Hum Genet (2009) 124:579–591
DOI 10.1007/s00439-008-0593-6
REVIEW ARTICLE
Lactose digestion and the evolutionary genetics of lactase
persistence
Catherine J. E. Ingram · Charlotte A. Mulcare ·
Yuval Itan · Mark G. Thomas · Dallas M. Swallow
Received: 6 August 2008 / Accepted: 6 November 2008 / Published online: 26 November 2008
© Springer-Verlag 2008
Abstract It has been known for some 40 years that lactase
production persists into adult life in some people but not in
others. However, the mechanism and evolutionary signiWcance of this variation have proved more elusive, and continue to excite the interest of investigators from diVerent
disciplines. This genetically determined trait diVers in frequency worldwide and is due to cis-acting polymorphism
of regulation of lactase gene expression. A single nucleotide polymorphism located 13.9 kb upstream from the lactase gene (C-13910 > T) was proposed to be the cause, and
the ¡13910*T allele, which is widespread in Europe was
found to be located on a very extended haplotype of 500 kb
or more. The long region of haplotype conservation reXects
a recent origin, and this, together with high frequencies, is
evidence of positive selection, but also means that
¡13910*T might be an associated marker, rather than
being causal of lactase persistence itself. Doubt about function was increased when it was shown that the original SNP
did not account for lactase persistence in most African
populations. However, the recent discovery that there are
Electronic supplementary material The online version of this
article (doi:10.1007/s00439-008-0593-6) contains supplementary
material, which is available to authorized users.
C. J. E. Ingram · C. A. Mulcare · Y. Itan · M. G. Thomas ·
D. M. Swallow (&)
Department of Genetics Evolution and Environment,
University College London, Wolfson House,
4 Stephenson Way, London NW1 2HE, UK
e-mail: d.swallow@ucl.ac.uk
Y. Itan
Centre for Mathematics and Physics in the Life Sciences
and Experimental Biology, CoMPLEX,
University College London, Wolfson House,
4 Stephenson Way, London NW1 2HE, UK
several other SNPs associated with lactase persistence in
close proximity (within 100 bp), and that they all reside in a
piece of sequence that has enhancer function in vitro, does
suggest that they may each be functional, and their occurrence on diVerent haplotype backgrounds shows that several independent mutations led to lactase persistence. Here
we provide access to a database of worldwide distributions
of lactase persistence and of the C-13910*T allele, as well
as reviewing lactase molecular and population genetics and
the role of selection in determining present day distributions of the lactase persistence phenotype.
Introduction
Lactase, the small intestinal enzyme responsible for cleaving lactose into its constituent absorbable monosaccharides,
glucose and galactose, is essential for the nourishment of
newborn mammals, whose sole source of nutrition is milk,
in which lactose is the major carbohydrate component. In
adult mammals other than humans lactase production
decreases signiWcantly in quantity following weaning (Buller et al. 1990; Lacey et al. 1994; Sebastio et al. 1989).
Although individual diVerences in the ability of human
adults to digest milk had been remarked upon in Roman
times, variation in expression of lactase was not established
as a genetically determined trait until the second half of the
twentieth century. Indeed before this, expression of high
levels of lactase in adulthood was considered by people of
European descent to be the ‘normal’ state of aVairs, and
widespread deWciency of lactase in adults was only appreciated in the early 1960s (Auricchio et al. 1963; Dahlqvist
et al. 1963).
Here, we review all aspects of this polymorphism from
description of phenotype to molecular and evolutionary
123
580
genetics. Since we had noted that the population distribution data available in many literature reviews contained
anomalous information (as will be discussed below) we
also provide access to a newly constructed database of phenotypic data taken from source publications.
Determination of lactase persistence status
People whose lactase persists at high levels throughout
adult life are said to be lactase persistent while those with
little lactase as adults are described as lactase non-persistent (also referred to in the literature as primary adult hypolactasia). Since taking intestinal biopsies from healthy
people is invasive and not acceptable unless the person is
having other investigations, lactase persistence status is
often inferred by a method depending on lactose digestion.
This allows people to be classiWed as lactose digesters and
maldigesters. This diVerence in digestion is measured by a
test traditionally known as a ‘lactose tolerance test’ and
thus the terms tolerant and intolerant are sometimes used,
though this can be confused with dietary intolerance.
The lactose tolerance test usually involves giving a lactose load after an overnight fast and then measuring blood
glucose or breath hydrogen. A baseline measurement of
blood glucose or breath hydrogen is taken before ingestion
of the lactose, and then at various time intervals thereafter.
An increase in blood glucose indicates lactose digestion
(glucose produced from the lactose hydrolysis is absorbed
into the bloodstream), and no increase, or a ‘Xat line’ is
indicative of a lactose maldigester (probable lactase nonpersistent) phenotype. An increase in breath hydrogen indicates maldigestion and reXects colonic fermentation of the
lactose, as described in the following section. In both cases
somewhat arbitrary cut-oV points have to be set for distinguishing the two phenotypes and both methods inform
upon the person’s ability to digest lactose rather than the
given individual’s lactase expression. It must therefore be
borne in mind that there will be an underlying error rate,
leading to both false negatives and false positives. The relative eYciency of the tests has been examined in more than
one study, and the breath hydrogen method was found the
most accurate (Mulcare et al. 2004; Newcomer et al 1975;
Peuhkuri 2000). It is also convenient and cheap. Lactase
levels can, however, be secondarily reduced by gastrointestinal disease, leading to secondary lactose intolerance and
also some people fail to produce hydrogen. In the clinical
setting there are ways of improving the quality of the test.
These include retesting, and giving a dose of a non-digestible
carbohydrate, lactulose, to test for the presence of hydrogen
producing bacteria (see section below), and investigation of
other causes of the lactose intolerance, which might include
examination of biopsy material.
123
Hum Genet (2009) 124:579–591
Symptoms of lactose intolerance
Undigested lactose passing through the small intestine
into the colon has two physiological eVects. First, an
osmotic gradient is set up across the gut wall, which
results in an inXux of water, causing symptoms of diarrhoea. Second, the lactose can be fermented by colonic
bacteria, to produce fatty acids and gaseous by-products
(including hydrogen, used in the tolerance test), potentially causing discomfort, bloating and Xatulence. However most lactase non-persistent individuals can tolerate
small amounts of lactose (as in tea or coVee), and some
can consume a lot without ill eVects (Scrimshaw and
Murray 1988; Suarez et al. 1997). Variation in the composition of the gut Xora between individuals (Hertzler
et al. 1997; Hertzler and Savaiano 1996), as well as a
psychosomatic component (Briet et al. 1997; Peuhkuri
et al. 2000; Saltzman et al. 1999) may account for some
of the interindividual variation in symptoms.
Worldwide distribution of lactase persistence
Surveys of lactase persistence phenotype frequencies
have been carried out in many populations over the
years, so that the global distribution of lactase persistence is now fairly well characterised (Flatz 1987; Swallow and Hollox 2000; Table 1 supplementary
information; Fig. 1a). This reveals that lactase non-persistence is the most common phenotype in humans (65%
if one takes into account population census size as
shown in Table 2 of the supplementary information),
with lactase persistence being common only in certain
populations with a long history of pastoralism and milking (McCracken 1971; Simoons 1970). Lactase persistence is at highest frequency in north-western Europe,
with a decreasing cline to the south and east. On the
Indian subcontinent the frequency of lactase persistence
is higher in the north-west than elsewhere, and further
east than India the lactase persistence frequency is generally low. In Africa, the distribution is patchy, with
some pastoralist nomadic tribes having high frequencies
of lactase persistence compared with neighbouring
groups living in the same country (Bayoumi et al. 1981,
1982), with a similar pattern observed between Bedouin
and neighbouring populations in the Middle East (Fig. 2,
Cook and al-Torki 1975; Dissanyake et al. 1990; Snook
et al. 1976).
The noted correlation of lactase persistence phenotype
with the cultural practise of milking generated the hypothesis that this trait has been subject to strong positive selection (Aoki 1986; Holden and Mace 1997; McCracken 1971;
Simoons 1970, 1978).
Hum Genet (2009) 124:579–591
Fig. 1 Interpolated maps of the
‘old world’ showing the distribution of (a) lactase persistence
data taken from the literature
(Supplementary data Table 1),
(b) -13910*T distribution (c)
lactase persistence frequency
predicted from -13910*T distribution, using the data collection
to be found in Supplementary
data Table 3. Maps were
generated using PYNGL (http://
www.pyngl.ucar.edu). Only
includes individuals over
12 years of age, who are
unrelated, and literature for
which the original publications
have been located and checked.
Articles in which there was clear
selection bias, and recent
immigrant populations are excluded, but the data can be found
in Supplementary data Table 1.
The Americas are excluded from
all maps because of the paucity
of data. Most data were obtained
from lactose tolerance tests
using either breath hydrogen or
blood glucose, though in some
cases enzyme assay data were
available. Locations were either
as described precisely in the
publication, or taken from
capital cities or central points of
a country or region where
precise location is not
mentioned. Where more than
one data set was available
weighted averages of the data
were taken. Predicted frequency
taken to be p2 + 2pq, where p is
the frequency of ¡13910*T.
Data points are shown as dots. It
should be noted that the
interpolation is inaccurate where
there are few data points. A
colour version of this Wgure can
be found in the electronic
supplementary information
581
(a)
(b)
(c)
123
582
0.9
Lactose digester frequency
Fig. 2 Examples of countries/
geographic regions in which
individual ethnic groups display
large diVerences in lactose
absorption capacity. See
Supplementary data (Table 1)
for details
Hum Genet (2009) 124:579–591
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
Beja
Jaali
Baggara
Nilotes
Fulani
Hausa
Ibo
Nigeria
Sudan
Yoruba
Jordanian
Bedouin
Non-Bedouin
Jordanians
Saudi
Bedouin
Non-Bedouin
Saudis
Middle East
nature of this (Wang et al. 1995) was obtained from mRNA
studies.
Sequencing of LCT and the immediate promoter region
in Europeans showed no nucleotide changes that were
absolutely associated with persistence/non-persistence
(Boll et al. 1991; Lloyd et al. 1992; Poulter et al. 2003).
However, several polymorphisms do exist across the 50 kb
LCT gene and association studies revealed that very few
haplotypes occur in most of the human populations tested,
although greater diversity was observed in African populations (Hollox et al. 2001). One combination of alleles
designated the ‘A’ haplotype (Fig. 3) is particularly common
in northern Europe and is associated with lactase persistence (Harvey et al. 1998). A putative causative single
nucleotide polymorphism (C-13910 > T) was subsequently
identiWed 13.9 kb upstream of the LCT transcription initiation site (Enattah et al. 2002) (Fig. 3). It is located in an
intron of an adjacent gene, MCM6, and occurs exclusively
on the background of the A haplotype (Poulter et al. 2003).
The ¡13910*T allele was found to associate completely
with lactase persistence, ascertained directly by enzyme
Identifying the causes of lactase persistence
By the early 1970s it was established that the lactase persistence polymorphism in humans has a genetic cause, and is
inherited in an autosomal dominant manner (Ferguson and
Maxwell 1967; Metneki et al. 1984; Sahi 1974). Further
evidence that lactase persistence is a genetic trait, and more
speciWcally that it is caused by a cis-acting element, was
produced in the early 1980s. Ho et al. reported a trimodal
distribution of sucrase:lactase ratios in intestinal samples
from British adults of northern European ancestry. The trimodal distribution was interpreted as attributable to groups
of individuals homozygous for lactase persistence (highest
lactase activity), heterozygotes with mid-level activity and
non-persistent homozygotes with low lactase activity (Ho
et al. 1982), and similar results were subsequently obtained
in individuals of German ancestry (Flatz 1984). The intermediate lactase activity observed in the heterozygotes indicated that only one copy of the lactase gene was being fully
expressed. Evidence for transcriptional regulation (Escher
et al. 1992) and conWrmatory evidence for the cis-acting
-14010*C
-13915*G
-13910*T
-13907*G
…
LCT
MCM6
A
B
C
U
1 2 3 4 5 6 7
Fig. 3 Diagrammatic representation of the genes MCM6 and LCT.
The arrow indicates the location of ¡13910*T, and the other alleles
shown more recently to be associated with lactase persistence. Locations of SNPs used for LCT core haplotype analysis are shown, with the
possible allelic combinations of the four common worldwide 11 SNP
123
8 9
10 11
haplotypes described in Hollox et al. (2001). The open circles indicate
an ancestral allele and Wlled circles denote the derived allele at a locus.
SNPs used for assessing haplotype background of the lactase persistence associated variants in our own studies are 4, 6, 9 and 10
Hum Genet (2009) 124:579–591
activity in 196 Finnish individuals, and subsequent studies
have conWrmed a tight but not absolute association between
¡13910*T and lactase persistence as judged by lactose tolerance testing in populations of northern European ancestry
(Bernardes-Silva et al. 2007; Hogenauer et al. 2005; Kerber
et al. 2007; Poulter et al. 2003) and there was also a correlation, but not absolute, between genotypes and enzymatic
activity (Poulter et al. 2003). However the A haplotype
extends far beyond the 50 kb LCT gene region, with carriers of the ¡13910*T allele having almost identical chromosomes extending for nearly 1 Mb (Bersaglieri et al. 2004;
Poulter et al. 2003).
Evidence for function of ¡13910*T
In vitro studies provided evidence that the ¡13910*T allele
increases transcription in promoter–reporter construct
assays in cell lines (Lewinsky et al. 2005; Olds and Sibley
2003; Troelsen et al. 2003), suggesting that it may have
enhancer activity in vivo. A transcription factor, Oct-1, was
identiWed which bound more strongly to the ¡13910*T
containing motif than to the alternative C allele, providing a
possible mechanism for up-regulation of LCT (Lewinsky
et al. 2005), and suggesting that the cause of lactase persistence had been identiWed (Rasinpera et al. 2004), although
many questions remain unanswered.
Population distribution of ¡13910*T: ¡13910*T does
not account for lactase persistence worldwide
and is rare in sub-Saharan African populations
Using carefully checked primary source literature data
(Supplementary Table 1) we failed to obtain the tight correlation of ¡13910*T with published worldwide lactase persistence phenotype frequency reported elsewhere (Enattah
et al. 2007), but it is clear that in Europe the frequency distribution of ¡13910*T is in broad agreement with that
expected from distribution of the phenotype (Fig. 1).
Figure 1a shows an interpolated contour map depicting the
distribution of lactase persistence, prepared from phenotypic data taken from all the available literature, in which
we were conWdent of the phenotypic testing, and from
which children, family members, patients selected for
likely intolerance, and twentieth/twenty-Wrst century immigrant status were excluded. Figure 1b shows the distribution of ¡13910*T and details of the worldwide ¡13910*T
data can be found in the supplementary information (Supplementary Table 3). Figure 1c shows predicted lactose tolerance distribution taken from ¡13910*T frequencies,
assuming that ¡13910*T is the sole cause of lactase persistence and is dominant (p2 + 2pq).
583
In contrast to the high frequency in Europe, ¡13910*T
is rare in sub-Saharan African populations (Fig. 1b) even in
those populations where lactase persistence frequency is
reported to be high (Mulcare et al. 2004), and it is also rare
in the Bedouins of the Arabian peninsula, who are also frequently lactose digesters (Ingram et al. 2007). The allele
was also absent from all but one of a series of phenotyped
individuals of Sudanese ancestry (Ingram et al. 2007). An
obvious interpretation was that -13910*T is not truly causal
of lactase persistence, but is a very strongly associated
marker of the causal element, which appeared on the lactase
persistence carrying (A haplotype) chromosome after
humans had spread out of Africa. However there was also
no association with A haplotype in this African group and
subsequent research indicated genetic heterogeneity.
New variants in intron 13 of MCM6, and multiple
causes of lactase persistence in Africa
Three studies revealed several new sequence variants in
very close proximity (Figs. 3, 4; Table 1) to ¡13910*T
(Enattah et al. 2008; Ingram et al. 2007; TishkoV et al.
2007), two of which are clearly associated with lactase persistence in diVerent parts of East Africa (¡13915*G and
¡14010*C). One of these, ¡13915*G, was also shown to
be associated with high lactase expression in Saudi Arabia
(Imtiaz et al. 2007). A third SNP, ¡13907*G, showed
much weaker evidence, but was found in several studies
(Enattah et al. 2008; Ingram 2008; Ingram et al. 2007;
TishkoV et al. 2007), and there were several other candidates found in lactase persistent or milk drinking people
(Enattah et al. 2008; Ingram et al. 2007; Ingram 2008; Tag
et al. 2007; TishkoV et al. 2007). However, even taking
these additional variants into account, and supposing them
all to be functional, association with phenotype was not
complete. Although the occurrence of a few individuals
who carried an allele but were lactose maldigesters could
be explained by secondary lactase loss, individuals who
were digesters but carried no putative causative allele in
this genomic region still had to be explained, indicating that
there may be more, as yet unidentiWed, causal variants. The
genomic region may be particularly susceptible to mutations, and these ‘recent’ derived variants might simply be
markers of a causal element elsewhere. However, the three
newly described SNPs all occur on diVerent haplotype
backgrounds from each other (using our old nomenclature:
¡13907*G, on A, ¡13915*G, on C, and ¡14010*C probably on B) (Enattah et al. 2008; Ingram et al. 2007; Ingram
2008; TishkoV et al. 2007), although ¡13907*G is on the
same haplotype as ¡13910*T. In each case the haplotypes
extend well beyond the »¡14 kb allele in both directions,
showing clearly that the derived alleles cannot simply be
123
584
Hum Genet (2009) 124:579–591
-14133 TTTATGTAACTGTTGAATGCTCATACGACCATGGAATTCTTCCCTTTAAAGAGCTTGGTAAGCATTTGAGTGTAGTTGTTAGACGGAGACGATCACGTC
Cdx-2
-14034 ATAGTTTATAGAGTGCATAAAGACCGTAAGTTACCATTTAATACCTTTCATTCAGGAAAAATGTACTTAGACCCTACAATGTACTAGTAGGCCTCTGCGCT
HNF3α/Fox
HNF4α
GATA6
T
C
-13934 GGCAATACAGATAAGATAA GGTAGCTCC GTGGCCTCAAAGGAACTCTCCTCCTTAGGTTGCATTTGTATAATGTTTGATTTTTAGATTGTTCTTTGAGCCCT
Oct-1
-13833 GCATTCCACGAGGATAGGTCAGTGGGTATTAACGAGGTAAAAGGGGAGTAGTACGAAAGGGCATTCAAGCGTCCCATCTTCGCTTCAACCAAAGCAGCCC
-13733 TGCTTTTTCCTAGTTTTATTAATAGGTTTGATGTAAGGTCGTCTTTGAAA
-13684
Fig. 4 Sequence of the enhancer region in intron 13 of MCM6 showing the positions of characterised transcription factor binding sites
(Lewinsky et al. 2005) and the SNPs that have been shown to associate
with lactase persistence. Note that the protein binding region ¡13926
to ¡13909 is comprised of two partially overlapping sites (Oct-1 and
GATA6 as indicated). Several other SNPs that have been identiWed by
ourselves and others, in this region, including ¡13913T > C are not
shown since, as yet, no evidence of association with phenotype is available
markers for a single shared causal variant, and that there
must be several independent causes of lactase persistence.
Each of the alleles has a diVerent geographic distribution,
and the preliminary data suggest that -13915*G arose in the
Middle East, while ¡13907*G and ¡14010*C arose in
eastern Africa.
¡13915*G) was present (TishkoV et al. 2007). This eVect
is in fact small and the authors did not include ¡13910*T
as a positive control (previously shown to enhance transcription activity a further 80% compared to the ancestral
allele (Troelsen et al. 2003). Although a recent paper of
Enattah et al. (2008) does conWrm an eVect for ¡13915*G,
the results are hard to evaluate because additional
sequences are included in the construct, and the control
¡13910*T shows very little eVect in this study. However,
in the Enattah et al. (2008) paper the Caco-2 cells were not
diVerentiated, as they had been in some of the previous
studies (Troelsen et al. 2003). This also Xags the problem of
the appropriateness of the cell model. Caco-2 is a colon cell
line, and the only line known to express lactase and has features more comparable with fetal small intestine (Hauri
et al. 1985).
The predictive value of these in vitro functional studies
with respect to the eVect exerted in vivo by particular alleles is therefore uncertain, but the observations, together
with those made previously (Lewinsky et al. 2005; Olds
and Sibley 2003; Troelsen et al. 2003) do suggest, though
do not conWrm that this region is important in regulation of
LCT expression. But how it allows low expression in
fetuses, high expression in babies and then down-regulation
in some but not other people is currently hard to envisage.
Studies in mice Xag the complexities of interpretation of in
vitro studies, and indeed in vivo studies highlight the subtleties of tissue and developmental control (Bosse et al.
2006a, b, 2007; van Wering et al. 2004). Unfortunately
there are severe restrictions to animal models in elucidating
this uniquely human polymorphism.
Evidence of function for the alleles identiWed in Africa
It is important to critically evaluate the evidence for function of these recently described alleles. Footprint analysis,
to determine DNA–protein binding sites, of sequence
encompassing the intron 13 region revealed transcription
factor recognition sequences for Cdx-2, GATA, HNF3/
Fox and HNF4 along with Oct-1 (Lewinsky et al. 2005).
Two of the newly identiWed SNPs are located within the
Oct-1 binding site (Fig. 4). Electrophoretic mobility shift
assays (EMSAs) used to ascertain the eVect of the new alleles on Oct-1 binding showed that only the original allele,
¡13910*T containing oligonucleotide probes bound
strongly to Oct-1, -13907*G bound to a much lesser extent
(Enattah et al. 2008; Ingram et al. 2007), and that binding
of the other alleles was less still or undetectable. It can
therefore be concluded that the simple change in binding of
the protein Oct-1 to this site is unlikely to play a critical
role in causing lactase persistence. The identiWcation of the
other associated allele, ¡14010*C, (TishkoV et al. 2007),
situated 100 bp away from the predicted Oct-1 binding site
would appear to conWrm this.
In vitro promoter/reporter analysis of the newly identiWed MCM6 intron 13 variant alleles however, lends some
support to the idea that they do aVect enhancer activity.
Transcriptional activity of the LCT core promoter was
enhanced up to tenfold by addition of sequences from
MCM6 intron 13 (Lewinsky et al. 2005; Olds and Sibley
2003; TishkoV et al. 2007) which include the ancestral variant. This activity increased further (by up to 25% more)
when one of the variant alleles (¡14010*C, ¡13907*G or
123
The role of other factors inXuencing lactase expression
The immediate promoter of LCT is moderately well characterised in rat, pig and human (Fang et al. 2000, 2001;
Krasinski et al. 2001; Lee et al. 2002; Mitchelmore et al.
2000; Spodsberg et al. 1999; Troelsen et al. 1994, 1997;
Note that we and others have identiWed a total of ten other alleles (including -13913*C) within the 130 bp region -13,900 to -14,030 for which studies of their association and function are ongoing
Ethiopia/Sudan
TishkoV et al. (2007), Enattah et al. (2008)
C>G
13,907
rs41525747
TishkoV et al. (2007)
Ingram (2008)
A
Europe
Troelsen et al. (2003), Olds and Sibley (2003),
Lewinsky et al. (2005)
C>T
13,910
rs4988235
Enattah et al. (2002)
A
Saudi Arabia
TishkoV et al. (2007), Enattah et al. (2008)
T>G
13,915
rs41380347
Ingram et al. (2007),
TishkoV et al. (2007),
Imtiaz et al. (2007)
C
Kenya/Tanzania
TishkoV et al. (2007)
TishkoV et al. (2007)
G>C
14,010
Not included
in dbSNP
Evidence of function
Substitution
(ancestral allele Wrst,
from comparison
with chimp)
rs Number
Evidence of association with
lactase persistence
B
585
Position of
SNP (in bps
upstream of LCT)
Table 1 Details of SNPs known to be associated with lactase persistence as of July 2008
Haplotype
(Hollox et al. 2000
nomenclature)
Geographic location of
highest observed frequency
Hum Genet (2009) 124:579–591
van Wering et al. 2004; Wang et al. 2006), and there are
several allelic variants within the Wrst kilobase of human
sequence (Harvey et al. 1995; Hollox et al. 1999; Lloyd
et al. 1992). Although none of them is causal of persistence,
it is just possible that variations in these SNPs aVect expression under certain circumstances or at certain developmental stages: one study shows that the allele -958*T
(characteristic of the B haplotype) reduces binding to an
uncharacterised transcription factor (Hollox et al. 1999).
Whilst it has been well established that regulation of LCT is
predominantly under genetically determined transcriptional
control there is evidence that other factors inXuence interindividual diVerences in expression of the enzyme. Heterogeneity of the lactase non-persistence phenotype was
reported by a number of research groups in their early studies.
Some investigators observed individuals who show slower/
abnormal processing of their lactase protein (Sterchi et al.
1990; Witte et al. 1990) which may imply variation in posttranslational controls such as proteolytic cleavage, glycosylation and/or transport to the cell surface, which are
involved in the normal processing of lactase (Jacob et al.
1994, 1995, 1996, 2002; Naim and Lentze 1992). Others
have made observations suggestive of epigenetic regulation
(Maiuri et al. 1991, 1994). Although most non-persistent
individuals show no staining for lactase in the jejunal biopsies of the small intestine (concordant with low lactase
activity and transcriptional regulation of LCT), some individuals show patchy expression of the enzyme in the intestinal epithelia (Maiuri et al. 1991, 1994). This mosaic
expression pattern might be attributable to somatic cell
changes in methylation, or histone acetylation but curiously
this is not attributable to an ‘inherited’ change in expression
pattern from a single stem cell, since in that case ‘ribbons’
of positively stained cells would be expected.
Evolutionary considerations
The original observations in the 1970s and 1980s of a positive correlation between lactase persistence frequencies and
milk drinking led to the widely held notion that lactase persistence has been subject to positive selection. In the intervening years molecular evidence has accumulated which
would appear to corroborate this hypothesis. Our group Wrst
reported on the unusual pattern of lactase gene haplotype
diversity across populations (Hollox et al. 2001). We found
only four common 50 kb haplotypes outside Africa, with
many more within Africa, and a very high frequency of the
A haplotype in northern Europe, and suggested that the
very diVerent haplotype frequencies observed in N. Europeans as compared to other populations are most probably
explained by a combination of genetic drift and strong positive selection for lactase persistence (Hollox et al. 2001).
123
586
Hum Genet (2009) 124:579–591
-13910*C A haplotype,
-13910*T A haplotype
-13910*C non-A haplotype
Fig. 5 Pie charts showing microsatellite LCT/MCM6 haplotypes on
chromosomes of diVerent SNP haplotype background: A haplotype
carrying ¡13910*T, A haplotype carrying ¡13910*C and non-A haplotype chromosomes. 5579*C (rs2278544), SNP 10 in Fig. 3, used as
a marker for A haplotype and 5579*T as a marker for non-A haplotype,
and the A haplotype chromosomes are subdivided into those that do
and do not carry ¡13910*T. The lactase persistence associated SNP,
¡22018*A (rs182549), originally described in Enattah et al. (2002)
was tested on all samples and ¡22018*A correlated in all but one
sample with ¡13910*T. Data taken from families and the haplotypes
inferred from family structure. Data sets from: Irish n = 65 chromo-
somes, English n = 64, German, n = 60, French, n = 38, Ashkenazi
Jews n = 96, Armenian, n = 88, Kuwaiti, n = 28, Algerian, n = 20,
Ethiopian, Amharic n = 118; n values for main charts shown. The inset
small charts show Ethiopian chromosomes only; n = 93 for non-A haplotype; n = 25 for A haplotype. It can be seen that both groups of Ahaplotype chromosomes share the same modal haplotype as do both
groups of non-A chromosomes. The microsatellites tested are located
in intron 16 of MCM6, intron 1, 2 and 13 of LCT, respectively at positions 13840816, 136804355, 136798196, 136763409, from the Human
Genome Browser (http://genome.cse.ucsc.edu/cgi-bin/hgGateway
July 2003 freeze (colour in online)
More recently it has been shown that ¡13910*T occurs
on an unusually extended haplotype background, which is
present in the northern European population at very high
frequency (Bersaglieri et al. 2004; Poulter et al. 2003). This
is consistent with a model of recent positive selection, in
which alleles surrounding the causal variant ‘hitch-hike’
rapidly to high frequency due to strong positive selection,
and haplotype length is exaggerated, indicating a recent
mutation event where recombination has not decayed the
allelic associations in the region (reviewed in Sabeti et al.
2006). The ¡13910*T carrying chromosome is a real
outlier in the context of molecular signatures of selection
compared with the rest of the human genome (HapMap
Consortium 2003). Decreased diversity of microsatellite
polymorphisms (STRs) that occurs in the region of LCT
and MCM6 was also found for the ¡13910*T carrying
chromosomes, indicating that this allele has risen in frequency quickly and recently (Coelho et al. 2005; Mulcare
2006) (Fig. 5).
In our own study (Mulcare 2006) we used a marker for
A haplotype chromosomes so that we could compare A
haplotype chromosomes which carry the ¡13910*T with A
haplotype chromosomes which do not, thus reducing the
eVect of pooling haplotypes of totally diVerent lineages.
Interestingly, we can see from this that the microsatellite
haplotype that carries ¡13910*T is also the most frequent
123
Hum Genet (2009) 124:579–591
of the ancestral A haplotype chromosomes in Europeans,
and also in non-Europeans. It can also be seen that within
the non-A lineages there is a fairly frequent microsatellite
haplotype which occurs in Europeans as well as non-Europeans (Fig. 5). It is associated with the B core haplotype in
Europeans, and non-persistence. These observations suggest demographic factors additional to selection for one
particular allele, as proposed previously (Hollox et al.
2001). Indeed, in the case of European lactase persistence,
recent demic computer simulations indicate that the spread
of farming from the near east during the Neolithic transition
may have contributed to the high frequencies and genetic
homogeneity of lactase persistence on the continent
(Y. Itan, M. Thomas et al. manuscript in preparation).
Historical origins of lactase persistence; dating
of the lactase persistence associated alleles
Each of the microsatellite diversity studies used the microsatellites to attempt to date the expansion of the ¡13910*T
allele and the date ranges were 7,450–12,300 (Coelho et al.
2005), and 7,400–10,200 years ago (Mulcare 2006), and
this agrees with date estimates obtained from extended haplotypes of 2,188–20,650 years ago (Bersaglieri et al. 2004).
These dates are consistent with models of selection for lactase persistence along with the recent practise of dairying,
approximately 9,000 years ago in Europe. Ancient DNA
data obtained from human bones has shown that the
¡13910*T allele was either absent, or present at low frequencies, in early Neolithic Europeans. This is consistent
with the -13910*T allele age estimates and supports a
model whereby the cultural trait of dairying was adopted
prior to lactase persistence becoming frequent (Burger et al.
2007).
The newly discovered ¡14010*C allele is also reported
to occur as part of an unusually extended haplotype, suggesting that Africans too carry these signatures of recent
positive selection for lactase persistence. In this case the
allele is estimated to be between 1,200 and 23,200 years
old (TishkoV et al. 2007).
The identiWcation of the newly associated alleles themselves suggests that lactase persistence has arisen and been
selected for independently in several diVerent human populations, thus the ability to digest milk has been extremely
advantageous, at least for some, in the last few thousand
years.
What were the evolutionary forces?
Because of the worldwide distribution of lactase persistence and the generally coinciding pattern of historically
587
milk-drinking populations, Simoons and McCracken independently suggested, more than 30 years ago, that milk
dependence created strong selection for lactase persistence
(McCracken 1971; Simoons 1970). This has become
known as the ‘culture historical hypothesis’, and suggests
that the rise in lactase persistence co-evolved alongside the
cultural adaptation of milk drinking, and its associated
nutritional beneWts. Nevertheless, the correlation is not
absolute and there are exceptions in both directions. For
example there are some ethnic groups who rely heavily on
milk products and for whom cows or camels play a very
important role in their lifestyle, but who have a low
reported frequency of lactase persistence, for example, the
Dinka and Nuer in Sudan (Bayoumi et al. 1982) and the
Somali in Ethiopia (Ingram 2008). Statistical modelling
shows that an incomplete correlation can be accommodated
if some lactase persistent populations have recently stopped
milking or conversely have only recently adopted the habit,
therefore allowing insuYcient time for lactase persistence
to be driven to high frequency (Aoki 1986). Population
migration may also have played an important role. In addition the cultural practise of milk fermentation (e.g. to
yoghurt or cheese) reduces lactose content allowing nonpersistent individuals to beneWt from milk products.
Holden and Mace using regression analyses and correcting for relatedness of diVerent populations claimed that lactose digestion capacity had most likely evolved as an
adaptation to dairying, and concluded that high frequency
lactose digestion capacity had never ‘evolved’ without the
prior presence of milking (Holden and Mace 1997). Other
evidence suggested to be in support of the culture-historical
hypothesis has been provided by the observation that highintra allelic diversity of cattle milk protein genes in Europe
coincides with the geographic incidence of lactase persistence, which is consistent with large herd sizes kept for
dairying and selection for high milk yields (Beja-Pereira
et al. 2003).
However, it is noteworthy that at least in the Somali, one
of us (CI) has obtained data to suggest that signiWcant quantities of fresh milk are consumed by many who are lactase
non-persistent (Ingram 2008) apparently without any
adverse eVects, and it seems likely that adaptation of the
colonic bacterial Xora allows digestion of lactose by these
people. This means that under normal circumstances lactase
persistence is unlikely to be under very strong selection in
this population, and Wts with the hypothesis that dairying
and milk drinking can emerge before the genetic adaptation. It is likely that only at certain times and under more
extreme circumstances, such as drought and famine, that
the strong selective force operates. This is an extension of
the arid climate hypothesis, Wrst suggested by Cook and
al-Torki (1975). These authors speculated that in desert
climates (i.e. Middle and Near East) where water and food
123
588
were scarce, nomadic groups could survive by utilizing
milk as a food source, and in particular, as a source of
clean, uncontaminated Xuid (Cook and al-Torki 1975). This
scenario is particularly pertinent to desert nomads whose
major source of milk is obtained from camels, as these animals are able to survive up to 2 weeks without food and
water by metabolising the fat contained in their humps. The
beneWts to persistent individuals may have become more
pronounced during outbreaks of diarrhoeal disease, when
non-persistent individuals would be unable to utilize milk
as a water source without exacerbating their condition.
More recent research sought to address the question of
why some populations and not others had adopted the cultural habit of milk drinking. The frequencies of lactose malabsorption were greater in populations where environmental
conditions, such as extremes of climate or high incidence of
endemic cattle disease, made it impossible to raise livestock
(Bloom and Sherman 2005). The exceptions to the general
distribution were a number of African groups with high lactase persistence frequency who managed to circumvent
harsh environmental conditions by adopting a pastoralist
way of life (Bloom and Sherman 2005).
Obviously, the beneWts of milk drinking cannot be
explained by the arid climate hypothesis in Northern
Europe. Here, the advantage of improved calcium absorption has been suggested to explain the distribution of the
trait (Flatz and Rotthauwe 1973). The low light levels experienced at high latitudes are associated with an increased
risk of developing rickets and osteomalacia due to a lack of
vitamin D production (which is synthesized by the skin in
the presence of sunlight). Vitamin D is involved in the gut
absorption of calcium, which is itself an essential mineral
required for bone health. In addition, calcium may help to
prevent rickets by impairing the breakdown of vitamin D in
the liver (Thacher et al. 1999). Although lactase non-persistent individuals could obtain calcium from yoghurt or
cheese, dairy foods that contain reduced lactose, milk proteins and lactose are believed to facilitate the absorption of
calcium (for review see Gueguen and Pointillart 2000).
Hence the ability to drink fresh milk which contains both
calcium and components that stimulate its uptake (including small amounts of vitamin D) may have provided an
advantage to persistent individuals.
Just one hypothesis has been put forward which suggests
selection for lactase non-persistence. Since lactase non-persistence is the ancestral state, the need to invoke selection
for non-persistence is counter-intuitive, but should not be
ignored. In this proposal the selective agent is thought to be
malaria (Anderson and Vullo 1994). This proposal came
from the observations of high frequency of lactase non-persistence in regions where malaria is endemic, and that individuals with Xavin deWciency are at a slightly reduced risk
of infection by malaria. The consumption of milk, which is
123
Hum Genet (2009) 124:579–591
rich in riboXavins, was therefore proposed to be unfavourable since it would keep Xavin levels in the bloodstream
high. There is currently no support for this hypothesis
(Meloni et al. 1998), and it seems unlikely to contribute to
the current distribution of lactase persistence.
Present day health and medical considerations
Lactose malabsorption can readily be confused with milk
protein allergy, which has quite diVerent causes (reviewed
in Crittenden and Bennett 2005), and in recent times lactose
intolerance has been blamed for causing a variety of systemic conditions, often without clear evidence (Campbell
and Matthews 2005; Matthews et al. 2005). Nonetheless it
does appear that consumption of milk and milk products by
those who cannot digest lactose is a relatively common
cause of irritable bowel syndrome in Europe and the USA
(Vesa et al. 2000). Many commercial dairy products and
other foods (including yoghurts) contain high concentrations of lactose introduced in manufacturing, so that lactose
is more widespread in the diet than it was for that same person’s ancestors. Lactose tolerance testing can be a useful way
of detecting lactose malabsorption and enabling avoidance of
the cause, but DNA testing is not yet useful, particularly for
non-Europeans (Swallow 2006; Tag et al. 2008; Weiskirchen et al. 2007). In countries such as Finland, where there
is a high frequency of lactase non-persistence in comparison with the rest of northern Europe, commercial low
lactose products are readily available (Harju 2003).
Many association studies have attempted to demonstrate
the health beneWts of milk consumption in lactase persistent
people, e.g. by providing protection against osteoporosis
(Enattah et al. 2005a, b; Meloni et al. 2001; ObermayerPietsch et al. 2004), and others have claimed adverse eVects
of lactase persistence and associated high milk consumption (e.g. cataracts, ovarian cancer and diabetes) (Enattah
et al. 2004; Larsson et al. 2006; Meloni et al. 2001; Meloni
et al. 1999; Villako and Maaroos 1994). The often-contradictory Wndings are diYcult to evaluate because of the high
risk of confounding eVects such as mixed ancestry, dietary
intake and variation in gut Xora.
Conclusion
Lactase persistence has been one of the leading examples of
natural selection in humans, and also one of the Wrst clear
examples of polymorphism of a regulatory element. Further
investigation of the molecular mechanisms as well as the
evolutionary forces is however needed to fully understand
this normal variation, which is providing an important
model for understanding gene/culture co-evolution and
Hum Genet (2009) 124:579–591
disease susceptibility. The information accrued so far
already illustrates the limitations of disease association
studies and SNP tagging to Wnd functional genetic variation
attributable to multiple mutations, even if they are located
in a single gene, and highlights the potential importance of
distant regulatory elements.
Acknowledgments CJEI and CAM were funded by BBSRC CASE
studentships and YI was funded by UCL Graduate school, UCL ORS
and B’nai B’rith/Leo Baeck London Lodge scholarships. We thank
Neil Bradman, The Centre for Genetic Anthropology, UCL, for access
to samples and Melford Charitable Trust for funding.
References
Anderson B, Vullo C (1994) Did malaria select for primary adult
lactase deWciency? Gut 35:1487–1489
Aoki K (1986) A stochastic model of gene-culture coevolution suggested by the culture-historical hypothesis. Proc Natl Acad Sci
USA 83:2929–2933
Auricchio S, Rubino A, Semenza G, Landolt M, Prader A (1963) Isolated intestinal lactase deWciency in the adult. Lancet 2:324–326
Bayoumi RA, Saha N, Salih AS, Bakkar AE, Flatz G (1981) Distribution of the lactase phenotypes in the population of the Democratic
Republic of the Sudan. Hum Genet 57:279–281
Bayoumi RA, Flatz SD, Kuhnau W, Flatz G (1982) Beja and Nilotes:
nomadic pastoralist groups in the Sudan with opposite distributions of the adult lactase phenotypes. Am J Phys Anthropol
58:173–178
Beja-Pereira A, Luikart G, England PR, Bradley DG, Jann OC, Bertorelle G, Chamberlain AT, Nunes TP, Metodiev S, Ferrand N,
Erhardt G (2003) Gene-culture coevolution between cattle milk
protein genes and human lactase genes. Nat Genet 35:311–313
Bernardes-Silva CF, Pereira AC, de Fatima Alves da Mota, Krieger JE,
Laudanna AA (2007) Lactase persistence/non-persistence variants, C/T_13910 and G/A_22018, as a diagnostic tool for lactose
intolerance in IBS patients. Clin Chim Acta 386:7–11
Bersaglieri T, Sabeti PC, Patterson N, Vanderploeg T, SchaVner SF,
Drake JA, Rhodes M, Reich DE, Hirschhorn JN (2004) Genetic
signatures of strong recent positive selection at the lactase gene.
Am J Hum Genet 74:1111–1120
Bloom G, Sherman PW (2005) Dairying barriers aVect the distribution
of lactose malabsorption. Evol Human Behav 26:301–312
Boll W, Wagner P, Mantei N (1991) Structure of the chromosomal
gene and CDNAs coding for lactase-phlorizin hydrolase in humans with adult-type hypolactasia or persistence of lactase. Am J
Hum Genet 48:889–902
Bosse T, Piaseckyj CM, Burghard E, Fialkovich JJ, Rajagopal S, Pu
WT, Krasinski SD (2006a) Gata4 is essential for the maintenance
of jejunal–ileal identities in the adult mouse small intestine. Mol
Cell Biol 26:9060–9070
Bosse T, van Wering HM, Gielen M, Dowling LN, Fialkovich JJ,
Piaseckyj CM, Gonzalez FJ, Akiyama TE, Montgomery RK,
Grand RJ, Krasinski SD (2006b) Hepatocyte nuclear factor1alpha is required for expression but dispensable for histone acetylation of the lactase-phlorizin hydrolase gene in vivo. Am J
Physiol Gastrointest Liver Physiol 290:G1016–G1024
Bosse T, Fialkovich JJ, Piaseckyj CM, Beuling E, Broekman H, Grand
RJ, Montgomery RK, Krasinski SD (2007) Gata4 and Hnf1alpha
are partially required for the expression of speciWc intestinal
genes during development. Am J Physiol Gastrointest Liver Physiol 292:G1302–G1314
589
Briet F, Pochart P, Marteau P, Flourie B, Arrigoni E, Rambaud JC
(1997) Improved clinical tolerance to chronic lactose ingestion in
subjects with lactose intolerance: a placebo eVect? Gut 41:632–
635
Buller HA, Kothe MJC, Goldman DA, Grubman SA, Sasak WV, Matsudaira PT, Montgomery RK, Grand RJ (1990) Coordinate
expression of lactase-phlorizin hydrolase mRNA and enzyme levels in rat intestine during development. J Biol Chem 265:6978–
6983
Burger J, Kirchner M, Bramanti B, Haak W, Thomas MG (2007) Absence of the lactase-persistence-associated allele in early Neolithic Europeans. Proc Natl Acad Sci USA 104:3736–3741
Campbell AK, Matthews SB (2005) Darwin’s illness revealed. Postgrad Med J 81:248–251
Coelho M, Luiselli D, Bertorelle G, Lopes AI, Seixas S, stro-Bisol G,
Rocha J (2005) Microsatellite variation and evolution of human
lactase persistence. Hum Genet 117:329–339
Cook GC, al-Torki MT (1975) High intestinal lactase concentrations in
adult Arabs in Saudi Arabia. Br Med J 3:135–136
Crittenden RG, Bennett LE (2005) Cow’s milk allergy: a complex disorder. J Am Coll Nutr 24:582S–591S
Dahlqvist A, Hammond B, Crane R, Dunphy J, Littman A (1963)
Intestinal lactase deWciency and lactose intolerance in adults: preliminary report. Gastroenterology 45:488–491
Dissanyake AS, El-Munshid HA, Al-Qurain A (1990) Prevalence of
primary adult lactose malabsorption in the eastern province of
Saudi Arabia. Ann Saudi Med 10:598–601
Enattah NS, Sahi T, Savilahti E, Terwilliger JD, Peltonen L, Jarvela I
(2002) IdentiWcation of a variant associated with adult-type hypolactasia. Nat Genet 30:233–237
Enattah NS, Forsblom C, Rasinpera H, Tuomi T, Groop PH, Jarvela I
(2004) The genetic variant of lactase persistence C (¡13910) T as
a risk factor for type I and II diabetes in the Finnish population.
Eur J Clin Nutr 58:1319–1322
Enattah N, Pekkarinen T, Valimaki MJ, Loyttyniemi E, Jarvela I
(2005a) Genetically deWned adult-type hypolactasia and self-reported lactose intolerance as risk factors of osteoporosis in
Finnish postmenopausal women. Eur J Clin Nutr 59:1105–1111
Enattah NS, Sulkava R, Halonen P, Kontula K, Jarvela I (2005b)
Genetic variant of lactase-persistent C/T-13910 is associated with
bone fractures in very old age. J Am Geriatr Soc 53:79–82
Enattah NS, Trudeau A, PimenoV V, Maiuri L, Auricchio S, Greco L,
Rossi M, Lentze M, Seo JK, Rahgozar S, Khalil I, Alifrangis M,
Natah S, Groop L, Shaat N, Kozlov A, Verschubskaya G, Comas
D, Bulayeva K, Mehdi SQ, Terwilliger JD, Sahi T, Savilahti E,
Perola M, Sajantila A, Jarvela I, Peltonen L (2007) Evidence of
still-ongoing convergence evolution of the lactase persistence
T-13910 alleles in humans. Am J Hum Genet 81:615–625
Enattah NS, Jensen TG, Nielsen M, Lewinski R, Kuokkanen M, Rasinpera H, El-Shanti H, Seo JK, Alifrangis M, Khalil IF, Natah A,
Ali A, Natah S, Comas D, Mehdi SQ, Groop L, Vestergaard EM,
Imtiaz F, Rashed MS, Meyer B, Troelsen J, Peltonen L (2008)
Independent introduction of two lactase-persistence alleles into
human populations reXects diVerent history of adaptation to milk
culture. Am J Hum Genet 82:57–72
Escher JC, de Koning ND, van Engen CG, Arora S, Buller HA, Montgomery RK, Grand RJ (1992) Molecular basis of lactase levels in
adult humans. J Clin Invest 89:480–483
Fang R, Santiago NA, Olds LC, Sibley E (2000) The homeodomain
protein Cdx2 regulates lactase gene promoter activity during
enterocyte diVerentiation. Gastroenterology 118:115–127
Fang R, Olds LC, Santiago NA, Sibley E (2001) GATA family transcription factors activate lactase gene promoter in intestinal Caco2 cells. Am J Physiol Gastrointest Liver Physiol 280:G58–G67
Ferguson A, Maxwell J (1967) Genetic aetiology of lactose intolerance. Lancet 2:188–190
123
590
Flatz G (1984) Gene dosage eVect on intestinal lactase activity demonstrated in vivo. Am J Hum Genet 36:306–310
Flatz G (1987) Genetics of lactose digestion in humans. In: Harris H,
Hirschhorn K (eds) Advances in human genetics, vol 16. Plenum
Press, New York, pp 1–77
Flatz G, Rotthauwe HW (1973) Lactose nutrition and natural selection.
Lancet 2:76–77
Gueguen L, Pointillart A (2000) The bioavailability of dietary calcium.
J Am Coll Nutr 19:119S–136S
HapMap Consortium (2003) The International HapMap Project.
Nature 426:789–796
Harju M (2003) Chromatographic and enzymatic removal of lactose
from milk, IDF World Dairy Summit, Bruges, BELGIQUE
(09/2003) 2004, no 389, pp 4–8
Harvey CB, Pratt WS, Islam I, Whitehouse DB, Swallow DM (1995)
DNA polymorphisms in the lactase gene. Linkage disequilibrium
across the 70-kb region. Eur J Hum Genet 3:27–41
Harvey CB, Hollox EJ, Poulter M, Wang Y, Rossi M, Auricchio S, Iqbal TH, Cooper BT, Barton R, Sarner M, Korpela R, Swallow DM
(1998) Lactase haplotype frequencies in Caucasians: association
with the lactase persistence/non-persistence polymorphism. Ann
Hum Genet 62(Pt 3):215–223
Hauri HP, Sterchi EE, Bienz D, Fransen JA, Marxer A (1985) Expression and intracellular transport of microvillus membrane hydrolases in human intestinal epithelial cells. J Cell Biol 101:838–851
Hertzler SR, Savaiano DA (1996) Colonic adaptation to daily lactose
feeding in lactose maldigesters reduces lactose intolerance. Am J
Clin Nutr 64:232–236
Hertzler SR, Savaiano DA, Levitt MD (1997) Fecal hydrogen production and consumption measurements—response to daily lactose
ingestion by lactose maldigesters. Dig Dis Sci 42:348–353
Ho MW, Povey S, Swallow DM (1982) Lactase polymorphism in adult
British natives: estimating allele frequencies by enzyme assays in
autopsy samples. Am J Hum Genet 34:650–657
Hogenauer C, Hammer HF, Mellitzer K, Renner W, Krejs GJ, Toplak
H (2005) Evaluation of a new DNA test compared with the lactose
hydrogen breath test for the diagnosis of lactase non-persistence.
Eur J Gastroenterol Hepatol 17:371–376
Holden C, Mace R (1997) Phylogenetic analysis of the evolution of
lactose digestion in adults. Hum Biol 69:605–628
Hollox EJ, Poulter M, Wang Y, Krause A, Swallow DM (1999) Common polymorphism in a highly variable region upstream of the
human lactase gene aVects DNA–protein interactions. Eur J Hum
Genet 7:791–800
Hollox EJ, Poulter M, Zvarik M, Ferak V, Krause A, Jenkins T, Saha
N, Kozlov AI, Swallow DM (2001) Lactase haplotype diversity in
the Old World. Am J Hum Genet 68:160–172
Imtiaz F, Savilahti E, Sarnesto A, Trabzuni D, Al-Kahtani K, Kagevi
I, Rashed MS, Meyer BF, Jarvela I (2007) The T/G 13915 variant
upstream of the lactase gene (LCT) is the founder allele of lactase
persistence in an urban Saudi population. J Med Genet 44:e89
Ingram CJE (2008) The evolutionary genetics of lactase persistence in
Africa and the Middle East. Ph.D. thesis University of London
Ingram CJE, Elamin MF, Mulcare CA, Weale ME, Tarekegn A, Raga
TO, Bekele E, Elamin FM, Thomas MG, Bradman N, Swallow
DM (2007) A novel polymorphism associated with lactose tolerance in Africa: multiple causes for lactase persistence? Hum Genet 120:779–788
Jacob R, Brewer C, Fransen JA, Naim HY (1994) Transport, function,
and sorting of lactase-phlorizin hydrolase in Madin–Darby canine
kidney cells. J Biol Chem 269:2712–2721
Jacob R, Bulleid NJ, Naim HY (1995) Folding of human intestinal lactase-phlorizin hydrolase. J Biol Chem 270:18678–18684
Jacob R, Radebach I, Wuthrich M, Grunberg J, Sterchi EE, Naim HY
(1996) Maturation of human intestinal lactase-phlorizin hydrolase: generation of the brush border form of the enzyme involves
123
Hum Genet (2009) 124:579–591
at least two proteolytic cleavage steps. Eur J Biochem 236:789–
795
Jacob R, Peters K, Naim HY (2002) The prosequence of human lactase-phlorizin hydrolase modulates the folding of the mature enzyme. J Biol Chem 277:8217–8225
Kerber M, Oberkanins C, Kriegshauser G, Kollerits B, senbach-Glaninger A, Fuchs D, Ledochowski M (2007) Hydrogen breath testing versus LCT genotyping for the diagnosis of lactose
intolerance: a matter of age? Clin Chim Acta 383:91–96
Krasinski SD, van Wering HM, Tannemaat MR, Grand RJ (2001)
DiVerential activation of intestinal gene promoters: functional
interactions between GATA-5 and HNF-1 alpha. Am J Physiol
Gastrointest Liver Physiol 281:G69–G84
Lacey SW, Naim HY, Magness RR, Gething M-J, Sambrook JF (1994)
Expression of lactase-phlorizin hydrolase in sheep is regulated at
the RNA level. Biochem J 302:929–935
Larsson SC, Orsini N, Wolk A (2006) Milk, milk products and lactose
intake and ovarian cancer risk: a meta-analysis of epidemiological
studies. Int J Cancer 118:431–441
Lee SY, Wang Z, Lin CK, Contag CH, Olds LC, Cooper AD, Sibley E
(2002) Regulation of intestine-speciWc spatiotemporal expression
by the rat lactase promoter. J Biol Chem 277:13099–13105
Lewinsky RH, Jensen TG, Moller J, Stensballe A, Olsen J, Troelsen JT
(2005) T-13910 DNA variant associated with lactase persistence
interacts with Oct-1 and stimulates lactase promoter activity in
vitro. Hum Mol Genet 14:3945–3953
Lloyd M, Mevissen G, Fischer M, Olsen W, Goodspeed D, Genini M,
Boll W, Semenza G, Mantei N (1992) Regulation of intestinal lactase in adult hypolactasia. J Clin Invest 89:524–529
Maiuri L, Raia V, Potter J, Swallow DM, Ho MW, Fiocca R, Finzi G,
Cornaggia M, Capella C, Quaroni A, Auricchio S (1991) Mosaic
pattern of lactase expression in villous enterocytes in human
adult-type hypolactasia. Gastroenterology 100:359–369
Maiuri L, Rossi M, Raia V, Garipoli V, Hughes LA, Swallow D, Noren
O, Sjostrom H, Auricchio S (1994) Mosaic regulation of lactase
in human adult-type hypolactasia. Gastroenterology 107:54–60
Matthews SB, Waud JP, Roberts AG, Campbell AK (2005) Systemic
lactose intolerance: a new perspective on an old problem. Postgrad Med J 81:167–173
McCracken RD (1971) Lactase deWciency—example of dietary evolution. Curr Anthropol 12:479
Meloni T, Colombo C, Ruggiu G, Dessena M, Meloni GF (1998) Primary lactase deWciency and past malarial endemicity in Sardinia.
Ital J Gastroenterol Hepatol 30:490–493
Meloni GF, Colombo C, La VC, Ruggiu G, Mannazzu MC, Ambrosini
G, Cherchi PL (1999) Lactose absorption in patients with ovarian
cancer. Am J Epidemiol 150:183–186
Meloni GF, Colombo C, La VC, PaciWco A, Tomasi P, Ogana A, Marinaro AM, Meloni T (2001) High prevalence of lactose absorbers
in Northern Sardinian patients with type 1 and type 2 diabetes
mellitus. Am J Clin Nutr 73:582–585
Metneki J, Cziezel A, Flatz SD, Flatz G (1984) A study of lactose
absorption capacity in twins. Hum Genet 67:296–300
Mitchelmore C, Troelsen JT, Spodsberg N, Sjostrom H, Noren O
(2000) Interaction between the homeodomain proteins Cdx2 and
HNF1alpha mediates expression of the lactase-phlorizin hydrolase gene. Biochem J 346(Pt 2):529–535
Mulcare (2006) The evolution of the lactase persistence phenotype.
Ph.D. thesis University of London, London, UK
Mulcare CA, Weale ME, Jones AL, Connell B, Zeitlyn D, Tarekegn A,
Swallow DM, Bradman N, Thomas MG (2004) The T allele of a
single-nucleotide polymorphism 13.9 kb upstream of the lactase
gene (LCT) (C-13.9kbT) does not predict or cause the lactase-persistence phenotype in Africans. Am J Hum Genet 74:1102–1110
Naim HY, Lentze MJ (1992) Impact of O-glycosylation on the function
of human intestinal lactase-phlorizin hydrolase. Characterization
Hum Genet (2009) 124:579–591
of glycoforms varying in enzyme activity and localization of
O-glycoside addition. J Biol Chem 267:25494–25504
Newcomer AD, McGill DB, Thomas PJ, Hofmann AF (1975) Prospective comparison of indirect methods for detecting lactase deWciency. N Engl J Med 293:1232–1236
Obermayer-Pietsch BM, Bonelli CM, Walter DE, Kuhn RJ, Fahrleitner-Pammer A, Berghold A, Goessler W, Stepan V, Dobnig H,
Leb G, Renner W (2004) Genetic predisposition for adult lactose
intolerance and relation to diet, bone density, and bone fractures.
J Bone Miner Res 19:42–47
Olds LC, Sibley E (2003) Lactase persistence DNA variant enhances
lactase promoter activity in vitro: functional role as a cis regulatory element. Hum Mol Genet 12:2333–2340
Peuhkuri (2000) Lactose, lactase, and bowel disorders, Ph.D. thesis,
University of Helsinki, Finland
Peuhkuri K, Vapaatalo H, Korpela R, Teuri U (2000) Lactose intolerance—a confusing clinical diagnosis. Am J Clin Nutr 71:600–602
Poulter M, Hollox E, Harvey CB, Mulcare C, Peuhkuri K, Kajander K,
Sarner M, Korpela R, Swallow DM (2003) The causal element for
the lactase persistence/non-persistence polymorphism is located
in a 1 Mb region of linkage disequilibrium in Europeans. Ann
Hum Genet 67:298–311
Rasinpera H, Savilahti E, Enattah NS, Kuokkanen M, Totterman N,
Lindahl H, Jarvela I, Kolho KL (2004) A genetic test which can
be used to diagnose adult-type hypolactasia in children. Gut
53:1571–1576
Sabeti PC, SchaVner SF, Fry B, Lohmueller J, Varilly P, Shamovsky
O, Palma A, Mikkelsen TS, Altshuler D, Lander ES (2006) Positive natural selection in the human lineage. Science 312:1614–
1620
Sahi T (1974) The inheritance of selective adult-type lactose malabsorption. Scand J Gastroenterol 9:1–73
Saltzman JR, Russell RM, Golner B, Barakat S, Dallal GE, Goldin BR
(1999) A randomized trial of Lactobacillus acidophilus BG2FO4
to treat lactose intolerance. Am J Clin Nutr 69:140–146
Scrimshaw NS, Murray EB (1988) The acceptability of milk and milk
products in populations with a high prevalence of lactose intolerance. Am J Clin Nutr 48:1079–1159
Sebastio G, Villa M, Sartorio R, Guzzetta V, Poggi V, Auricchio S,
Boll W, Mantei N, Semenza G (1989) Control of lactase in human
adult-type hypolactasia and in weaning rabbits and rats. Am J
Hum Genet 45:489–497
Simoons FJ (1970) Primary lactose intolerance and the milking habit:
a problem in biological and cultural interrelations, II. A culture
historical hypothesis. Am J Dig Dis 15:695–710
Simoons FJ (1978) The geographic hypothesis and lactose malabsorption—a weighing of the evidence. Dig Dis 23:963–980
Snook CR, Mahmoud JN, Chang WP (1976) Lactose tolerance in adult
Jordanian Arabs. Trop Geogr Med 28:333–335
Spodsberg N, Troelsen JT, Carlsson P, Enerback S, Sjostrom H, Noren
O (1999) Transcriptional regulation of pig lactase-phlorizin
hydrolase. Involvement of HNF-1 and FREACs. Gastroenterology 116:842–854
Sterchi E, Mills P, Fransen J, Hauri H, Lentze M, Naim H, Ginsel L,
Bond J (1990) Biogenesis of intestinal lactase-phlorizin hydrolase
in adults with lactose intolerance. Evidence for reduced biosynthesis and slowed-down maturation in enterocytes. J Clin Invest
86:1329–1337
Suarez FL, Savaiano D, Arbisi P, Levitt MD (1997) Tolerance to the
daily ingestion of two cups of milk by individuals claiming
lactose intolerance. Am J Clin Nutr 65:1502–1506
591
Swallow DM (2006) DNA test for hypolactasia premature. Gut
55:131–132
Swallow DM, Hollox EJ (2000) The genetic polymorphism of intestinal lactase activity in adult humans. In: Scriver CR, Beaudet AL,
Sly WS, Valle D (eds) The metabolic and molecular basis of
inherited disease. McGraw-Hill, New York, pp 1651–1662
Tag CG, SchiZers MC, Mohnen M, Gressner AM, Weiskirchen R
(2007) A novel proximal ¡13914G > A base replacement in the
vicinity of the common-13910T/C lactase gene variation results
in an atypical LightCycler melting curve in testing with the MutaREAL lactase test. Clin Chem 53:146–148
Tag CG, Oberkanins C, Kriegshauser G, Ingram CJ, Swallow DM,
Gressner AM, Ledochowski M, Weiskirchen R (2008) Evaluation
of a novel reverse-hybridization StripAssay for typing DNA variants useful in diagnosis of adult-type hypolactasia. Clin Chim
Acta 392:58–62
Thacher TD, Fischer PR, Pettifor JM, Lawson JO, Isichei CO, Reading
JC, Chan GM (1999) A comparison of calcium, vitamin D, or
both for nutritional rickets in Nigerian children. N Engl J Med
341:563–568
TishkoV SA, Reed FA, Ranciaro A, Voight BF, Babbitt CC, Silverman
JS, Powell K, Mortensen HM, Hirbo JB, Osman M, Ibrahim M,
Omar SA, Lema G, Nyambo TB, Ghori J, Bumpstead S, Pritchard
JK, Wray GA, Deloukas P (2007) Convergent adaptation of human lactase persistence in Africa and Europe. Nat Genet 39:31–
40
Troelsen JT, Mehlum A, Olsen J, Spodsberg N, Hansen GH, Prydz H,
Noren O, Sjostrom H (1994) 1 kb of the lactase-phlorhizin hydrolase promoter directs post-weaning decline and small intestinalspeciWc expression in transgenic mice. FEBS Lett 342:291–296
Troelsen JT, Mitchelmore C, Spodsberg N, Jensen AM, Noren O, Sjostrom H (1997) Regulation of lactase-phlorizin hydrolase gene
expression by the caudal-related homoeodomain protein Cdx-2.
Biochem J 322(Pt 3):833–838
Troelsen JT, Olsen J, Moller J, Sjostrom H (2003) An upstream polymorphism associated with lactase persistence has increased enhancer activity. Gastroenterology 125:1686–1694
van Wering HM, Bosse T, Musters A, de Jong E, de Jong N, Hogen
Esch CE, Boudreau F, Swain GP, Dowling LN, Montgomery RK,
Grand RJ, Krasinski SD (2004) Complex regulation of the lactase-phlorizin hydrolase promoter by GATA-4. Am J Physiol
Gastrointest Liver Physiol 287(4):G899–909
Vesa TH, Marteau P, Korpela R (2000) Lactose intolerance. J Am Coll
Nutr 19:165S–175S
Villako K, Maaroos H (1994) Clinical picture of hypolactasia and lactose intolerance. Scand J Gastroenterol Suppl 202:36–54
Wang Y, Harvey CB, Pratt WS, Sams VR, Sarner M, Rossi M, Auricchio S, Swallow DM (1995) The lactase persistence/non-persistence polymorphism is controlled by a cis-acting element. Hum
Mol Genet 4:657–662
Wang Z, Maravelias C, Sibley E (2006) Lactase gene promoter fragments mediate diVerential spatial and temporal expression patterns in transgenic mice. DNA Cell Biol 25:215–222
Weiskirchen, Tag CG, Mengsteab S, Gressner AM, Ingram CJE, Swallow DM (2007) Pitfalls in LightCycler Diagnosis of the singlenucleotide polymorphism 13.9 kb upstream of the lactase gene
that is associated with adult-type hypolactasia
Witte J, Lloyd M, Lorenzsonn V, Korsmo H, Olsen W (1990) The
biosynthetic basis of adult lactase deWciency. J Clin Invest
86:1338–1342
123