ssCCMV was
conjugated to S9 peptides via the spdp linker. The extra bands seen in the western blot
analysis reflects the conjugation products.
Since primary amine reacts with NHS-ester at pH 7-9, to get the best coupling
reaction, we performed an experiment with two different pH conditions, 7 and 7.5. We
also varied the concentration of spdp linkers to be 1, and 2-fold molar excess to CCMV
virus. The conjugation products were loaded into SDS-PAGE gel and visualized by silver
staining (Figure 2.19). A greater degree of coupling was observed at pH 7.5and more
cross-linked products were obtained when the spdp linker was equimolar to the virus.
1
2
3
4
1 = ssCCMV 1000 ng
2 = ssCCMV-2x spdp –S9 pH 7.5
3 = ssCCMV-2x spdp –S9 pH 7
4 = ssCCMV-1x spdp –S9 pH 7.5
Figure 2. 19 The Conjugation Product of ssCCMv-S9 via spdp Linkers at Different pH
Conditions and Different spdp Concentrations.
The spdp linkers were used in 1 or 2-fold molar excess to CCMV. The reaction between
the linkers and viruses was performed at pH 7 or 7.5 (pH of reactions was adjusted by
adding NaH2PO4 1 M pH 9 for 1 hr at room temperature in the shaker. The conjugation
products were loaded onto 12% SDS-PAGE and visualized by silver staining.
We next performed coupling experiments with different S9 peptide concentrations
to analyze if concentration of peptide affects the coupling reaction resulting in more, or
less, CCMV-S9 conjugation product (Figure 2.20). Different concentrations of S9
106
peptide, 0.5,1, 10, 20, 30, 40 and 50-fold molar excess to CCMV were separately added
to the spdp-CCMV derivatized and the pH of reaction was controlled at 6.5. Adding
peptides at less than 10-fold molar excess to CCMV reduced the cross linking reaction.
Using a 10-fold molar excess of peptide to CCMV seemed optimal since a 50-fold molar
excess of peptide to CCMV did not provide a better yield of cross-linked material.
1
2
3
4
5
6
7
8
9
1 = ssCCMv
2 = ssCCMV-spdp
3 = ssCCMV- spdp - 0.5x S9
4 = ssCCMV- spdp - 1x S9
5 = ssCCMV- spdp - 10x S9
6 = ssCCMV- spdp - 20x S9
7 = ssCCMV- spdp - 30x S9
8 = ssCCMV- spdp - 40x S9
9 = ssCCMV- spdp - 50x S9
Figure 2. 20 ssCCMV-S9 Conjugation Products via spdp Linkers at Different Peptide
Concentrations
The ssCCMV was incubated with the fresh prepared spdp linker at 1:1 molar ratio. The
reaction was allowed to continue at room temperature pH 7.5. After 1 h, the reaction was
stop by incubating with 1.5 M hydroxylamine pH 8.5 for 1 h. Different concentrations of
S9 peptide were used in 0.5, 1, 10, 20, 30, 40 and 50-fold molar excess to CCMV. The
reactions were allowed to continue at room temperature for 1.5 h. 5 ul of reaction sample
was mixed with 5 ul of SDS loading buffer without β-mercapto ethanol and boiled for 10
min and placed on ice. The samples were loaded onto 12% SDS-PAGE and visualized by
silver staining.
The CCMV-S9 conjugates were next characterized by sucrose gradient
sedimentation. The ssCCMV-spdp-S9 conjugates were overlaid on the top of a 5-25%
sucrose density gradient and sedimented. The gradients were manually fractionated and
test samples loaded onto SDS-PAGE (Figure 2.21).
107
A
B
M ss 1
3 5
7
9 11 13 15
M ss-S9 1
3 5
7
9 11 13 15
C
M
ss 17
19 21 ss-S9 17 19 21
Figure 2. 21 Characterization of CCMV-S9 by Sucrose Gradient Sedimentation
ssCCMV was incubated with freshly prepared spdp linker at a 1:1 molar ratio. The
reaction was allowed to continue at room temperature pH 7.5. After 1 h, the reaction was
stopped by incubating with 1.5 M hydroxylamine pH8.5 for 1 h. S9 peptides were used in
10-fold molar excess to CCMV. The reactions were allowed to continue at room
temperature for 1.5 h. 500 ul of the conjugation product, and unconjugated ssCCMV
virions were loaded 5-25% sucrose gradients and centrifuged at 37,000 rpm for 3 h. The
gradients were fractionated 1 ml/fraction (21 fractions/tube). 10 ul of odd numbered
fractions were mixed with SDS loading buffer without β-mercapto ethanol and boiled for
10 min, loaded onto 12% SDS-PAGE, and visualized by silver staining. The odd number
fractions, 1-15, from ssCCMV were loaded onto gel A. The odd numbered fractions, 115, from ssCCMV-spdp-S9 conjugate were loaded onto gel B. The remaining odd
number fractions, 17-21, from ssCCMV were loaded into the first half of gel C and the
remaining odd number fractions, 17-21, from ssCCMV-spdp-S9 were loaded into the
second half of gel C (C figure). The ss indicates ssCCMV mutant and ss-S9 indicates
ssCCMV-spdp-S9 conjugates. M indicates protein molecular weight marker.
108
The ssCCMV nonconjugate virion fell in the middle of the gradient (fraction 911), whereas the CCMV-S9 conjugate fell in the bottom of the gradient (fraction 21). The
result indicated that the conjugation product exhibited higher sedimentation velocities
compared to the unconjugated ssCCMV particles. These higher sedimentation velocities
of the conjugated particles probably indicate that the conjugated particles aggregated
together. This may result from unexpected disulfide bond exchanging between
derivatized CCMV (CCMV-spdp) (Figure 2.1), thus causing aggregation that results in
different sedimentation velocities.
To attain coupling of S9 to CCMV without aggregation, the mutant CCMV, subE,
was used. SubE is a CCMV mutant stain, in which eight basic amino acid residues (K and
R) of the N-terminus were replaced with the acidic residue glutamic acid (E) (320).
Conjugation to SubE virions leads to efficient viral disassembly (unpublished data). The
SubE-S9 construct serves as a control for the effect of fully assemble virus, since it
represents the peptide conjugated to a monomer form of virus coat protein. Thus we
conjugated SubE to S9 via spdp linkers at 1:1 molar ratio of spdp:CCMV. The reaction
was allowed to continue at room temperature pH 7.5, 1 h, and stopped by incubating with
1.5 M hydroxylamine pH8.5 for 1 h. The S9 peptides were used in 10-fold molar excess
to SubE. The reactions were allowed to continue at room temperature for 1.5 h. The
subE-S9 conjugates were visualized by SDS-PAGE analysis and analyzed by western
blot analysis (Figure 2.22). The conjugated SubE-S9 products were able to be detected
by western blot analysis against anti-CCMV antibody.
109
SubE
SubE-S9
SubE
SubE-S9
Figure 2. 22 Conjugation between SubE and S9 via spdp Linkers
SubE CCMV and S9 were conjugated via the linker spdp. The conjugation products were
loaded onto the 12% SDS-PAGE and visualized by silver staining or transferred to the
nitrocellulose membrane for western blot analysis. Anti CCMV antibody and enzyme
conjugated mouse anti rabbit IgG antibody were used in the western blot.
SubE-S9 conjugates were next characterized by sucrose gradient sedimentation.
The SubE-spdp-S9 conjugates were overlaid on the top of 5-25% sucrose gradients
andsedimented. The gradients were manually fractionated and loaded onto SDS-PAGE
(Figure 2.23). The unconjugated SubE virions fell in the middle of the gradient (fraction
5-7). The SubE-S9 conjugate fell in the first fraction of the gradient (fraction 1). This
result indicated that cross linking SubE with S9 peptide via the spdp linker caused the
virus to fall apart. Thus the conjugation product from SubE is capsid protein subunit
conjugated to the S9 peptide. The result was confirmed by observation of virus under
EM. We could not see any particles from SubE-S9 conjugate.
110
A
M
B
SubE 1
3
5
7
9
11 13
M SubE-S9 1
3
5
7
9 11 13
Figure 2. 23 Conjugation Product SubE-spdp-S9 in Sucrose Gradient Velocity
The SubE was incubated with the fresh prepared spdp linker at a1:1 molar ratio. The
reaction was allowed to continue at room temperature pH 7.5. After 1 h, the reaction was
stopped by incubating with 1.5 M hydroxylamine pH8.5 for 1 h. The S9 peptides were
used in 10-fold molar excess to CCMV. The reactions were allowed to continue at room
temperature for 1.5 h. 500 ul of the conjugation product and or unconjugated SubE were
loaded on 5-25% sucrose gradients and then centrifuged at 37,000 rpm for 3 h. The
gradients were fractionated 1 ml/fraction (21fractions/tube). 10 ul of odd numbered
fraction were mixed with SDS loading buffer without β-mercapto ethanol and boiled for
10 min, loaded onto 12% SDS-PAGE and visualized by silver staining. The odd number
fractions, 1-13, from SubE were loaded into gel A from the third lane (one lane apart
from the protein molecular weight marker, to prevent contamination from reducing buffer
β-mercapto ethanol contained in the markers). The odd numbered fractions, 1-13, from
SubE-spdp-S9 conjugate were loaded into gel B from the third lane (one lane apart from
the protein molecular weight marker.
Another linker sulfo-smcc was introduced to replace the spdp linker to create nonaggregated ssCCMV-S9 particles. The sufo-smcc linker is composed of an NHS ester
111
group and maleimide group. As with the spdp linker, the NHS ester group reacts with a
primary amine in the CCMV coat protein, likely lysine. The amide bond is formed,
releasing N-hydroxysuccinimide (Figure 2.2). The maleimide group reacts with thiol
group of the peptide when the pH of the reaction mixture is maintained between 6.5 and
7.5. To preclude the aggregation between virus particles through the disulfide linkage that
might occur during the amide bonding, the ssCCMV was treated with tris (2carboxyethyl) phosphine (TCEP) to a final concentration of 50 mM. The TCEP reduces
the disulfide formation without affecting the other protein functional groups in the virus,
especially free amines. To assure that all disulfide bonds were reduced the ssCCMV was
treated with 2-iodoacetamide (IA), an alkylating sulfhydryl reagent. The IA binds
covalently with cysteine on the virus. Thus there was no available cys from the virus to
react with the maleimide group. Cross-linking between ssCCMV and S9 was performed
with or without the IA treatment (Figure 2.24).
Figure 2.24 shows that treatment with 50 mM IA did improve the conjugation
result. With or without IA treatment, the virus can cross-link to the peptide via the sulfosmcc linker, resulting in the conjugated product. With IA treatment, a dimer aggregation
band did not occur. The result showed that pretreating ssCCMV with 2-iodoacetamide
reduced disulfide formation between the viruses resulting in less dimer product
formation.
112
Without iodoacetamide
M
ss
ss
ss ss
nIA nIA nIA
m m
sc
Dimer aggregation band
Conjugation band
ss
nIA
m
sc
m
ss
nIA
m
sc
m
S9
With iodoacetamide
M ss
ss
ss
IA
IA
m
sc
ss
IA
m
sc
ss
IA
m
sc
m
ss
IA
m
sc
m
S9
Conjugation band
Figure 2. 24 The Conjugation Products Between ssCCMV and S9 Peptide via Sulfo-smcc
Linker with and without Iodoacetamide Treatment (IA treatment)
ssCCMV (ss) in 20 mM NaH2PO4 pH 7.5 was treated with TCEP to a final concentration
of 50 mM at room temperature for 1 h. The 2-iodoacetamide (IA) 0.5 M was added to the
virus to 50 mM final concentration, and incubated at room temperature for 30 min. The
virus solution was purified to eliminate excess TCEP and the IA by using the microcon
100 (m). Virus was washed extensively with 20 mM NaH2PO4 pH 7.5 and eluted with the
same buffer. Fresh prepared sulfo-smcc (sc) linker was used in 50-fold molar excess to
the virus. After adding the linker, the pH of the reaction was remeasured and adjusted to
be 7.5 with 1 M NaH2PO4 pH 9. The reaction was for 1 h in room temperature. Lysine
was added to the reaction to have 1 mM final concentration and kept for 15 min at room
temperature to stop the reaction. The excess linker and lysine were removed by using
m100 and washed and eluted with the 20 mM NaH2PO4 pH 7.5. The S9 peptide was
pretreated with TCEP to a final concentration of 50 mM for 1 h at room temperature prior
to coupling with the derivatized virus. The pretreated S9 peptide was used in 50 molar
excess to the ssCCMV. The pH was controlled at pH 7 with 1 M NaH2PO4 pH 9. The
reaction of maleimides with thiols was for 1.5 h in room temperature. 5 ul of each step in
the cross-linking process was mixed with 5 ul of SDS loading buffer containing βmercapto ethanol and boiled for 10 min, loaded into 12% SDS-PAGE, and visualized by
silver staining.
113
We next asked if the incubating temperature and time period of the reaction
between the ssCCMV virus and the linker affects the coupling reaction. To answer the
question, the ssCCMV was treated with TCEP and IA before adding the linker. The
sulfo-smcc linker was used in 50-fold molar excess to the ssCCMV. The virus was
incubated with the linker in 2 conditions, at room temperature or at 4°C. The length of
incubation was 2, 6 or 24 h for the room temperature condition and 6, 12, 18 or 24 for the
4°C temperature condition. After removing excess linkers out of the solution by using
m100, pretreated S9 peptide with TCEP was added in 50-fold molar excess to the
ssCCMV. The conjugation product was analyzed by SDS-PAGE gel (Figure 2.25). The
silver staining data indicated that conjugation can occur in both condition. NHS reactions
with primary amine can occur in 6 h and reached the maximum in 12 h. Incubating the
virus with the linker for 24 h at room temperature pushed the NHS reaction, resulting in
multimer conjugation between the viruses. The reaction at 4°C slows the amide forming
reaction compared to the reaction at room temperature. The slower reaction rate allowed
the virus to conjugate as amonomer, since multimer coupling products cannot be detected
when the reaction was performed at 4°C. Performing the reaction at 4°C allowed more
selective amide formation than did performing the reaction at room temperature, and thus
prevented the formation of multimers.
114
Incubation at room temperature
M ss ss ft ss ss ft ss ss ss
IA
IA IA
IA IA IA
m m
m m m
sc2
sc2 sc2 sc6
m m
S9
M
ft
ss
IA
m
sc6
m
ss
IA
m
sc6
m
S9
ss ft
IA
m
sc24
ss
ss
IA IA
m
m
sc24 sc24
m
m
S9
Multimer coupling product
Incubation at 4°C
M ss ss ft ss ss ft
IA
IA IA
m m
sc6
ss
IA
m
sc6
m
ss ss
IA IA
m m
sc6 sc12
m
S9
M
ft
ss ss ss ss ss ss ss ss
IA IA IA IA IA IA IA IA
m m m m m m m m
sc12 sc12 sc18 sc18 sc18 sc24 sc24 sc24
m m
m m
m m
S9
S9
S9
Coupling product
Figure 2. 25 Time Course Experiment and Temperature Effect on Coupling Rreaction
The ssCCMV (ss) was treated with TCEP and IA before adding the linker. The sulfosmcc linker was used in 50-fold molar excess to the ssCCMV. The virus was incubated
with the linker in 2 conditions, at room temperature (upper panel) or at 4°C (lower panel).
The length of incubation was 2, 6 or 24 h (sc2, sc6 and sc24) for the room temperature
condition and 6, 12, 18 or 24 h (sc6, sc12, sc18 and sc24) for the 4°C temperature
condition and the reaction was stopped by adding lysine to final concentration 1mM.
After removing excess linkers out of the solution by using m100 (m), TCEP-treated S9
peptide was added at 50X molar excess to the ssCCMV. 5 ul of samples from each step
of cross-linking process were mixed with SDS loading gel buffer containing β-mercapto
ethanol and analyzed by SDS-PAGE gel. M is the protein molecular weight marker, ss
stands for ssCCMV, ft is the flow through after passing reaction solution through
microcon 100. The sc represents the linker sulfo-smcc and the number after sc represents
the incubation time length. For example, sc6 means incubating with the sulfo-smcc linker
for 6 h.
115
To ask if the linker concentration affected the cross-linking reactivity, different
concentrations of sulfo-smcc, (25, 50, 100 or 200-fold molar excess to the ssCCMV
virus), was added in the cross-linking reaction. The conjugation products were analyzed
by SDS-PAGE gel analysis (Figure 2. 26).
The primary lysines on the ssCCMV are shown to react with NHS-ester from
linker in a dose dependent manner causing different amounts of ssCCMV-sufo smcc-S9
conjugation products. Using the linker in 100-fold molar excess to the virus pushed the
reaction to the plateau. There was not much difference between using the linker in 100
and 200-fold molar excess to the virus. The derivatized ssCCMVs with a higher
concentration of sulfo-smcc linker (200-fold molar excess) were found in the flow
through in the step of passing the derivatized virus through the size-exclusion filter
microcon 100. However, with lower concentrations of linker, 25, 50 and 100-fold molar
excess, the derivatized ssCCMV-linker cannot be detected in the flow through. Based on
this result, the next experiment was performed by using the linker sulfo-smcc in 100-fold
molar excess to the ssCCMV virus.
To investigate if the S9 peptide concentration affected the cross-linking, different
concentrations of S9 peptide: 12.5, 25, 50, 100 or 200-fold molar excess to the ssCCMV
virus, were tested in the cross-linking reaction. The conjugation products were analyzed
by SDS-PAGE gel analysis (Figure 2.27).
116
M
M
ss
ss
IA
ss
ft
ss
IA
m
ss
IA
m
200sc
ss ft
IA
m
25sc
ft
ss
IA
m
25sc
m
ss
M ss ft ss ss ss ss ft ss ss
IA
IA
IA IA
IA
IA IA
m
m
m
m
m
m m
25sc
50sc
50sc 50sc
100sc 100sc 100sc
m
m
m
m m
S9
S9
S9
ss
ss
IA
IA
m
m
200sc 200sc
m
m
S9
Figure 2. 26 Effect of Different Concentration of Sufo-smcc: 25, 50, 100 and 200 Molar
Excess to the ssCCMV Virus in Cross-Linking Reaction
The ssCCMV (ss) was treated with TCEP and IA before adding the linker. The sulfosmcc linker was used in 25, 50, 100 and 200-fold molar excess to the ssCCMV. The pH
of reaction is 7. The virus was incubated with the linker at 4°C for 12 h and the reaction
was stopped by adding lysine to final concentration 1 mM. After removing excess linkers
out of the solution by using m100 (m), TCEP-treated S9 peptide was added at 50 molar
excess to the ssCCMV. 5 ul of samples from each step of cross-linking process were
mixed with SDS loading gel buffer containing β-mercapto ethanol and analyzed by SDSPAGE gel. M is the protein molecular weight marker. The ss stands for ssCCMV. The ft
is the flow through after passing reaction solution through microcon 100. The sc
represents the linker sulfo-smcc and the number before sc represents the concentration of
the linker in term of molar ratio excess to the ssCCMV. For example, 25sc means that the
linker was used in 25 molar excess to the ssCCMV virus.
117
Figure 2.27 indicated that using peptide in 12.5-fold molar excess to the virus
provided the least conjugation product. Using peptide in 50-fold molar excess to the virus
increased the reaction between the maleimide group of the linker and thiol group of S9
leading to high conjugation productivity. Adding more peptide than 50-fold molar excess
to the virus did not improve the conjugation.
ss
200
100
50
25
12.5
M
Figure 2. 27 Effect of Peptide Concentration on Cross-Linking
The ssCCMV (ss) was treated with TCEP and IA before adding the linker. The sulfosmcc linker was used in 100-fold molar excess to the ssCCMV. The pH of the reaction
was 7. The virus was incubated with the linker at 4°C for 12h and the reaction was
stopped by adding lysine to final concentration 1 mM. After removing excess linkers out
of the solution by using microcon100, TCEP-treated S9 peptide was used in 12.5, 25, 50,
100 or 200-fold molar excess to the ssCCMV. The reaction was performed at 4°C for 6
h. 5 ul of samples from each step of cross-linking process were mixed with SDS loading
gel buffer containing β-mercapto ethanol and analyzed by SDS-PAGE gel. From left to
right are ssCCMV (ss), coupling product with 200, 100, 50, 25, 12.5-fold molar excess to
the ssCCMV and the last lane is protein molecular weight marker (M).
118
The ssCCMV-sulfo smcc-S9 particle was characterized by sucrose gradient
sedimentation velocity. The ssCCMV was treated with TCEP and IA before adding the
linker. The sulfo-smcc linker was used in 100-fold molar excess to the ssCCMV, pH 7.
The virus was incubated with the linker at 4°C for 12h and the reaction was stopped by
adding lysine to final concentration 1 mM. After removing excess linkers out of the
solution by using microcon100, TCEP-treated S9 peptide was used in 50-fold molar
excess to the ssCCMV. The reaction was performed at 4°C for 6 h. The ssCCMV-sulfo
smcc-S9 conjugation products were loaded on to 5-25% sucrose gradient and sedimented.
The gradients were manually fractionated and loaded into SDS-PAGE gel (Figure 2.28).
The sucrose gradient data showed that ssCCMV-sulf smcc-S9 particles remained
intact and stayed as monomer virions, since they exhibited the same sedimentation
velocities as underivatized ssCCMV particles. The ssCCMV-sulf smcc-S9 particles were
observed under TEM, and particles were found.
Both conjugation products, SubE-spdp-S9 (Figure 2.22) and ssCCMV-sufo smccS9 (Figure 2.27), were purified by passing through size exclusion microcon 100 filters.
The conjugation products were washed several times with sterilized 20 mM NaH2PO4 pH
6. The SubE-S9 coat protein-peptide conjugation product and ssCCMV-S9 particle were
ready for the immunization experiment, which will be discussed in later chapters
119
A
ssCCMV
M ss
B
ssCCMV-sufo smcc-S9 conjugate
1
3 5
7
C
ssCCMV
M
ss
9 11
13 15
M ss-S9 1
3
5
7
9
11 13 15
ssCCMV-sufo smcc-S9 conjugate
17
19
21
ssS9 17 19 21
Figure 2. 28 Conjugation Product ssCCMV-sulfo-smcc-S9 in Sucrose Gradient
500 ul of the conjugation product and unconjugated ssCCMV virions were loaded on the
top of 5-25% sucrose gradients and then centrifuged at 37,000 rpm for 3 h. The gradients
were fractionated 1 ml/fraction (total 21 fractions/tube). 10 ul of odd numbered fractions
were mixed with SDS loading buffer without β-mercapto ethanol and boiled for 10 min,
loaded onto 12% SDS-PAGE and visualized by silver staining. The odd number
fractions, 1-15, from ssCCMV (ss) were loaded into gel A. The odd numbered fractions,
1-15, from ssCCMV-sulfo smcc-S9 conjugate (ss-S9) were loaded into gel B. The
remaining odd number fractions, 17-21, from ssCCMV were loaded into the first half of
gel C and the remaining odd number fractions, 17-21, from ssCCMV-sulfo smcc-S9 were
loaded into the second half of gel C. The ss indicates ssCCMV mutant, and the ss-S9
indicates ssCCMV-sufo smcc-S9 conjugates. M indicates protein molecular weight
marker.
120
Discussion
The use of plant viruses for recombinant protein expression has been studied
extensively, including for vaccine development. In our study, we used CCMV as the
model for the design of a new vector for protein expression. We describe in detail the
techniques that we used to prepare chimeric CCMV and also CCMV virus-like particles
(VLP). The X-ray crystal structure of CCMV reveals that viral coat protein has a core
structure consisting of an eight stranded, antiparallel β-barrel motif, with exposed loops
(326-328). The N-terminus and the C-terminus of the coat protein subunit extends in
opposite directions from the β-barrel motif and plays an important role in virion assembly
and stability (329-331). The CCMV coat protein can be expressed in E. coli and can be
assembled in vitro into either empty virions or in combination with viral RNA (329).
Based on three-dimension EM and X-ray crystal analyses, the Young lab identified
permissive sites on exposed loops of coat protein subunit for foreign DNA insertion.
Loop-specific BamH1 cloning sites, where peptides could be expressed on the virus coat
protein subunit, were created.
We initially inserted DNA to encode the S9-peptide (FDTGAFDPDWPA) within
the loop sequence. The S9 peptide is a mimotope of type III Streptococcus group B
capsular polysaccharide, which was shown to be both antigenic and immunogenic (1).
Recombinant RNA3 encoding the S9 peptide sequence was in vitro transcribed for plant
inoculation. Chimeric recombinant virus particles were expected after inoculating on
cowpea and tobacco plants. The ELISA results revealed that no intact chimeric particles
were obtained, whereas the wild-type CCMV particles did produce virus following plant
121
inoculation. In vitro translation demonstrated that inserts were in frame and could be
translated. Results of inserting other peptides: peptide 44, HIV mimetic peptide
(unpublished data) and peptide 11, cell-targeting peptide (332, 333), into CCMV exposed
loops were consistent with our results (unpublished data). However, insertion of peptide
11 in loop position 129 did yield recombinant virus, but with loss of infectivity. The
productive yield of CCMV-peptide 11 was low, and the plant infection was localized not
systemic. It has been shown that movement protein of CCMV depends on the coat
protein to mediate the cell-to-cell movement (334, 335). All data indicates that insertion
of a peptide sequence into CCMV exposed coat protein loops leads to disruption of the
coat protein structure and its ability to assemble. Insertion of peptides into viral coat
proteins to create antigenic chimeras has been demonstrated in icosahedral virus such as
poliovirus (296), human rhinovirus (297) and also cowpea mosaic virus (CPMV) (299).
With these viruses the difficulty arises with a limitation of the size of peptide that can be
inserted and the loss of insert after serial passaging; whereas for CCMV, viral assembly
appears to be blocked
The second attempt to present the S9 peptide incorporated into CCMV coat
protein was by creating self-assembling recombinant S9-viral coat protein in
heterologous systems resulting in procapsids called virus-like particles (VLP). We chose
P. pastoris as our heterologous expression system. Yeast requires methanol for protein
production and has been used to produce other VLPs such as bacteriophage Qbeta (324)
Norovirus (336), Hepatitis B virus (337) and Hepatitis C virus (338). For this, we
subcloned the DNA cassette encoding S9-CCMV recombinant coat protein into a Pichia
122
pastoris, expecting intracellular recombinant VLP production. DNA sequencing analysis
and in vitro translation results indicated that the cassettes were in frame and able to be
translated. The dot blot results indicated that recombinant VLP were obtained after
methanol induction. However, the recombinant protein yield was low, even when we
used the fermentor batch to produce the recombinant yeasts. In the fermentor batches, we
produced recombinant proteins but could not purify the recombinant chimeric VLP from
the yeast cell debris, whereas wt CCMV VLPs can be obtained easily from the same
purification. Urea was applied to disrupt noncovalent associations between the viral coat
protein and yeast cell debris, but we were still unable to gain CCMV-S9 VLP. This data
indicated that the insertion of S9 into the CCMV virus coat protein also inhibits the
formation of intact chimeric VLP, just as it does infectious virions. However, other
chimeric plant viruses have been successfully made as VLPs (299, 307, 308). It has been
shown that success in chimeric VLP production is dependent upon the insertion sites into
the coat protein. In the development of epitope expression in CPMV, the insertion of
foot-and-mouth disease virus (FMDV) epitope into the S protein results in genetic
instability resulting from homologous recombination (299, 310). Repositioning of the
epitope insertion site results in the successful assembly of viral particles (310, 339, 340).
However, some chimeric CPMV constructs are incapable of systemic infection, probably
because the coat protein modifications interfers with viral movement (299). In our study,
it is likely that coat protein modification in CCMV interfered with viral assembly.
Our third attempt to produce S9-CCMV particle was by using chemical methods
to conjugate the CCMV to the S9 peptide. We first conjugated dS9 and CCMV through
123
disulfide bond formation between thiol groups on the virus coat protein and the Cterminal of peptide. The CCMV mutant, CCMV A163C with cysteine substituted at
position 163, was used in the experiment because position 163 is on the exposed loops
and considered to be suitable as B-cell epitope. The result indicated that conjugation
products could be obtained, but they were aggregated resulting in precipitated particles at
the bottom of the tube when the product was stored at 4°C. The aggregation reaction may
have resulted from continuous covalent disulfide bonding between viruses.
We next used the chemical linkers, spdp and sulfo-smcc to conjugate the virus
and peptide. The NHS ester group on spdp or sulfo-smcc reacts with primary amines on
the viral coat protein. The 2-pyridyldithio group of the spdp linker reacts with sulfhydryl
at the amino terminal of S9 peptide. A maleimide group of sufo-smcc reacts with the
thiols on the S9 peptide. The coupling reaction requires pH 6-7.5. Wild-type CCMV is
stable at pH 5 and low ionic strength. Therefore, we used the salt stable mutant of CCMV
(ssCCMV), which resists disassembly in 1.0M NaCl, pH 7.5 (319, 341). The result
indicated that the ssCCMV can conjugate to the S9 via spdp linker but the conjugation
product again aggregated. According to the sucrose gradient analysis, the conjugation
product was found in the bottom of the gradient whereas the unconjugated ssCCMV was
found in the middle of gradient. The data indicated aggregation of the conjugation
product, which may result from unexpected disulfide bond exchanging between
derivatized CCMV (CCMV-spdp). Then we changed the linker to sulfo-smcc to create
nonaggregated S9-CCMV particles. We could obtain the conjugation product with the
help of 2-iodoacetamide (IA), an alkylating sulfhydryl reagent. The IA binds covalently
124
with cysteine on the virus, resulting in no available cys from virus to react with the
maleimide group. The sucrose gradient analysis revealed that the ssCCMV-S9 particles
remained intact and stayed as monomers, since they exhibited the same sedimentation
velocities as underivatized ssCCMV particles. To create the coat protein subunit-S9
conjugate, the SubE mutant in which eight basic amino acid residues (K and R) of the Nterminus were replaced with acidic residue glutamic acid was used (320). The sucrose
gradient analysis indicated that conjugation of SubE virions to S9 results in efficient viral
disassembly, since the coupling product was found at the top of the gradient. The western
blot analyses showed that the yield of conjugation products was low and less virus
seemed to be conjugated. One possible explanation is that there might be few accessible
lysines on the coat protein, resulting in less conjugation product. A second explanation is
that the coupling reaction might not be suitable, disrupting natural coat protein folding of
viral particle. Anther virus, Cowpea Mosaic Virus (CPMV), was used to conjugate to
fluorescein N-hydroxysuccinimide (NHS) and biotin (311, 312). At neutral pH, wild-type
CPMV was found to carry up to 60 dye molecules per virion, in a dose-dependent
manner. At pH 8.3, 1.5 dye molecules per asymmetric unit (90 per virion). Under
maximal conditions, up to 4 lysine residues per asymmetric unit could be labeled (311,
312). The conjugation between CPMV and S9 was kindly performed by the Johnson Lab,
(Scripps Institute, La Jolla CA). The conjugation product yield was higher than CCMVS9 conjugation (discussed more in next chapter). In conclusion, the CCMV-S9 particles
and CCMV coat protein subunit-S9 conjugates (made with the SubE mutant, which fails
125
to assemble) were obtained from the experiment and were ready to use in immunization
experiments, which will be discussed in the next chapter.
126
MURINE IMMUNE RESPONSE TO CCMV-CONJUGATED PEPTIDE MIMICS OF
GBS CAPSULAR POLYSACCHARIDE
Introduction
Group B streptococci (GBS) (Streptococcus agalactiae) is a commensal of the
genitourinary tract in 15-40% of healthy adult women (342). It is reported as a major
cause of neonatal sepsis and meningitis in developed countries (99), with type III GBS
predominate (100, 343). Neonatal GBS infection is acquired during delivery by vertical
transmission. Neonates are exposed to GBS either via GBS ascending through ruptured
amniotic membranes, aspiration of contaminated amniotic fluid, or through exposure to
colonized tissues while passing through the birth canal (344). Immunity to GBS infection
in humans (168), mice (345) and rats (346) is due to type-specific capsular
polysaccharide antibody. GBS capsular polysaccharide (CPS) is both a virulence factor
and the target of a protective humoral immune response (143, 168, 191, 345-348). GBS
vaccine development has been based on immunization with CP or CP conjugated to a
protein carrier, leading to protective levels of maternal IgG type specific anti-GBS
antibodies, which could be transplacentally passed to the newborn. Vaccines containing
CPS of group B streptococcus induced protective IgG antibodies in only 60% of
vacinees (191, 346). Conjugation of CPS to protein carriers, including tetanus toxoid
(TT) (192, 346) and choleratoxin B subunit (199) induce much better protective IgG
antibodies. GBS CPS is a poor immunogen and acts as a T-independent antigen resulting
in IgM production instead of IgG, and a lack of immunological memory.
127
An alternate approach is to design antigenic mimics, and relevant to our approach
is using peptide-display phage libraries to search for peptides that mimic carbohydrate
epitopes. The technique was developed by G. P. Smith (238) and is a powerful tool to
identify mimotopes for vaccine development. Several carbohydrate mimetic epitopes
have been reported by using this technique (1, 273, 276, 349, 350). In our lab, previously,
we identified peptide mimics of a protective epitope of GBS by the means of a phage
display library (1). The S9 mAb demonstrating in vivo protection against GBS type III
(172, 174) was used to select displayed peptides. The S9 peptide, FDTGAFDPDWPA
was isolated. The S9 peptide is shown to be both antigenic and immunogenic.
Immunization of mice with peptide-carriers results in the production of GBS antibodies
(1).
Several systems have been developed to improve vaccines for small peptides
epitopes. Conjugation to carrier protein such as TT or keyhole limpet hemocyanin (KLH)
has been extensively used in experimental studies to test candidates for vaccine
development. An alternative scheme to enhance the immunogenicity of the peptides is to
fuse the peptide sequences to the genes coding for virus capsid proteins, which have
ability in self-assembly to be virus-like particles (VLP), or chemically conjugate peptides
to virion or to VLP. Several plant viruses have been successfully used as expression
vectors to present epitopes for vaccine development (308, 310, 340, 351, 352). Our
studies have focused on the use of the plant virus Cowpea Chlorotic Mottle Virus
(CCMV) to present the S9 peptide on viral coat proteins. The structure of CCMV,
determined by X-ray crystallography, demonstrates that the virion is comprised of 180
128
copies of the coat protein subunit (317). The attempt to genetically modify CCMV coat
protein to express the S9 peptide is discussed in the previous chapter. We failed to
genetically express S9 fused to the viral coat protein, due to failure of virus assembly. We
then chemically conjugated the S9 peptide to the CCMV virus and to the VLP of CCMV.
In this study, we investigated antibody responses of mice immunized with the virus-S9
conjugate compared with KLH-S9 conjugate and evaluated their immunogenicity.
Materials and Methods
Preparation of Antigens
The S9 peptide, which mimics the type III GBS CPS, was chemically conjugated
to CCMV ss and SubE mutants, as described in the previous chapter. CCMV wild type
was obtained from the Young lab (Montana State University). Cowpea Mosaic Virus
(CPMV) wild type and conjugated to S9 peptide were kindly provided by Dr. John E.
Johnson (Scripps Institute, La Jolla CA). Synthetic peptides (Sigma Laboratories (USA))
containing Cys at the COOH peptide terminals were conjugated to maleimide derivatized
KLH (Pierce Chemical Co., Rockford, IL). Maleimides react with sulfhydryls at pH 6.57.5 to form stable thioether bonds. Peptides (300 ug) were mixed with KLH (300 ug) (1:1
ratio) in phosphate buffer pH 7 in a reaction volume of 300 ul. The reaction was allowed
to continue at room temperature for 3 h. The unconjugated peptides were removed by
using microcon 100 (Millipore, Billerica, MA) filtration. The conjugated KLH-peptides
were quantified by using BCA protein assay reagent kit.
129
We used ELISA to determine the amount of S9 peptide and virus in each
preparation. Protein concentrations were measured using BCA Protein Assay Reagent Kit
from Pierce (Rockford, IL). The first titration was performed to compare CCMV
concentration in each preparation. 96 well microtiter plates were coated with the 0.2, 0.1,
0.05, 0.025 and 0.0125 ug/ml (based upon BCA concentration) of CCMV, CCMV-S9,
SubE-S9 or KLH-S9. Then the coated plates were blocked with 1% BSA in phosphatebuffered saline (PBS). Primary antibody, rabbit anti-CCMV (1:3000 dilution) was
incubated in microtiter wells at 4°C for 18 h. Plates were washed with ELISA washing
buffer, 10 mM phosphate buffer pH 7.4, 150 mM NaCl, 0.05% Tween 20 and incubated
with alkaline phosphatase-conjugated anti-rabbit Ig (Zymed Laboratories, South San
Francisco CA) at a 1/10,000 dilution for 6 h, followed by washing and the addition of
colorimetric substrate p-nitrophenyl phosphate (Sigma Chemical) 1 mg/mL in 10%
diethanolamine buffer, pH 9.6, with 0.5mM MgCl2. Absorbance at 405 nm was
determined using a microplate reader (EL-320, Bio-Tek Instruments, Winooski, VT). A
second assay was performed to measure the amount of S9 peptide in each antigen
preparation. Plates were coated with the 0.4, 0.2, 0.1, 0.05, 0.025 and 0.0125 ug/ml of
ccmv-S9, subE-S9, cpmv-S9, cpmv or KLH-S9. S9 mAb at 5ug/ml in PBS buffer was
used as the primary antibody and alkaline phosphatase-conjugated anti-mouse Igs (H+L
chain specific, Zymed) at 1/10,000 in PBS was used as the secondary antibody.
Immunization
Two sets of immunizations were performed. Female BALB/c mice 8-10 weeks
were used. We compared the antibody responses to immunization with different antigen
130
preparations, with and without adjuvant, and the ability to prime for secondary immune
responses to GBS.
In the first experiment, mice were separated into 2 main groups (20 mice in each
group): adjuvant and no adjuvant. In the adjuvant group, mice were immunized with
antigens, which were emulsified in a 1:1 ratio with complete Freund’s adjuvant (CFA,
Difco, Detroit, MI) for the primary immunization, and with incomplete Freund’s adjuvant
(IFA) for booster injections. The non-adjuvant groups were immunized with antigens
which were diluted with PBS for primary and booster immunizations. Each group was
separated into 5 subgroups (4 mice in each subgroup) each receiving a different antigen:
CCMV, CCMV-S9, SubE-S9, CPMV-S9 and KLH-S9. Mice were immunized with
following amount of antigens: CCMV 2 ug, CCMV-S9 20 ug, SubE-S9 20 ug, CPMV-S9
10 ug, KLH-S9 10 ug. The concentration of antigen was based upon ELISA results
characterizing the amount of S9 peptide coupled to each antigen, as determined by
ELISA. Mice were bled to collect sera before immunization (Bleed 1). Primary
immunization was given subcutaneously (sc) and boosters intraperitonealy (ip). Booster
immunization followed the primary immunization by four weeks and one week after
boosting, all mice were bled to collect sera (Bleed 2) to measure antibody. Sera were
diluted to appropriate concentrations in PBS to measure different antibody responses:
1/200 to test the antibody response to GBS; 1/1000 to test the antibody response to other
mimetic peptides: S9-2, S7 and S11; and 1/5000 to test the antibody response to CCMV
and S9 peptide. ELISA was used to measure total Ig and specific subclasses of
antibodies.
131
Six subgroups of mice from this experiment were chosen for boosting with GBS:
CCMV, CCMV-S9 and KLH-S9 from both the adjuvant and non-adjuvant groups. Five
weeks after boosting with peptide, these mice were injected with heat-killed GBS.
Overnight cultures of GBS type III strain 125 in Todd Hewitt broth was spun down and
washed three times with sterilized PBS and then resuspended into sterilized PBS.
Absorbance at 600 nm of suspended GBS was adjusted to OD 0.9. The cells were killed
by heating at 60 °C for 30 min. Mice were injected subcutaneously with 0.1 ml of heatinactivated culture. The heat-inactivated culture was checked for viability by plating on
Todd Hewitt agar plates. Sera were collected at 3 and 7 days after challenge (Bleed 3 and
Bleed 4). Antibody to GBS, S9 peptide and CCMV was measured.
In the second experiment, 24 mice were separated into 4 groups (6 mice in each
group). Each group received a different antigen: CCMV, CCMV-S9, CPMV-S9 and
KLH-S9. Groups of mice were immunized subcutaneously, without adjuvant, with
following amount of antigens; CCMV 2 ug, CCMV-S9 20 ug, CPMV-S9 10 ug, and
KLH-S9 10 ug. Mice were bled to collect sera before immunization (Bleed 1). Four
weeks later, mice were reimmunized ip with the same amount of antigen. One week after
boosting, all mice were bled to collect sera (Bleed 2) and antibody to GBS, S9 and
CCMV was measured. Mice with high anti-S9 and anti-GBS antibody titers were chosen
to be investigated for cytokine production.
Cell Purification and Culture
Mice from the second experiment with high anti-S9 and anti-GBS antibody titers
were bled (Bleed 3) and immunized ip with the same antigen and dose as in the prime
132
and boost. Immunized and age-matched naive mice were bled and sacrificed 4 days after
the second booster immunization. Spleens and mesenteric lymph nodes were removed
aseptically. The spleens and mesenteric nodes were pooled, single-cell suspensions
prepared by aspiration into syringes, washed in culture medium (RPMI 1640), and
incubated on ice for 30 min in RPMI 1640. After one wash in RPMI 1640 medium, the
cells were resuspended in 10 ml of the same medium and layered onto 10 ml of
Lymphocyte M separation medium (Cedarlane Laboratories limited, Ontario, Canada).
The gradient was spun at 1750 rpm for 30 min at room temperature. Cells at the interface
of the gradient were collected, washed twice, and resuspended in cold culture media
(RPMI 1640 containing 2% fetal calf serum (FCS)), 100 U/ml penicillin, 100 g/ml
streptomycin, 50 mM 2-mercaptoethanol and 2mM l-glutamine (Gibco BRL,
Gaithersburg, MD). Cells were counted and used as splenocytes in some experiments, in
others the cells were passed through a column (Mouse T cell Recovery Column Kit from
Cedarlane Laboratories Limited, Ontario, Canada) to prepare CD4 T cells. Cells were
plated 100 ul per well (2×105 cell per well) into sterile 96-well microplates (Costar,
Corning Inc., NY) and stimulated either with medium, CCMV, CCMV-S9, S9, KLH-S9,
KLH, all at 20 ug/ml, or PHA-M (Sigma Chemical) at 10 ug/ml. Cultures were
incubated for 7 days at 37 ◦C in 5% CO2. The supernatants were collected at day 3, 5 and
7 and frozen at −20 ◦C until analyzed for cytokine production.
133
Collection and Preparation of Blood
Blood samples were taken from the lateral saphenous vein. Serum was prepared
by centrifugation and stored at −20 ◦C. Sera were diluted to appropriate concentration
with PBS/1% BSA/0.01% Na Azide before ELISA.
Enzyme-Linked Immunosorbent Assays (ELISA) of Peptide-Specific Antibodies, GBSSpecific Antibodies, and CCMV-Specific Antibody
CCMV or the peptide Ags: S9, S9-2, S7 and S11 were coated onto microtiter
wells (Immulon, Costar) at 5 µg/ml for at least 18 h. Amino acid sequences of each
peptide are indicated in Table 3.1.
Table 3. 1 Amino Acid Sequences of Peptides
Peptide
Amino acid
Description
sequence
S9
FDTGAFDPDWPA Mimic epitope of type III, GBS
group B
S9-2
WENWMMGNAGC Mimic epitope of type III, GBS
group B
S7
WGNWQDRLKC
Mimic epitope of GBS group B,
C, G
S11
EEYPHGPEPC
Mimic epitope of type I, GBS
group B
Note; UO : unpublished observation by Dr. Seth Pincus
References
(1)
UO
UO
UO
GBS were coated onto microtiter wells using poly-L-lysine and glutaraldehyde, as
described elsewhere (353). Plates were blocked with 1% BSA and used within 1 week.
Plates were washed with ELISA washing buffer (10 mM phosphate buffer pH 7.4, 150
mM NaCl, 0.05% Tween 20) prior to use. Test sera at appropriate dilutions were added to
antigen-coated wells in triplicate and incubated at 4°C for 18 h. The plates were washed
134
and incubated with alkaline phosphatase-conjugated anti mouse-Ig (heavy and light chain
specific, Zymed laboratories, South San Francisco, CA) for 4 h at room temperature.
Following incubation with the secondary antibody, plates were washed and the
colorimetric substrate p-nitrophenyl phosphate (Sigma Chemical) was added. Absorbance
at 405nm was determined using a microplate reader (EL-320, Bio-Tek Instruments,
Winooski, VT).
ELISA of S9-Specific Antibodies Subclasses in Serum
S9-peptide was coated onto microtiter wells (Immulon, Costar) at 5 µg/ml. Mouse
sera at a dilution of 1/2000 were added in triplicate to the plates and incubated at 4°C for
18 h. The plates were washed with ELISA washing buffer and incubated with rabbit
antisera specific for -mouse IgG1, IgG2a, IgG2b or IgG3 (Zymed laboratories, South San
Francisco, CA) diluted 1/8000 at 4°C for 18 h. Following a washing step, goat anti-rabbit
IgG antibody conjugated with alkaline phosphatase (Zymed Laboratories) was incubated
in the wells for 6 h, followed by washing and addition of colorimetric substrate and A405
was determined.
ELISA of S9-Specific and GBS-Specific IgM Antibodies in Serum
S9-peptide and GBS plates were prepared as described in section 4. Sera diluted
1/1000 for S9 plates and 1/200 for GBS plates were added in triplicate to the plates and
incubated at 4°C for 18 h. The plates were washed and incubated with rabbit anti-mouse
IgM μ chain specific antibody (Zymed laboratories, South San Francisco, CA diluted
1/1000). Goat anti-rabbit IgG antibody conjugated with alkaline phosphatase (Zymed
135
Laboratories), diluted 1/10,000 was incubated in wells for 6 h, followed by washing and
addition of colorimetric substrate and A405 was determined.
Assessment of Cytokines in Supernatants from
Cultured Splenocytes and CD4 T Cells
A sandwich ELISA was used to determine the amount of gamma interferon (IFNγ), interleukin 4 (IL -4) and IL-10 produced by the splenocytes and CD4 T cells during
antigen activation. Antibody pairs, recombinant standards and ELISA reagent for the
assay were purchased from eBioscience, Inc. Corning Costar 9018 96-well ELISA plates
were coated in100 µl/well of capture antibody in Coating Buffer. Plates were sealed and
incubated overnight at 4°C. Wells were blocked with 200 µl/well of assay diluent
(provided with reagents) and incubated at room temperature for 1 hour. The standards
(IFN-γ, IL-4 or IL-10) were diluted by 2-fold serial dilutions to create appropriate
standard curves and were added in duplicate to the plates. The supernatants from cell
media were added in duplicate to the plates in a series of two-fold dilutions. We then
added 100 ul/ well of the diluted biotin-conjugated detection antibody. Plates were sealed
and incubated at room temperature for 1 hour. After 5 washes, we added 100 ul/well
avidin-peroxidase and the plates were incubated at room temperature for 30 min. After 7
washes, 100ul/ well substrate, 2,2-azinobis-3-ethylbenzthiazoline-sulfonic acid with 0.3%
H2O2 were added and incubated at room temperature for 15 min. The reaction was
stopped with a stop solution (0.7M SDS in DMF and purified water, 1:1). The absorbance
was measured at 450 nm. In each sample, the final concentration of IFN-γ, IL-4 or IL-10
136
was determined from the standard curves by calculating the mean concentration from two
dilutions.
Results
Antigen Titration
To immunize with the same amount of the relevant antigen (S9 peptide) in
preparations having different carrier proteins, methods of coupling, and coupling
efficiencies; CCMV-S9, SubE-S9, CCMV, KLH-S9and cpmv-S9 were titrated by
ELISA. Antigens were diluted in PBS. The graphs in figure 3.1 and 3.2 display the
results.
Optical Density 405 nm
3.00
2.50
CCMV-S9
2.00
SubE-S9
KLH-S9
1.50
SubE
1.00
CCMV
0.50
0.00
0
0.05
0.1
0.15
0.2
0.25
Prote in Concentration (ug/ml)
Figure 3. 1 Comparison of CCMV Virus Antigen in Different Antigen Preparations
96 well microtiter plates were coated with the 0.2, 0.1, 0.05, 0.025 and 0.0125 ug/ml of
CCMV, CCMV-S9, SubE, SubE-S9 or KLH-S9. The coated plates were then blocked
with 1% BSA in PBS. Anti-CCMV serum (1:3000 dilution) was incubated in the
microtiter wells at 4°C for 18 h. Plates were washed and incubated with alkaline
phosphatase-conjugated anti-rabbit Ig for 4 h, followed by washing and addition of
colorimetric substrate p-nitrophenyl phosphate. Absorbance at 405 nm was determined.
Results are means and standard errors.
137
Optical Density 405 nm
2.50
2.00
CCMV-S9
1.50
SubE-S9
1.00
KLH-S9
0.50
0.00
0
0.1
0.2
0.3
0.4
0.5
Protein Concentration (ug/ml)
Optical Density 405 nm
2.50
2.00
CPMV-S9
1.50
CPMV
1.00
KLH-S9
0.50
0.00
0.00
0.10
0.20
0.30
0.40
0.50
Protein Concentration (ug/ml)
Figure 3. 2 Comparison of S9 Peptide in CCMV-S9, SubE-S9, CPMV-S9, CPMV and
KLH-S9 Antigens
Plates were coated with 0.4, 0.2, 0.1, 0.05, 0.025 and 0.0125 ug/ml of CCMV-S9, SubES9, CPMV-S9, CPMV and KLH-S9. Plates were blocked with 1% BSA and washed with
ELISA washing buffer. S9 mAb 5ug/ml in PBS buffer was added and incubated at 4°C
for 18 h. After washing with ELISA washing buffer, alkaline phosphatase-conjugated
anti-mouse Igs 1/10,000 in PBS were added into the wells and incubated at room
temperature for 4 hours, followed by washing and addition of colorimetric substrate pnitrophenyl phosphate. Absorbance at 405 nm was determined.
138
At the same nominal protein concentrations, the amount of CCMV antigen in
SubE-S9 and CCMV-S9 was 10 fold less than the amount of CCMV antigen in
unconjugated CCMV (Figure 3.1). This may have resulted from a degree of denaturation
of the S9-conjugated viruses, and loss of antigenicity of the virus coat protein.
The amount of S9 peptide in the KLH-S9 is approximately equal to the amount of
S9 antigen in the CPMV-S9 (Figure 3.2). The amount of S9 in the KLH-S9 is two-fold
higher than the amount of S9 protein antigen in the CCMV-S9 and SubE-S9 (Figure 3.2).
According to these titration results, we decided to choose concentrations of CCMV 2 ug,
CCMV-S9 20 ug, SubE-S9 20 ug, CPMV-S9 10 ug, KLH-S9 10 ug in immunization
experiments.
Immune Response after Immunization
In the first experiment, we immunized 2 groups of mice, with and without
Freund’s adjuvant. Mice in the adjuvant group were immunized with antigens which
were emulsified in complete Freund’s adjuvant and then 4 weeks later were reimmunized
with the same amount of each antigen emulsified in incomplete Freund’s. Mice in the
non-adjuvant group were immunized with antigens diluted in PBS. Each group was
separated into 5 subgroups (4 mice in each subgroup), each receiving a different antigen:
CCMV, CCMV-S9, SubE-S9, CPMV-S9 and KLH-S9. Groups of mice were immunized
with the amount of antigen determined above. Mice received a primary, and 4 weeks
later, a booster immunization. One week after the booster, sera were collected and tested
for antibody response to S9 peptide, CCMV and GBS (Figure 3.3).
139
S9
Optical Density 405 nm
3
2.5
2
Bleed1
1.5
Bleed2
1
0.5
CCMV
CCMV-S9
SubE-S9
CPMV-S9
KLH-S9
CCMV
CCMV-S9
CFA
SubE-S9
CPMV-S9
M37
M38
M39
M40
M33
M34
M35
M36
M29
M30
M31
M32
M25
M26
M27
M28
M21
M22
M23
M24
M19
M20
M17
M18
M14
M15
M16
M13
M9
M10
M11
M12
M5
M6
M7
M8
M1
M2
M3
M4
0
KLH-S9
PBS
Mouse
3.00
2.50
2.00
Bleed1
1.50
Bleed2
1.00
0.50
CPMV-S9
CCMV-S9
SubE-S9
CPMV-S9
M37
M38
M39
M40
M33
M34
M35
M36
CCMV
CFA
M29
M30
M31
M32
KLH-S9
M25
M26
M27
M28
M17
M18
M14
M15
M16
M13
M9
M10
M11
M12
SubE-S9
M21
M22
M23
M24
CCMV-S9
M19
M20
CCMV
M5
M6
M7
M8
0.00
M1
M2
M3
M4
Optical Density 405 nm
CCMV
KLH-S9
PBS
Mouse
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Bleed1
CPMV-S9
CCMV-S9
SubE-S9
CPMV-S9
M37
M38
M39
M40
M33
M34
M35
M36
CCMV
M29
M30
M31
M32
KLH-S9
CFA
M25
M26
M27
M28
M17
M18
M14
M15
M16
M13
M9
M10
M11
M12
SubE-S9
M21
M22
M23
M24
CCMV-S9
M19
M20
CCMV
M5
M6
M7
M8
Bleed2
M1
M2
M3
M4
Optical Density 405 nm
GBS
KLH-S9
PBS
Mouse
Figure 3. 3 Antibody Response of Individual Mice to S9 Peptide, CCMV and GBS
Plates were coated with S9 peptide, CCMV or GBS. Prebleed (Bleed 1) and post-booster
sera, (Bleed 2) at dilutions of 1/5000 for S9, 1/1000 for CCMV and 1/200 for GBS, were
added into triplicate wells. Plates then were incubated at 4°C for 18 h. After washing with
ELISA washing buffer, the anti-mouse IgG dilution 1/1000 was added into wells and
incubated for 4 hours at room temperature. Colorimetric substrate p-nitrophenyl
phosphate was added. Absorbance at 405 nm was measured. Results are means and
standard errors.
140
ELISA results showed that sera from mice immunized with CCMV-S9, CPMVS9 and KLH-S9, with or without adjuvant, made antibody response to the S9 peptide and
that immunizing with Freund’s adjuvant increased the antibody response to the S9
peptide. Mice immunized with SubE-S9 antigen, with or without adjuvant were able to
induce anti-CCMV response but not an anti-S9 response. Mice immunized with
unconjugated CCMV, with or without adjuvant, made antibody responses to CCMV but
not the S9 peptide. Adjuvant had little effect on the anti-CCMV response in mice
immunized with CCMV, which was different than the effect of adjuvant on the anti-S9
response. It is difficult to judge the development of anti-GBS antibody response because
prebleeds had high levels of “natural” anti-GBS antibody, and in controls not immunized
with S9, the anti-GBS antibody increased with time. To confirm the results of the first
experiment, we repeated the immunizations with a subset of these antigens (Figure 3.4).
We immunized 4 groups of mice (6 mice per group) with the following antigens using no
adjuvant: CCMV, CCMV-S9, CPMV-S9 and KLH-S9. All mice were bled to collect sera
before immunization (Bleed 1). Mice received the primary immunization sc. Four weeks
later, mice were boosted with the same antigen, given ip. Sera were collected 1 week
after the booster immunization. Sera collected from CCMV-S9, KLH-S9 and CPMV-S9
bound to plates coated with S9 antigen. CPMV-S9 induced higher anti-S9 antibody levels
than CCMV-S9 and KLH-S9. Control mice, immunized with unconjugated CCMV, did
not produce anti-S9. Similar problems as described above (Figure 3.3) made analysis of
the anti-GBS difficult, but it appears that a small number of mice in CCMV-S9 and
CPMV-S9 groups produced anti-GBS antibody.
141
4.50
4.00
3.50
3.00
2.50
2.00
1.50
1.00
0.50
0.00
B leed1
CCM V
CCM V -S 9
CP M V -S 9
M6
M5
M4
M3
M2
M1
M6
M5
M4
M3
M2
M1
M6
M5
M4
M3
M2
M1
M6
M5
M4
M3
M2
B leed2
M1
Optical Density 405 nm
S9
K LH-S 9
M o u se
1.2 0
1.0 0
0.8 0
B lee d1
0.6 0
B lee d2
0.4 0
0.2 0
CCM V
C C M V -S 9
C P M V -S 9
M6
M5
M4
M3
M2
M1
M6
M5
M4
M3
M2
M1
M6
M5
M4
M3
M2
M1
M6
M5
M4
M3
M2
0.0 0
M1
Optical Density 405 nm
CCMV
K L H -S 9
M o u se
1.00
0.90
0.80
0.70
0.60
0.50
0.40
0.30
0.20
0.10
0.00
B leed1
CCM V
CCM V -S 9
CP M V -S 9
M1
M2
M3
M4
M5
M6
M1
M2
M3
M4
M5
M6
M1
M2
M3
M4
M5
M6
B leed2
M1
M2
M3
M4
M5
M6
Optical Density
GBS
K LH-S 9
M ouse
Figure 3. 4 Antibody Response of Individual Mice to S9 Peptide CCMV and GBS
Plates were coated with S9 peptide, CCMV or GBS. Prebleed (Bleed 1) and post-booster
sera, (Bleed 2) at dilutions of 1/5000 for S9, 1/1000 for CCMV and 1/200 for GBS, were
added into triplicate wells. Plates then were incubated at 4°C for 18 h. After washing with
ELISA washing buffer, the anti-mouse IgG dilution 1/1000 was added into wells and
incubated for 4 hours at room temperature. Colorimetric substrate p-nitrophenyl
phosphate was added. Absorbance at 405 nm was measured. Results are means and
standard errors.
142
To test whether CCMV-S9, KLH-S9 and CCMV were able to induce cross
reactivity to other phage selected peptides, collected sera from these mice were added to
ELISA plates coated with S7, S9-2 and S11. These peptides were selected with the
indicated monoclonal antibody (S7, S9, or S11). The S9-2 peptide has a completely
different sequence than the S9 peptide used here. The ELISA results showed no cross
reactivity between anti-S9 antibody and any of these other peptides representing group B
streptococcal carbohydrate antigens (Figure 3.5, Figure 3.6 and Figure 3.7).
Optocal Density 405 nm
0.90
0.80
0.70
0.60
0.50
0.40
0.30
0.20
CCMV
CCMV-S9
KLH-S9
CCMV
CFA
CCMV-S9
positive
negative
M40
M39
M37
M38
M28
M27
M26
M25
M24
M22
M23
M21
M20
M18
M19
M17
M7
M8
M5
M6
M4
M3
M1
M2
0.10
0.00
KLH-S9
PBS
Mouse
Figure 3. 5 Antibody Response of Individual Mice to S7 Peptide
S7 plates were prepared as described in Materials and Methods. Bleed 2 from the first
sequence of immunizations was tested. S7 mAb was used as a positive control and PBS
was used as a negative control. Plates were incubated at 4°C for 18 h. After washing with
ELISA washing buffer, enzyme conjugated anti-mouse IgG was added and incubated for
4 hours at room temperature. Colorimetric substrate p-nitrophenyl phosphate was added.
Absorbance at 405 nm was measured and shown as mean and SEM.
CCMV
CCMV-S9
KLH-S9
CCMV
CFA
CCMV-S9
positive
negative
M37
M38
M39
M40
M25
M26
M27
M28
M21
M22
M23
M24
M17
M18
M19
M20
M5
M6
M7
M8
0.80
0.70
0.60
0.50
0.40
0.30
0.20
0.10
0.00
M1
M2
M3
M4
Optical Density 405 nm
143
KLH-S9
PBS
Mouse
CCMV
CCMV-S9
KLH-S9
CCMV
CFA
CCMV-S9
positive
negative
M37
M38
M39
M40
M25
M26
M27
M28
M21
M22
M23
M24
M17
M18
M19
M20
M5
M6
M7
M8
0.60
0.50
0.40
0.30
0.20
0.10
0.00
M1
M2
M3
M4
Optical Density 405 nm
Figure 3. 6 Antibody Response of Individual Mice to S9-2 Peptide
S9-2 plates were prepared as described in Materials and Methods. Bleed 2 from the first
sequence of immunizations was tested. S9-2 mAb was used as a positive control and PBS
was used as a negative control. Plates were incubated at 4°C for 18 h. After washing with
ELISA washing buffer, enzyme conjugated anti-mouse IgG was added and incubated for
4 hours at room temperature. Colorimetric substrate p-nitrophenyl phosphate was added.
Absorbance at 405 nm was measured and shown as mean and SEM.
KLH-S9
PBS
Mouse
Figure 3. 7 Antibody Response of Individual Mice to S11 Peptide
S11 plates were prepared as described in Materials and Methods. Bleed 2 from the first
sequence of immunizations was tested. S11 mAb was used as a positive control and PBS
was used as a negative control. Plates were incubated at 4°C for 18 h. After washing with
ELISA washing buffer, enzyme conjugated anti-mouse IgG was added and incubated for
4 hours at room temperature. Colorimetric substrate p-nitrophenyl phosphate was added.
Absorbance at 405 nm was measured and shown as mean and SEM.
144
The Th1/Th2 Response Is Influenced by Antigen Conjugate Carriers
To determine the Th1/Th2 profile of the antibody response, the subclass profile of
the humoral IgG response, antigen-specific IgGl, IgG2a and IgG2b, and IgG3, was
analyzed using ELISA as described in Materials and Methods (Figure 3.8 and Figure
3.9).
2.00
1.80
Optical Density 405 nm
1.60
1.40
IgG1
1.20
IgG2a
1.00
IgG2b
0.80
IgG3
0.60
0.40
0.20
CCMV-S9
CPMV-S9
KLH-S9
CCMV-S9
PBS
CPMV-S9
M20
M19
M18
M17
M16
M15
M14
M13
M8
M7
M6
M5
M40
M39
M38
M37
M36
M35
M34
M33
M28
M27
M26
M25
0.00
KLH-S9
CFA
Mouse
Figure 3. 8 IgG Subclass Identification from the First Immunization Experiment
Bleed 2 sera from the first immunization were added to ELISA plates coated with S9
peptide. Following this, rabbit anti mouse IgG1, IgG2a, IgG2b or IgG3 antisera were
added and incubated at 4°C for 18 h. Goat anti rabbit IgG antibody conjugated with
alkaline phosphatase was then added to wells for 6 h, followed by washing and addition
of colorimetric substrate. A405 was determined using a microplate reader. Results are
means and SEM of triplicate samples.
Antibody subclass was determined on Bleed 2 sera from mice in the first set of
immunizations (Figure 3.8), which had been immunized with KLH-S9, CPMV-S9, and
CCMV-S9, with or without adjuvant. In the non-adjuvant group, CCMV-S9 and CPMV-
145
S9 predominantly induced antigen-specific IgG2a whereas KLH-S9 predominantly
induced antigen-specific IgG1 (Figure 3.8). When adjuvant was used, these differences
disappeared, all subgroups showed a mixed Th1/Th2 response as reflected by equivalent
levels of antigen specific IgG1, IgG2a and IgG2b (Figure 3.8).
The result was confirmed using sera from the second immunization experiment.
Immunization with the virus carrier conjugate induced predominantly antigen-specific
IgG2a for a Th1 type of response, whereas KLH-S9 predominantly induced antigen-
Optical Density 405 nm
specific IgG1, a Th2 pattern (Figure 3.9).
2.50
2.00
IgG1
1.50
IgG2a
1.00
IgG2b
IgG3
0.50
0.00
M1 M2 M3 M4 M5 M6
CCMV-S9
M1 M2 M3 M4 M5 M6
CPMV-S9
M1 M2 M3 M4 M5 M6
KLH-S9
Mouse
Figure 3. 9 IgG Subclass Identification from the Second Immunization
Bleed 2 sera from the second immunization were added to ELISA plates coated with S9
peptide. Following this, rabbit anti mouse IgG1, IgG2a, IgG2b or IgG3 antisera were
added and incubated at 4°C for 18 h. Goat anti rabbit IgG antibody conjugated with
alkaline phosphatase was then added to wells for 6 h, followed by washing and addition
of colorimetric substrate. A405 was determined using a microplate reader. Results are
means and SEM of triplicate samples.
146
Immune Response after Injection with Heat-Killed Group B Streptococcus
We next asked if mice primed with the S9 peptide were able to produce rapid
GBS-specific antibody response after exposure to intact GBS. From the first
immunization, six groups of mice (CCMV, CCMV-S9, KLH-S9), with and without
adjuvant, were injected with heat-killed GBS. Sera were collected 3 and 7 days after
injection (Bleed 3 and Bleed 4) to test for the induction of S9 and GBS-specific
antibodies. All groups of mice produced small amounts of GBS-specific antibodies
(Figure 3.10) and S9-specific IgG antibodies (Figure 3.11) at day 7, but not day 3 after
2.50
2.00
Bleed2
1.50
Bleed3
1.00
Bleed4
0.50
CCMV
CCMV-S9
KLH-S9
CFA
CCMV
CCMV-S9
M37
M38
M39
M40
M25
M26
M27
M28
M21
M22
M23
M24
M19
M20
M17
M18
M5
M6
M7
M8
0.00
M1
M2
M3
M4
Optical Density 405 nm
immunization.
KLH-S9
PBS
Mouse
Figure 3. 10 GBS-Specific IgG Antibodies after Injection of GBS
Mice were injected with heat-killed GBS. Sera were collected 3 and 7 days after injection
(Bleed 3 and Bleed 4) to test for GBS-specific IgG antibodies nd compared to Bleed 2
sera (obtained prior to exposure to GBS). Sera were diluted to 1/200 and added to GBS
coated plates in triplicate and incubated. The plates were washed and incubated with
alkaline phosphatase-conjugated anti mouse-Ig, followed by washing and addition of
colorimetric substrate. A405 was determined using a microplate reader. Results are mean
and SEM.
3.00
2.50
2.00
Bleed2
1.50
Bleed3
1.00
Bleed4
0.50
CCMV
CCMV-S9
KLH-S9
CFA
CCMV
CCMV-S9
M37
M38
M39
M40
M25
M26
M27
M28
M21
M22
M23
M24
M19
M20
M17
M18
M5
M6
M7
M8
0.00
M1
M2
M3
M4
Optical Density 405 nm
147
KLH-S9
PBS
Mouse
Figure 3. 11 S9-Specific IgG Antibody after Injection of GBS
Mice were injected with heat-killed GBS. Sera were collected 3 and 7 days after injection
(Bleed 3 and Bleed 4) to test for S9-specific IgG antibodies, and compared to Bleed 2
sera (obtained prior to exposure to GBS). Sera were diluted to 1/5000 and added to S9
coated plates in triplicate and incubated. The plates were washed and incubated with
alkaline phosphatase-conjugated anti mouse-Ig, followed by washing and addition of
colorimetric substrate. A405 was determined using a microplate reader. Results are mean
and SEM.
All groups of mice produced more GBS-specific and S9-specific IgM antibodies
at day 7, but not day 3, after immunization (Figure 3.12). The results confirmed that GBS
immunization results in the production of anti-S9 antibody. But the results did not
provide any evidence that immunizing with the S9 peptide resulted in priming for a
challenge with GBS.
148
2.00
1.80
1.60
1.40
1.20
1.00
0.80
0.60
0.40
0.20
0.00
Bleed2
Bleed3
CCMV
CCMV-S9
KLH-S9
CCMV
CFA
CCMV-S9
M37
M38
M39
M40
M25
M26
M27
M28
M21
M22
M23
M24
M19
M20
M17
M18
M5
M6
M7
M8
Bleed4
M1
M2
M3
M4
Optical Density 405 nm
GBS
KLH-S9
PBS
Mouse
3.00
2.50
2.00
Bleed2
1.50
Bleed3
1.00
Bleed4
0.50
CCMV
CCMV-S9
KLH-S9
CFA
CCMV
CCMV-S9
M37
M38
M39
M40
M25
M26
M27
M28
M21
M22
M23
M24
M19
M20
M17
M18
M5
M6
M7
M8
0.00
M1
M2
M3
M4
Optical Density 405 nm
S9
KLH-S9
PBS
Mouse
Figure 3. 12 GBS-Specific IgM and S9-Specific IgM Antibodies after Injection of GBS
Mice were injected with heat-killed GBS. Sera were collected at 3 and 7 days after
injection (Bleed 3 and Bleed 4) to test for GBS-specific IgM antibodies, and compare to
Bleed 2 sera (obtained prior to exposure to GBS). Sera were diluted to 1/200 for GBSspecific IgG antibody response or diluted to 1/5000 for S9 -specific IgG antibody
response. The diluted sera were added to GBS or S9 coated plates coated plates in
triplicate and incubated. The plates were washed and incubated with rabbit anti-mouse
IgM, and then alkaline phosphatase-conjugated anti rabbit-IgG. A405 was determined
using a microplate reader. Results are mean and SEM.
149
Cytokine Production in Primed Splenocytes after Antigen Stimulation
Because the subclass analysis of the antibody response suggested that immunizing
with antigen in association with virus induces a Th1 type of response, whereas antigen
conjugated to KLH induced a Th2 response, we examined cytokine expression in helper
T cells following antigen stimulation. Selected groups of mice from the second
immunization were boosted a second time ipwith the same antigen. Immunized and naive
mice were sacrificed 4 days after the last booster. The spleens and mesenteric lymph
nodes were removed aseptically. Splenocytes were purified and were plated 100 ul per
well (2×105 cell per well) into sterile 96-well microplates (Costar, Corning Inc., NY) and
stimulated either with CCMV, CCMV-S9, S9 peptide alone, KLH-S9, or KLH, at
concentration 20 ug/ml, PHA at concentration 10 ug/ml (positive control), or with sterile
RPMI-medium supplement with 10% FCS (negative control). Cytokine production on
days 3, 5 and 7 was measured and is represented in figures 3.13. The data indicated that
splenocytes primed with CCMV or CCMV-S9 and then stimulated with CCMV or
CCMV-S9 produced large amounts of IFN-γ, with variable amounts of IL10 and no IL4.
On the other hand, splenocytes primed with KLH-S9 and then stimulated with KLH-S9
or KLH produced IL4 and IL10, and little IFN-γ. There appeared to be a greater overall
cytokine response when the immunogen is associated with virions. These data showed
that immunizing with virus particles expressing S9 provide a Th1-biased response
whereas immunization with protein, KLH-S9 induces a Th2-biased response. These
results are consistent with the Th1 vs Th2 bias indicated by the subclass of antibody
produced.
150
9 0 0 0 .0 0
Cytokine concentration (pg/ml)
8 0 0 0 .0 0
3 day
7 0 0 0 .0 0
6 0 0 0 .0 0
5 0 0 0 .0 0
CCM V
4 0 0 0 .0 0
C C M V -S 9
K L H -S 9
3 0 0 0 .0 0
2 0 0 0 .0 0
1 0 0 0 .0 0
PHA
KLH
CCMV
KLH-S9
S9
IL - 1 0 p g /m l
CCMV-S9
medium
PHA
KLH
CCMV
KLH-S9
S9
IL - 4 p g /m l
CCMV-S9
medium
PHA
KLH
CCMV
KLH-S9
S9
CCMV-S9
medium
0 .0 0
-1 0 0 0 . 0 0
IF N - g p g /m l
6 0 0 0 .0 0
5 day
Cytokine Concentration (pg/ml)
5 0 0 0 .0 0
4 0 0 0 .0 0
3 0 0 0 .0 0
CCM V
C C M V -S 9
K L H -S 9
2 0 0 0 .0 0
1 0 0 0 .0 0
IL - 4 p g /m l
IL - 1 0 p g /m l
PHA
KLH
CCMV
KLH-S9
CCMV-S9
S9
medium
PHA
KLH
CCMV
KLH-S9
CCMV-S9
S9
medium
PHA
KLH
CCMV
KLH-S9
S9
CCMV-S9
-1 0 0 0 .0 0
medium
0 .0 0
IF N - g p g /m l
9 0 0 0 .0 0
7 day
Cytokine Concentration (pg/ml)
8 0 0 0 .0 0
7 0 0 0 .0 0
6 0 0 0 .0 0
5 0 0 0 .0 0
CCM V
4 0 0 0 .0 0
C C M V -S 9
K L H -S 9
3 0 0 0 .0 0
2 0 0 0 .0 0
1 0 0 0 .0 0
IL - 4 p g /m l
IL - 1 0 p g /m l
PHA
KLH
CCMV
KLH-S9
CCMV-S9
S9
medium
PHA
KLH
CCMV
KLH-S9
CCMV-S9
S9
medium
PHA
KLH
CCMV
KLH-S9
CCMV-S9
S9
-1 0 0 0 . 0 0
medium
0 .0 0
IF N - g p g /m l
Figure 3. 13 Cytokine production in primed splenocytes 3, 5 and 7 days after antigen
stimulation
Mice immunized with CCMV, CCMV-S9 or KLH-S9 were sacrificed. Splenocytes were
purified, cultured in vitro, and stimulated either with antigen, PHA, or medium. The
supernatants were collected on day 3, 5 and 7 and analyzed for cytokine production.
Results are from individual mice immunized with the antigen indicated in the legend.
151
Discussion
Immunization with capsular polysaccharide (CPS) of GBS has been known to
induce protective antibodies (85). Vaccines using CPS (191) or CPS conjugated to
protein carriers (193, 346) have been developed. In our lab, we used an alternative
approach to GBS vaccine development. A CPS mimetic peptide, S9, was previously
identified by the means of phage display (1). The S9 peptide consists of 12 amino acids
and is immunogenic when coupled to large proteins. Conjugating peptide epitope to large
proteins such as KLH is a common method to enhance immunogenicity of the peptide.
An alternative way, using viruses to present epitopes by forming chimeric viruses and
virus-like particles has been developed (310, 340, 352, 354). CPMV, an icosahedral virus
comprised of 60 capsomers, has been used as a viral vector to express an epitope on the
virus coat protein (299, 313).
In the present study, we aimed to improve the immunogenicity of the GBS
mimotope, S9 peptide, by chemically coupling it to the plant virus particle, CCMV. We
choose the CCMV as virus vector to deliver the S9 peptide to the immune system
because the X-ray crystal structure of CCMV has been resolved (326-328) and it has been
developed as a new expression vector in the Young lab( Montana State University).
CCMV is a member of Bromoviridae virus family. It is an icosahedral virus 28 nm in
diameter. The structure of CCMV has been determined to 3.2 A° resolution (317).The
virus particle is composed of 180 copies of the coat protein. The S9 peptide was
chemically conjugated to four different carriers: CCMV, CPMV, SubE (CCMV mutant)
and KLH. The CPMV-S9 conjugate is a gift from Dr. John E. Johnson (Scripps Institute,
152
La Jolla CA). CPMV is a picorna-like icosahedral virus with size of 30 nm with 60
copies of coat protein subunit (355). The crystal structure of CPMV has been refined
(356). CPMV has been used as a virus vector to present many epitopes in chimeric form
and as chimeric VLPs (299, 310, 356-358). The amount of S9 peptide coupled to
CPMV-S9 was two-fold higher than the amount of S9 protein antigen in the CCMV-S9
and SubE-S9. The reactive lysine side chains on the virus coat protein were used in the
conjugation procedure for both CCMV-S9 and CPMV-S9. This may indicate that lysines
are less accessible on the CCMV coat protein than on CPMV.
Mice immunized with CCMV-S9 can produce anti-S9 antibody even without
adjuvant. With the help of adjuvant, the antibody response to S9 peptide increased. The
anti-S9 antibody response from mice immunized with CPMV-S9 and KLH-S9 conjugate
seemed slightly higher than the response from mice immunized with CCMV-S9. The
degree of organization of antigens has been shown to be important and to have effects on
the B cell response (295, 352, 359). The S9 antigen in the CCMV-S9 conjugate might not
be optimal for antibody production. Even though the amount of S9 peptide in each
antigen was equal in each sample, the amount of S9 per virus particle was less in the
CCMV-S9 conjugate. Thus, more repetition of antigen in CPMV-S9 enhanced antibody
response. This explanation was supported by the result of SubE-S9 conjugation
immunization. SubE-S9 conjugate is a monomeric form of mutant CCMV-S9 conjugate.
The SubE is the CCMV mutant in which eight basic amino acid residues (K and R) of the
N-terminus were replaced with acidic residue glutamic acid(320). Conjugating S9 to the
SubE led to a virus that falls apart (monomeric form). Mice immunized with SubE-S9
153
conjugate without adjuvant resulted in less anti-S9 antibody production. When adjuvant
was used, the response increased but the level was still lower than response from other
conjugates. Experiments using papaya mosaic virus-like particles fused to a hepatitis C
virus epitope also demonstrate that the immunogenicity is highly dependent upon antigen
organization. Immunization with the chimeric VLP induces long-lasting higher antibody
response compared to immunization with the monomeric form (352).
In the second immunization experiment, the result indicated a better anti-S9
response in mice immunized with CPMV-S9 when compared with the KLH-S9. However
this observation cannot be obviously seen in the first immunization experiment, but is
consistent with our other observations that virion-associated antigen may be more
immunogenic than antigen attached to soluble proteins (352).
Sera from all mice immunized with CCMV-S9, CPMV-S9, and KLH-S9 were
tested for cross reactivity to other peptides (peptide S9-2, S7 and S11) representing group
B streptococcal carbohydrate antigens. S7 and S11 were detected using Mabs specific for
other GBS antigens, whereas S9-2 was from the same set of experiments that produced
the S9 peptide, but eluted at acid, rather than alkaline pH (1). The result indicated no
cross reactivity between antibody elicited by immunization with any of the S9-antigen
preparations, and any peptides. This shows that the S9 peptide elicits antibodies
specifically to this peptide, and there is little if any antigenic mimicry among the
peptides.
The anti-GBS antibody response was tested in sera from all mice. The result is
difficult to interpret. Control mice showed an increase in anti-GBS antibody with time,
154
suggesting possible cross-reactions with the normal flora of the mice (mice were tested
and negative for GBS). Also results were weak and inconsistent. In the first
immunization experiment, an anti-GBS response seemed to be induced in mice
immunized with or without adjuvant with CCMV-S9, CPMV-S9, SubE-S9 and KLH-S9.
However, when the sera from the second immunization experiment were tested for antiGBS antibody, an anti-GBS antibody response was only seen in CPMV-S9, when
compared to the prebleed sera.
Immunized mice were injected with heat-killed GBS to test the ability of the S9
conjugates to prime for a secondary response to the microbial antigen expressed on the
killed GBS. The results indicate that immunization with the S9 peptide was unable to do
so. Interestingly, the injection of the GBS elicits a strong anti-peptide IgM response at
day 7.
The goal of vaccination is to provide protection from infection. Effective
stimulation of the immune system depends upon stimulation of strong T-cell response. In
general, Th1 cells stimulate cell-mediated immunity (CMI), while Th2 induce an
antibody-mediated response. In vaccine design, the type of immune response is important
because different immune responses have different effects on different pathogens. In
general, Th1 cells are required for the elimination of intracellular pathogens, whereas the
Th2 cells are required for inhibition of attachment or entry of microbes during
extracellular stages of the infectious cycle. The route of immunization and the form of the
antigen and delivery method can have effects on the immune response. The antibody
subclass profile (IgG1, IgG2a, IgG2b and IgG3 in mice), can suggest a Th1 or Th2
155
response. In our study, mice immunized without adjuvant with the CCMV-S9 and
CPMV-S9 conjugate predominantly produce anti-S9 specific IgG2a, whereas KLH-S9
predominantly induced anti-S9 specific IgG1. The antibody profile result suggested that
S9 conjugated to virus particle induced Th1 response, whereas conjugation S9 peptide to
soluble protein (KLH) induced a Th2 response. Notably, the Th1/Th2 bias was obscured
when adjuvant was used in the immunization. To substantiate that the antigen, in the form
of virus particles affects the Th1/Th2 response, we examined cytokine expression in
helper T cells following antigen stimulation. The data indicated that splenocytes primed
with CCMV or CCMV-S9 and then stimulated with CCMV or CCMV-S9 produced the
Th1 cytokine, IFN-γ. On the other hand, splenocytes primed with KLH-S9 and then
stimulated with KLH-S9 or KLH produced the Th2 cytokines, IL4 and IL10. The ability
of multimeric VLP vaccines to induce a Th1 biased response has been shown before
(360-363). This may result from the multimeric form of the antigen, or it may be the
effect of RNA within the VLP or virion contributing to adjuvanticity. CCMV virion and
pseudovirion assembly has been shown to be dependent upon the inclusion of RNA
within the capsid (364-368). Whatever the mechanism, our study clearly indicated that
immunizing with virus particles expressing S9 induces a Th1 response, whereas
immunization with protein, KLH-S9, induced a Th2 response.
156
PHAGE DISPLAY LIBRARY
Introduction
Group B streptococci (GBS) can cause neonatal sepsis and meningitis (369).
Neonates are exposed to GBS either via GBS ascension through ruptured amniotic
membranes, aspiration of contaminated amniotic fluid, or through exposure to colonized
tissues while passing through the birth canal (344). GBS possess a polysaccharide
capsule which allows the GBS to avoid opsonophagocytosis (145). Capsular
polysaccharides (CPS) are poorly immunogenic and induce a T-independent response
without immunologic memory. GBS vaccines using conjugates of the carbohydrate to a
protein carrier have been developed and are able to generate a T-dependent response
(370).
In our lab, we have followed an alternative strategy, using peptides that mimic the
structure of microbial polysaccharides. Phage display technique was used to seek
peptides that mimic carbohydrate epitopes. The S9 mAb, which demonstrates in vivo
protection against GBS type III (172, 174) was used to select displayed peptides. The S9
peptide, FDTGAFDPDWPA was isolated. The S9 peptide was shown to be both
antigenic and immunogenic (1), specifically blocking the binding of antibody to type III
CPS and eliciting antibody that cross-reacts with GBS.
In this thesis we further investigated the structural basis of the peptide mimicry of
the GBS type III CPS carbohydrate epitope. We designed a sublibrary, expressing a
mutated version of the S9 peptide with 3% random nucleic acids at each position of the
157
original S9 nucleotide sequence, creating approximately one mutation in each inserted
sequence. Peptides with higher affinity to the S9 mAb were identified by affinity
selection. From this sublibrary, we also explored effects of the amino acid changes in the
antigenic S9 peptide. Phages displaying modified S9 peptides therefore were randomly
selected. Peptides from both affinity selection and random selection were characterized.
The results allow us to map the antigenic portion of the S9 peptide, and suggest ways to
generate better mimotopes of GBS.
Materials and Methods
Peptide Library Construction
To create a library expressing mutated versions of the S9 peptide, we inserted
oligonucleotide sequences between the BglII sites of the filamentous phage vector
fUSE2 (237). The inserted sequence is expressed at the amino terminus of the pIII coat
protein, giving the final amino acid sequence H2N-A EDPG [FDTGAFDPDWPA] GGP
TD. The modified S9 oligonucleotide sense strands (New England Biolabs) were
designed so that the nucleotide sequence, indicated within the brackets, consisted of 97%
of the appropriate nucleotide with the other 3% consisting of the other three nucleotides
at each position, thus creating approximately one mutation in each inserted sequence:
5’CAAA G GATCC AGGA [TTC GAT ACG GGC GCG TTC GAT CCA GAT TGG
CCA GCG] GGT GGG CCC ACG G 3’. The antisense strands, which were used to
prime the fill-in reaction, were 5’GAT GGA TCC GTG GGC CCA CC 3’. The red
highlight indicates BamHI sites. Each strand was heated at 95°C for 3 min and rapidly
158
cooled down for 5 min. Sense S9 library strands 25 ul of 40 ng/ul were mixed with 2 ul of
40 ng/ul antisense strands, giving 1:1 molar ratio reaction. The mixture was incubated 15
min at 50 °C and 15 min at 37 °C and then allowed to cool down to room temperature.
Klenow Fragment (Takara), its buffer, and dNTP mix were added to the mixture to have
total volume of 250 ul. The reaction was incubated at 37°C 3 h and at 65°C for 5 min.
The oligonucleotide library was then digested with BamH1 (Promega). The double
stranded mutated S9 oligonucleotide DNA library was then purified by phenolchloroform extraction, followed by ethanol precipitation. The library was ligated into Bgl
II digested, and dephosphorylated fUSE2. The ligation reaction was performed at a
vector to insert ratio of 1:2 with T4 DNA ligase (Promega, Madison, WI) and 1 ul of 10x
ligation buffer (containing 100mM mgCl2 and 10 mM ATP, Promega) in 10 ul total
volume. The reactions were incubated at 4°C overnight to facilitate ligation. Digested and
dephosphorylated fUSE2 plasmids were used as a control. The ligation reactions were
precipitated by mixing the mixture well with two volumes of 95% ethanol and 1/10
volume of 3 M sodium acetate pH 5. The mixture was incubated at –20°C overnight.
DNA was collected by centrifuging12 krpm 30 min. The DNA pellet was washed with
70% ethanol and air dried. DNA was resuspended in10 ul water. Two transfections were
performed by electroporating 4 µl DNA into MC1061 E. coli (371, 372). SOC medium
with 0.2 ug/ml tetracycline was added to the transformation reactions and the mixtures
were incubated in an incubated shaker at 37°C for 1 h. The transfection reactions were
spread on LB media agar plates supplemented with 40 ug/ml tetracycline and incubated
at 37°C overnight, or added to 200 ml LB broth media supplemented with 40 ug/ml
159
tetracycline and incubated with shaking at 37°C overnight. Phages were purified from the
culture by using large scale phage purification methods described below.
Plasmid Extraction
A modified alkaline lysis method was used to purify plasmid DNA (321). 3 ml of
overnight culture in LB broth with tetracycline 20 ug/ml were spun to collect the cell
pellet. Cells were resuspended in 100 ul of 20 mM Tris buffer pH 8 and then incubated at
room temperature for 5 min. 200 ul of lysis buffer (fresh prepared 0.2 N NaOH, 1% SDS)
were added and the mixture was mixed. The mixture was incubated at RT for 10 min and
then 150 ul of KAC/AC (5 M potassium acetate, 10 M (57%) acetic acid) were added.
The mixture was mixed vigorously and sat in ice for 30 min. Cell debris was removed by
centrifugation at 12 krpm 10 min twice. Supernatant was collected and was mixed with
equal volume of phenol/chloroform/isopropanol. The upper phase was collected. DNA
was precipitated with 95% ethanol and sodium acetate, and washed with 70% ethanol.
DNA was resuspended in10 ul water. DNA was characterized by running on 0.8-1.5%
agarose gels.
PCR
Double stranded plasmid DNA (RF form of phage) was studied to assure the
presence of DNA inserts. DNA from individual transfectant colonies was mixed with
PCR buffer with MgCl, dNTP mix, primers (fUSE2 primer1 (TCAAGATCCGTGGGCC CACC) and fUSE2 primer2 (GCTTCTCTTATGATTGACCGTCTGCG)), Taq
160
polymerase, and the DNA template. PCR cycles were 94°C for 30 s, 60°C for 30 s, and
72°C for 30 s. 5 ul of PCR product were loaded onto 1% agarose gels.
Single Stranded DNA (ssDNA) Extraction (373)
Phage clones containing inserts, as verified by PCR, were cultured in 1.5 ml LB
containing 20 ug/ml tetracycline and incubated overnight at 37°C with shaking. Cultures
were centrifuged and 1 ml of supernatant was mixed with 150 ul PEG/NaCl solution
(16.7%/3.3M). The tube was inverted several times and kept at 4°C overnight. The tube
was centrifuged at 12 krpm for 10 min and all supernatant was removed. The pellet,
containing precipitated phage virions, was dissolved in 200 ul TE buffer (10 mM
Tris·HCL 1mM EDTA pH8). An equal volume of phenol/chloroform solution
(phenol:chloroform = 1:1) was added to the phage solution and mixed well. After
centrifugation, 200 ul of the aqueous phase was transferred to another tube. The ssDNA
was precipitated by adding 20 ul of 3M sodium acetate pH6 and 440 ul 95% ethanol and
kept at 4°C overnight. DNA was obtained by high speed centrifugation at 12 krpm for 30
min. The pellet was washed with 500 ul 70% ethanol and allowed to air-dry. The pellet
containing ssDNA was resuspended in 20 ul of sterilized deionized water. The ssDNA
was kept in -20°C until sent for sequencing analysis (Davis Sequencing, Inc, Davis, CA),
using fUSE2 primer, CCCTCATAGCGTAACG. Peptide sequences were inferred from
the DNA sequences using MacVector 6.5.3 and EditView 1.0.1.
161
Phage Amplification
E. coli stain K91Kan was cultured in a 10 ml LB broth containing 100 ug/ml
kanamycin in an incubation shaker 37°C until an OD 600 of a 1/10 dilution reached 0.2.
Purified phages or the eluate from the phage affinity selection were added to the culture
and incubated for 15 min at 37°C without shaking. A fresh 10 ml of LB media containing
0.2 ug/ml tetracycline was added and incubated at 37°C with high speed shaking (250
rpm) for 30 min. Tetracycline was added to the culture to a final concentration of 20
ug/ml. The total culture was spread on an LB agar plate containing 20 ug/ml tetracycline
and 100 ug/ml kanamycin in a 9x24 inch glass baking dish. The plate was incubated at
37°C overnight. On the next day, 25 ml of TBS (50mM Tris-Cl, 150 mM NaCl pH7.5)
with 0.5% Tween 20 was flooded over the culture plate. An alcohol-flamed sterilized
glass spreader was used to gently remove colonies from the plate. Phage particles were
purified and quantified by phage titration method as described below. The phages were
further reamplified using 100 ml of E. coli stain K91Kan. Purified phage particles from
the previous amplification were added to the culture, incubated, and purified as described
above.
Phage Purification
Phage were purified as follows (374). The overnight culture of phage-infected
K91Kan was centrifuged at 8 krpm for 10 min. The supernatant was transferred and
mixed with 0.15 volume of PEG/NaCl. The phage particles were allowed to precipitate
overnight at 4°C. The pellet containing phages was collected by centrifugation at 10
162
krpm for 30 min. The pellet was resuspended with 15 ml TBS buffer. The phages were
reprecipitated 3 times with PEG/NaCl. After the final round of precipitation, the pellet
was resuspended in 1 ml TBS phage buffer. Phage were quantified by titration, preserved
by adding 50% glycerol, and stored at 4°C. Phage protein concentration was measured by
using BCA protein assay reagent kit (Pierce, Rockford, IL).
Phage Titration
Phage were titrated as follows (375) (376). Starved E. coli K91Kan were used as
host cells for phage titration. K91Kan cells were cultured in 20 ml LB media
supplemented with 100 ug/ml kanamycin at 37°C with shaking until reaching OD600
0.4-0.5. Cells were centrifuged at 2.5 krpm for 10 min and resuspended in 20 ml 80 mM
NaCl. The cell suspension was incubated in the 37°C shaker incubator for 45 min and
centrifuged 2.5 krpm for 10 min. Cells were resuspended in 1 ml cold NAP buffer (80
mM NaCl and 50 mM NH4H2PO4, adjusted pH to 7 with NH4OH) and kept at 4°C until
use. Purified phages were 10-fold serially diluted with TBS phage buffer with 100 ul
final volume. Phages were allowed to infect the cells at room temperature for 10 min and
the mixture was added with 1 ml LB supplemented with 0.2 ug/ml tetracycline. The
infection was allowed to continue in the 37°C shaking incubator for 40 min. 100 ul/plate
of infected cells were spread on LB agar supplemented with 40 ug/ml tetracycline and
100 ug/ml kanamycin. Culture plates were incubated overnight in the 37°C incubator.
Infected colonies able to grow on the tetracycline/kanamycin plates were counted and
calculated as transducing units (TU titer).
163
Affinity Selection of Phage-Displayed Peptides
S9 monoclonal antibody (mAb) was diluted with coupling buffer (0.1 M
NaHCO3, 0.5 M NaCl, pH8.3-8.5) to 1.5 mg/ml. Cyanogen bromide-activated Sepharose
4B (Sigma Chemical Co., St. Louis, MO) was washed and swollen in 200 ml cold 1mM
HCl per gram of dry gel for 30 min at 4°C . The resin was washed with 200 ml cold
distilled water 5 times. The resin was then mixed with S9 mAb at 3 mg of Ab/ml of beads
in the coupling buffer overnight at 4°C rotating end-over-end. The S9 mAb-resin was
spun down at low speed for 1 min and washed 3X with the coupling buffer. Supernatants
were collected for protein assay by using BCA protein assay reagent kit (Pierce,
Rockford, IL). The quantity of S9 mAb conjugated to the matrices was determined by
subtracting total S9 mAb protein released from each coupling step from the input S9
mAb protein. Unreacted groups on resin were blocked with 0.2 M glycine pH 8 overnight
at 4°C. The mAb-conjugated resin was separated into three aliquots and kept at 4°C in
0.02% azide until ready to use. The S9 mAb-conjugated resins were mixed with 1x1012-13
phage (1 ml) from the phage library at 4°C overnight. The mixture was loaded into a 5 ml
syringe plastic barrel (Becton, Dickinson and company, Franklin Lakes, NJ). The
unbound phages were removed by washing 10 times with phage buffer. Bound phages
were eluted with 0.5 M NH4OH pH 11 and the pH of the eluate was neutralized
immediately with 1 M acetic acid. The titer of phage in each wash and in each eluate was
determined by the phage titration method as described above. The eluted phage were then
amplified in E. coli strain K91Kan, as described above, to a TU titer of 1012 and reapplied
to the column for a second round of affinity selection. The same incubation, washing, and
164
elution procedures were used. The yield was determined from the second round. The
eluted phages were reamplified in K91Kan for the third round of affinity selection. After
the last round of selection, individual phages were rescued by infecting starved E. coli
strain K91Kan and plated on the LB agar media supplemented with 40 ug/ml tetracycline
and 100 ug/ml kanamycin. The yield was determined. Phage ssDNA were purified and
sent for sequencing analysis. Phages were purified and characterized for binding to
selecting, and other, Abs using ELISA.
ELISA and Antibodies
Direct binding ELISA was used to measure the binding of phages, peptides, and
KLH-peptide conjugates to select Abs. 100 ul of the appropriate concentration of antigen
were loaded onto microtiter wells (Immulon 2, Dynatech, McLean, VA). Plates were
blocked with ELISA blocking buffer (1% BSA in phosphate-buffered saline (PBS)) 4°C
overnight. 100 ul of appropriate concentrations of the following antibodies: S9, S7, S11,
or anti-M13 were incubated in microtiter wells at 4°C for 18 h. Unbound antibody was
removed by washing with ELISA washing buffer (10 mM phosphate buffer pH 7.4, 150
mM NaCl, 0.05% Tween 20). After several washings, 100 ul of 1/1000 alkaline
phosphatase-conjugated anti-Ig was added and incubated at room temperature for 6 h.
After washing, 100 ul of colorimetric substrate p-nitrophenyl phosphate (Sigma
Chemical) (1 mg/mL in 10% diethanolamine buffer, pH 9.6, with 0.5mM MgCl2) was
added. A405 was determined using a microplate reader (EL-320, Bio-Tek Instruments,
Winooski, VT).
165
Antigen capture ELISA was also used. Plates were coated with 3 ug/ml of mAbs
S9, S11, or B6.1. After blocking with ELISA blocking buffer, 100 ul of each phage
dilution was added. After incubating at 4°C overnight, anti-M13 antisera, at a 1/10,000
dilution was added and incubated at 4°C overnight. Plates were washed and incubated
with alkaline phosphatase-conjugated anti-rabbit IgG, followed by washing and the
addition of substrate, p-nitrophenyl phosphate. Absorbance at 405 was determined.
ELISA assays for phage or peptide inhibition of binding activity of mAb to Group
B streptococcus (GBS) were performed by coating microtiter wells with GBS (353).
Plates were blocked with ELISA blocking buffer overnight at 4°C. The inhibition assay
was performed by preincubation of the mAb with different concentrations of phages or
peptides. Small scale purified phage clones were diluted with phage buffer to have
concentration of 3 ug/ml. Phages were two-fold serially diluted ranged from 3 ug/ml to
0.006 ug/ml. Peptides were diluted to be 2.5, 0.5, 0.1, 0.2 and 0.004 ug/ml. The KLHpeptide conjugates were two-fold serially diluted, and ranged from 0.5 ug/ml to 0.001
ug/ml. The concentration of mAb used for the inhibition assay was in the middle of the
linear portion of the binding curve between mAb and GBS (S9 mAb ascites was diluted
to 1/25,000, SIIIV18.C2 was diluted to 1/250,000, SIIIS8.C3 was diluted to 1/3,000). The
mixture was allowed to incubate at room temperature for 1 h before placing 100 ul of the
mixture in wells and incubating 4°C overnight. The plates were washed with ELISA
washing buffer, and incubated with alkaline phosphatase-conjugated anti-mouse Ig,
followed by washing and addition of colorimetric substrate p-nitrophenyl phosphate
(Sigma Chemical). Absorbance at 405 nm was measured.
166
ELISA assays for binding activity of sera from immunized mice or mabs to GBS
were performed by coating microtiter wells with GBS (353). Information regarding the
mAbs used in this experiment are listed in table 4.1.
Table 4. 1 Mabs Used in This Study
Name
S9
S11
SIIIS8.C3
S3.1A6
S3.2A6
S3.1B1
SIIIV18.C2
B6.1
Specificity
Type III capsular polysaccharide
Beta-C protein of type I and II GBS
Complete type III
Type III capsular polysaccharide
Type III capsular polysaccharide
Type III capsular polysaccharide
Complete type III
Candida albicans
Plates were blocked with ELISA blocking buffer overnight at 4°C. Diluted
antibody was loaded onto the GBS coated plates and incubated at 4°C overnight. After
washing, alkaline phosphatase-conjugated anti-mouse Ig was added and incubated. After
another wash, colorimetric substrate p-nitrophenyl phosphate was added. A405 was
determined using a microplate reader.
Conjugation of Peptides to Keyhole Limpet Hemocyanin (KLH)
Synthetic peptides (Sigma Laboratories (USA)) containing Cys at the COOH
peptide terminals were conjugated to maleimide derivatized KLH (Pierce Chemical Co.,
Rockford, IL). Maleimides react with sulfhydryls at pH 6.5-7.5 to form stable thioether
bonds. Peptides (300 ug) were mixed with KLH (300 ug) in phosphate buffer pH 7 in a
reaction volume of 300 ul. The reaction was allowed to continue at room temperature for
3 h. The unconjugated peptides were removed by using microcon 100 (Millipore,
Billerica, MA) filtration. The conjugated KLH-peptides were quantified by using the
167
BCA protein assay reagent kit. The specificity of conjugated peptides binding to mAb
and ability to inhibit mAb to GBS were characterized by ELISA.
Results
Library Constructions
To identify peptides that would engage the S9 mAb more effectively and to map
the binding motif within the S9 peptide, we created a mutated phage library based on the
S9 peptide sequence having approximately one mutation per phage. The library was
constructed by inserting a randomly modified version of the S9 DNA sequence between
the BglII sites of the filamentous phage vector fUSE2. To make the oligomers that would
form the library, the sense strands were designed to have 97% correct nucleotide and 3%
consisting of the other three nucleotides in each position of the S9 coding sequence.
Klenow fragment DNA polymerase was used to extend the antisense strands
complementary to the sense strands resulting in the oligomer of modified S9 DNA
fragments (Figure 4.1)
Figure 4. 1 Construction of Randomly Modified S9 DNA ds Oligomer
Red, white and blue areas indicate BamHI site, the modified S9 library and bases
encoding unmodified AA’s, respectively.
168
The modified S9 DNA oligomers were digested with BamH1 restriction enzyme.
The digested products were purified and loaded onto the 12% polyacrylamide gels
(Figure 4.2).
Annealing S9
Annealing S9 + klenow fragment
Annealing S9 + klenow fragment +
BamHI+purification
50bp DNA ladder
Figure 4. 2 Modified S9 DNA Fragment Library
Sense S9 library strands 25 ul of 40 ng/ul were mixed with 2 ul of 40 ng/ul antisense
strands. Klenow fragment (Takara), its bufferand dNTP mix were added to the mixture to
have total volume of 25 ul. The reaction was incubated at 37 °C at least 3 h and at 65 °C
for 5 min. The complete set of double stranded S9 DNA oligomers was then digested
with BamH1 and purified by using phenol-chloroform extraction followed by ethanol
precipitation.
The library was ligated into the ends of restriction digested Bgl II sites of fUSE2
vector located at the amino terminal part of the pIII coat protein giving the final amino
acid sequence H2N-A EDPG [FDTGAFDPDWPA] GGPT D. The blue letters indicate
the S9 peptide sequence that was modified. Two batches of electroporation were
performed, which gave a transfection efficiency of 4.7 x 104 and 5 x 104 colonies,
respectively. Only 36 colonies derived from transfection with control dephosphorylated
fUSE2 plasmid.
169
Random and Affinity Selection of Phage
Phages were selected using two different screening protocols, random selection
and affinity selection. In random selection, the entire first electroporated reaction was
spread on the LB supplemented with 40 ug/ml tetracycline with appropriate dilution to
provide isolated colonies on plates. 1,224 isolated colonies were randomly selected for
PCR analysis to identify positive clones containing inserts in the correct orientation. A
642 bp PCR product was expected from the positive clones (Figure 4.3). From 1224
random-selecting clones, 493 clones (40.3%) contained foreign DNA inserts in the
correct orientation.
Figure 4. 3 PCR Analysis of Transfected Clones
Recombinant plasmids (RF form) were isolated from each clone and then PCR amplified.
5 ul of PCR products were analyzed by 2% agarose gel electrophoresis. The first lane was
1 kb DNA marker. The last lane is negative
Single stranded phage DNAs from the total 493 positive clones were analyzed by
DNA sequencing. Table 4.2 displays a summary of the DNA sequencing analysis.
170
Table 4. 2 Summarized DNA Sequencing Analysis
Number of clones
Description
Affinity selection
Random
selection
Second
Third
round
round
Base change, resulting in amino acid change
120
5
4
Base change without amino acid change
17
1
2
Original S9 identical
356
9
18
Subtotal
493
15
24
Total
532
Single stranded DNA from 532 recombinant clones from random selection and affinity
selection were sent for sequencing analysis (Davis Sequencing, Inc, Davis, CA).
The sequencing result indicated that 72.2% of positive phage clones encoded the
S9 identical sequence, FDTGAFDPDWPA, without any DNA base alteration. Only
27.8% of the positive phage clones contained modified S9 DNA sublibrary inserts. From
120 phage clones contained the modified S9, 41 clones encoded redundant amino acid
sequences. In conclusion only 79 clones encoded modified S9 sequences. All 79 clones
were cultured and the phages were purified for further characterization.
In the affinity selection, the second electroporation batch was added to 200 ml LB
broth media supplemented with 40 ug/ml tetracycline and cultured overnight in a shaking
incubator at 37 °C overnight. Phages were purified from the culture by using the large
scale phage purification method described above. After amplification, 1.2x1013 phages
were obtained for phage displayed peptide selection with S9 monoclonal antibody. S9
mAb was conjugated to cyanogen bromide-activated sepharose, containing 0.7 mg of S9
mAb conjugated to the resin. The S9-conjugated matrices were separated into three
aliquots, resulting in approximately 0.2 mg of S9 mAb for each affinity selection round.
After the first affinity selection round, the yield of affinity selected phage was 5x105. The
171
output phages were amplified to have 8x1012 TU for the second round of affinity
selection. The yield in the second round was 1x108. The output phages were amplified to
4x1012 TU for the last round of affinity selection, yielding 4.8x109 phage. 15 and 24
clones from the second and the third round were sequenced, respectively. Single stranded
phage DNAs were purified and sent for sequencing analysis. A summary of the
sequencing data is displayed in the table 3.2. Four clones isolated from the second round
and three clones isolated from the final round displayed a modified sequence. Three (2
from the second round, one from the final) displayed FDTGAFDPDWRA (designated
RP1.8).
Specificity and Avidity of Phage-Displayed Peptides
In order to determine the binding between the selected phages and mAbs, ELISAs
using different antibodies were performed. A total of 86 phages, from both random and
affinity selection, were tested. Phage binding to S9 mAb and anti-M13 antibody is shown
in Figure 4.4 and 4.5. With the same phage concentration, binding by anti-M13 was more
or less equivalent for all phage preparations. In contrast, binding of the mutant phages by
the S9 mab was different, with some having increased binding, some equivalent, some
less, and some lacking binding altogether; when compared to phage displaying the
original S9 peptide. Six out of seven phages selected by affinity selection showed
increased S9 binding activity. A phage displaying the wrong orientation of S9
surprisingly showed some degree of binding by S9 mAb.
0.00
0.20
0.40
0.60
0.80
1.00
1.20
1.40
1.60
1.80
2.00
0.00
0.50
1.00
1.50
2.00
2.50
3.00
Individual Phages
Individual Phage
Figure 4. 4 Direct binding of phage by S9 and anti-M13 antibodies (set I)
ELISA plates were coated with phages at 50 ug/ml and 1 ug/ml, for S9 and antiM13 binding activity respectively. For S9 binding activity (A) 100
ul of S9 mAb 15 ug/ml was added and the binding activity was detected by adding anti-mouse IgG-AP conjugate. For antiM13 binding activity
(B), 100 ul of antiM13 1/10,000 was added and the binding activity was detected by adding anti-rabbit IgG. Absorbance at 405 nm was measured.
The blue bar represents a phage displaying the original S9 peptide. The pink bar represents a phage displaying the wrong orientation of the S9
coding sequence. The green bar represents a fUSE2 original phage vector. The purple bars represent phage displaying modified S9 sequences.
B
Optical Density 405 nm
Optical Density 405 nm
A
172
0.00
0.20
0.40
0.60
0.80
1.00
1.20
1.40
1.60
0.00
0.50
1.00
1.50
2.00
2.50
3.00
Individual Phages
Individual Phages
Figure 4. 5 Direct binding of phage by S9 and anti-M13 antibodies (set II)
ELISA plates were coated with phages at 50 ug/ml and 1 ug/ml, for S9 and antiM13 binding activity respectively. For S9 binding activity (A) 100
ul of S9 mAb 15 ug/ml was added and the binding activity was detected by adding anti-mouse IgG-AP conjugate. For antiM13 binding activity
(B), 100 ul of antiM13 1/10,000 was added and the binding activity was detected by adding anti-rabbit IgG. Absorbance at 405 nm was measured.
The blue bar represents a phage displaying the original S9 peptide. The pink bar represents a phage displaying the wrong orientation of the S9
coding sequence. The green bar represents a fUSE2 original phage vector. The purple bars represent phage displaying modified S9 sequences.
B
Optical Density 405 nm
Optical Density 405 nm
A
173
174
To confirm these results, phages with increases in binding activity to the S9 mAb
and some phages with reduction in binding activity were recultured and retested (Figure
4.6). The data were consistent with the previous data.
A
Optical Density 405 nm
3.000
2.500
2.000
1.500
1.000
0.500
82
11
2
15
0
16
1
16
8
17
2
19
2
20
8
21
9
23
2
26
1
27
8
28
6
31
1
31
8
41
4
52
0
55
4
82
6
1.
2
1.
8
1.
12
2.
10
2.
13
2.
16
3
10
9
S
w
ro
ng
S
9
or v ec
ie
t
nt or
at
io
n
rp
-2
rp
-5
0.000
Individual Phages
B
Optical Density 405 nm
2.500
2.000
1.500
1.000
0.500
82
11
2
15
0
16
1
16
8
17
2
19
2
20
8
21
9
23
2
26
1
27
8
28
6
31
1
31
8
41
4
52
0
55
4
82
6
1.
2
1.
8
1.
12
2.
10
2.
13
2.
16
3
10
rp
-2
rp
-5
9
w
ro
ng
S
S
9
or vec
ie
t
nt o r
at
io
n
0.000
Individual Phages
Figure 4. 6 Direct Binding of Phage by S9 and Anti-M13 Antibodies
To measure binding by S9 and M13 antibodies ELISA plates were coated with phages at
50 ug/ml and 1 ug/ml, respectively. For S9 binding activity (A and B) 100 ul of S9 mAb
15 ug/ml was added and the binding activity was detected by adding anti-mouse IgG-AP
conjugate. For antiM13 binding activity (C and D), 100 ul of antiM13 1/10,000 was
added and the binding activity was detected by adding anti-rabbit IgG. Absorbance at 405
nm was measured. The blue bar represents a phage displaying the original S9 peptide.
The pink bar represents a phage displaying the wrong orientation of the S9 coding
sequence. The green bar represents a fuse2 original phage vector. The purple bars
represent phage displaying modified S9 sequences.
175
In order to determine the specificity and avidity of binding of phage-displayed
peptides by antibody, a capture ELISA was designed, in which purified phages were
captured by S9 mAb and detected with anti-M13 antibody. ELISA plates were coated
with S9 mAb or irrelevant antibodies, B6.1 (antibody against Candia albicans) and S11
(mAb IgM against Beta-C protein of type I and II GBS). The immobilized antibodies
were incubated with different concentrations of the phage clones. Phages were detected
with antiM13 antibody and the binding activity was measured (Figure 4.7).
4 .5 0 0
4 .0 0 0
3 .5 0 0
Optical Density 405 nm
3 .0 0 0
172
1 .2
2 .5 0 0
2 .1 6
S9
F u s e 2 v e c to r
2 .0 0 0
w r o n g o r e i n ta ti o n
1 .5 0 0
1 .0 0 0
0 .5 0 0
0 .0 0 0
0 .0 0 0
0 .0 0 4
0 .0 0 8
0 .0 1 6
0 .0 3 1
0 .0 6 3
0 .1 2 5
0 .2 5 0
B 6 .1
S11
In d iv id u a l P h a g e C o n c e n t r a t io n ( u g /m l)
Figure 4. 7 Capture ELISA
Plates were coated with S9, S11 or B6.1mabs. Phage clones 172, 1.2, 2.16, parental S9,
original fuse2, and phages with wrong orientation insert at different concentrations were
added. After incubating at 4 °C overnight, anti-M13 antibody was added and incubated.
The reactions were detected with alkaline phosphatase conjugated anti-rabbit IgG and
addition of colorimetric substrate. Absorbance at 405 nm was observed.
176
The ELISA results show that phage-displayed peptides bound to S9 mAb in a
concentration-dependent manner. Phage clone 1.2 from the second round affinity
selection and 2.16 from the third round affinity selection gave stronger reactions than the
parental S9 phage, suggesting higher binding avidity by the S9 mAb. fUSE2 vector phage
was not recognized by S9 mAb, whereas the phage-displayed wrong orientation S9 insert
showed some degree of binding activity. No phage clones were recognized by the
irrelevant antibodies B6.1 and S11.
To determine whether peptides displayed as phage fusion protein are mimetic of a
group B streptococcus (GBS) determinant, we tested the ability of phage-displayed
peptides to inhibit the binding of GBS by S9 mAb. We chose those phages with the
greatest direct binding activity for testing. To perform the inhibition experiment, different
concentrations of phages were premixed with mAb and allowed to incubate for 1 h at
room temperature and then loaded onto the plates coated with GBS. The concentration of
S9 mAb used for the inhibition assay was in the middle of the linear portion of the
binding curve (Figure 4.8), which was 1/25,000. The inhibition assay (Figure 4.9)
indicated that phage clone 10 showed highest activity in blocking the binding activity of
S9 mAb to GBS. Phage clone 1.2 was also a good inhibitor. However, inhibition obtained
from both clones was not much different from that obtained from phage displaying the
original S9 peptide. The original fUSE2 phage did not show any inhibition.
177
Optical Density 405 nm
3.000
2.500
2.000
S3.2A6
1.500
SIII S8.C3
S9 Ascites
1.000
0.500
0.000
1/1000
1/5000
1/25000
1/75000 1/125000
3.000
2.500
2.000
S3.1A6
1.500
SIIIV 18.C2
1.000
S3.1B1
0.500
00
0
1/
15
62
50
1/
31
25
00
1/
62
50
00
1/
12
50
00
0.000
1/
25
00
0
Optical Density 405 nm
Monoclonal Antibody Dilution
Monoclonal Antibody Dilution
Figure 4. 8 Titration of mAb binding to GBS
ELISA assays for mAb interaction with Group B streptococcus (GBS) were performed by
coating microtiter wells with GBS. MAbs were two-fold serially diluted and binding was
detected with alkaline phosphatase-conjugated anti-Ig and colorimetric substrate pnitrophenyl phosphate. A405 was determined.
178
0.600
Optical density 405 nm
0.500
S9
0.400
rp5
10
0.300
172
219
1.2
Fuse2 vector
0.200
0.100
0.000
0.001
0.01
0.1
1
10
Phage Concentration (ug/ml)
Figure 4. 9 Inhibition Assay by Phages of S9 mAb Binding to GBS
ELISA assays for phage inhibition of mAb interaction with Group B streptococcus (GBS)
were performed by coating microtiter wells with GBS. The inhibition assay was
performed by preincubation of S9 with different phage concentrations and adding to GBS
coated wells. Binding was detected with alkaline phosphatase-conjugated anti-mouse Ig
followed by washing and addition of colorimetric substrate p-nitrophenyl phosphate
(Sigma Chemical). Absorbance at 405 nm was determined.
Specificity and Avidity of Peptides
In order to ensure that the interaction between the selected phages and S9 mAb is
caused by insert sequences, peptides representing sequences from phage clones, which
showed higher binding activity to S9 mAb and the ability to compete with GBS for S9
binding, were synthesized. Binding of S9 mAb to the synthetic peptides was
demonstrated by ELISA (Figure 4.10).
O p tic a l D e n s ity 4 0 5 n m
S9
1 T2
-T
s9 s9
-2
rp
-5
rp
3
10
82
15
0
17
2
19
2
21
9
8
28
6
Peptide
27
31
1
41
4
82
6
2
1
1
2
6
.8
.2
-1 p-1 -1.1 2.1 2-M 2-M 2-M
p
.
rp
r
r
rp
17 1 7 rp1
W
O
PB
S
1 ug/ml
3 ug/ml
10 ug/ml
ELISA plates were coated with peptides at 1, 3 and 10 ug/ml or with PBS as negative control. S9 mAb was added and
the binding was detected by adding anti-mouse IgG-AP conjugate. Absorbance at 405 nm was observed. Note that
WO peptide represents the peptide from the wrong orientation of original S9 DNA sequence.
Figure 4. 10 Binding activities of peptides to S9 mAb
0.400
0.300
0.200
0.100
0.000
0.800
0.700
0.600
0.500
179
180
While there is a concentration dependent effect of the S9 peptide binding by S9
mAb, several of the peptides show very good binding even at the lowest concentration
tested, indicating a higher avidity interaction with S9 mab. The peptide representing the
wrong orientation of S9 DNA did not show binding activity to S9 mAb. Other peptides,
which showed strong binding activity when they were displayed on phage particles
(Figure 4.5, 4.6 and 4.7) showed low binding values.
To determine whether peptides are mimetic of the group B streptococcus (GBS)
determinant, we tested the ability of peptides to compete with S9 mAb binding to GBS.
Different concentrations of peptides were premixed with S9, SIIIS8.C3 or IIIIV18.C2
mAbs and allowed to incubate for 1 h at room temperature and then loaded onto plates
coated with GBS. The concentration of mAb used for the inhibition assay was in the
middle of the linear portion of the binding curve (Figure 4.8), which was 1/25,000 for S9,
1/250,000 for SIIIV18.C2 and 1/3,000 for SIIIS8.C3. The inhibition assay (Figure 4.11)
indicated that peptides which had stronger binding activity with S9 mAb when compared
to the original S9 peptide also were better inhibitors of binding of S9 mAb to GBS. There
was no inhibition when peptides, which had lower binding activity with S9 mAb than the
parental S9 peptide, were used as inhibitors. All peptides were better inhibitors of the
binding reaction between GBS and SIIIV18.C2 mAb IgM when compared with the
original S9 peptide (Figure 4.12). None of the peptides showed inhibition between GBS
and SIIIS8.C3 mAb IgG2a (Figure 4.13). The inhibition assay indicated that certain
modified S9 peptides can be better mimetic peptides than the original S9 peptide.
181
2.000
1.800
1.600
Optical Density 405 nm
1.400
1.200
1.000
0.800
0.600
0.400
0.200
0.000
0.004
0.02
0.1
0.5
2.5
Peptide Concentration (ug/ml)
Figure 4. 11 Inhibition Assay by Peptides of S9 mAb Binding to GBS
ELISA assays for peptide inhibition of mAb interaction with GBS were performed by
coating microtiter wells with GBS. The inhibition assay was performed by preincubation
of the S9 mAb with different peptide concentrations. S9 mAb ascites was diluted to
1/25,000. The mixture was allowed to incubate at room temperature for 1 h before
placing in wells. Red lines represent inhibition curves when peptides were used. The blue
line represents inhibition curve when S9 original peptide was used. The green line
represents inhibition curve when peptide from the wrong orientation S9 DNA sequence
was used.
182
1.400
1.200
Optical Density 405 nm
1.000
0.800
0.600
0.400
0.200
0.000
0.004
0.02
0.1
0.5
2.5
Peptide Concentration (ug/ml)
Figure 4. 12 Inhibition Assay by Peptides of SIIIV18.C2 mAb Binding to GBS
ELISA assays for peptide inhibition of mAb interaction with GBS were performed by
coating microtiter wells with GBS. The inhibition assay was performed by preincubation
of the mAb with different peptide concentrations. SIIIV18.C2 mAb was diluted to
1/250,000. The mixture was allowed to incubate at room temperature for 1 h before
placing in wells. Red lines represent inhibition curves when peptides were used. The blue
line represents inhibition curve when S9 original peptide was used. The green line
represents inhibition curve when peptide from the wrong orientation S9 DNA sequence
was used.
183
0.600
0.500
Optical Density 405 nm
0.400
0.300
0.200
0.100
0.000
0.004
0.02
0.1
0.5
2.5
PeptideConcentration(ug/ml)
Figure 4. 13 Inhibition Assay by Peptides of SIIIS8.C3 mAb Binding to GBS
ELISA assays for peptide inhibition of mAb interaction with GBS were performed by
coating microtiter wells with GBS. The inhibition assay was performed by preincubation
of the mAb with different peptide concentrations. SIIIS8.C3 mAb was diluted to 1/3,000.
The mixture was allowed to incubate at room temperature for 1 h before placing in wells.
Red lines represent inhibition curves when peptides were used. The blue line represents
inhibition curve when S9 original peptide was used. The green line represents inhibition
curve when peptide from the wrong orientation S9 DNA sequence was used.
184
Specificity of KLH-Peptides Conjugates
To determine whether multivalent peptides were more effective at inhibiting GBS
mab interactions, peptides were conjugated to the carrier protein KLH. We compared the
binding of several closely related anti-GBS mAb to different KLH-peptide conjugates by
ELISA (Figure 4.14). At the same protein concentration, KLH-S9 bound to mAbs more
strongly than the S9 peptide alone. Compared with KLH-S9 conjugate, KLH-219 bound
more strongly to S9 mAb. None of the KLH-peptides bound to S3.1A6, S3.2A6 and
S3.1B1, which detect a conformational carbohydrate determinant.
Optical Density 405 nm
4.000
KLH-S9
KLH-rp5
KLH-10
KLH-172
KLH-219
KLH-1.2
S9
KLH
GBS
3.500
3.000
2.500
2.000
1.500
1.000
0.500
0.000
S3.1A6 S3.1B1
SIII
SIIIV
S9 S3.2A6 anti-KLH PBS
S8.C3 18.C2 ascites
Monoclanal Antibody
Figure 4. 14 Binding Activity of KLH-Peptide Conjugates by a Panel of Anti-GBS mAb
ELISA plates were coated with KLH-peptide conjugates, S9 peptide, KLH or GBS. AntiGBS mabs, anti-KLH, or PBS as negative control, were added and the binding activity
was detected by adding anti-mouse IgG-AP conjugate. Absorbance at 405 nm was
observed.
185
Competitive ELISA s between the KLH-peptides and the S9 mAb was then
performed (Figure 4.15).
1.400
1.200
Optical Density 405 nm
1.000
KLH-S9
KLH-rp5
KLH-10
0.800
KLH-172
KLH-219
0.600
KLH-1.2
KLH
0.400
S9
0.200
0.000
0.000
0.001
0.010
0.100
1.000
Concentration (ug/ml)
Figure 4. 15 Inhibition Assay by KLH-Conjugates of S9 mAb Binding to GBS
GBS coated plates were blocked with ELISA blocking buffer overnight at 4°C. The
inhibition assay was performed by preincubation of the S9 mAb with different KLHpeptide concentrations. The mixture was allowed to incubate at room temperature for 1 h
before placing 100 ul of the mixture in wells and incubating 4°C overnight. The plates
were washed with ELISA washing buffer, and incubated with 100 ul of alkaline
phosphatase-conjugated anti-mouse Ig, followed by washing and addition of colorimetric
substrate p-nitrophenyl phosphate. Absorbance at 405 nm was read.
The competitive ELISA indicated that all KLH-peptides and S9 inhibit the
binding of S9 mAb to GBS. KLH-S9 gave greater inhibition of binding than did the
unconjugated peptide at higher concentrations, indicating that the multivalent ligand had
greater avidity, even though the free peptide gave greater inhibition at lower
186
concentrations, where there were more antigenic molecules and binding was not yet
saturated. Other peptide-KLH conjugates behaved as expected compared to the S9-KLH
conjugate.
Sequence Analysis of Peptides
Binding activity and sequence of the peptides described in this chapter are
summarized in table 4.3 and table 4.4. Table 4.3 displays peptides, which have one amino
acid different from the original S9 peptide. The data indicate that changes amino acid at
positions 3, 4, 5, 7, 8, 9, 10 resulted in a decrease in binding activity to S9 mAb
compared to the original S9 peptide. Changing amino acid at positions 1, 2, 6, 11 and 12
led to increased or unchanged binding activity compared to the original S9 peptide. Table
4.4 shows the information for peptides containing more than one amino acid different
from the original S9 peptide. ELISA data analysis was separated into three groups. Group
I represents a population of peptides with changes at positions 7, 8, 9 and 10. Group II
represents peptides with changes of positions 7, 8, 9 and 10 combined with changes at
other positions. Group III represents peptides with changes outside positions 7, 8, 9 and
10. Changing amino acids in positions 7, 8, 9 and 10 led to a reduction in binding by S9
mAb even though other changes are at positions 1, 2, 6, 11 and or 12, which alone may
have increased avidity. Group III indicates that amino acid combination changes in
positions outside 7, 8, 9 and 10 reduced or slightly reduced the binding activity by the S9
mAb.
187
Table 4. 3 Summary of Binding Activity and Sequence of Peptides Which Have One
Amino Acid Different from the Original S9 Peptide
peptide
S9
47
445
516
554
219
315
836
Rp-1.2
172M1
Rp2
32
310
712
819
443
Rp12
39
189
312
Rp5
150
Rp1.12
42
82
112
306
372
439
533
22
227
259
379
172M2
28
693
719
Rp1.15
144
168
311
192
414
520
Rp1.8
Rp2.10
Rp2.16
selection
Original
Random
Random
Random
Random
Random
Random
Random
Affinity
R+Syn*
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Affinity
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
R+Syn*
Random
Random
Random
Affinity
Random
Random
Random
Random
Random
Random
Affinity
Affinity
Affinity
1
F
L
C
S
V
2
D
3
T
4
G
Amino Acid Position
5
6
7
8
9
A F D P D
10
W
11
P
H
G
A
E
Y
P
S
A
R
K
A
V
T
G
S
I
C
L
E
H
V
N
Y
A
G
A
R
L
Q
T
E
V
A
G
G
R
S
T
S
A
R
Q
L
12
A
Binding
Activity
S
S/S/S
+
S
S/+
S/+
S/S/S/+
+
S/+
S/+
+
S/+
S/+
+
+
188
Table 4.3-Continued Summary of Binding Activity and Sequence of Peptides Which
Have One Amino Acid Different from the Original S9 Peptide
peptide
S9
10
278
318
820
selection
Original
Random
Random
Random
Random
1
F
2
D
3
T
4
G
Amino Acid Position
5
6
7
8
9
A F D P D
10
W
11
P
12
A
G
S
P
R
Binding
Activity
S
S/+
S
S
172 M1 and M2 are peptides modified from peptide 172. S, S/+, +, S/- and - represent
same, slightly increased, increased, slightly decreased, and decreased binding by S9 mAb
compared to the parental peptide.
Table 4. 4 Summary of Binding Activity and Sequence of Peptides Which Have More
than One Amino Acid Different from the Original S9 Peptide
peptide
S9
Group I
74
146
545
261
850
Group II
113
475
51
61
208
172
238
319
390
457
74
90
156
237
378
608
850
214
Rp2.13
selection
Origin
1
F
2
D
3
T
4
G
Amino Acid Position
5
6
7
8
9
A
F
D
P
D
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Random
Affinity
A
G
E
C
G
E
K
G
Y
G
H
S
H
A
A
S
A
M
L
V
P
G
Binding
activity
S
R
L
L
G
R
S
S
L
T
R
T
A
T
A
L
L
S
T
C
G
Y
A
N
E
12
A
-
G
E
K
G
C
I
11
P
T
L
A
Q
R
V
10
W
L
189
Table 4.4-Continued Summary of Binding Activity and Sequence of Peptides Which
Have More than One Amino Acid Different from the Original S9 Peptide
peptide
selection
S9
Origin
Group III
3
Random
121
Random
164
Random
173
Random
190
Random
204
Random
286
Random
291
Random
309
Random
332
Random
436
Random
612
Random
624
Random
650
Random
1
F
2
D
3
T
4
G
Amino Acid Position
5
6
7
8
9
A
F
D
P
D
10
W
11
P
A
P
G
V
V
D
S
N
A
L
L
S
L
C
V
Z
L
L
C
12
A
V
Q
A
S
T
E
G
E
A
P
Q
K
Binding
activity
S
S
S/S/-
Discussion
The peptide-display phage library technique has served as a powerful system to
identify mimetic peptides. In our lab, this technique has been used successfully to define
a mimotope of type III Streptococcus group B capsular polysaccharide epitope identified
by the protective antibody S9. This is designated the S9 peptide (1). Here in this study,
the technique was used to clarify the nature of the portion of the peptide bound by
antibody and to identify better antigen mimetic peptides. Phage fUSE2 vector, which has
been used in our study, originally was developed by Smith lab (237, 373, 375, 377-379)
and proved to be successful in identifying epitopes identified by antibodies to African
horsesickness virus (380), Hepatitis C virus (381), HIV (382), Bluetongue virus (383),
and the rickettsia, Cowdria ruminantium (384). The fUSE2 vector is a type 3 vector,
which accepts DNA inserts and encodes fusion protein of the pIII molecule. The foreign
190
peptides are displayed on all five pIII molecules on a virion (377). We decided to choose
the type 3 vectors because the type III vector can display long foreign peptides, whereas
the type 8 vector, which allows insertion of foreign peptides in pVIII molecules, can only
display short foreign peptides (242, 385). To achieve our aims, we created the modified
S9 sublibrary to have approximately one mutation in each inserted original S9 sequence.
Transforming the recombinant DNA into competent cells gave a low efficiency (4.85 x
104) compared to the Puc19 vector control (1011). This resulted in less diversity in the
library. However, the need for library diversity was not a priority in this study since the
library need only cover mutations in a 12-mer peptide. The diversity of our library was
further diminished according to the sequencing analysis. Most clones with inserts had an
unmutated version of the peptide encoding gene, indicating that our mutagenesis was less
efficient than hoped. Cloning the library into a single cloning site of the fUSE2 vector
resulted in two possible orientations giving 40.3% of transformant with foreign DNA
inserts in the correct orientation. The library in this study was small in size, but it was
large enough to analyze effects of amino acid changes in the 12 amino acid S9 peptide
and search for better mimetic peptides based on the original S9 sequence.
Affinity selection with the S9 mAb was used to seek out peptides with higher
binding activity. It has been shown that the yield in the first round of selection is very
important (375, 376). If the yield is not high enough in the first round (<1% of the input
phage), clones have a good chance of being lost (373). Even though, the yield in the first
round of the selection was low (5x105), the increasing yield in the second round of our
experiment indicated the success of affinity selection. In the third round of affinity
191
selection, the yield increased by 1 log suggesting that the phage population was saturated
with phages displaying high binding activity to S9 mAb. Sequencing analysis of clones
from the second and the third round of affinity selection revealed that the S9 original
sequence was found most commonly among the phage clones. Only six unique peptide
sequences were identified either in the second or the third round of affinity selection. The
peptides are RP1.2, RP1.12 and RP1.15 from the first round of selection and RP2.10,
RP2.13 and RP2.16 from the second round of selection. One unique deduced peptide,
RP1.8, was detected from both rounds of the selection (from 2 clones in the second round
and one clone in the final). Six out of seven phages selected by affinity selection showed
increased or equivalent binding by the S9 mab. One clone showed reduced S9 binding. It
has been shown that there is always a background of non-specifically bound phages,
especially when low stringency phage elution conditions are used, as we did (373, 386).
Even so, the affinity selection protocol appeared to select for phage with enhanced
binding by the mab, i.e. enhanced immunogenicity.
The relationship between peptide sequence and antibody binding is summarized
in tables 3.3 and 3.4. The data show that amino acid positions 7, 8, 9, 10 are most
important for binding activity by the S9 mAb. Changes in these positions resulted in
reductions in binding by the S9 mAb. In position 7 and 9, the original S9 residue is D,
which is an acidic amino acid. Even changing the residue from D to other acidic amino
acids, E and H, still led to reduced binding activity by the S9 mAb. In position 10, the
original residue is W, an aromatic amino acid. Changing this residue also led to reduced
binding. We do not know if a change to another aromatic amino acid would have
192
preserved binding. These results are consistent with the data reported by Johnson et al.
(277). These NMR studies of the S9 peptide, as bound by the S9 mAb, indicated that the
mAb bound to peptide residues 7 to 10, DPDW (Figure 4.16).
Figure 4. 16 Views of S9 mAb Bound Structure of the Peptide FDTGAFDPDWPA
(Peptide S9) (277)
Epitope mapping techniques and sequence analysis from anti-Id and phagedisplayed libraries have demonstrated that antibodies bind to an epitope of three to five
amino acids within a sequence. The fine specificity of some carbohydrate-binding
proteins maps to peptides containing central W/YXY residues (387-392). A protective
antibody against Cryptococcus neoformans glucuronoxylomannan selected phage
displaying a binding motif of TPXW(M/L)(M/L) (393). Peptide mimicry of the
carbohydrate epitope of Mycobacterium leprae is W(T/R)LGPY(V/M) (349). The peptide
motif, DPDW from the S9 is different but there are some similarities. There are aromatic
(W) and hydrophobic (W) residues. The acidic residue, D, may also imitate properties of
the GBS capsular saccharide epitope, in which sialic acid plays a key role.
193
Our study also found that AA positions 3 to 5, TGA, play an important role in
peptide binding. The mutation in this motif led to a reduction in binding activity by the
S9 mAb. In position 3, the original amino acid residue is T, a non-aromatic amino acid
with a hydroxyl group. Changing to S, which is also a non-aromatic amino acid with
hydroxyl groups, still led to a reduction in binding avidity. In position 4, the original
amino acid residue is G, which is an aliphatic amino acid. Changing to A still led to the
reduction in peptide avidity. In position 5, the original amino acid residue is A, another
aliphatic amino acid. Changing to V (peptide Rp12) or to G (peptide 189), also aliphatic
amino acids, led to reductions in peptide avidity, although less so with G than V. The
hydrophobicity of each amino acid residue may also play an important role: V is very
highly hydrophobic whereas the A and G possess less hydrophobicity. Thus the TGA
motif may possess hydrophobic properties that are important in antibody binding. This
result indicated that the peptide may imitate the hydrophobic properties of the native
bacterial capsule.
All data indicated that amino acid residues at positions 1, 11, and 12 are less
important in binding to the S9 mAb. But altering positions 2 and 6 can lead to increased
antibody binding. No single amino acid alteration in position 1 (F), 11 (P) and 12 (A) had
an effect on peptide binding by the S9 mAb. A combination of amino acid alterations in
these positions (peptide 332 and 624) led to slightly decreased peptide binding. Amino
acid alterations at position 2 led to unchanged or increased binding to the S9 mAb, which
depended upon the amino acid properties. In peptide 219, changing the amino acid from
D to H, which is more hydrophobic, resulted in increased binding activity to the S9 mAb.
194
Alteration of position 6 (F), which is aromatic and highly hydrophobic, to non-aromatic
but still highly hydrophobic amino acids (I,C,L) led to an increase in the binding activity
to the S9 mAb. It would be interesting to investigate the result of the amino acid
alteration from a hydrophobic to a non-hydrophobic amino acid in this position.
The results of sequence analysis of peptides obtained randomly, and by avidity
binding to the S9 mAb, were consistent. Five of seven phages from the affinity selection,
have amino acid alterations at positions 2, 6, 11 and/or 12 which resulted in increased
binding to the S9 mAb. Several phages with increased binding to the S9 Ab randomly
selected were not picked by the affinity selection. Several clones were lost during the
affinity selection process, and we did not fully explore the effects of different elution
methods
Data from our study indicated that peptides with stronger binding by S9 mAb also
were better inhibitors of the binding of S9 mAb to GBS. When peptides which had lower
binding than the parental peptide were used as inhibitors, no inhibition of the S9 mabGBS interaction was seen. The result implied that peptides with higher avidity for the S9
mAb are also better inhibitors of GBS binding to the S9 mAb. Peptides did not bind to
irrelevant antibodies, B6 (antibody against Candida albicans) and S11 (antibody against
Beta-C protein of type I and II GBS), showing that the peptides we isolated were specific
for the S9 mAb.
We next asked whether the peptides were bound by other mabs that react with
GBS type III polysaccharide. Antibody SIIIV18.C2 mAb (specific for the complete type
III CPS) bound a similar array of peptides as S9, whereas an antibody with similar
195
specificity, SIIIS8.C3, binds to none. Antibodies to the conformational type III CPS
epitope do not bind the peptides either. .
The results presented here indicated that phage peptide sublibraries can be
powerful tools for isolating high affinity peptides and mapping the original peptide
mimotope.Immunization with phages displaying these peptides (E. Moran, S.H. Pincus,
unpublished) did not lead to significantly higher anti-GBS titers than immunization with
the original S9 phage. At best, only a small fraction of the anti-peptide antibody is antiGBS. These results have implications for the design of peptide mimotope vaccines to
carbohydrate antigens.
196
CONCLUSION
Streptococcus group B, (GBS) is a major cause of neonatal sepsis and meningitis.
Even though the pathogen can be successfully treated with antibiotics, deaths due to
infection still occur (100, 342). The main virulence factor of GBS is capsular
polysaccharide (CPS), which is anti-phagocytic (94, 394). The antibody against CPS
confers protection against GBS infection (170, 194, 346). GBS vaccines using CPS alone
were of limited effectiveness. This is likely because CPS of GBS, as a carbohydrate
antigen, is a T-independent antigen resulting in low IgG induction and lack of
immunologic memory. Conjugation with protein carriers has improved its
immunogenicity and conferred protection against GBS infection (192, 195, 199).
To develop a vaccine against GBS, an alternative approach using a phage
displayed library was applied to search for a peptide that mimics the CPS of GBS. The S9
peptide, FDTGAFDPDWPA, was identified and shown to be both antigenic and
immunogenic. S9-KLH conjugate conferred antibody against S9 peptide and GBS (1).
In this study we continued the focus on GBS vaccine design. The goal of this
thesis research is first to enhance immunogenicity of the S9 peptide, second to investigate
the structural basis of the peptide mimicry of the GBS type III CPS carbohydrate epitope,
and third to identify better mimic peptides.
The standard method to improve immunogenicity of small peptides is by
conjugating them to protein carriers such as KLH and tetanus toxoid. In our study, we
used an alternative method by presenting the peptide on plant virus coat protein. Plant
viruses have been used as vaccine vectors to deliver peptides or small proteins to the
197
immune system (reviewed in reference (395)). There are two approaches to accomplish
these using recombinant techniques. The first strategy is to create replicative chimeric
virus expressing peptide by fusing the foreign protein to the virus coat protein. The
second approach is based on the property of virus coat proteins to self-assemble on
expression in bacteria, such as Escherichia coli or in yeast, such as Saccharomyces
cerevisiae or Pichia pastoris. In our study, Cowpea Chlorotic Mottle Virus (CCMV) was
chosen to carry the S9 peptide. The capsid of CCMV is composed of 180 copies of coat
protein subunits. The CCMV structure has been revealed by X-ray crystallography(317).
Based on the structure and X-ray crystallography, the Young lab has modified coat
protein gene at permissive sites for peptide insertion. Each site was located on the
exposed loop of CCMV coat protein. Nucleic acids encoding the peptide S9 were cloned
into each site in a separate construct. The RNA of the recombinant constructs was in vitro
transcribed and manually inoculated on the natural host, cowpea plant and tobacco. No
infection with chimeric virus was obtained. The result suggested that inserting peptide
into coat protein disrupted virus assembly process. The coat protein of CCMV can selfassemble in P. pastoris, a heterologous expression system, resulting in the formation of
virus-like particles (VLP). The cassettes of chimeric S9-coat protein genes for each
construct were subcloned into the P. pastoris expression plasmid pPicZa. The S9-CCMV
coat protein from each construct can be expressed inside the yeast cells. However, intact
recombinant VLP could not be purified from yeast cell debris, while the wild-type VLP
can be obtained easily. This data indicates that the insertion of the S9 into the CCMV
coat protein might cause virus to fall apart or disrupt viral assembly. We therefore
198
presented the S9 peptide on the CCMV coat protein via chemically conjugating CCMV
and S9 through chemical linkers. Two CCMV mutants were used in the coupling
reaction, salt stable mutant (ssCCMV) and SubE mutant. Because the ssCCMV (K42R)
can resist disassembly in 1.0M NaCl, pH 7.5 (319, 341) whereas the wild type CCMV is
only stable at pH4 and lower ionic strength, and the coupling reaction is done at the
higher pH and ionic strength, the salt stable mutant is the appropriate virion for
conjugation. The ssCCMV-S9 conjugation resulted in monomeric intact virions. SubE is
a mutant that cannot assemble virions, and thus serves as a control with the S9 peptide
conjugated to the monomeric coat protein. We next tested if the CCMV-S9 conjugate can
enhance S9 peptide immunogenicity. Mice were immunized, with or without adjuvant,
with different antigens, CCMV, CCMV-S9, SubE-S9, CPMV-S9 (kindly provided from
Dr. John E. Johnson), and KLH-S9. Mice immunized with CPMV-S9, CCMV-S9 and
KLH-S9 produced an antibody response to S9 and GBS without the help of adjuvant.
When adjuvant was used in the immunization, the antibody response was augmented.
SubE-S9 conjugate only induced an antibody response with the help of adjuvant. The
data suggested that organization of antigen is important in immunogenicity. In fact the
anti-S9 antibody response from mice immunized with CPMV-S9 conjugate was higher
than the response from mice immunized with KLH-S9 conjugate. The data suggested that
conjugation of peptide to virus coat protein created repetitive structures expressing the
peptide, leading to enhanced in immunogenicity.
The antigen-specific IgG subclass profile was characterized. Mice immunized
with both virus-S9 conjugates expressed predominant IgG2a, whereas mice immunized
199
with KLH-S9 conjugate produced predominant IgG1, suggesting Th1/Th2 bias with the
different carriers. The cytokine profile analysis confirmed this, showing that splenocytes
primed with CCMV or CCMV-S9 and then stimulated with CCMV or CCMV-S9
produced predominantly IFN-γ, whereas splenocytes primed with KLH-S9 and then
stimulated with KLH-S9 or KLH produced predominantly IL4 and IL10. These data
suggested that immunizing with virus particle expressing S9 provides a Th1 biased
response whereas immunization with protein, KLH-S9 induces a Th2 biased response.
Even though, the data indicates that CCMV is not suitable for use as vaccine
vector because insertion of peptides into the virus coat protein disrupts virus assembly,
this study elucidated immunological issues. The study indicated that organization and the
composition of the carrier for a peptide antigen is important to its immunogenicity.
Virions are particulate antigens, with repetition of the basic epitope, and may also have
accompanying nucleic acids. These differences appear to make them more immunogenic
than carrier proteins, and may also influence the Th1/Th2 orientation of the resulting
immune response. This knowledge could benefit vaccine design.
The second goal of the study was to characterize the structural basis of S9
mimetic antigen. To accomplish this goal, we designed a DNA sublibrary, expressing a
mutated version of the S9 peptide with 3% random nucleic acids at each position of the
original S9 nucleotide sequence, creating approximately one mutation in each inserted
sequence. By affinity selection, peptides with better binding activity to the S9 mAb were
obtained. By random selection, it was shown that phage clones with amino acid
alterations in positions 3-5 and 7-10 had reduction in S9 antibody binding activity. This
200
data indicates that these residues are involved in antibody binding of the peptide. These
findings are consistent with those of an NMR study of antibody binding to the S9 peptide
(277). The characterization of peptides with higher affinity for antibody showed that
changing certain amino acids to more hydrophobic amino acid residues increased
binding. This suggests that the S9 peptide mimics the hydrophobicity of the native
capsular polysaccharide.
In summary, this thesis examined an alternative approach toward GBS vaccine
development. Phage display libraries have been used in our study and proven to be a
powerful tool to search for peptides that mimic carbohydrate epitopes. The technique also
allows us to explore the structural basis of the mimetic peptide providing a better
understanding of the structural basis for mimicry epitope. By using CCMV plant virus as
a vaccine vector we also show that using particulate antigens influences the
immunogenicity of peptide antigens.
Our original goals in this study were to enhance the immunogencity of S9 as a
GBS mimetic and to study the structural basis of the peptide. Our results indicated that
we were not able to improve upon the original S9 in terms of eliciting an anti GBS
response. However, our studies have provided answers to the structural questions of S9
memetic structure.
201
REFERENCES CITED
1.
Pincus, S. H., M. J. Smith, H. J. Jennings, J. B. Burritt, and P. M. Glee. 1998.
Peptides that mimic the group B streptococcal type III capsular polysaccharide
antigen. Journal of Immunology 160:293-298.
2.
Schaechter, M., L. C. Madoff, and B. I. Eisenstein. 1993. Streptococci. In
Mechanisms of microbial disease, 2 ed. T. S. Satterfield, ed. Williams& Wilkins.
198-212.
3.
Hardie, J. M., and R. A. Whiley. 1997. Classification and overview of the genera
Streptococcus and Enterococcus. Society for Applied Bacteriology Symposium
Series 26:1S-11S.
4.
Jones, G. W., D. B. Clewell, L. G. Charles, and M. M. Vickerman. 1996. Multiple
phase variation in haemolytic, adhesive and antigenic properties of Streptococcus
gordonii. Microbiology 142 ( Pt 1):181-189.
5.
Kim, J. O., and J. N. Weiser. 1998. Association of intrastrain phase variation in
quantity of capsular polysaccharide and teichoic acid with the virulence of
Streptococcus pneumoniae. Journal of Infectious Diseases 177:368-377.
6.
Weiser, J. N. 1998. Phase variation in colony opacity by Streptococcus
pneumoniae. Microb Drug Resist 4:129-135.
7.
Weiser, J. N., Z. Markiewicz, E. I. Tuomanen, and J. H. Wani. 1996. Relationship
between phase variation in colony morphology, intrastrain variation in cell wall
physiology, and nasopharyngeal colonization by Streptococcus pneumoniae.
Infection and Immunity 64:2240-2245.
8.
Pincus, S. H., R. L. Cole, M. R. Wessels, M. D. Corwin, E. Kamanga-Sollo, S. F.
Hayes, W. Cieplak, Jr., and J. Swanson. 1992. Group B streptococcal opacity
variants. Journal of Bacteriology 174:3739-3749.
9.
Wannamaker, L. W. 1983. Streptococcal toxins. Reviews of Infectious Diseases 5
Suppl 4:S723-732.
10.
Palmer, M., I. Vulicevic, P. Saweljew, A. Valeva, M. Kehoe, and S. Bhakdi.
1998. Streptolysin O: a proposed model of allosteric interaction between a poreforming protein and its target lipid bilayer. Biochemistry 37:2378-2383.
202
11.
Kawakita, S., T. Takeuchi, J. Inoue, T. Onishi, and Y. Uemura. 1981. Infection of
group A streptococcus and antibody response to extracellular antigens. Japanese
Circulation Journal 45:1384-1390.
12.
Ginsburg, I. 1999. Is streptolysin S of group A streptococci a virulence factor?
APMIS 107:1051-1059.
13.
Wellstood, S. A. 1987. Rapid, cost-effective identification of group A
streptococci and enterococci by pyrrolidonyl-beta-naphthylamide hydrolysis.
Journal of Clinical Microbiology 25:1805-1806.
14.
Phillips, E. A., J. W. Tapsall, and D. D. Smith. 1980. Rapid tube CAMP test for
identification of Streptococcus agalactiae (Lancefield group B). Journal of
Clinical Microbiology 12:135-137.
15.
Darling, C. L. 1975. Standardization and evaluation of the CAMP reaction for the
prompt, presumptive identification of Streptococcus agalactiae (Lancefield group
B) in clinical material. Journal of Clinical Microbiology 1:171-174.
16.
Mundy, L. S., E. N. Janoff, K. E. Schwebke, C. J. Shanholtzer, and K. E. Willard.
1998. Ambiguity in the identification of Streptococcus pneumoniae. Optochin,
bile solubility, quellung, and the AccuProbe DNA probe tests. American Journal
of Clinical Pathology 109:55-61.
17.
Fertally, S. S., and R. Facklam. 1987. Comparison of physiologic tests used to
identify non-beta-hemolytic aerococci, enterococci, and streptococci. Journal of
Clinical Microbiology 25:1845-1850.
18.
Tao, L., I. C. Sutcliffe, R. R. Russell, and J. J. Ferretti. 1993. Cloning and
expression of the multiple sugar metabolism (msm) operon of Streptococcus
mutans in heterologous streptococcal hosts. Infection and Immunity 61:11211125.
19.
Thomas, T. D., and K. W. Turner. 1981. Carbohydrate Fermentation by
Streptococcus cremoris and Streptococcus lactis Growing in Agar Gels. Applied
and Environmental Microbiology 41:1289-1294.
20.
Efstratiou, A., and W. R. Maxted. 1979. Serological grouping of streptococci by
slide agglutination. Journal of Clinical Pathology 32:1228-1233.
21.
Herbst, H., D. Lavanchy, and D. G. Braun. 1983. Grouping of haemolytic
streptococci by monoclonal antibodies: determinant specificity, cross-reactivity
and affinity. Ann Immunol 134D:349-371.
203
22.
Lancefield, R. C. 1962. Current knowledge of type-specific M antigens of group
A streptococci. Journal of Immunology 89:307-313.
23.
Martin, J. M., and M. Green. 2006. Group A streptococcus. Semin Pediatr Infect
Dis 17:140-148.
24.
Mora, M., G. Bensi, S. Capo, F. Falugi, C. Zingaretti, A. G. Manetti, T. Maggi, A.
R. Taddei, G. Grandi, and J. L. Telford. 2005. Group A Streptococcus produce
pilus-like structures containing protective antigens and Lancefield T antigens.
Proceedings of the National Academy of Sciences of the United States of America
102:15641-15646.
25.
Moses, A. E., M. R. Wessels, K. Zalcman, S. Alberti, S. Natanson-Yaron, T.
Menes, and E. Hanski. 1997. Relative contributions of hyaluronic acid capsule
and M protein to virulence in a mucoid strain of the group A Streptococcus.
Infection and Immunity 65:64-71.
26.
Hanski, E., and M. Caparon. 1992. Protein F, a fibronectin-binding protein, is an
adhesin of the group A streptococcus Streptococcus pyogenes. Proceedings of the
National Academy of Sciences of the United States of America 89:6172-6176.
27.
Ellen, R. P., and R. J. Gibbons. 1972. M protein-associated adherence of
Streptococcus pyogenes to epithelial surfaces: prerequisite for virulence. Infection
and Immunity 5:826-830.
28.
Courtney, H. S., D. L. Hasty, Y. Li, H. C. Chiang, J. L. Thacker, and J. B. Dale.
1999. Serum opacity factor is a major fibronectin-binding protein and a virulence
determinant of M type 2 Streptococcus pyogenes. Molecular Microbiology 32:8998.
29.
Wessels, M. R., and M. S. Bronze. 1994. Critical role of the group A
streptococcal capsule in pharyngeal colonization and infection in mice.
Proceedings of the National Academy of Sciences of the United States of America
91:12238-12242.
30.
Schrager, H. M., J. G. Rheinwald, and M. R. Wessels. 1996. Hyaluronic acid
capsule and the role of streptococcal entry into keratinocytes in invasive skin
infection. Journal of Clinical Investigation 98:1954-1958.
31.
Dale, J. B., R. G. Washburn, M. B. Marques, and M. R. Wessels. 1996.
Hyaluronate capsule and surface M protein in resistance to opsonization of group
A streptococci. Infection and Immunity 64:1495-1501.
204
32.
Schrager, H. M., S. Alberti, C. Cywes, G. J. Dougherty, and M. R. Wessels. 1998.
Hyaluronic acid capsule modulates M protein-mediated adherence and acts as a
ligand for attachment of group A Streptococcus to CD44 on human keratinocytes.
Journal of Clinical Investigation 101:1708-1716.
33.
McKay, F. C., J. D. McArthur, M. L. Sanderson-Smith, S. Gardam, B. J. Currie,
K. S. Sriprakash, P. K. Fagan, R. J. Towers, M. R. Batzloff, G. S. Chhatwal, M.
Ranson, and M. J. Walker. 2004. Plasminogen binding by group A streptococcal
isolates from a region of hyperendemicity for streptococcal skin infection and a
high incidence of invasive infection. Infection and Immunity 72:364-370.
34.
Wang, H., R. Lottenberg, and M. D. Boyle. 1995. Analysis of the interaction of
group A streptococci with fibrinogen, streptokinase and plasminogen. Microbial
Pathogenesis 18:153-166.
35.
Wang, H., R. Lottenberg, and M. D. Boyle. 1995. A role for fibrinogen in the
streptokinase-dependent acquisition of plasmin(ogen) by group A streptococci.
Journal of Infectious Diseases 171:85-92.
36.
Pancholi, V., and V. A. Fischetti. 1993. Glyceraldehyde-3-phosphate
dehydrogenase on the surface of group A streptococci is also an ADP-ribosylating
enzyme. Proceedings of the National Academy of Sciences of the United States of
America 90:8154-8158.
37.
Pancholi, V., and V. A. Fischetti. 1998. alpha-enolase, a novel strong
plasmin(ogen) binding protein on the surface of pathogenic streptococci. Journal
of Biological Chemistry 273:14503-14515.
38.
Pancholi, V., and V. A. Fischetti. 1997. A novel plasminogen/plasmin binding
protein on the surface of group A streptococci. Advances in Experimental
Medicine and Biology 418:597-599.
39.
Stockbauer, K. E., D. Grigsby, X. Pan, Y. X. Fu, L. M. Mejia, A. Cravioto, and J.
M. Musser. 1998. Hypervariability generated by natural selection in an
extracellular complement-inhibiting protein of serotype M1 strains of group A
Streptococcus. Proceedings of the National Academy of Sciences of the United
States of America 95:3128-3133.
40.
Chiang-Ni, C., C. H. Wang, P. J. Tsai, W. J. Chuang, Y. S. Lin, M. T. Lin, C. C.
Liu, and J. J. Wu. 2006. Streptococcal pyrogenic exotoxin B causes mitochondria
damage to polymorphonuclear cells preventing phagocytosis of group A
streptococcus. Med Microbiol Immunol 195:55-63.
205
41.
Ohara-Nemoto, Y., M. Sasaki, M. Kaneko, T. Nemoto, and M. Ota. 1994.
Cysteine protease activity of streptococcal pyrogenic exotoxin B. Canadian
Journal of Microbiology 40:930-936.
42.
Kuo, C. F., J. J. Wu, K. Y. Lin, P. J. Tsai, S. C. Lee, Y. T. Jin, H. Y. Lei, and Y.
S. Lin. 1998. Role of streptococcal pyrogenic exotoxin B in the mouse model of
group A streptococcal infection. Infection and Immunity 66:3931-3935.
43.
Hidalgo-Grass, C., M. Dan-Goor, A. Maly, Y. Eran, L. A. Kwinn, V. Nizet, M.
Ravins, J. Jaffe, A. Peyser, A. E. Moses, and E. Hanski. 2004. Effect of a bacterial
pheromone peptide on host chemokine degradation in group A streptococcal
necrotising soft-tissue infections. Lancet 363:696-703.
44.
Matsubara, K., and T. Fukaya. 2007. The role of superantigens of group A
Streptococcus and Staphylococcus aureus in Kawasaki disease. Curr Opin Infect
Dis 20:298-303.
45.
Weiss, K. A., and M. Laverdiere. 1997. Group A Streptococcus invasive
infections: a review. Canadian Journal of Surgery 40:18-25.
46.
Sriskandan, S., L. Faulkner, and P. Hopkins. 2007. Streptococcus pyogenes:
Insight into the function of the streptococcal superantigens. International Journal
of Biochemistry and Cell Biology 39:12-19.
47.
Beachey, E. H., and W. A. Simpson. 1982. The adherence of group A streptococci
to oropharyngeal cells: the lipoteichoic acid adhesin and fibronectin receptor.
Infection 10:107-111.
48.
Beachey, E. H., and H. S. Courtney. 1987. Bacterial adherence: the attachment of
group A streptococci to mucosal surfaces. Reviews of Infectious Diseases 9 Suppl
5:S475-481.
49.
Courtney, H. S., J. B. Dale, and D. L. Hasty. 1997. Host cell specific adhesins of
group A streptococci. Advances in Experimental Medicine and Biology 418:605606.
50.
Beachey, E. H., and H. S. Courtney. 1989. Bacterial adherence of group A
streptococci to mucosal surfaces. Respiration 55 Suppl 1:33-40.
51.
Collin, M., and A. Olsen. 2003. Extracellular enzymes with immunomodulating
activities: variations on a theme in Streptococcus pyogenes. Infection and
Immunity 71:2983-2992.
206
52.
Stevens, D. L. 1997. The toxins of group A streptococcus, the flesh eating
bacteria. Immunological Investigations 26:129-150.
53.
Kaplan, M. H. 1979. Rheumatic fever, rheumatic heart disease, and the
streptococcal connection: the role of streptococcal antigens cross-reactive with
heart tissue. Reviews of Infectious Diseases 1:988-986.
54.
Stollerman, G. H. 1967. Prospects for a vaccine against group A streptococci: the
problem of the immunology of M proteins. Arthritis and Rheumatism 10:245-255.
55.
Vashishtha, A., and V. A. Fischetti. 1993. Surface-exposed conserved region of
the streptococcal M protein induces antibodies cross-reactive with denatured
forms of myosin. Journal of Immunology 150:4693-4701.
56.
El-Demellawy, M., R. El-Ridi, N. I. Guirguis, M. Abdel Alim, A. Kotby, and M.
Kotb. 1997. Preferential recognition of human myocardial antigens by T
lymphocytes from rheumatic heart disease patients. Infection and Immunity
65:2197-2205.
57.
Lymbury, R. S., C. Olive, K. A. Powell, M. F. Good, R. G. Hirst, J. T. LaBrooy,
and N. Ketheesan. 2003. Induction of autoimmune valvulitis in Lewis rats
following immunization with peptides from the conserved region of group A
streptococcal M protein. Journal of Autoimmunity 20:211-217.
58.
Mollick, J. A., G. G. Miller, J. M. Musser, R. G. Cook, D. Grossman, and R. R.
Rich. 1993. A novel superantigen isolated from pathogenic strains of
Streptococcus pyogenes with aminoterminal homology to staphylococcal
enterotoxins B and C. Journal of Clinical Investigation 92:710-719.
59.
Proft, T., P. D. Webb, V. Handley, and J. D. Fraser. 2003. Two novel
superantigens found in both group A and group C Streptococcus. Infection and
Immunity 71:1361-1369.
60.
Henrichsen, J. 1999. Typing of Streptococcus pneumoniae: past, present, and
future. American Journal of Medicine 107:50S-54S.
61.
Nielsen, S. V., U. B. Sørensen, and J. Henrichsen. 1993. Antibodies against
pneumococcal C-polysaccharide are not protective. Microbial Pathogenesis
14:299-305.
62.
Winkelstein, J. A. 1981. The role of complement in the host's defense against
Streptococcus pneumoniae. Reviews of Infectious Diseases 3:289-298.
207
63.
Jarva, H., T. S. Jokiranta, R. Würzner, and S. Meri. 2003. Complement resistance
mechanisms of streptococci. Molecular Immunology 40:95-107.
64.
Brown, E. J., S. W. Hosea, and M. M. Frank. 1983. The role of antibody and
complement in the reticuloendothelial clearance of pneumococci from the
bloodstream. Reviews of Infectious Diseases 5 Suppl 4:S797-805.
65.
Ren, B., M. A. McCrory, C. Pass, D. C. Bullard, C. M. Ballantyne, Y. Xu, D. E.
Briles, and A. J. Szalai. 2004. The virulence function of Streptococcus
pneumoniae surface protein A involves inhibition of complement activation and
impairment of complement receptor-mediated protection. Journal of Immunology
173:7506-7512.
66.
Paton, J. C., P. W. Andrew, G. J. Boulnois, and T. J. Mitchell. 1993. Molecular
analysis of the pathogenicity of Streptococcus pneumoniae: the role of
pneumococcal proteins. Annual Review of Microbiology 47:89-115.
67.
Kostyukova, N. N., M. O. Volkova, V. V. Ivanova, and A. S. Kvetnaya. 1995. A
study of pathogenic factors of Streptococcus pneumoniae strains causing
meningitis. FEMS Immunology and Medical Microbiology 10:133-137.
68.
Jedrzejas, M. J. 2001. Pneumococcal virulence factors: structure and function.
Microbiology and Molecular Biology Reviews 65:187-207 first page, table of
contents.
Rubins, J. B., and E. N. Janoff. 1998. Pneumolysin: a multifunctional
pneumococcal virulence factor. Journal of Laboratory and Clinical Medicine
131:21-27.
69.
70.
Feldman, C., R. Read, A. Rutman, P. K. Jeffery, A. Brain, V. Lund, T. J. Mitchell,
P. W. Andrew, G. J. Boulnois, H. C. Todd, and et al. 1992. The interaction of
Streptococcus pneumoniae with intact human respiratory mucosa in vitro.
European Respiratory Journal 5:576-583.
71.
Cundell, D. R., J. N. Weiser, J. Shen, A. Young, and E. I. Tuomanen. 1995.
Relationship between colonial morphology and adherence of Streptococcus
pneumoniae. Infection and Immunity 63:757-761.
72.
Barocchi, M. A., J. Ries, X. Zogaj, C. Hemsley, B. Albiger, A. Kanth, S.
Dahlberg, J. Fernebro, M. Moschioni, V. Masignani, K. Hultenby, A. R. Taddei,
K. Beiter, F. Wartha, A. von Euler, A. Covacci, D. W. Holden, S. Normark, R.
Rappuoli, and B. Henriques-Normark. 2006. A pneumococcal pilus influences
virulence and host inflammatory responses. Proceedings of the National Academy
of Sciences of the United States of America 103:2857-2862.
208
73.
Tong, H. H., L. M. Fisher, G. M. Kosunick, and T. F. Demaria. 1999. Effect of
tumor necrosis factor alpha and interleukin 1-alpha on the adherence of
Streptococcus pneumoniae to chinchilla tracheal epithelium. Acta Otolaryngol
119:78-82.
74.
Shah, M., R. M. Centor, and M. Jennings. 2007. Severe acute pharyngitis caused
by group C streptococcus. Journal of General Internal Medicine 22:272-274.
75.
Hashikawa, S., Y. Iinuma, M. Furushita, T. Ohkura, T. Nada, K. Torii, T.
Hasegawa, and M. Ohta. 2004. Characterization of group C and G streptococcal
strains that cause streptococcal toxic shock syndrome. Journal of Clinical
Microbiology 42:186-192.
76.
Jankowski, S., K. MacLachlan, J. Stephenson, and P. Thomas. 2002. Necrotising
infections and group G streptococcus. Lancet 359:2277.
77.
Flahaut, S., A. Hartke, J. C. Giard, A. Benachour, P. Boutibonnes, and Y.
Auffray. 1996. Relationship between stress response toward bile salts, acid and
heat treatment in Enterococcus faecalis. FEMS Microbiology Letters 138:49-54.
78.
Davis, D. R., J. B. McAlpine, C. J. Pazoles, M. K. Talbot, E. A. Alder, C. White,
B. M. Jonas, B. E. Murray, G. M. Weinstock, and B. L. Rogers. 2001.
Enterococcus faecalis multi-drug resistance transporters: application for antibiotic
discovery. Journal of Molecular Microbiology and Biotechnology 3:179-184.
79.
Bosley, G. S., R. R. Facklam, and D. Grossman. 1983. Rapid identification of
enterococci. Journal of Clinical Microbiology 18:1275-1277.
80.
Koranyi, K. I., R. Ray, V. D. Scott, and C. G. Wahoff. 1981. Meningitis caused
by a streptococcus of the viridans group. Clinical Pediatrics 20:526.
81.
1996. Prevention of perinatal group B streptococcal disease: a public health
perspective. In In Morbid. C. f. D. C. a. Prevention, ed. Morbid. Mortal. Wk. Rep.
1.
82.
Slotved, H. C., J. Elliott, T. Thompson, and H. B. Konradsen. 2003. Latex assay
for serotyping of group B Streptococcus isolates. Journal of Clinical
Microbiology 41:4445-4447.
83.
Ke, D., C. Menard, F. J. Picard, M. Boissinot, M. Ouellette, P. H. Roy, and M. G.
Bergeron. 2000. Development of conventional and real-time PCR assays for the
rapid detection of group B streptococci. Clinical Chemistry 46:324-331.
209
84.
Reglier-Poupet, H., G. Quesne, E. Le Theo, M. Dommergues, P. Berche, P. TrieuCuot, and C. Poyart. 2005. Prospective evaluation of a real-time PCR assay for
detection of group B streptococci in vaginal swabs from pregnant women.
European Journal of Clinical Microbiology and Infectious Diseases 24:355-357.
85.
Lancefield, R. C., and E. H. Freimer. 1966. Type-specific polysaccharide antigens
of group B streptococci. Journal of Hygiene 64:191-203.
86.
Michon, F., E. Katzenellenbogen, D. L. Kasper, and H. J. Jennings. 1987.
Structure of the complex group-specific polysaccharide of group B Streptococcus.
Biochemistry 26:476-486.
87.
Michon, F., R. Chalifour, R. Feldman, M. Wessels, D. L. Kasper, A. Gamian, V.
Pozsgay, and H. J. Jennings. 1991. The alpha-L-(1----2)-trirhamnopyranoside
epitope on the group-specific polysaccharide of group B streptococci. Infection
and Immunity 59:1690-1696.
88.
Anthony, B. F., N. F. Concepcion, and K. F. Concepcion. 1985. Human antibody
to the group-specific polysaccharide of group B Streptococcus. Journal of
Infectious Diseases 151:221-226.
89.
Jennings, H. J., E. Katzenellenbogen, C. Lugowski, and D. L. Kasper. 1983.
Structure of native polysaccharide antigens of type Ia and type Ib group B
Streptococcus. Biochemistry 22:1258-1264.
90.
Jennings, H. J., K. G. Rosell, E. Katzenellenbogen, and D. L. Kasper. 1983.
Structural determination of the capsular polysaccharide antigen of type II group B
Streptococcus. Journal of Biological Chemistry 258:1793-1798.
91.
Wessels, M. R., V. Pozsgay, D. L. Kasper, and H. J. Jennings. 1987. Structure and
immunochemistry of an oligosaccharide repeating unit of the capsular
polysaccharide of type III group B Streptococcus. A revised structure for the type
III group B streptococcal polysaccharide antigen. Journal of Biological Chemistry
262:8262-8267.
92.
Wessels, M. R., W. J. Benedi, H. J. Jennings, F. Michon, J. L. DiFabio, and D. L.
Kasper. 1989. Isolation and characterization of type IV group B Streptococcus
capsular polysaccharide. Infection and Immunity 57:1089-1094.
93.
Wessels, M. R., J. L. DiFabio, V. J. Benedi, D. L. Kasper, F. Michon, J. R.
Brisson, J. Jelinkova, and H. J. Jennings. 1991. Structural determination and
immunochemical characterization of the type V group B Streptococcus capsular
polysaccharide. Journal of Biological Chemistry 266:6714-6719.
210
94.
von Hunolstein, C., S. D'Ascenzi, B. Wagner, J. Jelinkova, G. Alfarone, S.
Recchia, M. Wagner, and G. Orefici. 1993. Immunochemistry of capsular type
polysaccharide and virulence properties of type VI Streptococcus agalactiae
(group B streptococci). Infection and Immunity 61:1272-1280.
95.
Kogan, G., D. Uhrin, J. R. Brisson, L. C. Paoletti, D. L. Kasper, C. von
Hunolstein, G. Orefici, and H. J. Jennings. 1994. Structure of the type VI group B
Streptococcus capsular polysaccharide determined by high resolution NMR.
Journal of carbohydrate chemistry 13:1071-1078.
96.
Kogan, G., J. R. Brisson, D. L. Kasper, C. von Hunolstein, G. Orefici, and H. J.
Jennings. 1995. Structural elucidation of the novel type VII group B
Streptococcus capsular polysaccharide by high resolution NMR spectroscopy.
Carbohydrate Research 277:1-9.
97.
Kogan, G., D. Uhrin, J. R. Brisson, L. C. Paoletti, A. E. Blodgett, D. L. Kasper,
and H. J. Jennings. 1996. Structural and immunochemical characterization of the
type VIII group B Streptococcus capsular polysaccharide. Journal of Biological
Chemistry 271:8786-8790.
98.
Pincus, S. H., R. L. Cole, E. Kamanga-Sollo, and S. H. Fischer. 1993. Interaction
of group B streptococcal opacity variants with the host defense system. Infection
and Immunity 61:3761-3768.
99.
Gibbs, R. S., S. Schrag, and A. Schuchat. 2004. Perinatal infections due to group
B streptococci. Obstetrics and Gynecology 104:1062-1076.
100.
Schuchat, A. 1998. Epidemiology of group B streptococcal disease in the United
States: shifting paradigms. Clinical Microbiology Reviews 11:497-513.
101.
Edwards, M. S., and C. J. Baker. 2005. Group B streptococcal infections in
elderly adults. Clinical Infectious Diseases 41:839-847.
102.
Farley, M. M. 2001. Group B streptococcal disease in nonpregnant adults.
Clinical Infectious Diseases 33:556-561.
103.
Munoz, P., A. Llancaqueo, M. Rodriguez-Creixems, T. Pelaez, L. Martin, and E.
Bouza. 1997. Group B streptococcus bacteremia in nonpregnant adults. Archives
of Internal Medicine 157:213-216.
104.
Kotiw, M., G. W. Zhang, G. Daggard, E. Reiss-Levy, J. W. Tapsall, and A.
Numa. 2003. Late-onset and recurrent neonatal Group B streptococcal disease
associated with breast-milk transmission. Pediatric and Developmental Pathology
6:251-256.
211
105.
Clay, L. S. 1996. Group B streptococcus in the perinatal period. A review.
Journal of Nurse-Midwifery 41:355-363.
106.
Platt, J. S., and W. F. O'Brien. 2003. Group B streptococcus: prevention of earlyonset neonatal sepsis. Obstetrical and Gynecological Survey 58:191-196.
107.
Munoz, P., T. Coque, M. Rodriguez Creixems, J. C. Bernaldo de Quiros, S.
Moreno, and E. Bouza. 1992. Group B Streptococcus: a cause of urinary tract
infection in nonpregnant adults. Clinical Infectious Diseases 14:492-496.
108.
Ferrieri, P., P. P. Cleary, and A. E. Seeds. 1977. Epidemiology of group-B
streptococcal carriage in pregnant women and newborn infants. Journal of
Medical Microbiology 10:103-114.
109.
Anthony, B. F., D. M. Okada, and C. J. Hobel. 1978. Epidemiology of group B
Streptococcus: longitudinal observations during pregnancy. Journal of Infectious
Diseases 137:524-530.
110.
Anthony, B. F., D. M. Okada, and C. J. Hobel. 1979. Epidemiology of the group
B streptococcus: maternal and nosocomial sources for infant acquisitions. Journal
of Pediatrics 95:431-436.
111.
Gray, B. M., D. G. Pritchard, and H. C. Dillon, Jr. 1989. Seroepidemiology of
group B streptococcus type III colonization at delivery. Journal of Infectious
Diseases 159:1139-1142.
112.
Nagano, Y., N. Nagano, S. Takahashi, K. Murono, K. Fujita, F. Taguchi, and Y.
Okuwaki. 1991. Restriction endonuclease digest patterns of chromosomal DNA
from group B beta-haemolytic streptococci. Journal of Medical Microbiology
35:297-303.
113.
Henneke, P., S. Morath, S. Uematsu, S. Weichert, M. Pfitzenmaier, O. Takeuchi,
A. Muller, C. Poyart, S. Akira, R. Berner, G. Teti, A. Geyer, T. Hartung, P. TrieuCuot, D. L. Kasper, and D. T. Golenbock. 2005. Role of lipoteichoic acid in the
phagocyte response to group B streptococcus. Journal of Immunology 174:64496455.
114.
Goldschmidt, J. C., Jr., and C. Panos. 1984. Teichoic acids of Streptococcus
agalactiae: chemistry, cytotoxicity, and effect on bacterial adherence to human
cells in tissue culture. Infection and Immunity 43:670-677.
212
115.
Spellerberg, B., E. Rozdzinski, S. Martin, J. Weber-Heynemann, N. Schnitzler, R.
Lutticken, and A. Podbielski. 1999. Lmb, a protein with similarities to the LraI
adhesin family, mediates attachment of Streptococcus agalactiae to human
laminin. Infection and Immunity 67:871-878.
116.
Schubert, A., K. Zakikhany, G. Pietrocola, A. Meinke, P. Speziale, B. J.
Eikmanns, and D. J. Reinscheid. 2004. The fibrinogen receptor FbsA promotes
adherence of Streptococcus agalactiae to human epithelial cells. Infection and
Immunity 72:6197-6205.
117.
Schubert, A., K. Zakikhany, M. Schreiner, R. Frank, B. Spellerberg, B. J.
Eikmanns, and D. J. Reinscheid. 2002. A fibrinogen receptor from group B
Streptococcus interacts with fibrinogen by repetitive units with novel ligand
binding sites. Molecular Microbiology 46:557-569.
118.
Tamura, G. S., and A. Nittayajarn. 2000. Group B streptococci and other grampositive cocci bind to cytokeratin 8. Infection and Immunity 68:2129-2134.
119.
Wibawan, I. T., C. Lammler, and F. H. Pasaribu. 1992. Role of hydrophobic
surface proteins in mediating adherence of group B streptococci to epithelial cells.
Journal of General Microbiology 138:1237-1242.
120.
Harris, T. O., D. W. Shelver, J. F. Bohnsack, and C. E. Rubens. 2003. A novel
streptococcal surface protease promotes virulence, resistance to
opsonophagocytosis, and cleavage of human fibrinogen. Journal of Clinical
Investigation 111:61-70.
121.
Nizet, V., K. S. Kim, M. Stins, M. Jonas, E. Y. Chi, D. Nguyen, and C. E.
Rubens. 1997. Invasion of brain microvascular endothelial cells by group B
streptococci. Infection and Immunity 65:5074-5081.
122.
Rubens, C. E., S. Smith, M. Hulse, E. Y. Chi, and G. van Belle. 1992. Respiratory
epithelial cell invasion by group B streptococci. Infection and Immunity 60:51575163.
123.
La Penta, D., P. Framson, V. Nizet, and C. Rubens. 1997. Epithelial cell invasion
by group B streptococci is important to virulence. Advances in Experimental
Medicine and Biology 418:631-634.
124.
Winram, S. B., M. Jonas, E. Chi, and C. E. Rubens. 1998. Characterization of
group B streptococcal invasion of human chorion and amnion epithelial cells In
vitro. Infection and Immunity 66:4932-4941.
213
125.
Valentin-Weigand, P., H. Jungnitz, A. Zock, M. Rohde, and G. S. Chhatwal.
1997. Characterization of group B streptococcal invasion in HEp-2 epithelial
cells. FEMS Microbiology Letters 147:69-74.
126.
Gibson, R. L., M. K. Lee, C. Soderland, E. Y. Chi, and C. E. Rubens. 1993.
Group B streptococci invade endothelial cells: type III capsular polysaccharide
attenuates invasion. Infection and Immunity 61:478-485.
127.
Baron, M. J., G. R. Bolduc, M. B. Goldberg, T. C. Auperin, and L. C. Madoff.
2004. Alpha C protein of group B Streptococcus binds host cell surface
glycosaminoglycan and enters cells by an actin-dependent mechanism. Journal of
Biological Chemistry 279:24714-24723.
128.
Stalhammar-Carlemalm, M., L. Stenberg, and G. Lindahl. 1993. Protein rib: a
novel group B streptococcal cell surface protein that confers protective immunity
and is expressed by most strains causing invasive infections. Journal of
Experimental Medicine 177:1593-1603.
129.
Areschoug, T., M. Stalhammar-Carlemalm, C. Larsson, and G. Lindahl. 1999.
Group B streptococcal surface proteins as targets for protective antibodies:
identification of two novel proteins in strains of serotype V. Infection and
Immunity 67:6350-6357.
130.
Lachenauer, C. S., and L. C. Madoff. 1996. A protective surface protein from type
V group B streptococci shares N-terminal sequence homology with the alpha C
protein. Infection and Immunity 64:4255-4260.
131.
Adderson, E. E., S. Takahashi, Y. Wang, J. Armstrong, D. V. Miller, and J. F.
Bohnsack. 2003. Subtractive hybridization identifies a novel predicted protein
mediating epithelial cell invasion by virulent serotype III group B Streptococcus
agalactiae. Infection and Immunity 71:6857-6863.
132.
Gutekunst, H., B. J. Eikmanns, and D. J. Reinscheid. 2004. The novel fibrinogenbinding protein FbsB promotes Streptococcus agalactiae invasion into epithelial
cells. Infection and Immunity 72:3495-3504.
133.
Herbert, M. A., C. J. Beveridge, and N. J. Saunders. 2004. Bacterial virulence
factors in neonatal sepsis: group B streptococcus. Curr Opin Infect Dis 17:225229.
134.
Cunningham, M. W. 2000. Pathogenesis of group A streptococcal infections.
Clinical Microbiology Reviews 13:470-511.
214
135.
Jiang, S. M., M. J. Cieslewicz, D. L. Kasper, and M. R. Wessels. 2005.
Regulation of virulence by a two-component system in group B streptococcus.
Journal of Bacteriology 187:1105-1113.
136.
Hulse, M. L., S. Smith, E. Y. Chi, A. Pham, and C. E. Rubens. 1993. Effect of
type III group B streptococcal capsular polysaccharide on invasion of respiratory
epithelial cells. Infection and Immunity 61:4835-4841.
137.
Gibson, R. L., C. Soderland, W. R. Henderson, Jr., E. Y. Chi, and C. E. Rubens.
1995. Group B streptococci (GBS) injure lung endothelium in vitro: GBS
invasion and GBS-induced eicosanoid production is greater with microvascular
than with pulmonary artery cells. Infection and Immunity 63:271-279.
138.
Johri, A. K., J. Padilla, G. Malin, and L. C. Paoletti. 2003. Oxygen regulates
invasiveness and virulence of group B streptococcus. Infection and Immunity
71:6707-6711.
139.
Nizet, V., R. L. Gibson, E. Y. Chi, P. E. Framson, M. Hulse, and C. E. Rubens.
1996. Group B streptococcal beta-hemolysin expression is associated with injury
of lung epithelial cells. Infection and Immunity 64:3818-3826.
140.
Jackson, R. J., M. L. Dao, and D. V. Lim. 1994. Cell-associated collagenolytic
activity by group B streptococci. Infection and Immunity 62:5647-5651.
141.
Pritchard, D. G., J. O. Trent, X. Li, P. Zhang, M. L. Egan, and J. R. Baker. 2000.
Characterization of the active site of group B streptococcal hyaluronan lyase.
Proteins 40:126-134.
142.
Baker, J. R., and D. G. Pritchard. 2000. Action pattern and substrate specificity of
the hyaluronan lyase from group B streptococci. Biochemical Journal 348 Pt
2:465-471.
143.
Edwards, M. S., D. L. Kasper, H. J. Jennings, C. J. Baker, and A. NicholsonWeller. 1982. Capsular sialic acid prevents activation of the alternative
complement pathway by type III, group B streptococci. Journal of Immunology
128:1278-1283.
144.
Lewis, A. L., V. Nizet, and A. Varki. 2004. Discovery and characterization of
sialic acid O-acetylation in group B Streptococcus. Proceedings of the National
Academy of Sciences of the United States of America 101:11123-11128.
145.
Takahashi, S., Y. Aoyagi, E. E. Adderson, Y. Okuwaki, and J. F. Bohnsack. 1999.
Capsular sialic acid limits C5a production on type III group B streptococci.
Infection and Immunity 67:1866-1870.
215
146.
Jerlstrom, P. G., S. R. Talay, P. Valentin-Weigand, K. N. Timmis, and G. S.
Chhatwal. 1996. Identification of an immunoglobulin A binding motif located in
the beta-antigen of the c protein complex of group B streptococci. Infection and
Immunity 64:2787-2793.
147.
Jarva, H., J. Hellwage, T. S. Jokiranta, M. J. Lehtinen, P. F. Zipfel, and S. Meri.
2004. The group B streptococcal beta and pneumococcal Hic proteins are
structurally related immune evasion molecules that bind the complement inhibitor
factor H in an analogous fashion. Journal of Immunology 172:3111-3118.
148.
Poyart, C., E. Pellegrini, M. Marceau, M. Baptista, F. Jaubert, M. C. Lamy, and P.
Trieu-Cuot. 2003. Attenuated virulence of Streptococcus agalactiae deficient in
D-alanyl-lipoteichoic acid is due to an increased susceptibility to defensins and
phagocytic cells. Molecular Microbiology 49:1615-1625.
149.
Poyart, C., E. Pellegrini, O. Gaillot, C. Boumaila, M. Baptista, and P. Trieu-Cuot.
2001. Contribution of Mn-cofactored superoxide dismutase (SodA) to the
virulence of Streptococcus agalactiae. Infection and Immunity 69:5098-5106.
150.
Fettucciari, K., E. Rosati, L. Scaringi, P. Cornacchione, G. Migliorati, R. Sabatini,
I. Fetriconi, R. Rossi, and P. Marconi. 2000. Group B Streptococcus induces
apoptosis in macrophages. Journal of Immunology 165:3923-3933.
151.
Fettucciari, K., I. Fetriconi, R. Mannucci, I. Nicoletti, A. Bartoli, S. Coaccioli,
and P. Marconi. 2006. Group B Streptococcus induces macrophage apoptosis by
calpain activation. Journal of Immunology 176:7542-7556.
152.
Ulett, G. C., and E. E. Adderson. 2005. Nitric oxide is a key determinant of group
B streptococcus-induced murine macrophage apoptosis. Journal of Infectious
Diseases 191:1761-1770.
153.
Kwak, D. J., N. H. Augustine, W. G. Borges, J. L. Joyner, W. F. Green, and H. R.
Hill. 2000. Intracellular and extracellular cytokine production by human mixed
mononuclear cells in response to group B streptococci. Infection and Immunity
68:320-327.
154.
Rosati, E., K. Fettucciari, L. Scaringi, P. Cornacchione, R. Sabatini, L.
Mezzasoma, R. Rossi, and P. Marconi. 1998. Cytokine response to group B
streptococcus infection in mice. Scandinavian Journal of Immunology 47:314323.
216
155.
Vallejo, J. G., P. Knuefermann, D. L. Mann, and N. Sivasubramanian. 2000.
Group B Streptococcus induces TNF-alpha gene expression and activation of the
transcription factors NF-kappa B and activator protein-1 in human cord blood
monocytes. Journal of Immunology 165:419-425.
156.
Levy, O., R. M. Jean-Jacques, C. Cywes, R. B. Sisson, K. A. Zarember, P. J.
Godowski, J. L. Christianson, H. K. Guttormsen, M. C. Carroll, A. NicholsonWeller, and M. R. Wessels. 2003. Critical role of the complement system in group
B streptococcus-induced tumor necrosis factor alpha release. Infection and
Immunity 71:6344-6353.
157.
Vallejo, J. G., C. J. Baker, and M. S. Edwards. 1996. Roles of the bacterial cell
wall and capsule in induction of tumor necrosis factor alpha by type III group B
streptococci. Infection and Immunity 64:5042-5046.
158.
Medvedev, A. E., T. Flo, R. R. Ingalls, D. T. Golenbock, G. Teti, S. N. Vogel,
and T. Espevik. 1998. Involvement of CD14 and complement receptors CR3 and
CR4 in nuclear factor-kappaB activation and TNF production induced by
lipopolysaccharide and group B streptococcal cell walls. Journal of Immunology
160:4535-4542.
159.
Goodrum, K. J., L. L. McCormick, and B. Schneider. 1994. Group B
streptococcus-induced nitric oxide production in murine macrophages is CR3
(CD11b/CD18) dependent. Infection and Immunity 62:3102-3107.
160.
Maloney, C. G., S. D. Thompson, H. R. Hill, J. F. Bohnsack, T. M. McIntyre, and
G. A. Zimmerman. 2000. Induction of cyclooxygenase-2 by human monocytes
exposed to group B streptococci. Journal of Leukocyte Biology 67:615-621.
161.
Mancuso, G., V. Cusumano, F. Genovese, M. Gambuzza, C. Beninati, and G.
Teti. 1997. Role of interleukin 12 in experimental neonatal sepsis caused by group
B streptococci. Infection and Immunity 65:3731-3735.
162.
Schrag, S. J., R. Gorwitz, K. Fultz-Butts, and A. Schuchat. 2002. Prevention of
perinatal group B streptococcal disease: revised guidelines. C. f. D. C. a.
Prevention, ed. Morbid. Mortal. Wk. Rep. 1.
163.
Logsdon, B. A., and D. T. Casto. 1997. Prevention of group B Streptococcus
infection in neonates. Annals of Pharmacotherapy 31:897-906.
164.
Alkalay, A. L., P. A. Brunell, J. S. Greenspon, and J. J. Pomerance. 1996.
Management of neonates born to mothers with group B streptococcus
colonization. Journal of Perinatology 16:470-477.
217
165.
Schrag, S. J., S. Zywicki, M. M. Farley, A. L. Reingold, L. H. Harrison, L. B.
Lefkowitz, J. L. Hadler, R. Danila, P. R. Cieslak, and A. Schuchat. 2000. Group B
streptococcal disease in the era of intrapartum antibiotic prophylaxis. New
England Journal of Medicine 342:15-20.
166.
Yang, Y. J., C. C. Liu, and S. M. Wang. 1998. Group B streptococcal infections in
children: the changing spectrum of infections in infants. Journal of Microbiology,
Immunology, and Infection 31:107-112.
167.
Heelan, J. S., M. E. Hasenbein, and A. J. McAdam. 2004. Resistance of group B
streptococcus to selected antibiotics, including erythromycin and clindamycin.
Journal of Clinical Microbiology 42:1263-1264.
168.
Baker, C. J., and D. L. Kasper. 1976. Correlation of maternal antibody deficiency
with susceptibility to neonatal group B streptococcal infection. New England
Journal of Medicine 294:753-756.
169.
Baker, C. J., M. A. Rench, and D. L. Kasper. 1990. Response to type III
polysaccharide in women whose infants have had invasive group B streptococcal
infection. New England Journal of Medicine 322:1857-1860.
170.
Lancefield, R. C., M. McCarty, and W. N. Everly. 1975. Multiple mouseprotective antibodies directed against group B streptococci. Special reference to
antibodies effective against protein antigens. Journal of Experimental Medicine
142:165-179.
171.
Lancefield, R. C. 1938. Two serological types of group B hemolytic streptococci
with relatd, but not idntical type specific substances. Journal of Experimental
Medicine 67:25.
172.
Pincus, S. H., A. O. Shigeoka, A. A. Moe, L. P. Ewing, and H. R. Hill. 1988.
Protective efficacy of IgM monoclonal antibodies in experimental group B
streptococcal infection is a function of antibody avidity. Journal of Immunology
140:2779-2785.
173.
Shigeoka, A. O., S. H. Pincus, N. S. Rote, D. G. Pritchard, J. I. Santos, and H. R.
Hill. 1985. Monoclonal antibody preparations for immunotherapy of experimental
GBS infection. Antibiotics and Chemotherapy 35:254-266.
174.
Shigeoka, A. O., S. H. Pincus, N. S. Rote, and H. R. Hill. 1984. Protective
efficacy of hybridoma type-specific antibody against experimental infection with
group-B Streptococcus. Journal of Infectious Diseases 149:363-372.
218
175.
Egan, M. L., D. G. Pritchard, H. C. Dillon, Jr., and B. M. Gray. 1983. Protection
of mice from experimental infection with type III group B Streptococcus using
monoclonal antibodies. Journal of Experimental Medicine 158:1006-1011.
176.
Raff, H. V., P. J. Siscoe, E. A. Wolff, G. Maloney, and W. Shuford. 1988. Human
monoclonal antibodies to group B streptococcus. Reactivity and in vivo protection
against multiple serotypes. Journal of Experimental Medicine 168:905-917.
177.
Madoff, L. C., J. L. Michel, and D. L. Kasper. 1991. A monoclonal antibody
identifies a protective C-protein alpha-antigen epitope in group B streptococci.
Infection and Immunity 59:204-210.
178.
Christensen, K. K., P. Christensen, G. Duc, W. H. Hitzig, V. Linden, B. Muller,
and R. A. Seger. 1984. Human IgG antibodies to carbohydrate and protein
antigens in mouse protection tests with group B streptococci. Pediatric Research
18:478-482.
179.
Rubens, C. E., M. R. Wessels, L. M. Heggen, and D. L. Kasper. 1987. Transposon
mutagenesis of type III group B Streptococcus: correlation of capsule expression
with virulence. Proceedings of the National Academy of Sciences of the United
States of America 84:7208-7212.
180.
Marques, M. B., D. L. Kasper, M. K. Pangburn, and M. R. Wessels. 1992.
Prevention of C3 deposition by capsular polysaccharide is a virulence mechanism
of type III group B streptococci. Infection and Immunity 60:3986-3993.
181.
Campbell, J. R., C. J. Baker, T. G. Metzger, and M. S. Edwards. 1988. Functional
activity of class-specific antibodies to type III, group B streptococcus. Pediatric
Research 23:31-34.
182.
Edwards, M. S., C. J. Baker, and D. L. Kasper. 1979. Opsonic specificity of
human antibody to the type III polysaccharide of group B Streptococcus. Journal
of Infectious Diseases 140:1004-1008.
183.
Edwards, M. S., A. Nicholson-Weller, C. J. Baker, and D. L. Kasper. 1980. The
role of specific antibody in alternative complement pathway-mediated
opsonophagocytosis of type III, group B Streptococcus. Journal of Experimental
Medicine 151:1275-1287.
184.
Gravekamp, C., D. L. Kasper, J. L. Michel, D. E. Kling, V. Carey, and L. C.
Madoff. 1997. Immunogenicity and protective efficacy of the alpha C protein of
group B streptococci are inversely related to the number of repeats. Infection and
Immunity 65:5216-5221.
219
185.
Gravekamp, C., D. L. Kasper, L. C. Paoletti, and L. C. Madoff. 1999. Alpha C
protein as a carrier for type III capsular polysaccharide and as a protective protein
in group B streptococcal vaccines. Infection and Immunity 67:2491-2496.
186.
Cheng, Q., B. Carlson, S. Pillai, R. Eby, L. Edwards, S. B. Olmsted, and P.
Cleary. 2001. Antibody against surface-bound C5a peptidase is opsonic and
initiates macrophage killing of group B streptococci. Infection and Immunity
69:2302-2308.
187.
Brodeur, B. R., M. Boyer, I. Charlebois, J. Hamel, F. Couture, C. R. Rioux, and
D. Martin. 2000. Identification of group B streptococcal Sip protein, which elicits
cross-protective immunity. Infection and Immunity 68:5610-5618.
188.
Moyo, S. R., J. A. Maeland, and R. V. Lyng. 2001. The putative R1 protein of
Streptococcus agalactiae as serotype marker and target of protective antibodies.
APMIS 109:842-848.
189.
Erdogan, S., P. K. Fagan, S. R. Talay, M. Rohde, P. Ferrieri, A. E. Flores, C. A.
Guzman, M. J. Walker, and G. S. Chhatwal. 2002. Molecular analysis of group B
protective surface protein, a new cell surface protective antigen of group B
streptococci. Infection and Immunity 70:803-811.
190.
Baker, C. J., M. S. Edwards, and D. L. Kasper. 1978. Immunogenicity of
polysaccharides from type III, group B Streptococcus. Journal of Clinical
Investigation 61:1107-1110.
191.
Baker, C. J., M. A. Rench, M. S. Edwards, R. J. Carpenter, B. M. Hays, and D. L.
Kasper. 1988. Immunization of pregnant women with a polysaccharide vaccine of
group B streptococcus. New England Journal of Medicine 319:1180-1185.
192.
Lagergard, T., J. Shiloach, J. B. Robbins, and R. Schneerson. 1990. Synthesis and
immunological properties of conjugates composed of group B streptococcus type
III capsular polysaccharide covalently bound to tetanus toxoid. Infection and
Immunity 58:687-694.
193.
Wessels, M. R., L. C. Paoletti, D. L. Kasper, J. L. DiFabio, F. Michon, K. Holme,
and H. J. Jennings. 1990. Immunogenicity in animals of a polysaccharide-protein
conjugate vaccine against type III group B Streptococcus. Journal of Clinical
Investigation 86:1428-1433.
194.
Marques, M. B., D. L. Kasper, A. Shroff, F. Michon, H. J. Jennings, and M. R.
Wessels. 1994. Functional activity of antibodies to the group B polysaccharide of
group B streptococci elicited by a polysaccharide-protein conjugate vaccine.
Infection and Immunity 62:1593-1599.
220
195.
Kasper, D. L., L. C. Paoletti, M. R. Wessels, H. K. Guttormsen, V. J. Carey, H. J.
Jennings, and C. J. Baker. 1996. Immune response to type III group B
streptococcal polysaccharide-tetanus toxoid conjugate vaccine. Journal of
Clinical Investigation 98:2308-2314.
196.
Paoletti, L. C., R. C. Kennedy, T. C. Chanh, and D. L. Kasper. 1996.
Immunogenicity of group B Streptococcus type III polysaccharide-tetanus toxoid
vaccine in baboons. Infection and Immunity 64:677-679.
197.
Baker, C. J., M. A. Rench, M. Fernandez, L. C. Paoletti, D. L. Kasper, and M. S.
Edwards. 2003. Safety and immunogenicity of a bivalent group B streptococcal
conjugate vaccine for serotypes II and III. Journal of Infectious Diseases 188:6673.
198.
Paoletti, L. C., M. R. Wessels, A. K. Rodewald, A. A. Shroff, H. J. Jennings, and
D. L. Kasper. 1994. Neonatal mouse protection against infection with multiple
group B streptococcal (GBS) serotypes by maternal immunization with a
tetravalent GBS polysaccharide-tetanus toxoid conjugate vaccine. Infection and
Immunity 62:3236-3243.
199.
Shen, X., T. Lagergard, Y. Yang, M. Lindblad, M. Fredriksson, and J. Holmgren.
2000. Systemic and mucosal immune responses in mice after mucosal
immunization with group B streptococcus type III capsular polysaccharidecholera toxin B subunit conjugate vaccine. Infection and Immunity 68:5749-5755.
200.
Shen, X., T. Lagergard, Y. Yang, M. Lindblad, M. Fredriksson, and J. Holmgren.
2001. Group B Streptococcus capsular polysaccharide-cholera toxin B subunit
conjugate vaccines prepared by different methods for intranasal immunization.
Infection and Immunity 69:297-306.
201.
Shen, X., T. Lagergard, Y. Yang, M. Lindblad, M. Fredriksson, and J. Holmgren.
2000. Preparation and preclinical evaluation of experimental group B
streptococcus type III polysaccharide-cholera toxin B subunit conjugate vaccine
for intranasal immunization. Vaccine 19:850-861.
202.
Larsson, C., M. Stalhammar-Carlemalm, and G. Lindahl. 1996. Experimental
vaccination against group B streptococcus, an encapsulated bacterium, with
highly purified preparations of cell surface proteins Rib and alpha. Infection and
Immunity 64:3518-3523.
203.
Martin, D., S. Rioux, E. Gagnon, M. Boyer, J. Hamel, N. Charland, and B. R.
Brodeur. 2002. Protection from group B streptococcal infection in neonatal mice
by maternal immunization with recombinant Sip protein. Infection and Immunity
70:4897-4901.
221
204.
Cheng, Q., S. Debol, H. Lam, R. Eby, L. Edwards, Y. Matsuka, S. B. Olmsted,
and P. P. Cleary. 2002. Immunization with C5a peptidase or peptidase-type III
polysaccharide conjugate vaccines enhances clearance of group B Streptococci
from lungs of infected mice. Infection and Immunity 70:6409-6415.
205.
Kuby, J. 1997. Immunology. W.H. Freeman, New York.
206.
Hjelm, F., F. Carlsson, A. Getahun, and B. Heyman. 2006. Antibody-mediated
regulation of the immune response. Scand J Immunol 64:177-184.
207.
Bhat, T. N., G. A. Bentley, G. Boulot, M. I. Greene, D. Tello, W. Dall'Acqua, H.
Souchon, F. P. Schwarz, R. A. Mariuzza, and R. J. Poljak. 1994. Bound water
molecules and conformational stabilization help mediate an antigen-antibody
association. Proc Natl Acad Sci U S A 91:1089-1093.
208.
Braden, B. C., H. Souchon, J. L. Eisele, G. A. Bentley, T. N. Bhat, J. Navaza, and
R. J. Poljak. 1994. Three-dimensional structures of the free and the antigencomplexed Fab from monoclonal anti-lysozyme antibody D44.1. J Mol Biol
243:767-781.
209.
Padlan, E. A., E. W. Silverton, S. Sheriff, G. H. Cohen, S. J. Smith-Gill, and D. R.
Davies. 1989. Structure of an antibody-antigen complex: crystal structure of the
HyHEL-10 Fab-lysozyme complex. Proc Natl Acad Sci U S A 86:5938-5942.
210.
Sheriff, S., E. W. Silverton, E. A. Padlan, G. H. Cohen, S. J. Smith-Gill, B. C.
Finzel, and D. R. Davies. 1987. Three-dimensional structure of an antibodyantigen complex. Proc Natl Acad Sci U S A 84:8075-8079.
211.
Colman, P. M., W. G. Laver, J. N. Varghese, A. T. Baker, P. A. Tulloch, G. M.
Air, and R. G. Webster. 1987. Three-dimensional structure of a complex of
antibody with influenza virus neuraminidase. Nature 326:358-363.
212.
Tulip, W. R., J. N. Varghese, W. G. Laver, R. G. Webster, and P. M. Colman.
1992. Refined crystal structure of the influenza virus N9 neuraminidase-NC41
Fab complex. J Mol Biol 227:122-148.
213.
Worobec, R. B., J. H. Wallace, and C. G. Huggins. 1972. Angiotensin-antibody
interaction. II. Thermodynamic and activation parameters. Immunochemistry
9:239-251.
214.
Garcia, K. C., P. M. Ronco, P. J. Verroust, A. T. Brunger, and L. M. Amzel.
1992. Three-dimensional structure of an angiotensin II-Fab complex at 3 A:
hormone recognition by an anti-idiotypic antibody. Science 257:502-507.
222
215.
Bentley, G. A., G. Boulot, M. M. Riottot, and R. J. Poljak. 1990. Threedimensional structure of an idiotope-anti-idiotope complex. Nature 348:254-257.
216.
Couraud, P. O. 1986. Structural analysis of the epitopes recognized by
monoclonal antibodies to angiotensin II. J Immunol 136:3365-3370.
217.
Metzger, D. W., A. Miller, and E. E. Sercarz. 1980. Sharing of an idiotypic
marker by monoclonal antibodies specific for distinct regions of hen lysozyme.
Nature 287:540-542.
218.
Garcia, K. C., S. V. Desiderio, P. M. Ronco, P. J. Verroust, and L. M. Amzel.
1992. Recognition of angiotensin II: antibodies at different levels of an idiotypic
network are superimposable. Science 257:528-531.
219.
Budisavljevic, M., P. M. Ronco, and P. J. Verroust. 1990. Angiotensin II (AII)related idiotypic network. III. Comparative analysis of idiotopes and paratopes
borne by monoclonal antibodies raised against AII (AB1) and its internal image
(AB3). J Immunol 145:1440-1449.
220.
Garcia, K. C., P. Ronco, P. J. Verroust, and L. M. Amzel. 1989. Crystallization
and preliminary X-ray diffraction data of an anti-angiotensin II Fab and of the
peptide-Fab complex. J Biol Chem 264:20463-20466.
221.
Liao, J., K. G. Nickerson, S. Bystricky, J. B. Robbins, R. Schneerson, S. C. Szu,
and E. A. Kabat. 1995. Characterization of a human monoclonal immunoglobulin
M (IgM) antibody (IgMBEN) specific for Vi capsular polysaccharide of
Salmonella typhi. Infect Immun 63:4429-4432.
222.
Gawinowicz, M. A., G. Merlini, S. Birken, E. F. Osserman, and E. A. Kabat.
1991. Amino acid sequence of the FV region of a human monoclonal IgM (NOV)
with specificity for the capsular polysaccharide of the group B meningococcus
and of Escherichia coli K1, which cross-reacts with polynucleotides and with
denatured DNA. J Immunol 147:915-920.
223.
Kabat, E. A., J. Liao, E. F. Osserman, A. Gamian, F. Michon, and H. J. Jennings.
1988. The epitope associated with the binding of the capsular polysaccharide of
the group B meningococcus and of Escherichia coli K1 to a human monoclonal
macroglobulin, IgMNOV. J Exp Med 168:699-711.
223
224.
Kabat, E. A., K. G. Nickerson, J. Liao, L. Grossbard, E. F. Osserman, E.
Glickman, L. Chess, J. B. Robbins, R. Schneerson, and Y. H. Yang. 1986. A
human monoclonal macroglobulin with specificity for alpha(2----8)-linked polyN-acetyl neuraminic acid, the capsular polysaccharide of group B meningococci
and Escherichia coli K1, which crossreacts with polynucleotides and with
denatured DNA. J Exp Med 164:642-654.
225.
Naparstek, Y., D. Duggan, A. Schattner, M. P. Madaio, F. Goni, B. Frangione, B.
D. Stollar, E. A. Kabat, and R. S. Schwartz. 1985. Immunochemical similarities
between monoclonal antibacterial Waldenstrom's macroglobulins and monoclonal
anti-DNA lupus autoantibodies. J Exp Med 161:1525-1538.
226.
Kabat, E. A., and A. E. Bezer. 1958. The effect of variation in molecular weight
on the antigenicity of dextran in man. Arch Biochem Biophys 78:306-318.
227.
Kabat, E. A. 1966. The nature of an antigenic determinant. J Immunol 97:1-11.
228.
Lai, E., E. A. Kabat, and L. Mobraaten. 1985. Genetic and nongenetic control of
the immune response of mice to a synthetic glycolipid, stearylisomaltotetraose.
Cell Immunol 92:172-183.
229.
Geysen, H. M., S. J. Rodda, and T. J. Mason. 1986. A priori delineation of a
peptide which mimics a discontinuous antigenic determinant. Mol Immunol
23:709-715.
230.
Geysen, H. M., R. H. Meloen, and S. J. Barteling. 1984. Use of peptide synthesis
to probe viral antigens for epitopes to a resolution of a single amino acid. Proc
Natl Acad Sci U S A 81:3998-4002.
231.
Jerne, N. K. 1974. Towards a network theory of the immune system. Ann
Immunol (Paris) 125C:373-389.
232.
Herlyn, D., R. Somasundaram, W. Li, and H. Maruyama. 1996. Anti-idiotype
cancer vaccines: past and future. Cancer Immunol Immunother 43:65-76.
233.
Schreiber, J. R., G. B. Pier, M. Grout, K. Nixon, and M. Patawaran. 1991.
Induction of opsonic antibodies to Pseudomonas aeruginosa mucoid
exopolysaccharide by an anti-idiotypic monoclonal antibody. J Infect Dis
164:507-514.
234.
Monafo, W. J., N. S. Greenspan, J. A. Cebra-Thomas, and J. M. Davie. 1987.
Modulation of the murine immune response to streptococcal group A
carbohydrate by immunization with monoclonal anti-idiotope. J Immunol
139:2702-2707.
224
235.
McNamara, M. K., R. E. Ward, and H. Kohler. 1984. Monoclonal idiotope
vaccine against Streptococcus pneumoniae infection. Science 226:1325-1326.
236.
Burritt, J. B., C. W. Bond, K. W. Doss, and A. J. Jesaitis. 1996. Filamentous
phage display of oligopeptide libraries. Analytical Biochemistry 238:1-13.
237.
Smith, G. P., and V. A. Petrenko. 1997. Phage Display. Chemical Reviews
97:391-410.
238.
Smith, G. P. 1985. Filamentous fusion phage: novel expression vectors that
display cloned antigens on the virion surface. Science 228:1315-1317.
239.
Cabilly, S. 1999. The basic structure of filamentous phage and its use in the
display of combinatorial peptide libraries. Molecular Biotechnology 12:143-148.
240.
Greenwood, J., A. E. Willis, and R. N. Perham. 1991. Multiple display of foreign
peptides on a filamentous bacteriophage. Peptides from Plasmodium falciparum
circumsporozoite protein as antigens. Journal of Molecular Biology 220:821-827.
241.
Russel, M. 1993. Protein-protein interactions during filamentous phage assembly.
Journal of Molecular Biology 231:689-697.
242.
Kishchenko, G., H. Batliwala, and L. Makowski. 1994. Structure of a foreign
peptide displayed on the surface of bacteriophage M13. Journal of Molecular
Biology 241:208-213.
243.
Makowski, L. 1993. Structural constraints on the display of foreign peptides on
filamentous bacteriophages. Gene 128:5-11.
244.
Riechmann, L., and P. Holliger. 1997. The C-terminal domain of TolA is the
coreceptor for filamentous phage infection of E. coli. Cell 90:351-360.
245.
Murai, H., S. Hara, T. Ikenaka, A. Goto, M. Arai, and S. Murao. 1985. Amino
acid sequence of protein alpha-amylase inhibitor from Streptomyces
griseosporeus YM-25. Journal of Biochemistry 97:1129-1133.
246.
Vertesy, L., V. Oeding, R. Bender, K. Zepf, and G. Nesemann. 1984. Tendamistat
(HOE 467), a tight-binding alpha-amylase inhibitor from Streptomyces tendae
4158. Isolation, biochemical properties. European Journal of Biochemistry
141:505-512.
225
247.
Oldenburg, K. R., D. Loganathan, I. J. Goldstein, P. G. Schultz, and M. A.
Gallop. 1992. Peptide ligands for a sugar-binding protein isolated from a random
peptide library. Proceedings of the National Academy of Sciences of the United
States of America 89:5393-5397.
248.
Westerink, M. A., and P. C. Giardina. 1992. Anti-idiotype induced protection
against Neisseria meningitidis serogroup C bacteremia. Microbial Pathogenesis
12:19-26.
249.
Prinz, D. M., S. L. Smithson, and M. A. Westerink. 2004. Two different methods
result in the selection of peptides that induce a protective antibody response to
Neisseria meningitidis serogroup C. Journal of Immunological Methods 285:1-14.
250.
Luo, P., G. Canziani, G. Cunto-Amesty, and T. Kieber-Emmons. 2000. A
molecular basis for functional peptide mimicry of a carbohydrate antigen. Journal
of Biological Chemistry 275:16146-16154.
251.
Moe, G. R., S. Tan, and D. M. Granoff. 1999. Molecular mimetics of
polysaccharide epitopes as vaccine candidates for prevention of Neisseria
meningitidis serogroup B disease. FEMS Immunology and Medical Microbiology
26:209-226.
252.
Valadon, P., G. Nussbaum, L. F. Boyd, D. H. Margulies, and M. D. Scharff. 1996.
Peptide libraries define the fine specificity of anti-polysaccharide antibodies to
Cryptococcus neoformans. Journal of Molecular Biology 261:11-22.
253.
Beenhouwer, D. O., R. J. May, P. Valadon, and M. D. Scharff. 2002. High
affinity mimotope of the polysaccharide capsule of Cryptococcus neoformans
identified from an evolutionary phage peptide library. Journal of Immunology
169:6992-6999.
254.
Murali, R., and T. Kieber-Emmons. 1997. Molecular recognition of a peptide
mimic of the Lewis Y antigen by an anti-Lewis Y antibody. Journal of Molecular
Recognition 10:269-276.
255.
Harris, S. L., L. Craig, J. S. Mehroke, M. Rashed, M. B. Zwick, K. Kenar, E. J.
Toone, N. Greenspan, F. I. Auzanneau, J. R. Marino-Albernas, B. M. Pinto, and J.
K. Scott. 1997. Exploring the basis of peptide-carbohydrate crossreactivity:
evidence for discrimination by peptides between closely related anti-carbohydrate
antibodies. Proceedings of the National Academy of Sciences of the United States
of America 94:2454-2459.
226
256.
Magliani, W., L. Polonelli, S. Conti, A. Salati, P. F. Rocca, V. Cusumano, G.
Mancuso, and G. Teti. 1998. Neonatal mouse immunity against group B
streptococcal infection by maternal vaccination with recombinant anti-idiotypes.
Nature Medicine 4:705-709.
257.
Fleuridor, R., A. Lees, and L. Pirofski. 2001. A cryptococcal capsular
polysaccharide mimotope prolongs the survival of mice with Cryptococcus
neoformans infection. Journal of Immunology 166:1087-1096.
258.
Valadon, P., G. Nussbaum, J. Oh, and M. D. Scharff. 1998. Aspects of antigen
mimicry revealed by immunization with a peptide mimetic of Cryptococcus
neoformans polysaccharide. Journal of Immunology 161:1829-1836.
259.
Zhang, H., Z. Zhong, and L. A. Pirofski. 1997. Peptide epitopes recognized by a
human anti-cryptococcal glucuronoxylomannan antibody. Infection and Immunity
65:1158-1164.
260.
Harris, S. L., A. S. Dagtas, and B. Diamond. 2002. Regulating the isotypic and
idiotypic profile of an anti-PC antibody response: lessons from peptide mimics.
Molecular Immunology 39:263-272.
261.
Charalambous, B. M., and I. M. Feavers. 2000. Peptide mimics elicit antibody
responses against the outer-membrane lipooligosaccharide of group B neisseria
meningitidis. FEMS Microbiology Letters 191:45-50.
262.
Gulati, S., D. P. McQuillen, J. Sharon, and P. A. Rice. 1996. Experimental
immunization with a monoclonal anti-idiotope antibody that mimics the Neisseria
gonorrhoeae lipooligosaccharide epitope 2C7. Journal of Infectious Diseases
174:1238-1248.
263.
Kieber-Emmons, T., P. Luo, J. Qiu, T. Y. Chang, I. O, M. Blaszczyk-Thurin, and
Z. Steplewski. 1999. Vaccination with carbohydrate peptide mimotopes promotes
anti-tumor responses. Nature Biotechnology 17:660-665.
264.
Kieber-Emmons, T., B. Monzavi-Karbassi, B. Wang, P. Luo, and D. B. Weiner.
2000. Cutting edge: DNA immunization with minigenes of carbohydrate
mimotopes induce functional anti-carbohydrate antibody response. Journal of
Immunology 165:623-627.
265.
Chen, X., G. Scala, I. Quinto, W. Liu, T. W. Chun, J. S. Justement, O. J. Cohen,
T. C. vanCott, M. Iwanicki, M. G. Lewis, J. Greenhouse, T. Barry, D. Venzon,
and A. S. Fauci. 2001. Protection of rhesus macaques against disease progression
from pathogenic SHIV-89.6PD by vaccination with phage-displayed HIV-1
epitopes. Nature Medicine 7:1225-1231.
227
266.
Pashov, A., G. Canziani, B. Monzavi-Karbassi, S. V. Kaveri, S. Macleod, R.
Saha, M. Perry, T. C. Vancott, and T. Kieber-Emmons. 2005. Antigenic
properties of peptide mimotopes of HIV-1-associated carbohydrate antigens.
Journal of Biological Chemistry 280:28959-28965.
267.
Harris, S. L., M. K. Park, M. H. Nahm, and B. Diamond. 2000. Peptide mimic of
phosphorylcholine, a dominant epitope found on Streptococcus pneumoniae.
Infection and Immunity 68:5778-5784.
268.
Lesinski, G. B., S. L. Smithson, N. Srivastava, D. Chen, G. Widera, and M. A.
Westerink. 2001. A DNA vaccine encoding a peptide mimic of Streptococcus
pneumoniae serotype 4 capsular polysaccharide induces specific anticarbohydrate antibodies in Balb/c mice. Vaccine 19:1717-1726.
269.
Hou, Y., and X. X. Gu. 2003. Development of peptide mimotopes of
lipooligosaccharide from nontypeable Haemophilus influenzae as vaccine
candidates. Journal of Immunology 170:4373-4379.
270.
De Bolle, X., T. Laurent, A. Tibor, F. Godfroid, V. Weynants, J. J. Letesson, and
P. Mertens. 1999. Antigenic properties of peptidic mimics for epitopes of the
lipopolysaccharide from Brucella. Journal of Molecular Biology 294:181-191.
271.
Molenaar, T. J., C. C. Appeldoorn, S. A. de Haas, I. N. Michon, A. Bonnefoy, M.
F. Hoylaerts, H. Pannekoek, T. J. van Berkel, J. Kuiper, and E. A. Biessen. 2002.
Specific inhibition of P-selectin-mediated cell adhesion by phage display-derived
peptide antagonists. Blood 100:3570-3577.
272.
Zhan, J., Z. Xia, L. Xu, Z. Yan, and K. Wang. 2003. A peptide mimetic of Galalpha 1,3-Gal is able to block human natural antibodies. Biochemical and
Biophysical Research Communications 308:19-22.
273.
Taki, T., D. Ishikawa, H. Hamasaki, and S. Handa. 1997. Preparation of peptides
which mimic glycosphingolipids by using phage peptide library and their
modulation on beta-galactosidase activity. FEBS Letters 418:219-223.
274.
Kim, Y. G., C. S. Lee, W. J. Chung, E. M. Kim, D. S. Shin, J. H. Rhim, Y. S. Lee,
B. G. Kim, and J. Chung. 2005. Screening of LPS-specific peptides from a phage
display library using epoxy beads. Biochemical and Biophysical Research
Communications 329:312-317.
275.
Tang, S. S., W. S. Tan, S. Devi, L. F. Wang, T. Pang, and K. L. Thong. 2003.
Mimotopes of the Vi antigen of Salmonella enterica serovar typhi identified from
phage display peptide library. Clinical and Diagnostic Laboratory Immunology
10:1078-1084.
228
276.
Phalipon, A., A. Folgori, J. Arondel, G. Sgaramella, P. Fortugno, R. Cortese, P. J.
Sansonetti, and F. Felici. 1997. Induction of anti-carbohydrate antibodies by
phage library-selected peptide mimics. European Journal of Immunology
27:2620-2625.
277.
Johnson, M. A., M. Jaseja, W. Zou, H. J. Jennings, V. Copie, B. M. Pinto, and S.
H. Pincus. 2003. NMR studies of carbohydrates and carbohydrate-mimetic
peptides recognized by an anti-group B Streptococcus antibody. Journal of
Biological Chemistry 278:24740-24752.
278.
Levy, N. J., A. Nicholson-Weller, C. J. Baker, and D. L. Kasper. 1984.
Potentiation of virulence by group B streptococcal polysaccharides. Journal of
Infectious Diseases 149:851-860.
279.
Zou, W., R. Mackenzie, L. Therien, T. Hirama, Q. Yang, M. A. Gidney, and H. J.
Jennings. 1999. Conformational epitope of the type III group B Streptococcus
capsular polysaccharide. Journal of Immunology 163:820-825.
280.
Kasper, D. L. 1995. Designer vaccines to prevent infections due to group B
Streptococcus. Proceedings of the Association of American Physicians 107:369373.
281.
Boyer, K. M., L. S. Kendall, C. K. Papierniak, M. E. Klegerman, and S. P. Gotoff.
1984. Protective levels of human immunoglobulin G antibody to group B
streptococcus type Ib. Infection and Immunity 45:618-624.
282.
Muñoz, A. I. 1980. Hemophilus influenzae infections: a brief review. Clin Pediatr
19:86-90.
283.
Anderson, P., and D. H. Smith. 1977. Isolation of the capsular polysaccharide
from culture supernatant of Haemophilus influenzae type b. Infection and
Immunity 15:472-477.
284.
Anderson, P., D. H. Smith, D. L. Ingram, J. Wilkins, P. F. Wehrle, and V. M.
Howie. 1977. Antibody of polyribophate of Haemophilus influenzae type b in
infants and children: effect of immunization with polyribophosphate. Journal of
Infectious Diseases 136 Suppl:S57-62.
285.
Parke, J. C., Jr., R. Schneerson, J. B. Robbins, and J. J. Schlesselman. 1977.
Interim report of a controlled field trial of immunization with capsular
polysaccharides of Haemophilus influenzae type b and group C Neisseria
meningitidis in Mecklenburg county, North Carolina (March 1974-March 1976).
Journal of Infectious Diseases 136 Suppl:S51-56.
229
286.
Peltola, H., H. Kayhty, A. Sivonen, and H. Makela. 1977. Haemophilus
influenzae type b capsular polysaccharide vaccine in children: a double-blind field
study of 100,000 vaccinees 3 months to 5 years of age in Finland. Pediatrics
60:730-737.
287.
Smith, D. H., G. Peter, D. L. Ingram, A. L. Harding, and P. Anderson. 1973.
Responses of children immunized with the capsular polysaccharide of
Hemophilus influenzae, type b. Pediatrics 52:637-644.
288.
Anderson, P., M. Pichichero, R. Insel, P. Farsad, and M. Santosham. 1985.
Capsular antigens noncovalently or covalently associated with protein as vaccines
to Haemophilus influenzae type b: comparison in two-year-old children. Journal
of Infectious Diseases 152:634-636.
289.
Anderson, P., M. E. Pichichero, and R. A. Insel. 1985. Immunogens consisting of
oligosaccharides from the capsule of Haemophilus influenzae type b coupled to
diphtheria toxoid or the toxin protein CRM197. Journal of Clinical Investigation
76:52-59.
290.
Musher, D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical
spectrum, pathogenesis, immunity, and treatment. Clinical Infectious Diseases
14:801-807.
291.
O'Brien, K. L., A. J. Swift, J. A. Winkelstein, M. Santosham, B. Stover, R.
Luddy, J. E. Gootenberg, J. T. Nold, A. Eskenazi, S. J. Snader, and H. M.
Lederman. 2000. Safety and immunogenicity of heptavalent pneumococcal
vaccine conjugated to CRM(197) among infants with sickle cell disease.
Pneumococcal Conjugate Vaccine Study Group. Pediatrics 106:965-972.
292.
O'Brien, K. L., L. H. Moulton, R. Reid, R. Weatherholtz, J. Oski, L. Brown, G.
Kumar, A. Parkinson, D. Hu, J. Hackell, I. Chang, R. Kohberger, G. Siber, and M.
Santosham. 2003. Efficacy and safety of seven-valent conjugate pneumococcal
vaccine in American Indian children: group randomised trial. Lancet 362:355361.
293.
Ramsay, M. E., N. Andrews, E. B. Kaczmarski, and E. Miller. 2001. Efficacy of
meningococcal serogroup C conjugate vaccine in teenagers and toddlers in
England. Lancet 357:195-196.
294.
Bachmann, M. F., and R. M. Zinkernagel. 1996. The influence of virus structure
on antibody responses and virus serotype formation. Immunology Today 17:553558.
230
295.
Bachmann, M. F., H. Hengartner, and R. M. Zinkernagel. 1995. T helper cellindependent neutralizing B cell response against vesicular stomatitis virus: role of
antigen patterns in B cell induction? European Journal of Immunology 25:34453451.
296.
Burke, K. L., G. Dunn, M. Ferguson, P. D. Minor, and J. W. Almond. 1988.
Antigen chimaeras of poliovirus as potential new vaccines. Nature 332:81-82.
297.
Arnold, G. F., D. A. Resnick, Y. Li, A. Zhang, A. D. Smith, S. C. Geisler, A.
Jacobo-Molina, W. Lee, R. G. Webster, and E. Arnold. 1994. Design and
construction of rhinovirus chimeras incorporating immunogens from polio,
influenza, and human immunodeficiency viruses. Virology 198:703-708.
298.
Fernandez-Fernandez, M. R., J. L. Martinez-Torrecuadrada, J. I. Casal, and J. A.
Garcia. 1998. Development of an antigen presentation system based on plum pox
potyvirus. FEBS Letters 427:229-235.
299.
Porta, C., V. E. Spall, J. Loveland, J. E. Johnson, P. J. Barker, and G. P.
Lomonossoff. 1994. Development of cowpea mosaic virus as a high-yielding
system for the presentation of foreign peptides. Virology 202:949-955.
300.
Valenzuela, P., A. Medina, W. J. Rutter, G. Ammerer, and B. D. Hall. 1982.
Synthesis and assembly of hepatitis B virus surface antigen particles in yeast.
Nature 298:347-350.
301.
Sabara, M., M. Parker, P. Aha, C. Cosco, E. Gibbons, S. Parsons, and L. A.
Babiuk. 1991. Assembly of double-shelled rotaviruslike particles by simultaneous
expression of recombinant VP6 and VP7 proteins. Journal of Virology 65:69946997.
302.
Urakawa, T., M. Ferguson, P. D. Minor, J. Cooper, M. Sullivan, J. W. Almond,
and D. H. Bishop. 1989. Synthesis of immunogenic, but non-infectious, poliovirus
particles in insect cells by a baculovirus expression vector. Journal of General
Virology 70 ( Pt 6):1453-1463.
303.
French, T. J., J. J. Marshall, and P. Roy. 1990. Assembly of double-shelled,
viruslike particles of bluetongue virus by the simultaneous expression of four
structural proteins. Journal of Virology 64:5695-5700.
304.
Plana-Duran, J., M. Bastons, M. J. Rodriguez, I. Climent, E. Cortes, C. Vela, and
I. Casal. 1996. Oral immunization of rabbits with VP60 particles confers
protection against rabbit hemorrhagic disease. Archives of Virology 141:14231436.
231
305.
Thomsen, D. R., L. L. Roof, and F. L. Homa. 1994. Assembly of herpes simplex
virus (HSV) intermediate capsids in insect cells infected with recombinant
baculoviruses expressing HSV capsid proteins. Journal of Virology 68:24422457.
306.
Brown, C. S., J. W. Van Lent, J. M. Vlak, and W. J. Spaan. 1991. Assembly of
empty capsids by using baculovirus recombinants expressing human parvovirus
B19 structural proteins. Journal of Virology 65:2702-2706.
307.
Nemchinov, L. G., T. J. Liang, M. M. Rifaat, H. M. Mazyad, A. Hadidi, and J. M.
Keith. 2000. Development of a plant-derived subunit vaccine candidate against
hepatitis C virus. Archives of Virology 145:2557-2573.
308.
Joelson, T., L. Akerblom, P. Oxelfelt, B. Strandberg, K. Tomenius, and T. J.
Morris. 1997. Presentation of a foreign peptide on the surface of tomato bushy
stunt virus. Journal of General Virology 78 ( Pt 6):1213-1217.
309.
Lin, T., Z. Chen, R. Usha, C. V. Stauffacher, J. B. Dai, T. Schmidt, and J. E.
Johnson. 1999. The refined crystal structure of cowpea mosaic virus at 2.8 A
resolution. Virology 265:20-34.
310.
Usha, R., J. B. Rohll, V. E. Spall, M. Shanks, A. J. Maule, J. E. Johnson, and G.
P. Lomonossoff. 1993. Expression of an animal virus antigenic site on the surface
of a plant virus particle. Virology 197:366-374.
311.
Wang, Q., E. Kaltgrad, T. Lin, J. E. Johnson, and M. G. Finn. 2002. Natural
supramolecular building blocks. Wild-type cowpea mosaic virus. Chemistry and
Biology 9:805-811.
312.
Wang, Q., T. Lin, J. E. Johnson, and M. G. Finn. 2002. Natural supramolecular
building blocks. Cysteine-added mutants of cowpea mosaic virus. Chemistry and
Biology 9:813-819.
313.
Chatterji, A., L. L. Burns, S. S. Taylor, G. P. Lomonossoff, J. E. Johnson, T. Lin,
and C. Porta. 2002. Cowpea mosaic virus: from the presentation of antigenic
peptides to the display of active biomaterials. Intervirology 45:362-370.
314.
de Assis Filho, F. M., O. R. Paguio, J. L. Sherwood, and C. M. Deom. 2002.
Symptom induction by Cowpea chlorotic mottle virus on Vigna unguiculata is
determined by amino acid residue 151 in the coat protein. Journal of General
Virology 83:879-883.
232
315.
Mise, K., R. F. Allison, M. Janda, and P. Ahlquist. 1993. Bromovirus movement
protein genes play a crucial role in host specificity. Journal of Virology 67:28152823.
316.
Rao, A. L., and G. L. Grantham. 1995. A spontaneous mutation in the movement
protein gene of brome mosaic virus modulates symptom phenotype in Nicotiana
benthamiana. Journal of Virology 69:2689-2691.
317.
Speir, J. A., S. Munshi, G. Wang, T. S. Baker, and J. E. Johnson. 1995. Structures
of the native and swollen forms of cowpea chlorotic mottle virus determined by
X-ray crystallography and cryo-electron microscopy. Structure 3:63-78.
318.
Albert, F. G., J. M. Fox, and M. J. Young. 1997. Virion swelling is not required
for cotranslational disassembly of cowpea chlorotic mottle virus in vitro. Journal
of Virology 71:4296-4299.
319.
Fox, J. M., X. Zhao, J. A. Speir, and M. J. Young. 1996. Analysis of a salt stable
mutant of cowpea chlorotic mottle virus. Virology 222:115-122.
320.
Brumfield, S., D. Willits, L. Tang, J. E. Johnson, T. Douglas, and M. Young.
2004. Heterologous expression of the modified coat protein of Cowpea chlorotic
mottle bromovirus results in the assembly of protein cages with altered
architectures and function. Journal of General Virology 85:1049-1053.
321.
Feliciello, I., and G. Chinali. 1993. A modified alkaline lysis method for the
preparation of highly purified plasmid DNA from Escherichia coli. Analytical
Biochemistry 212:394-401.
322.
Linder, S., M. Schliwa, and E. Kube-Granderath. 1996. Direct PCR screening of
Pichia pastoris clones. Biotechniques 20:980-982.
323.
Ao, J. Q., J. W. Wang, X. H. Chen, X. Z. Wang, and Q. X. Long. 2003.
Expression of pseudorabies virus gE epitopes in Pichia pastoris and its utilization
in an indirect PRV gE-ELISA. Journal of Virological Methods 114:145-150.
324.
Freivalds, J., A. Dislers, V. Ose, D. Skrastina, I. Cielens, P. Pumpens, K.
Sasnauskas, and A. Kazaks. 2006. Assembly of bacteriophage Qbeta virus-like
particles in yeast Saccharomyces cerevisiae and Pichia pastoris. Journal of
Biotechnology 123:297-303.
233
325.
Martinez-Donato, G., N. Acosta-Rivero, J. Morales-Grillo, A. Musacchio, A.
Vina, C. Alvarez, N. Figueroa, I. Guerra, J. Garcia, L. Varas, V. Muzio, and S.
Duenas-Carrera. 2006. Expression and processing of hepatitis C virus structural
proteins in Pichia pastoris yeast. Biochemical and Biophysical Research
Communications 342:625-631.
326.
Johnson, J. E., and W. Chiu. 2000. Structures of virus and virus-like particles.
Current Opinion in Structural Biology 10:229-235.
327.
Johnson, J. E., and J. A. Speir. 1997. Quasi-equivalent viruses: a paradigm for
protein assemblies. Journal of Molecular Biology 269:665-675.
328.
Rossmann, M. G., and J. E. Johnson. 1989. Icosahedral RNA virus structure.
Annual Review of Biochemistry 58:533-573.
329.
Zhao, X., J. M. Fox, N. H. Olson, T. S. Baker, and M. J. Young. 1995. In vitro
assembly of cowpea chlorotic mottle virus from coat protein expressed in
Escherichia coli and in vitro-transcribed viral cDNA. Virology 207:486-494.
330.
Vriend, G., B. J. Verduin, and M. A. Hemminga. 1986. Role of the N-terminal
part of the coat protein in the assembly of cowpea chlorotic mottle virus. A 500
MHz proton nuclear magnetic resonance study and structural calculations.
Journal of Molecular Biology 191:453-460.
331.
Johnson, J. E. 1996. Functional implications of protein-protein interactions in
icosahedral viruses. Proceedings of the National Academy of Sciences of the
United States of America 93:27-33.
332.
Graf, J., Y. Iwamoto, M. Sasaki, G. R. Martin, H. K. Kleinman, F. A. Robey, and
Y. Yamada. 1987. Identification of an amino acid sequence in laminin mediating
cell attachment, chemotaxis, and receptor binding. Cell 48:989-996.
333.
Kazmin, D. A., T. R. Hoyt, L. Taubner, M. Teintze, and J. R. Starkey. 2000.
Phage display mapping for peptide 11 sensitive sequences binding to laminin-1.
Journal of Molecular Biology 298:431-445.
334.
Rao, A. L., and B. Cooper. 2006. Capsid protein gene and the type of host plant
differentially modulate cell-to-cell movement of cowpea chlorotic mottle virus.
Virus Genes 32:219-227.
335.
Sasaki, N., M. Kaido, T. Okuno, and K. Mise. 2005. Coat protein-independent
cell-to-cell movement of bromoviruses expressing brome mosaic virus movement
protein with an adaptation-related amino acid change in the central region.
Archives of Virology 150:1231-1240.
234
336.
Xia, M., T. Farkas, and X. Jiang. 2007. Norovirus capsid protein expressed in
yeast forms virus-like particles and stimulates systemic and mucosal immunity in
mice following an oral administration of raw yeast extracts. Journal of Medical
Virology 79:74-83.
337.
Li, H. Z., H. Y. Gang, Q. M. Sun, X. Liu, Y. B. Ma, M. S. Sun, and C. B. Dai.
2004. Production in Pichia pastoris and characterization of genetic engineered
chimeric HBV/HEV virus-like particles. Chinese Medical Sciences Journal
19:78-83.
338.
Falcon, V., C. Garcia, M. C. de la Rosa, I. Menendez, J. Seoane, and J. M. Grillo.
1999. Ultrastructural and immunocytochemical evidences of core-particle
formation in the methylotrophic Pichia pastoris yeast when expressing HCV
structural proteins (core-E1). Tissue and Cell 31:117-125.
339.
McLain, L., C. Porta, G. P. Lomonossoff, Z. Durrani, and N. J. Dimmock. 1995.
Human immunodeficiency virus type 1-neutralizing antibodies raised to a
glycoprotein 41 peptide expressed on the surface of a plant virus. AIDS Research
and Human Retroviruses 11:327-334.
340.
Porta, C., and G. P. Lomonossoff. 1998. Scope for using plant viruses to present
epitopes from animal pathogens. Reviews in Medical Virology 8:25-41.
341.
Fox, J. M., F. G. Albert, J. A. Speir, and M. J. Young. 1997. Characterization of a
disassembly deficient mutant of cowpea chlorotic mottle virus. Virology 227:229233.
342.
Schuchat, A. 1999. Group B streptococcus. Lancet 353:51-56.
343.
Wenger, J. D., A. W. Hightower, R. R. Facklam, S. Gaventa, and C. V. Broome.
1990. Bacterial meningitis in the United States, 1986: report of a multistate
surveillance study. The Bacterial Meningitis Study Group. Journal of Infectious
Diseases 162:1316-1323.
344.
Daugaard, H. O., A. C. Thomsen, U. Henriques, and A. Ostergaard. 1988. Group
B streptococci in the lower urogenital tract and late abortions. American Journal
of Obstetrics and Gynecology 158:28-31.
345.
Baltimore, R. S., D. L. Kasper, and J. Vecchitto. 1979. Mouse protection test for
group B Streptococcus type III. Journal of Infectious Diseases 140:81-88.
235
346.
De Cueninck, B. J., T. K. Eisenstein, T. S. McIntosh, G. D. Shockman, and R. M.
Swenson. 1983. Quantitation of in vitro opsonic activity of human antibody
induced by a vaccine consisting of the type III-specific polysaccharide of group B
streptococcus. Infection and Immunity 39:1155-1160.
347.
Baltimore, R. S., C. J. Baker, and D. L. Kasper. 1981. Antibody to group B
Streptococcus type III in human sera measured by a mouse protection test.
Infection and Immunity 32:56-61.
348.
Baltimore, R. S., D. L. Kasper, C. J. Baker, and D. K. Goroff. 1977. Antigenic
specificity of opsonophagocytic antibodies in rabbit anti-sera to group B
streptococci. Journal of Immunology 118:673-678.
349.
Youn, J. H., H. J. Myung, A. Liav, D. Chatterjee, P. J. Brennan, I. H. Choi, S. N.
Cho, and J. S. Shin. 2004. Production and characterization of peptide mimotopes
of phenolic glycolipid-I of Mycobacterium leprae. FEMS Immunology and
Medical Microbiology 41:51-57.
350.
Gevorkian, G., E. Segura, G. Acero, J. P. Palma, C. Espitia, K. Manoutcharian,
and L. M. Lopez-Marin. 2005. Peptide mimotopes of Mycobacterium tuberculosis
carbohydrate immunodeterminants. Biochemical Journal 387:411-417.
351.
Yusibov, V., D. C. Hooper, S. V. Spitsin, N. Fleysh, R. B. Kean, T. Mikheeva, D.
Deka, A. Karasev, S. Cox, J. Randall, and H. Koprowski. 2002. Expression in
plants and immunogenicity of plant virus-based experimental rabies vaccine.
Vaccine 20:3155-3164.
352.
Denis, J., N. Majeau, E. Acosta-Ramirez, C. Savard, M. C. Bedard, S. Simard, K.
Lecours, M. Bolduc, C. Pare, B. Willems, N. Shoukry, P. Tessier, P. Lacasse, A.
Lamarre, R. Lapointe, C. Lopez Macias, and D. Leclerc. 2007. Immunogenicity
of papaya mosaic virus-like particles fused to a hepatitis C virus epitope: evidence
for the critical function of multimerization. Virology 363:59-68.
353.
Rote, N. S., N. L. Taylor, A. O. Shigeoka, J. R. Scott, and H. R. Hill. 1980.
Enzyme-linked immunosorbent assay for group B streptococcal antibodies.
Infection and Immunity 27:118-123.
354.
Gleba, Y., S. Marillonnet, and V. Klimyuk. 2004. Engineering viral expression
vectors for plants: the 'full virus' and the 'deconstructed virus' strategies. Current
Opinion in Plant Biology 7:182-188.
355.
Lomonossoff, G. P., and J. E. Johnson. 1991. The synthesis and structure of
comovirus capsids. Progress in Biophysics and Molecular Biology 55:107-137.
236
356.
Lin, T., C. Porta, G. Lomonossoff, and J. E. Johnson. 1996. Structure-based
design of peptide presentation on a viral surface: the crystal structure of a
plant/animal virus chimera at 2.8 A resolution. Folding and Design 1:179-187.
357.
Liu, L., M. C. Canizares, W. Monger, Y. Perrin, E. Tsakiris, C. Porta, N. Shariat,
L. Nicholson, and G. P. Lomonossoff. 2005. Cowpea mosaic virus-based systems
for the production of antigens and antibodies in plants. Vaccine 23:1788-1792.
358.
Xu, F., T. D. Jones, and P. B. Rodgers. 1996. Potential of chimaeric plant virus
particles as novel, stable vaccines. Developments in Biological Standardization
87:201-205.
359.
Jegerlehner, A., T. Storni, G. Lipowsky, M. Schmid, P. Pumpens, and M. F.
Bachmann. 2002. Regulation of IgG antibody responses by epitope density and
CD21-mediated costimulation. European Journal of Immunology 32:3305-3314.
360.
Yang, R., F. M. Murillo, H. Cui, R. Blosser, S. Uematsu, K. Takeda, S. Akira, R.
P. Viscidi, and R. B. Roden. 2004. Papillomavirus-like particles stimulate murine
bone marrow-derived dendritic cells to produce alpha interferon and Th1 immune
responses via MyD88. Journal of Virology 78:11152-11160.
361.
Bach, P., E. Kamphuis, B. Odermatt, G. Sutter, C. J. Buchholz, and U. Kalinke.
2007. Vesicular stomatitis virus glycoprotein displaying retrovirus-like particles
induce a type I IFN receptor-dependent switch to neutralizing IgG antibodies.
Journal of Immunology 178:5839-5847.
362.
Ball, J. M., D. Y. Graham, A. R. Opekun, M. A. Gilger, R. A. Guerrero, and M.
K. Estes. 1999. Recombinant Norwalk virus-like particles given orally to
volunteers: phase I study. Gastroenterology 117:40-48.
363.
Ye, L., J. Lin, Y. Sun, S. Bennouna, M. Lo, Q. Wu, Z. Bu, B. Pulendran, R. W.
Compans, and C. Yang. 2006. Ebola virus-like particles produced in insect cells
exhibit dendritic cell stimulating activity and induce neutralizing antibodies.
Virology 351:260-270.
364.
Brown, D. R., J. T. Bryan, J. M. Schroeder, T. S. Robinson, K. H. Fife, C. M.
Wheeler, E. Barr, P. R. Smith, L. Chiacchierini, A. DiCello, and K. U. Jansen.
2001. Neutralization of human papillomavirus type 11 (HPV-11) by serum from
women vaccinated with yeast-derived HPV-11 L1 virus-like particles: correlation
with competitive radioimmunoassay titer. Journal of Infectious Diseases
184:1183-1186.
237
365.
Reyburn, H. T., D. J. Roy, B. A. Blacklaws, D. R. Sargan, and I. McConnell.
1992. Expression of maedi-visna virus major core protein, p25: development of a
sensitive p25 antigen detection assay. Journal of Virological Methods 37:305320.
366.
Svirshchevskaya, E. V., L. Alekseeva, A. Marchenko, N. Viskova, T. M.
Andronova, S. V. Benevolenskii, and V. P. Kurup. 2002. Immune response
modulation by recombinant peptides expressed in virus-like particles. Clinical
and Experimental Immunology 127:199-205.
367.
Tegerstedt, K., A. V. Franzen, K. Andreasson, J. Joneberg, S. Heidari, T.
Ramqvist, and T. Dalianis. 2005. Murine polyomavirus virus-like particles
(VLPs) as vectors for gene and immune therapy and vaccines against viral
infections and cancer. Anticancer Research 25:2601-2608.
368.
Veenstra, J., I. G. Williams, R. Colebunders, L. Dorrell, S. E. Tchamouroff, G.
Patou, J. M. Lange, I. V. Weller, J. Goeman, S. Uthayakumar, I. R. Gow, J. N.
Weber, and R. A. Coutinho. 1996. Immunization with recombinant p17/p24:Ty
virus-like particles in human immunodeficiency virus-infected persons. Journal of
Infectious Diseases 174:862-866.
369.
Prevention., C. f. D. C. a. 1996. Prevention of perinatal group B streptococcal
disease: a public health perspective. In Morbid. Mortal. Wk. Rep. 1.
370.
Madoff, L. C., L. C. Paoletti, J. Y. Tai, and D. L. Kasper. 1994. Maternal
immunization of mice with group B streptococcal type III polysaccharide-beta C
protein conjugate elicits protective antibody to multiple serotypes. Journal of
clinical investigation 94:286.
371.
Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. High efficiency
transformation of E. coli by high voltage electroporation. Nucleic Acids Research
16:6127-6145.
372.
Speyer, J. F. 1990. A simple and effective electroporation apparatus.
Biotechniques 8:28-30.
373.
Parmley, S. F., and G. P. Smith. 1988. Antibody-selectable filamentous fd phage
vectors: affinity purification of target genes. Gene 73:305-318.
374.
Parmley, S. F., and G. P. Smith. 1989. Filamentous fusion phage cloning vectors
for the study of epitopes and design of vaccines. Adv Exp Med Biol 251:215-218.
375.
Smith, G. P., and J. K. Scott. 1993. Libraries of peptides and proteins displayed
on filamentous phage. Methods in Enzymology 217:228-257.
238
376.
Yu, J., and G. P. Smith. 1996. Affinity maturation of phage-displayed peptide
ligands. Methods in Enzymology 267:3-27.
377.
Smith, G. P. 1993. Surface display and peptide libraries. Gene 128:1-2.
378.
Murray, A., R. G. Smith, K. Brady, S. Williams, R. A. Badley, and M. R. Price.
2001. Generation and refinement of peptide mimetic ligands for paratope-specific
purification of monoclonal antibodies. Analytical Biochemistry 296:9-17.
379.
Scott, J. K., and G. P. Smith. 1990. Searching for peptide ligands with an epitope
library. Science 249:386-390.
380.
Bentley, L., J. Fehrsen, F. Jordaan, H. Huismans, and D. H. du Plessis. 2000.
Identification of antigenic regions on VP2 of African horsesickness virus serotype
3 by using phage-displayed epitope libraries. Journal of General Virology 81:9931000.
381.
Pereboeva, L. A., A. V. Pereboev, L. F. Wang, and G. E. Morris. 2000. Hepatitis
C epitopes from phage-displayed cDNA libraries and improved diagnosis with a
chimeric antigen. Journal of Medical Virology 60:144-151.
382.
Lundin, K., A. Samuelsson, M. Jansson, J. Hinkula, B. Wahren, H. Wigzell, and
M. A. Persson. 1996. Peptides isolated from random peptide libraries on phage
elicit a neutralizing anti-HIV-1 response: analysis of immunological mimicry.
Immunology 89:579-586.
383.
Wang, L. F., D. H. Du Plessis, J. R. White, A. D. Hyatt, and B. T. Eaton. 1995.
Use of a gene-targeted phage display random epitope library to map an antigenic
determinant on the bluetongue virus outer capsid protein VP5. Journal of
Immunological Methods 178:1-12.
384.
Fehrsen, J., and D. H. du Plessis. 1999. Cross-reactive epitope mimics in a
fragmented-genome phage display library derived from the rickettsia, Cowdria
ruminantium. Immunotechnology 4:175-184.
385.
Petrenko, V. A., G. P. Smith, X. Gong, and T. Quinn. 1996. A library of organic
landscapes on filamentous phage. Protein Engineering 9:797-801.
386.
Tsunetsugu-Yokota, Y., M. Tatsumi, V. Robert, C. Devaux, B. Spire, J. C.
Chermann, and I. Hirsch. 1991. Expression of an immunogenic region of HIV by
a filamentous bacteriophage vector. Gene 99:261-265.
239
387.
Oldenburg, K. R., D. Loganathan, I. J. Goldstein, P. G. Schultz, and M. A.
Gallop. 1992. Peptide ligands for a sugar-binding protein isolated from a random
peptide library. Proceedings of the national academy of sciences of the united
states of america 89:5393-5397.
388.
Scott, J. K., D. Loganthan, R. B. Easley, X. Gong, and I. J. Goldstein. 1992. A
family of concanavalin A-binding peptides from a hexapeptide epitope library.
Proceedings of the national academy of sciences of the united states of america
89:5398-5402.
389.
Murai, H., S. Hara, T. Ikenaka, A. Goto, M. Arai, and S. Murao. 1985. Amino
acid sequence of protein a-amylase inhibitor from Streptomyces griseosporeus
YM-25. Journal of biochemistry 97:1129-1133.
390.
Kieber-Emmons, T., B. Monzavi-Karbassi, B. Wang, P. Luo, and D. B. Weiner.
2000. DNA Immunization with minigenes of carbohydrate mimotopes induce
functional anticarbohydrate antibody response. Journal of immunology 165:623627.
391.
Kieber-Emmons, T., P. Luo, J. Qiu, T. Y. Chang, I. O, M. Blaszczyk-Thurin, and
Z. Steplewski. 1999. Vaccination with carbohydrate peptide mimotopes promotes
anti-tumor responses. Nature biotechnology 17:660-665.
392.
Moe, G. R., S. Tan, and D. M. Granoff. 1999. Molecular mimetics of
polysaccharide epitopes as vaccine candidates for prevention of Neisseria
meningitidis serogroup B disease. FEMS Immunology and medical microbiology
26:209-226.
393.
Molenaar, T. J. M., C. C. M. Appeldoorn, S. Haas, A. M. de, I. N. Michon, A.
Bonnefoy, M. F. Hoylaerts, H. Pannekoek, T. C. v. Berkel, J. Kuiper, and E. A.
Biessen. 2002. Specific inhibition of P-selectin-mediated cell adhesion by phage
diplay-derived peptide antagonists. Blood 100:3570-3577.
394.
Martin, T. R., J. T. Ruzinski, C. E. Rubens, E. Y. Chi, and C. B. Wilson. 1992.
The effect of type-specific polysaccharide capsule on the clearance of group B
streptococci from the lungs of infant and adult rats. Journal of Infectious Diseases
165:306-314.
395.
Awram, P., R. C. Gardner, R. L. Forster, and A. R. Bellamy. 2002. The potential
of plant viral vectors and transgenic plants for subunit vaccine production.
Advances in Virus Research 58:81-124.