Advance Journal of Food Science and Technology 9(8): 626-632, 2015
DOI: 10.19026/ajfst.9.1977
ISSN: 2042-4868; e-ISSN: 2042-4876
© 2015 Maxwell Scientific Publication Corp.
Submitted: April 14, 2015
Accepted: May 10, 2015
Published: September 10, 2015
Research Article
Compare Two Contrasting Breeds of Pigs Postmortem for Differential Protein Expression
in Relation to Meat Quality
1
Daofeng Qu, 1Jianzhong Han, 1Kaili Jia, 1Luoting Ye, 2Xinjie Wang, 3Xiaoning Liu,
1
Yang Shen and 1Keke Ye
1
Food Science and Engineering the Most Important Discipline of Zhejiang Province, School of Food
Science and Biotechnology, Zhejiang Gongshang University, Hangzhou 310035,
2
Jinhua Polytechnic, No.1188 Wuzhou Street, Jinhua, Zhejiang,
3
Logistics Center Quarantine Station of Yuhang District Agricultural Bureau, Hangzhou 310029,
P.R. China
Abstract: The aim of this study was to assess the postmortem changes of muscle proteins and their relationships
between these changes and meat quality traits. Six Jinhua and 6 crossbred (Duroc×Landrace×Yorkshire) male pigs
at 180 d were used to determine the post-mortem changes of meat during the storage. Differential proteins between
Jinhua pigs and crossbred pigs were profiled and identified by the application of two-dimensional electrophoresis
and Mass Spectrometry. Two-dimensional electrophoresis results showed that the expression level of 27 proteins
from different breeds of pigs varied during postmortem time (6, 24, 48 and 72 h) and 16 of them was up-regulated in
Jinhua pigs (p0.05). Furthermore, the structure and function of 12 proteins were identified by the application of
Mass Spectrometry and referring to the protein database. Analysis showed that heat shock protein 27, desmin, βenolase and pyruvate kinase were highly correlated with the integrity of meat tenderness, water-holding capacity as
well as shelf life.
Keywords: Differential proteomics, meat quality, pig, postmortem changes, storage
2003; Zellner et al., 2011). The researchers attempted
to look for specific protein markers which is related to
the meat quality (tenderness, water holding capacity,
color, etc.) from the post-mortem changes of muscle
protein and have made a series of fruitful progress
(Lametsch and Bendixen, 2001; Lametsch et al., 2003,
2004). However, the research on the postmortem changes of meat from the Chinese local pigs
has been little reported.
There are plenty of swine germplasm resources in
China. The meat quality of some local pigs (Jinhua pig)
has advantages compared with the meat quality of
crossbred pigs (DLY-Duroc×Landrace×Yorkshire).
Jinhua pig is also called panda pig, the reason of which
is that the head and buttock of Jinhua pig are black
(Guo et al., 2011; Miao et al., 2009). In this study,
differential proteomics of fresh pork from Jinhua and
DLY pigs after different storage time were analyzed.
Some protein markers were found and identified by
mass spectrometry. Further analysis of these data
provides useful information for the research of meat
quality.
INTRODUCTION
The quality of fresh pork is affected by many
factors such as genetic, breeding management,
transportation, slaughtering and so on (Beaulieu et al.,
2010). While, almost all of the meat quality traits are
associated with complex genes and proteins (Bendixen,
2005). Two-dimensional electrophoresis and mass
spectrometry-based proteomics provide
a
classic
method for the the research of meat quality. Proteomics
is the large-scale study of proteins, the product of gene
expression, which can directly reflect the expression
and activity status of proteins (Hollung et al., 2007;
Zheng et al., 2008). Thus, the study on the quality of
fresh meat by the method of differential proteomics is
valuable for finding the important proteins, controlling
the quality of meat, rating and marketing the meat.
In recent years, efforts have been made to analyze
the post-mortem changes of meat, the feasibility of
which was suggested by the novel proteins found by the
method of differential proteomics (Lametsch et al.,
Corresponding Author: Jianzhong Han, Food Science and Engineering the Most Important Discipline of Zhejiang Province,
School of Food Science and Biotechnology, Zhejiang Gongshang University, Hangzhou 310035, P.R.
China, Tel.: +8613758032556; Fax: +86057188071024
This work is licensed under a Creative Commons Attribution 4.0 International License (URL: http://creativecommons.org/licenses/by/4.0/).
626
Adv. J. Food Sci. Technol., 9(8): 626-632, 2015
MATERIALS AND METHODS
All of the experiments were carried out according
to the guidelines for animal experiments at the National
Institute of Animal Health.
Animals and sample collection: Six Jinhua and 6
crossbred (Duroc× Landrace×Yorkshire) male pigs at
180 d were used to determine the post-mortem changes
of meat during the storage. Muscle samples were taken
from the Longissimus dorsi muscle, at the position of
the last rib and stored at 4°C in refrigerator. The
samples were taken from the muscles in the refrigerator
immediately after 6, 24, 48 and 72 h post-mortem and
kept at -80°C until the time of protein extraction.
Extraction of muscle proteins: The method was
adapted from Lametsch et al. (2002). The frozen
muscle tissue (100 mg) was homogenized in 1 mL of 8
M urea, 2 M thiourea, 65 mM DTT, 2% CHAPS-O and
1% carrier ampholytes (Ampholyte 3-10, Pharmacia,
Uppsala, Sweden), in a handheld glass homogenizer.
Crude extracts were transferred to an Eppendorf tube
and vigorously shaken for 2 h at room temperature,
followed by a 30 min centrifugation step at 10000 g to
remove unextracted cellular components, high
molecular weight protein complexes and insoluble
proteins. The protein concentration was determined by
the RC-DC assay (Bio-Rad).
Two-dimensional electrophoresis: The preparation
and running of the Two-Dimensional Electrophoresis (2
DE) analysis were done according to Theron et al.
(2011). First 1 mg of proteins was incorporated in a
buffer containing 7 M urea, 2 M thiourea, 2% CHAPS
(w/v), 0.4% carrier ampholyte (v/v), 1% DTT (w/v) and
bromophenol blue. Samples were loaded onto
immobilized pH gradient strips (pH 3-10 NL, 17 cm,
Bio-Rad) and isoelectric focusing was performed using
a Protean IEF cell system (Bio-Rad). Gels were
passively rehydrated for 16 h. Rapid voltage ramping
was subsequently applied to reach a total of 86 kVh.
After strip equilibration, proteins were resolved on 12%
sodium dodecyl sulphate polyacrylamide gel
electrophoresis (SDS-PAGE) gels using a Protean II
XL system (Bio-Rad) for the second dimension. Gels
were stained with Coomassie Blue (colloidal blue).
Three gels were produced per sample, giving 24 gels in
all.
Image analysis: Gels were visualized and analysed
using the two-dimensional electrophoresis image
analysis software (Bio-Rad). First, all spot positions
were recognized and relative integrated spot intensities
in the individual gels were estimated. Then, the 2 DE
images were matched by comparing the relative
positions and integrated intensities of the individual
spots on each gel. For comparative image analysis, the
images were grouped, after which the relative levels of
expression of individual spots were analyzed and
compared within and between the image groups. The
matches suggested by automated image analysis were
finally individually inspected and confirmed. The gel
images were normalized according to the total quantity
in the analysis set. Relative comparison of intensity
abundance among different groups at three time points
(three replicate samples for each group) was performed
using Student’s t test. Expression intensity ratio values
larger than 2.0 (p<0.05) or smaller than 0.5 (p<0.05)
were set as a threshold indicating significant changes.
In-gel digestion of 2 D gel electrophoresis separated
proteins: The protein spots were manually excised
from the silver-stained gels and then transferred to Vbottom 96-well microplates loaded with 100 μL of 50%
ACN, 25 mM ammonium bicarbonate solution/well.
After being destained for 1 h, gel plugs were
dehydrated with 100 μL of 100% ACN for 20 min and
then thoroughly dried in a SpeedVac concentrator
(Thermo Savant) for 30 min. The dried gel particles
were rehydrated at 4°C for 45 min with 2 μL/well
trypsin (Promega, Madison, WI) in 25 mM ammonium
bicarbonate and then incubated at 37°C for 12 h. After
trypsin digestion, the peptide mixtures were extracted
with 8 μL of extraction solution (50% ACN, 0.5%
TFA) /well at 37°C for 1 h. Finally the extracts were
dried under the protection of N2.
Protein Identification by Mass Spectrometry: The
peptide mixtures were redissolved in 0.8 μL of matrix
solution (α-cyano-4-hydroxycinnamic acid (Sigma) in
0.1% TFA, 50% ACN) and then spotted on the MALDI
plate. Samples were allowed to air dry and analyzed by
a 4700 MALDI-TOF/TOF Proteomics Analyzer
(Applied Biosystems, Foster City, CA). Trypsindigested peptides of myoglobin were added to the six
calibration spots on the MALDI plate to calibrate the
mass instrument with internal calibration mode. The
UV laser was operated at a 200-Hz repetition rate with
wavelength of 355 nm. The accelerated voltage was
operated at 20 kV. All acquired spectra of samples were
processed using 4700 ExploreTM software (Applied
Biosystems) in a default mode. Parent mass peaks with
mass range of 700-3200 Da and minimum signal to
noise ratio of 20 were picked out for tandem TOF/TOF
analysis. Combined MS and MS/MS spectra were
submitted to MASCOT (Version 2.1, Matrix Science,
London, UK) by GPS Explorer software (Version 3.6,
Applied Biosystems) and searched with the following
parameters: National Center for Biotechnology
Information non-redundant (NCBInr) database,
taxonomy of bony vertebrates or viruses, trypsin digest
with one missing cleavage, no fixed modifications, MS
tolerance of 0.2 Da, MS/MS tolerance of 0.6 Da and
possible oxidation of methionine. Known contaminant
ions (human keratin and tryptic autodigest peptides)
were excluded. A total of 4,736,044 sequences and
1,634,373,987 residues in the database were actually
searched. MASCOT protein scores (based on combined
MS and MS/MS spectra) of greater than 72 were
considered statistically significant (p≤0.05). The
627 Adv. J. Food Sci. Technol., 9(8): 626-632, 2015
Table 1: Primer sequences and amplicon lengths of quantitative real-time PCR products of target genes
Target genes
Primers (5’ to 3’)
HSP 27
FP: TCCCTGGACGTCAACCACTTC
RP: GGCAGCGTGTATTTTCGAGTG
Desmin
FP: TCAATGTCAAGATGGCCCTG
RP: TATGGACCTCAGAACCCCTT
Enolase
FP: GGCTTCCACGGGTATCTAT
RP: GTTTCTTTTCCAGCAGCGC
Pyruvate kinase
FP: TTCGCATCTTTCATCCGTAA
RP: CGCCCAATCATCATCTTCT
GAPDH
FP: TGAGACACGATGGTGAAGGT
RP: CGTGGGTGGAATCATACTG
FP: Forward primer; RP: Reverse primer
individual MS/MS spectrum with a statistically
significant (confidence interval ≥95%) ion score (based
on MS/MS spectra) were accepted.
Real Time RT-PCR verification: Specific primers
Table 1 suited to simultaneously amplify various target
genes were designed according to the corresponding
gene sequences of MS/MS-identified proteins and the
available gene information deposited in the GenBankTM
library by using the Lasergene sequence analysis
software (DNAStar, Inc., Madison, WI). Total muscle
RNA was extracted using the RNeasy minikit (Qiagen,
GmbH, Hilden, Germany) according to the
manufacturer’s protocol. RNA concentrations were
measured using a spectrophotometer (260/280 nm).
After heating at 65°C for 5 min to denature RNA and to
inactivate RNases, 1 μg of total RNA was subjected to
reverse transcription using 200 units of SuperScript III
reverse transcriptase (Invitrogen), 40 units of
RNaseOUT recombinant RNase inhibitor (Invitrogen),
200 ng of random hexamer primers (TaKaRa), 0.5 mM
Amplicon length (bp)
143
150
131
227
163
(each) dNTPs (TaKaRa), 4 μL of 5×First-Strand Buffer
(Invitrogen) and 1 μL of 0.1 M DTT (Invitrogen) in a
total volume of 20 μL at 25°C for 5 min and then
incubated at 50°C for 1 h. The reaction was terminated
by heating at 70°C for 15 min. The real time RT-PCR
was performed by using the 7500 Real-Time PCR
System (Applied Biosystems) in a total volume of 20
μL containing 100 ng of cDNA template, 1×SYBR
Premix Ex Taq (Perfect Real Time, TaKaRa) and a 200
nM concentration of each primer. After initial
denaturation at 95°C for 30 s, the amplification was
carried out through 40 cycles, each consisting of
denaturation at 95°C for 15 s, primer annealing at 58°C
for 15 s and DNA extension at 72°C for 40 s. Melting
curves were obtained and quantitative analysis of the
data was performed using the 7500 System SDS
software Version 1.3.1 in a relative quantification(ddCt)
study model (Applied Biosystems). Glyceraldehyde-3phosphate dehydrogenase (GAPDH) was used as a
housekeeping gene for the tests.
Fig. 1: Two-dimensional model electrophoresis protein pattern of pork muscles (6 h). 2-DE of skeletal muscles from Jinhua and
DLY pigs at postmortem 6 h were compared
628 Adv. J. Food Sci. Technol., 9(8): 626-632, 2015
RESULTS
D Gel electrophoresis and analysis: Figure 1 to 4
respectively show two dimensional gel electrophoresis
of skeletal muscles from different breed of pigs during
postmortem time (6, 24, 48 and, 72 h, respectively). As
shown in the figures, the molecular weights of proteins
of porcine muscles at different time are mainly at the
range of 10 kDa~90 kDa. With the help of PDQuest 2-
D analysis software, 27 different protein spots were
found, of which 16 proteins were over-expressed in
Jinhua pork compared with DLY pork. 12 protein spots
which were statistically significant (p<0.05) were
selected for the subsequent mass spectrometry analysis.
Identification of the differentially expressed
proteins: The proteins in the gel plugs were digested
with trypsin, which cleaves peptide bonds only on the
Fig. 2: Two-dimensional model electrophoresis protein pattern of pork muscles (24 h). 2-DE of skeletal muscles from Jinhua and
DLY pigs at postmortem 24 h were compared
Fig. 3: Two-dimensional model electrophoresis protein pattern of pork muscles (48 h). 2-DE of skeletal muscles from Jinhua and
DLY pigs at postmortem 48 h were compared
629 Adv. J. Food Sci. Technol., 9(8): 626-632, 2015
Fig. 4: Two-dimensional model electrophoresis protein pattern of pork muscles (72 h). 2-DE of skeletal muscles from Jinhua and
DLY pigs at postmortem 72 h were compared
Table 2: PMF database searching results of protein spots between DLY pig and jinhua pig
Types of protein
Protein score
Reference species
6 h post-mortem
Sarcolumenin
52
Rat
Leucine rich repeat
88
Bovine
Heat shock protein(27KD)
141
Pig
24 h post-mortem
Adenylate kinase
96
Pig
26S protease regulatory subunit
110
Rat
ATP phosphoribosyltransferase
67
Human
48 h post-mortem
desmin
105
Pig
Zinc fingering protein
62
Mouse
β-enolase
74
Pig
72 h post-mortem
Pyruvate kinase
158
Pig
Glycogen phosphorylase
111
Rabbit
NADH-ubiquinone oxidoreductase
86
Bovine
N-terminal side of lysine and arginine residues. The
resulting peptide mixtures were eluted from the gel
plugs and the peptide masses were measured by
MALDITOF MS. The information of the specific
peptide masses was used for searching alignments to
proteins found in theoretic digest databases in order to
identify the 12 proteins and peptides. Porcine as well as
other mammalian sequence databases were used in
these searches. This approach allowed the identification
of 12 of the 16 selected spots. The 12 proteins
identified were differentially expressed at 6, 24, 48, 72
h post-mortem Table 2. Four of 12 proteins are heat
shock protein, desmin, enolase and pyruvate kinase
respectively which come from the pork protein group.
While the other 8 proteins are from the groups of
human, rat and other animals, the reason of which may
be the incomplete of the pork proteomics database.
Whether the function of the 8 proteins in the pig is
Mw
Intensity matched
17974.7
20265.6
14211.2
10.678
20.816
44.636
21621.3
48413.0
23027.1
17.583
27.512
6.709
53465.2
39829.2
46864
17.187
21.181
24.498
57844.9
97096.8
49142.6
29.392
34.127
27.162
consistent with it in other animal species remains
unknown and needs further research.
Quantitative real-time PCR verification of
differentially expressed proteins: Four genes
corresponding to the protein spots, heat shock protein,
desmin, enolase and pyruvate kinase were chosen for
quantitative real-time PCR analysis to quantify their
transcript levels. The real time PCR results were
consistent with those of the 2-DE studies and suggested
that these proteins identified as differentially expressed
were regulated at transcriptional level.
DISCUSSION
In the present study, we have compared the
differential proteins between Jinhua pigs and DLY pigs
during postmortem time (6, 24, 48 and 72 h,
630 Adv. J. Food Sci. Technol., 9(8): 626-632, 2015
respectively). From the results, the relationship between
meat quality and muscle protein degradation during
postmortem storage can be analyzed, which can provide
valuable information for understanding the molecular
mechanism responsible for breed specific differences in
meat quality.
Heat shock protein (27 kDa, HSP 27) is highly
expressed in the muscle of Jinhua pig at 6 h
postmortem. The functions of HSP27 are mainly
including stabling the signal transduction of actin
filaments and cytokine, as well as enhancing the
resistance to the various stresses as molecular
chaperones (Bao et al., 2009; Zhang et al., 2011). The
high expression of HSP27 can provide Jinhua pigs’
tissues and cells effective resistance to the stress
responses. At the beginning of the protein denaturation,
HSP combines with myofibrillar protein which plays a
role in protection and preventing the enzymes to
decompose the myofibrillar. Pulford reported that the
expression amount of heat shock protein reached its
peak value at 3 h postmortem. He also studied the
correlation between the protein decomposition and the
amount of HSP, finding that small molecular weight
heat shock protein effectively inhibits the
decomposition of desmin (Pulford et al., 2008a, b).
Some researchers observed HSP27 expressed
differently in the different quality grades of beef (Kim
et al., 2008). Others have shown that the contents of
HSP in the fresh pork is highly correlated with its
sensory and quality (Morzel et al., 2008). The heat
shock protein of small molecular weight can effectively
delay the rupture of membrane, thereby preventing the
release of endogenous proteases, reducing the water
loss rate of muscles, slowing down the release of flavor
substances and thus improving the tenderness of pork.
With the extension of post-mortem storage time, the
content of heat shock protein decreased resulting in
unable to maintain the cells integrity and the repair
function of certain proteins, such as desmin, myoplasm
and myofibril.
The content of desmin in Jinhua pigs was higher
than that in DLY pigs (p<0.05). Desmin is distributed
around Z line, connecting the neighboring filaments to
be arranged in a structure of highly sophisticated, which
plays an important role in maintaining muscle cell
skeleton
integrity.
During
the
post-mortem
conditioning, the degradation of desmin and troponin T
is the typical characteristic of protein changes. The
degradation of desmin is highly correlated with the
tenderness and water-holding capacity of post-mortem
muscle (Van de Wiel and Zhang, 2007). The waterholding capacity, shelf-life, antioxidant capacity of
post-mortem meat in Jinhua pigs were better than those
in DLY pigs (p<0.05) which may be correlated with the
high expression of HSP and desmin.
Enolase is a kind of rate-limiting enzyme, which
not only can catalyze the conversion of 2-phosphate-Dglycerate (PGA) to phosphoric acid-pyruvate (PEP)
during glycolysis but also can catalyze the reverse
reaction in the process of glycogen synthesis (Bolten
et al., 2008). Pyruvate Kinase (PK) is one of the three
key enzymes in the process of anaerobic glycolysis
which can catalyze the conversion of phosphoric acidpyruvate (PEP) to pyruvicacid (Lametsch et al., 2002).
The pyruvicacid generated can be catalyzed to lactic
acid by lactic dehydrogenase (LDH), at the same time
NADH is oxidated to NAD+ (Picariello et al., 2006).
The expression level of enolase in Jinhua pigs was
higher than that in DLY pigs (p<0.05), while pyruvate
kinase in DLY pigs was higher (p<0.05), the results of
which were that anaerobic metabolism was accelerated
and muscle glycogen was mostly hydrolyzed in postmortem pork of DLY pigs compared with Jinhua pigs.
Glycogen phosphorylase is a kind of complex
allosteric enzyme which can catalyze the degradation of
glycogen (Guo et al., 2011; Lametsch et al., 2003).
Adenylate kinase is a kind of monomeric enzyme which
indirectly involved in cellular activities as well as in the
process of apoptosis through regulating the value of
ATP, GTP and ADP in vivo (Theron et al., 2011). 26S
proteasome is part of the ubiquitin system (UPS) which
is closely related with variety of cellular activities. 26S
proteasome plays an important role in the process of
tenderization of the post-mortem muscles. It is reported
that the Z-disk and I-line of beef fiber were rapidly
destroyed when 26S proteasome was added (Dutaud
et al., 2006). After 24 h debris and residue were
produced and α-actin was dissolved (Robert et al.,
1999). Arcolumenin is a kind of sarcoplasmic reticulum
protein which plays a role in the maintenance of the
structure of calcium channels in the membrane (Fan
et al., 2008). Zinc finger protein plays an important role
in the regulation of related genes (Ren et al., 2012).
CONCLUSION
This study showed that some proteins (HSP 27,
Desmin, Enolase, Pyruvate kinase and so on) were
expressed differentially in post-mortem pork of Jinhua
pigs compared with DLY pigs (p<0.05), which maybe
highly associated with meat quality and needs further
research. Our findings may help future meat science
projects focus on novel post-mortem processes that
maybe relevant to meat quality.
ACKNOWLEDGMENT
This study was financially supported by the
program of National innovation project (GJ20141007),
Zhejiang Xinmiao project (2014R408023).
REFERENCES
Bao, E., K.R. Sultan, N. Bernhard and J. Hartung, 2009.
Expression of heat shock proteins in tissues from
young pigs exposed to transport stress. Deut.
Tierarztl. Woch. , 116: 321-325.
631 Adv. J. Food Sci. Technol., 9(8): 626-632, 2015
Beaulieu, A.D., J.L. Aalhus, N.H. Williams and J.F.
Patience, 2010. Impact of piglet birth weight, birth
order and litter size on subsequent growth
performance, carcass quality, muscle composition
and eating quality of pork. J. Anim. Sci., 88:
2767-2778.
Bendixen, E., 2005. The use of proteomics in meat
science. Meat Sci., 71: 138-149.
Bolten, K.E., A.E. Marsh, S.M. Reed, J.P. Dubey, R.E.
Toribio and W.J. Saville, 2008. Sarcocystis
neurona: Molecular characterization of enolase
domain I region and a comparison to other
protozoa. Exp. Parasitol., 120: 108-112.
Dutaud, D., L. Aubry, M.A. Sentandreu and A. Ouali,
2006. Bovine muscle 20S proteasome: I. Simple
purification
procedure
and
enzymatic
characterization in relation with postmortem
conditions. Meat Sci., 74: 327-336.
Fan, G.C., Q. Yuan and E.G. Kranias, 2008. Regulatory
roles of junctin in sarcoplasmic reticulum calcium
cycling and myocardial function. Trends
Cardiovas. Med., 18: 1-5.
Guo, J., T. Shan, T. Wu, L.N. Zhu, Y. Ren, S. An and
Y. Wang, 2011. Comparisons of different muscle
metabolic enzymes and muscle fiber types in
Jinhua and Landrace pigs. J. Anim. Sci., 89:
185-191.
Hollung, K., E. Veiseth, X. Jia, E.M. Faergestad and
K.I. Hildrum, 2007. Application of proteomics to
understand the molecular mechanisms behind meat
quality. Meat Sci., 77: 97-104.
Kim, N.K., S. Cho, S.H. Lee, H.R. Park, C.S. Lee,
Y.M. Cho, Y.H. Choy, D. Yoon, S.K. Im and E.W.
Park, 2008. Proteins in longissimus muscle of
Korean native cattle and their relationship to meat
quality. Meat Sci., 80: 1068-1073.
Lametsch, R. and E. Bendixen, 2001. Proteome analysis
applied to meat science: Characterizing
postmortem changes in porcine muscle. J. Agr.
Food Chem., 49: 4531-4537.
Lametsch, R., P. Roepstorff and E. Bendixen, 2002.
Identification of protein degradation during postmortem storage of pig meat. J. Agr. Food Chem.,
50: 5508-5512.
Lametsch, R., A. Karlsson, K. Rosenvold, H.J.
Andersen, P. Roepstorff and E. Bendixen, 2003.
Postmortem proteome changes of porcine muscle
related to tenderness. J. Agr. Food Chem., 51:
6992-6997.
Lametsch, R., P. Roepstorff, H.S. Moller and E.
Bendixen, 2004. Identification of myofibrillar
substrates for mu-calpain. Meat Sci., 68: 515-521.
Miao, Z.G., L.J. Wang, Z.R. Xu, J.F. Huang and Y.R.
Wang, 2009. Developmental changes of carcass
composition, meat quality and organs in the Jinhua
pig and Landrace. Animal, 3: 468-473.
Morzel, M., C. Terlouw, C. Chambon, D. Micol and B.
Picard, 2008. Muscle proteome and meat eating
qualities of Longissimus thoracis of "Blonde
d'Aquitaine" young bulls: A central role of HSP27
isoforms. Meat Sci., 78: 297-304.
Picariello, G., A. De Martino, G. Mamone, P. Ferranti,
F. Addeo, M. Faccia, S. Spagnamusso and A. Di
Luccia, 2006. Proteomic study of muscle
sarcoplasmic proteins using AUT-PAGE/SDSPAGE as two-dimensional gel electrophoresis. J.
Chromatogr. B, 833: 101-108.
Pulford, D.J., P. Dobbie, S. Fraga Vazquez, E. FraserSmith, D.A. Frost and C.A. Morris, 2008a.
Variation in bull beef quality due to ultimate
muscle pH is correlated to endopeptidase and small
heat shock protein levels. Meat Sci., 83: 1-9.
Pulford, D.J., S. Fraga Vazquez, D.F. Frost, E. FraserSmith, P. Dobbie and K. Rosenvold, 2008b. The
intracellular distribution of small heat shock
proteins in post-mortem beef is determined by
ultimate pH. Meat Sci., 79: 623-630.
Ren, A., H. Zhang, Z. Xie, X. Ma, W. Ji, Z. He et al.,
2012. Regulation of hippocampus-dependent
memory by the zinc finger protein Zbtb20 in
mature CA1 neurons. J. Physiol., 590: 4917-32.
Robert, N., M. Briand, R. Taylor and Y. Briand, 1999.
The effect of proteasome on myofibrillar structures
in bovine skeletal muscle. Meat Sci., 51: 149-153.
Theron, L., T. Sayd, J. Pinguet, C. Chambon, N. Robert
and V. Sante-Lhoutellier, 2011. Proteomic analysis
of semimembranosus and biceps femoris muscles
from Bayonne dry-cured ham. Meat Sci., 88:
82-90.
Van de Wiel, D.F. and W.L. Zhang, 2007.
Identification of pork quality parameters by
proteomics. Meat Sci., 77: 46-54.
Zellner, M., R. Babeluk, L.H. Jakobsen, C. Gerner, E.
Umlauf, I. Volf, E. Roth and J. Kondrup, 2011. A
proteomics study reveals a predominant change in
MaoB expression in platelets of healthy volunteers
after high protein meat diet: Relationship to the
methylation cycle. J. Neural Transm., 118:
653-662.
Zhang, M., Y. Lv, Z. Yue, A. Islam, B. Rehana, E. Bao
and J. Hartung, 2011. Effects of transportation on
expression of Hsp90, Hsp70, Hsp27 and alphaBcrystallin in the pig stomach. Vet. Rec., 169: 312.
Zheng, X., L. Hong, L. Shi, J. Guo, Z. Sun and J. Zhou,
2008. Proteomics analysis of host cells infected
with infectious bursal disease virus. Mol. Cell.
Proteomics, 7: 612-625.
632