tjp˙031
TJP-xml.cls
December 16, 1904
16:12
353
J Physiol 554.2 pp 353–370
Modulation of the excitability of cholinergic basal
forebrain neurones by KATP channels
T. G. J. Allen and D. A. Brown
Department of Pharmacology, University College London, Gower Street, London WC1E 6BT
The expression of ATP-sensitive K+ (K ATP ) channels by magnocellular cholinergic basal forebrain
(BF) neurones was investigated in thin brain slice and dissociated cell culture preparations
using a combination of whole-cell, perforated-patch and single-channel recording techniques.
Greater than 95% of BF neurones expressed functional K ATP channels whose activation resulted
in membrane hyperpolarization and a profound fall in excitability. The whole-cell K ATP
conductance was 14.0 ± 1.5 nS and had a reversal potential of –91.4 ± 0.9 mV that shifted
by 59.6 mV with a tenfold increase in [K+ ] o . I KATP was inhibited reversibly by tolbutamide (IC 50
of 34.1 µM) and irreversibly by glibenclamide (0.3–3 nM) and had a low affinity for [ATP] i (67%
reduction with 6 mM [MgATP] i ). Using perforated-patch recording, a small proportion of the
conductance was found to be tonically active. This was weakly potentiated by diazoxide (0.1
mM extracellular glucose) but insensitive to pinacidil (≤500 µM). Single-channel K ATP currents
recorded in symmetrical 140 mM K+ -containing solutions exhibited weak inward rectification
with a mean conductance of 66.2 ± 1.9 pS. Channel activity was inhibited by MgATP (>50 µM)
and activated by MgADP (200 µM). The K+ channels opener diazoxide (200–500 µM) increased
channel opening probability (NP o ) by 486 ± 120% whereas pinacidil (500 µM) had no effect. In
conclusion, the characteristics of the K ATP channels expressed by BF neurones are very similar to
channels composed of SUR1 and Kir6.2 subunits. In the native cell, their affinity for ATP is close
to the resting [ATP] i , potentially allowing them to be modulated by physiologically relevant
changes in [ATP] i . The effect of these channels on the level of ascending cholinergic excitation
of the cortex and hippocampus is discussed.
(Resubmitted 26 September 2003; accepted after revision 23 October 2003; first published online 24 October 2003)
Corresponding author T. G. J. Allen: Department of Pharmacology, University College London, Gower Street, London
WC1E 6BT, UK. Email: t.allen@ucl.ac.uk
K+ channels that are tonically active at subthreshold
potentials play a pivotal role in regulating the excitability
of many neurones (Brown & Selyanko, 1985; Benson et al.
1988; Millar et al. 2000). Small changes in the activity of
this type of channel can produce profound changes in cell
excitability. One example of subthreshold K+ channels
are the so-called ATP-sensitive K+ channels which open
in response to a fall in the intracellular ATP/ADP ratio
(Ashcroft & Gribble, 1998). Structurally K ATP channels
are hetero-octamers made up from a combination of
four pore forming subunits (either Kir6.1 or 6.2) and
four sulphonylurea receptors (SUR 1, 2A, 2B and 2C)
(Ashcroft & Gribble, 1998; Babenko et al. 1998a). Both
the pore forming and receptor subunits must be expressed
and co-assemble in order to form a functional channel
(Clement et al. 1997). K ATP channel subunits are widely
distributed throughout the nervous system including the
brain (Treherne & Ashford, 1991; Dunn-Meynell et al.
C The Physiological Society 2003
1998). Within basal forebrain nuclei, large numbers of
high affinity binding sites for the sulphonylurea receptor
antagonist glibenclamide have been described (Mourre
et al. 1990). In situ hybridization studies have revealed
overlapping moderate to high mRNA levels for the
channel-forming Kir6.2 and sulphonylurea receptor SUR1
subunits in medial septal and diagonal band regions of
the basal forebrain (Karschin et al. 1997). In addition,
3 days after selective lesioning of the nucleus basalis Kir6.2
mRNA levels in the cortex have been shown to fall by 47%
(Xu et al. 2002). Together these findings indicate that a
significant population of the cells in these regions may
express functional somatic as well as presynaptic K ATP
channels.
However, basal forebrain nuclei contain a
heterogeneous population of neurones, and the identity
of the cells expressing K ATP channels is unknown. In
this study, the functional expression of K ATP channels
DOI: 10.1113/jphysiol.2003.055889
tjp˙031
TJP-xml.cls
December 16, 1904
354
16:12
T. G. J. Allen and D. A. Brown
by individually identified cholinergic basal forebrain
neurones has been examined. These large neurones
provide the principal ascending cholinergic input
to both the hippocampus and cerebral cortex and
the integrity of their projections is vital for various
learning and memory processes and also for maintaining
normal levels of cortical arousal and attentiveness
(Jones, 1993; Everitt & Robbins, 1997). A preliminary
report of these findings has appeared in abstract form
(Allen, 2003).
Methods
Preparation of dissociated basal forebrain cultures
Sprague Dawley rat pups (12–14 days old) were
anaesthetized by chloroform inhalation prior to
decapitation in accordance with UK legislation. The brain
was rapidly removed and placed in ice-cold Gey’s balanced
salt solution supplemented with 8 mm Mg2+ and 0.6%
d-glucose. The brain was hemisected and 450 µm thick
coronal sections cut using a McIllwain tissue chopper.
Basal forebrain areas, namely the medial septum (MS),
diagonal band of Broca (DBB) and substantia innominata
(SI) were isolated and placed in Hanks’ balanced salt
solution (HBSS) containing 10 mm Hepes and 1.25 mgl−1
trypsin and incubated for 60 min at 37◦ C. The tissue
fragments were subsequently washed in HBSS containing
10% fetal bovine serum (FBS) and 8 mm Mg2+ before
being gently dissociated using a flamed Pasteur pipette.
The resulting cell suspension was centrifuged at 600 r.p.m.
for 6 min, the supernatant discarded and the cell pellet
re-suspended in Neurobasal medium containing B27
supplement (Gibco, UK), 0.01 mg l−1 nerve growth factor
and 10% FBS. Cells were plated onto 13 mm diameter
poly-d-lysine-coated glass coverslips (1 per 35 mm Petri
dish) and left to settle for 10 min before the entire dish was
gently flooded with medium. The medium was replaced
after 4 h. Subsequent re-feeding took place after 18 h and
thereafter weekly with medium of the same composition
minus FBS. Cells were maintained in a 5% CO 2 incubator
at 37◦ C for periods of up to 8 weeks prior to use.
Brain slice preparation
Sprague Dawley rat pups (12–14 days old) were
anaesthetized as above before decapitation and removal
of the brain to ice-cold (4◦ C) Krebs solution containing
(mm): NaCl 118; KCl; 3; Hepes 5; NaHCO 3 25; glucose
11; CaCl 2 0.5; MgCl 2 6; kynurenic acid 1, adjusted to pH
7.3 (where necessary) and gassed with 95% O 2 –5% CO 2 .
J Physiol 554.2 pp 353–370
The brain was hemisected and 200–250 µm thick coronal
sections containing the different basal forebrain regions
(as detailed above) were cut using a Vibratome (model
1000 plus). Sections were incubated for 1 h at room
temperature in oxygenated Krebs solution (composition
as above) prior to the start of electrophysiological
recording. Brain slices were transferred to a recording
chamber and gently held in place by a flattened
C-shaped platinum wire bridged by fine nylon
fibres. Cells were visualized using water immersion
objectives on an upright microscope (Olympus BX50WI)
equipped with differential interference contrast (DIC)
optics.
The preparation was continuously superfused (nonrecirculating) with oxygenated Krebs (see below for
composition), containing 1 mm kynurenic acid, 10 µm
6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) and
30 µm bicuculline methochloride. All experiments were
carried out at room temperature using the whole-cell
configuration of the patch-clamp technique (see below).
Electrophysiology
Whole-cell and perforated-patch recording from cell
cultures. Coverslips bearing the cell culture were
transferred into a recording bath mounted on the
microscope stage (Olympus BX50WI). Unless otherwise
stated, cells were superfused at a rate of 5–8 ml min−1
at room temperature (22–26◦ C) with Krebs solution of
composition (mm): NaCl, 122; KCl, 3; Hepes, 5; NaHCO 3 ,
15; glucose, 11; CaCl 2 , 2; MgCl 2 , 1; adjusted to pH 7.3 and
gassed with 95% O 2 –5% CO 2 . Recordings were carried out
using either the tight-seal whole-cell configuration of the
patch-clamp technique or the amphotericin-B perforatedpatch method (Rae et al. 1991), using an Axoclamp
2 amplifier coupled to a Digidata 1200 (Axon Instruments)
interface and pCLAMP 8 (Axon Instruments) acquisition
software. Data was acquired at a sampling rate of
10–40 kHz and filtered at 1–3 kHz (voltage clamp) or
20 kHz (bridge voltage recording) prior to acquisition.
When necessary, additional filtering was carried out
off-line. Patch pipettes were pulled from 1.5 mm
o.d. × 1.17 mm i.d. borosilicate glass (Harvard
Apparatus) coated to within 100 µm of the tip with
Sylgard (Dow Corning). Electrode resistance ranged
between 5 and 9 M for whole-cell recording and
between 3 and 5 M for perforated-patch recording.
The composition of the pipette solution (unless
otherwise stated) was (mm): potassium acetate, 108;
KCl, 11; Hepes, 40; NaOH, 17; EGTA, 3; CaCl 2 , 0.52,
MgCl 2 , 1.2 (pH 7.3). Voltage-clamp recordings were
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
16:12
Effect of K ATP channels on BF neuronal activity
J Physiol 554.2 pp 353–370
carried out using the discontinuous single-electrode
voltage-clamp technique. During perforated-patch
recordings, series resistance (R s ) ranged between 7 and
28 M.
A(i)
B
brain slice
355
Whole-cell brain slice recording. All brain slice recordings
were carried out at room temperature using the
whole-cell variant of the patch-clamp technique (see
above).
C
dissociated cell culture
-60 mV
20 mV
50 ms
-64 mV
20 mV/ 685 pA
ChAT 323 bp
50 ms
-61 mV
40 mV/700 pA
100 ms
-66 mV
-66 mV
D
A (ii)
control
-70 mV
1 nA
50 ms
20 mV
1s
Sub P
20 mV/ 685 pA
50 ms
-62 mV
-67 mV
-70 mV
-67 mV
Figure 1. Characteristics of basal forebrain (BF) neurones from brain slice and dissociated cell culture
preparations
A, recording from BF neurones in brain slice preparations (13-day-old rats). Ai illustrates the spike afterhyperpolarization (AHP) (upper panels), slow firing rate and pronounced A-type current-induced delay of spike
initiation (lower panel) that are typical features of cholinergic basal forebrain neurones. The cholinergic nature
of this cell was confirmed using single-cell RT-PCR for ChAT (see panel C, gel lane 1). Aii shows typical firing
characteristics (high frequency discharge with no spike AHP) associated with non-cholinergic BF neurones. Again
the non-cholinergic nature of the cell was confirmed using RT-PCR (see panel C, lane 2). B illustrates that the firing
characteristics of cholinergic BF neurones are still maintained after prolonged periods in culture. The cell shown was
from a 32-day-old culture and the recording was carried out using perforated patch recording. Upper, middle and
lower panels, respectively, show the spike AHP, I–V relationship and slow rate of firing characteristic of cholinergic
neurones in intact preparations. Again the cholinergic nature of the cells was confirmed by RT-PCR (see panel C,
lane 4). C, composite gel showing the presence and absence of ChAT (323 bp) reaction product in 4 different BF
neurones. Cholinergic BF neurones also express a Substance P-sensitive inward rectifier current (Yamaguchi et al.
1990). D shows that this current is also maintained when the cells are maintained in culture (17-day-old culture).
From a holding potential of –70 mV voltage steps from –125 to –55 mV (160 ms duration; 5 mV increments) were
imposed to generate an I–V relationship under control conditions (0.5 µM TTX present throughout) and in the
presence of 600 nM substance P.
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
16:12
356
T. G. J. Allen and D. A. Brown
A
J Physiol 554.2 pp 353–370
3 nM Glibenclamide
iv
--58 mV
-71
--71 mV
55 pA
A 10 min
B 46 ms
Bi
iii
ii
- 58
-71
40 pA
350 pA
20 pA
Tolbutamide
C(i)
2
1
-63 mV
10 mV
20 s
100 pA
C(ii)
1
2
10 mV
25 ms
Figure 2.
A, whole-cell recording of a basal forebrain (BF) neurone from the diagonal band region of a thin (250 µm) brain
slice. Immediately upon breaking through to whole-cell (1 mM [MgATP] i ), resting potential (V m ) was –58 mV.
Within less than a minute of cell dialysis commencing, V m slowly began to hyperpolarize, reaching a maximum of
–71 mV after approximately 15 min. During this period, excitability declined markedly (see Bi and ii). Subsequent
application of glibenclamide (3 nM) reversed both the hyperpolarization and fall in excitability (Biii). In this particular
cell, excitability in the presence of glibenclamide was slightly higher than under control conditions. At the end
of the record shown in A (glibenclamide present), current was directly injected through the electrode in order
to restore the membrane potential to that observed at the peak of the hyperpolarization. Biv shows that the
increase in excitability observed in the presence of glibenclamide (Biii) was not simply the result of the change in
V m (compare Bii and Biv). Ci, perforated-patch recording from a BF neurone maintained in culture for 13 days
(2 mM extracellular glucose). Under control conditions, V m was –63 mV. Hyperpolarizing current steps (100 pA
(100 ms)−1 ) were applied at 0.5 Hz to monitor changes membrane resistance (R in ). Application of tolbutamide (100
µM) caused a membrane depolarization associated with a fall in R in . Cii illustrates the direct effect of tolbutamide
on R in after the associated depolarization had been nulled by current injection.
C The Physiological Society 2003
TJP-xml.cls
December 16, 1904
16:12
Effect of K ATP channels on BF neuronal activity
J Physiol 554.2 pp 353–370
Cell-attached and inside-out patch recording. Recordings
were carried out using an Axopatch 200 A (Axon
Instruments) patch-clamp amplifier (interface and
acquisition software as above). Patch electrodes were filled
with a high K+ -containing solution of composition (mm):
potassium acetate 140; Hepes 20; EGTA 0.5 mm; MgCl 2 1;
and the pH was adjusted to 7.3 with KOH. For inside-out
patch recording the bathing and pipette solutions were of
the same composition (see above). Additional drugs were
directly added to the bathing solution.
357
conductance both before and after nulling any associated
changes in resting potential. As alterations in firing
frequency were only observed to occur as a secondary
consequence of membrane potential changes resulting in
the activation or inhibition of other conductances and
were extremely variable from cell to cell, this form of
measurement was not considered to be a very reliable
or direct measure of K ATP channel-induced excitability
changes.
Choline acetyltransferase (ChAT) single-cell RT-PCR
Assessment of changes in excitability
Measurement of excitability changes were carried out using
standard bridge voltage recording mode. Excitability was
quantified in terms of the minimum current (100–500 ms
stimuli) required to reach spike threshold. Measurements
were made following activation or inhibition of the K ATP
A
When harvesting cell contents for single-cell RT-PCR,
electrodes were filled with 3.75 µl of filling solution
of composition (mm): potassium acetate 108; KCl 10.6;
Hepes 40; MgCl 2 1.2; EGTA 3; NaOH 12 (pH 7.3). After
whole-cell patch clamping the cell, a steady negative
pressure was applied to the pipette until as much of
after runup
0.5
B
Glibenclamide-sensitive current
0.75
I (nA)
30 nM glibenclamide
I (nA)
Erev -88.9 mV
0.25
0
-120
-60 mV -40
-100
-0.5
-1
ramp 80 mVs
0
-120
-100
-80
-60 mV -40
-0.25
-1.0
-0.5
C Rectification of the sulphonylurea-sensitive current
0.50
D
K+-dependence of reversal potential
1.00
I (nA)
-60
I (nA)
0.25
Erev -90.7 mV
0.50
0.25
0
-120
-100
-80mV -60
-0.25
0
-0.25
-0.50
Erev-89.7 mV
-120
-100
-80mV -60
Vm(mV)
tjp˙031
-70
-80
slope 59.6 mV/decade
-90
-0.50
3
4
5 6 7 8 9 10
+
Log [K ]out (mM)
Figure 3. Voltage and K+ dependence of the sulphonylurea-sensitive run-up current
A, shows the whole-cell membrane current in response to ramping the membrane potential (V m ) from
–126 to –47 mV (ramp 80 mV s−1 ) following current run-up and after subsequent application of glibenclamide
(30 nM). B, I–V relationship of the glibenclamide-sensitive component of the current shown in A. C, examples of
the extremes of rectification observed in the I–V relation of the sulphonylurea-sensitive from different cells. D, the
reversal potentials of the sulphonylurea-sensitive current measured in 3, 6 and 10 mM [K+ ] o were 91.4 ± 0.94,
–74.5 ± 1.01 and –59.9 ± 1.17 mV (n = 5), respectively, slope 59.6 mV for a 10-fold change in [K+ ] o .
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
16:12
358
T. G. J. Allen and D. A. Brown
the cytoplasm as possible was aspirated, taking care
not rupture the membrane seal. Having removed the
cytoplasmic contents, negative pressure was released, and
the electrode was quickly removed from the bath and its
contents aspirated into a sterile Eppendorf tube containing
6.25 µl of a solution containing 10 U RNase inhibitor,
100 U M-MLV RNase H− point mutant reverse
transcriptase (Promega), oligo(dT) 15 (final concentration
5 µm), 0.1 µg µl−1 acetylated BSA and the four
deoxyribonucleoside triphosphates (final concentration
0.5 mm).
The tubes containing approximately 10 µl were then
incubated at 37◦ C for 1 h to synthesize single-stranded
complimentary DNA (cDNA) followed by a further
15 min incubation at 72◦ C for enzyme inactivation. The
samples were then frozen at –25◦ C prior to carrying
out PCR. PCR was used to amplify mRNA transcripts
using ChAT subunit specific pair of primers. ChAT
mRNA (Brice et al. 1989) was identified using a pair of
primers flanking a splicing site near the 3 terminus of the
coding region. The upper primer was 5 -ATGGCCATTGACAACCATCTTCTG
(nucleotides
1729–1752)
located on exon 14. The lower primer was 5 CCTTGAACTGCAGAGGTCTCTCAT
(nucleotides
2052–2029) located on exon 15, and the fragment size
was 323 bp (Yan & Surmeier, 1996). Taq DNA polymerase
A
J Physiol 554.2 pp 353–370
(1 µl; 10 × Titanium Taq DNA polymerase, Clontech,
UK), in a buffer containing 3.5 mm Mg2+ , 0.2 mm dNTPs
and the primer pair (5 pmol each), was added to 10 µl of
RT product to give a final volume of 50 µl. After 3 min
at 94◦ C, 35 cycles (94◦ C 30 s, 55◦ C 30 s, 72◦ C 40 s) were
performed, followed by an elongation period of 10 min at
72◦ C. The amplification product was then purified using
High Pure microspin tubes (Roche Diagnostics GmbH).
The purified product (5 µl) was used as a template
for the second round of PCR amplification: 40 cycles
(94◦ C 30 s, 55◦ C 30 s, 72◦ C 40 s) with a 10 min final
elongation period at 72◦ C.
Data acquisition and analysis
Data was analysed using a combination of the pCLAMP 8
suite of software (Axon Instruments), Origin 5 (Microcal
Software Inc., Northampton, MA, USA) and Coreldraw
8 (Corel graphics, Corel Corporation, Ontario, Canada).
Unless otherwise stated all values are means ± s.e.m.
Significance values were calculated using Student’s paired
t test.
Drugs
All drugs were applied either via the superfusing
solution or by inclusion in the pipette filling solution.
B
control
tolbutamide
1nA
100 ms
-87
D
C
tolbutamide-sensitive
1.0
I (nA)
0.5
0.0
-0.5
-120
-100
-80
-60
Vm (mV)
Figure 4. Kinetics of the whole-cell K ATP
channel current
I–V relationship (–127 to –57 mV in 10 mV
increments) in the presence of (TTX, 0.5 µM)
under (A) control conditions (V h –87 mV) and
(B) after addition of tolbutamide (100 µM). C,
the tolbutamide-sensitive component of
current exhibits no fast kinetic activation or
inactivation. D, the I–V curve of the steady
state (end of pulse) tolbutamide-sensitive
current shown in B.
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
J Physiol 554.2 pp 353–370
16:12
Effect of K ATP channels on BF neuronal activity
4-Aminopyridine, Na 2 ADP, MgADP, apamin, Na 2 ATP,
MgATP, cAMP, charybdotoxin, chloroform, diazoxide,
GDP-β-S, glibenclamide, GTP, halothane, paclitaxel,
phalloidin, pinacidil, spermine, tetraethylammonium
chloride and tolbutamide were from Sigma. Tetrodotoxin
was from Alomone Laboratories. Bicuculline
methochloride and 6-cyano-7-nitroquinoxaline-2,3dione disodium (CNQX) were from Tocris.
359
Results
Whole-cell patch-clamp recordings were made from 139
magnocellular cholinergic basal forebrain (BF) neurones
in thin brain slice preparations. A further 194 whole-cell,
perforated-patch or excised-patch recordings were made
from magnocellular BF neurones in mixed cell cultures.
Cells were selected on the basis of their size (diameters
Diazoxide 200 µ M
A
*
*
B
60 mV
-
20 mV
diazoxide
50 ms/50s
control
Figure 5.
A, activation of the K ATP conductance by
diazoxide (200 µM) in a perforated-patched
cell superfused with low extracellular glucose
(0.1 mM) containing Krebs solution.
hyperpolarizing current steps (100 pA (100
ms)−1 ) were applied at 0.5 Hz to monitor
changes membrane resistance (R in ). B
illustrates the direct effect of diazoxide on R in
(∗ traces) after the associated depolarization
had been nulled by current injection. C,
histogram showing the sensitivity of
whole-cell K ATP run-up conductance to
intracellular [ATP]. In each case, the K ATP
conductance was calculated by measuring
the amplitude of the tolbutamide-sensitive
current activated in response to stepping
from –80 to –40 mV following full current
run-up. A significant reduction in the
amplitude of the run-up conductance was
only observed with [ATP] i of 6 mM.
C The Physiological Society 2003
Effect of [ATP]i on whole-cell KATP conductance
C
18
15
5
8
55
10
* P< 0.05
6
5
0
0
0.1
1.0
[ATP]i(mM)
4.0
6.0
TJP-xml.cls
December 16, 1904
16:12
360
T. G. J. Allen and D. A. Brown
20–38 µm), location (see Methods), firing characteristics
(see Fig. 1A and B) and current–voltage relationships (see
Fig. 1D). The cholinergic nature of the cells meeting these
criteria was also confirmed by carrying out single-cell RTPCR for ChAT on 23 cells (15 of which were cultured cells
with the other 8 from acute slices) of which 21 gave a
positive product (see Fig. 1C). No consistent differences
were observed in the electrophysiological characteristics
A
0.3 nM glibenclamide
1.2
*
1.0
Im (nA)
0.8
*
0.6
runup
0.4
glibenclamide
0.2
0.0
10
5
0
15
20
time (min)
25
30
B
100
% inhibition
tjp˙031
7
7
80
7
60
40
7
20
IC50 34.1 mM
slope 1.03
7
3
0
1E-6
1E-5
1E-4
Tolbutamide conc
1E-3
Figure 6.
A, inhibition of run-up current by glibenclamide. The K ATP
conductance was allowed to maximally activate under whole-cell
recording conditions (0 mM [ATP] i ). Ordinate is membrane current (I m )
evoked by stepping from –80 to –40 mV (see inset) after run-up and in
the presence of 0.3 nM glibenclamide. Inset shows membrane current
in response to a 2 s step to –40 mV from V h –80 mV followed by a
0.1 s step to –120 mV and ramp change in V m to –40 mV (ramp 80
mV s−1 ) before stepping back to V h (protocol repeated every 20 s) at
the points recording indicated by the asterisk. B, dose–response curve
for the K ATP current to tolbutamide. The curve was constructed from
the mean IC 50 and slope values obtained from the individual cells.
IC 50 and Hill slope values were 34.1 µM and 1.03, respectively. All
points are mean ± S.E.M.
J Physiol 554.2 pp 353–370
of the neurones from the different preparations, and
therefore data were pooled.
Immediately after breaking through to the
whole-cell recording configuration (0 mm [ATP] i ),
the average resting potential of basal forebrain
neurones was –60.3 ± 1.13 mV (n = 69);
as cell dialysis proceeded membrane potential slowly
hyperpolarized over a period of 10–15 min, reaching a
maximum resting potential of –70.6 ± 1.14 mV (n =
60). Figure 2 shows a typical example of this run-up
phenomenon recorded from a cholinergic basal forebrain
neurone in a 250 µm thick brain slice of the rat diagonal
band region. As the cell hyperpolarized, its excitability
declined markedly and much more current needed to
be injected in order to elicit action potential discharge.
Typically, the current required to evoke firing at the peak
of the hyperpolarization (range 0.35–1.56 nA; mean
812.5 ± 89 pA; n = 17) was significantly greater (P >
0.0001; paired t test) than what was initially required
at the start of the recording (range 0.02–0.28 nA; mean
158 ± 24 pA; n = 17). The fall in excitability resulted from
a combination of the membrane hyperpolarization, which
also had the additional inhibitory effect of removing
inactivation from A-type K+ channels, and the shunting
effect on the membrane due to the increase in resting
conductance (see Fig. 2Bii and iv). The hyperpolarization
and conductance increase were unaffected by the calciumactivated K+ channel blockers apamin (30 nm; n = 4) or
charybdotoxin (100 nm; n = 3) and were not potentiated
by the twin pore K+ channel modulators, chloroform
(1 mm; n = 4) or halothane (3 mm; n = 4). However, both
the membrane hyperpolarization and the resulting fall
in excitability could largely be prevented by application
of the sulphonylurea receptor antagonists glibenclamide
(1–10 nm) or tolbutamide (30–200 µm), indicating the
involvement of K ATP channels. In a few cells, excitability in
the presence of these antagonists was slightly higher than
at the start of the recording, indicating that a proportion
of the K ATP channels might be tonically activated under
resting conditions. In order to investigate this possibility
under more physiological conditions, experiments were
carried out using perforated-patch recording to minimize
any disturbance to the normal intracellular ATP/ADP
ratio in the presence of 2 mm extracellular glucose. Under
these conditions, application of tolbutamide (100 µm)
induced a small reversible depolarization (mean 7.2 ±
1.6 mV; n = 9) and increase in input resistance (mean
increase 52.6 ± 16.2 M; n = 7) in 9 out of 11 cells tested
(Fig. 2C).
During prolonged (>30 min) whole-cell recording,
the activity of the underlying K ATP channel conductance
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
16:12
Effect of K ATP channels on BF neuronal activity
J Physiol 554.2 pp 353–370
was frequently observed to slowly decline and excitability
returned to levels similar to those observed at the start of
the recording (data not shown).
Ionic basis of the run-up current
The
mechanism
underlying
the
membrane
hyperpolarization and increase in conductance was
examined under voltage clamp. Figure 3A shows
membrane current in response to ramping membrane
potential from –125 to –47 mV (ramp rate 80 mV
s−1 ) following full current run-up and after subsequent
application of glibenclamide (30 nm). Panel B shows the
current–voltage (I–V ) relationship of the glibenclamidesensitive component of the current. Typically, the
sulphonylurea-sensitive current between –130 and
–50 mV exhibited weak outward rectification which was
most pronounced at strongly hyperpolarized potentials.
The degree of rectification varied considerably between
cells (see Fig. 3C). In cells exhibiting relatively marked
361
rectification, the I–V curve of the sulphonylurea-sensitive
current occasionally exhibited a region of negative
slope conductance at strongly negative potentials (see
right-hand panel of Fig. 3C and (Sim & Allen, 1998).
A similar phenomenon has been observed in other Kir
channels and has been attributed to voltage-dependent
block of the channels by extracellular Na+ ions (Standen
& Stanfield, 1979).
In Fig. 3B, the reversal potential (E rev ) of the
sulphonylurea-sensitive current in 3 mm [K+ ] out was
–88.9 mV, a value close to the calculated potassium
equilibrium potential (E K ). The K+ selectivity of the
underlying channels was examined further by measuring
the shift in the reversal potential of the tolbutamidesensitive run-up current in response to changing the
extracellular [K+ ]. Mean E rev values for the sulphonylureasensitive current in 3, 6 and 10 mm [K+ ] o were –91.4
± 0.94, –74.5 ± 1.01 and –59.9 ± 1.17 mV (n = 5),
respectively, yielding a predicted shift of 59.6 mV for a 10fold change in [K+ ] o , a value consistent with what would be
cell-attached
Vp +40 mV
whole-cell
Vm -40 mV
0.4
Whole-cell current
0.3
Im (nA)
0.2
tolbutamide
0.1
60 s
0.0
Cell-attached patch
control
tolbutamide
wash
3 pA
5s
Figure 7. Simultaneous recording of single-channel and whole-cell K ATP currents from a cholinergic basal
forebrain neurone maintained in culture
Upper trace shows the whole cell current recorded from the cell after full activation of the K ATP current. The cell
was voltage clamped at a depolarized potential (–40 mV). The lower traces show single-channel activity from a
cell-attached patch on the same cell (V p +40 mV). Both the whole-cell and patch-electrodes were filled with 140
mM K+ -containing solutions, whilst the bathing Krebs solution contained 3 mM K+ . Under control conditions, an
outward current was recorded by the whole-cell electrode and a high level of K ATP channel activity was observed
in the patch. Application of tolbutamide (100 µM) to the bathing solution reduced both the standing membrane
current and single-channel activity. On washout the K ATP current and channel activity both recovered. Note the
occasional brief upward deflections from the zero current level are recording artefacts not channel openings.
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
16:12
362
T. G. J. Allen and D. A. Brown
J Physiol 554.2 pp 353–370
predicted if the underlying channels were highly selective
for K+ ions (see Fig. 3D).
cells were too large to clamp sufficiently well to be able to
obtain accurate subtraction currents.
Kinetics of the run-up current
Activation of the run-up current
The activation and inactivation kinetics of the
sulphonylurea-sensitive run-up current were examined.
Figure 4A and B shows membrane currents evoked
between –125 and –60 mV from a holding potential of
–87 mV following current run-up and in the presence
of tolbutamide (100 µm). Over this range of potentials
the sulphonylurea-sensitive component of the current
exhibited no observable time dependence of either its
activation or inactivation (see Fig. 4C). However, switchclamp recordings have a limited frequency response and
any kinetic components with a time constant of less than
1–2 ms would be unresolved. The kinetics of the current
were not examined at potentials more depolarized than
–60 mV as the native transient outward K+ currents in BF
Dialysis of the cell contents during whole-cell recording
invariably triggered current run-up; it did not occur
when disruption of cytoplasmic contents was minimized
by employing the perforated patch recording technique,
indicating that it was triggered by loss of a specific
cytoplasmic factor. Under whole-cell recording
conditions, neither the rate nor amplitude of the
run-up current were affected by inclusion in the pipette
solution of the microtubule or cytoskeletal stabilizing
agents paclitaxol (300 nm) and phalloidin (10 µm); the
mean run-up conductances (G run−up ) in paclitaxol and
phalloidin were 12.3 ± 2.7 nS (n = 5) and 16.7 ± 3.2 nS
(n = 5), respectively, compared to a value of 14.0 ± 1.5
nS (n = 18) under control conditions.
Inside-out patch
I/V KATP in symmetrical K+
A
*
B
4
*
+80 mV
2
+60 mV
-100
-50
50 (mV) 100
-2
Slope G = 74.5 pS
+40 mV
-4
+20 mV
I (pA)
-6
-20 mV
-40 mV
C
Inward rectification of KATP channels in 140 mM symmetrical K
-70 mV
6
I (pA)
3
-80 mV
0
+
slope G = 64 pS
-61
Vm (mV)
+59
-3
-1
ramp 67 mVs
-6
12 sweeps
5 pA
1s
-9
-12
Figure 8. Voltage-dependent rectification by K ATP channels in the inside-out recording configuration
A, steady-state channel activity recorded in symmetrical 140 mM K+ -containing solution for membrane potentials
ranging between –80 and +80 mV (Note: the larger brief channel openings marked with an asterisk on the
+80 mV record are clipped openings of a much larger unidentified channel). B, I–V curve for the single-channel
currents shown in A. (Note: channel slope conductance was measured over the relatively linear region of the curve
between –25 and –80 mV). C, rectification of single-channel currents as revealed by slowly ramping patch potential
between –61 and +59 mV (ramp 67 mV s−1 ). The patch contained at least two K ATP channels.
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
J Physiol 554.2 pp 353–370
16:12
Effect of K ATP channels on BF neuronal activity
Basal forebrain neurones also express other Kir channels
whose rectification at depolarized potentials results in
large part from channel block by intracellular polyamines
(Bajic et al. 2002). During prolonged whole-cell recordings
endogeneous polyamines may be dialysed away, resulting
in loss of rectification due to unblock of the channels,
which could contribute to the observed run-up current at
potentials positive to E K . However, inclusion of spermine
(1 µm) in the pipette filling solution did not significantly
reduce the amplitude of the run-up conductance. Mean
conductance (positive to E K ) in the presence spermine was
13.9 ± 2.2 nS (n = 4), compared to a value 14.0 ± 1.5 nS
(n = 18) under control conditions.
Depending upon their subunit composition, K ATP
channels exhibit varying sensitivities to the different
K+ channel activators (KCOs) (Babenko et al. 1998a;
Schwanstecher et al. 1998). As run-up was activated
under whole-cell conditions even in the presence of
high intracellular ATP concentration (see later section),
it was not possible to test these compounds in this
recording configuration. Thus the ability of these
compounds to activate the whole-cell K ATP current in basal
forebrain neurones was investigated using the perforatedpatch recording technique. Under these conditions, in
the presence of normal to high extracellular glucose
concentrations (2–10 mm), the ATP-sensitive K+ channel
activators diazoxide and pinacidil (100–500 µm) both
failed to activate the K+ run-up current (n = 12). This
lack of effect was surprising, as almost all subtypes of K ATP
channel are sensitive to at least one of the compounds.
A
Figure 9. K ATP channel pharmacology
(inside-out configuration in symmetrical
140 mm K+ )
A, on excision there was an initial high level
of channel activity which characteristically
declined to a lower level (V p +50 mV).
Application of 0.5 mM MgATP inhibited all
K ATP channel activity (remaining small
unidentified channel openings remain). On
washout channel activity returned to a level
similar to that observed immediately after
excision but higher than that immediately
prior to adding ATP (channel refreshment).
Application of tolbutamide (100 µM) greatly
reduced the frequency of channel openings.
B, a second patch displaying increased
channel opening in the presence of diazoxide
(300 µM; V p +80 mV). Again channel activity
was greatly reduced by application of
tolbutamide.
C The Physiological Society 2003
363
However, previous studies have shown that ATP competes
with diazoxide/pinacidil for control of channel opening
and that their effect can be completely suppressed if the
intracellular ATP concentration exceeds 2–5 mm (Dunne
et al. 1987; Fan et al. 1990). Thus if, as has been reported
in other cells (Ashcroft, 1988), basal forebrain neurones
have a high resting submembrane [ATP] i, then this could
explain the observed lack of effect of these compounds.
In order to test this possibility, the effects of KCOs were
tested on cells bathed with Krebs solution containing low
(0.1 mm) extracellular glucose. This should result in a
reduction in the intracellular ATP concentration and allow
the KCOs access to the active site on the SUR subunit.
Under these conditions, diazoxide (200 µm; see Figs 5A
and B), but not pinacidil (200–500 µm), was then observed
to hyperpolarize the resting cell membrane potential by
3.3 ± 1.15 mV and decrease input resistance by 41.3 ±
17.3 M in 3 out of 8 cells tested.
Modulation by [ATP]i and other high
energy phosphates
The dependence of the run-up current on the intracellular
ATP concentration was examined. The histogram in
Fig. 5C shows the amplitude of the sulphonylureasensitive run-up conductance in the presence of different
intracellular ATP concentrations. In the absence of ATP, the
average conductance increase due to the activation of K ATP
channels was 14.0 ± 1.5 nS (n = 18). Increasing [ATP] i
had no effect upon the amplitude of the conductance until
Patch excised
500 µM MgATP
wash/refresh
tolbutamide
2 pA
30 s
Ai
100 ms
100 µM MgATP + 300 µM diazoxide
tolbutamide
B
2 pA
30s
tjp˙031
TJP-xml.cls
December 16, 1904
16:12
364
T. G. J. Allen and D. A. Brown
its concentration exceeded 4 mm. With 6 mm [ATP] i , the
mean run-up conductance was reduced by approximately
67% to 4.6 ± 1.6 nS (n = 6). In contrast, inclusion
of physiologically relevant intracellular concentrations of
GTP (0.5 mm), GDP-βS (1 mm), ADP (1 mm) or cAMP
(0.5–1 mm) in the intracellular solution failed to prevent
run-up, the mean sulphonylurea-sensitive conductances
under these conditions being 14.3 ± 3.5 nS (n = 4), 13.0
J Physiol 554.2 pp 353–370
± 1.2 nS (n = 3), 17.0 ± 2.8 nS (n = 8) and 16.6 ± 5.1 nS
(n = 4), respectively.
Pharmacology of the K ATP current
K ATP channels can be assembled from a variety of
different subunits. To date, five different channel
subtypes have been identified, each displaying distinctive
A
100 pA
100 pA
20 mV
-64 mV
2 mM glucose
105 pA
100 pA
12 mM glucose
2 mM glucose
0.2 mM glucose
60 s
2 mM glucose
B
*
-58 mV
20 mV
1 mM sodium azide
60 s
Figure 10.
A, examination of the effect of acute changes in extracellular glucose levels on the excitability of cholinergic BF
neurones. The illustrated recording was made from a cell maintained in culture for 6 days using the perforated-patch
recording technique. Downward deflections are membrane voltage responses to current pulses delivered at 0.5
Hz (100 pA, 200 ms) used to monitor changes in input resistance. The threshold current required to evoke spike
discharge was determined just prior to changing the extracellular glucose concentration (upward deflections).
Insets show firing (200 ms duration pulses) and the threshold current under each condition. Note, prolonged
current stimulation (0.5–1 s evoked a sustained slow rate of firing). B, the effect upon excitability of exposure to
sodium azide (1 mM). Downward deflections are membrane voltage responses to 50 pA, 200 ms duration current
pulses delivered at 1 Hz. On exposure to sodium azide membrane potential typically depolarized transiently before
slowly hyperpolarizing. The hyperpolarization was associated with a fall in input resistance (R in ) and inhibited by
tolbutamide confirming the involvement of K ATP channels (data not shown). In the cell shown, R in fell from 340 to
60 M whilst the current required to evoke an action potential increased from 130 to 850 pA. Asterisk marks the
region of the voltage trace where the change in membrane potential was nulled by direct current injection. From
this it can be see that the majority of the fall in input resistance was the result of sodium azide-induced channel
opening rather than as a secondary consequence of membrane hyperpolarization.
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
J Physiol 554.2 pp 353–370
16:12
Effect of K ATP channels on BF neuronal activity
pharmacological and biophysical characteristics. Their
sensitivity to inhibition by sulphonylurea compounds is
one indicator of individual channel subunit composition.
Channels composed of SUR1–Kir 6.2 or SUR2B–Kir6.1
subunits are both blocked by nanomolar concentrations
of glibenclamide (Dunne et al. 1987; Gribble et al. 1998).
In channels assembled from SUR1–Kir 6.2 subunits the
block is irreversible, whereas in channels composed of
SUR2B–Kir6.1 subunits the block is reversible (Gribble
& Ashcroft, 2000). By contrast, tolbutamide reversibly
inhibits all K ATP channels but displays its highest affinity
(K i ∼ 2–32 µm) for channels composed of SUR1–Kir
6.2 subunits (Inagaki et al. 1995; Gribble et al. 1997,
1998). In basal forebrain neurones, glibenclamide potently
inhibited the K ATP current at concentrations as low as
0.1–3 nm (see Fig. 6A). Inhibition by glibenclamide was
found to be essentially irreversible with no recovery being
observed during the time course of recordings (=45 min).
The irreversible nature of the block precluded direct
measurement of the IC 50 value. By contrast tolbutamide
reversibly inhibited the current with a mean IC 50 of 34.1 ±
6.5 µm (n = 7; see Fig. 6B).
K ATP channels also display relatively low affinities for
the K+ channel blockers tetraethylammonium (Fatherazi
& Cook, 1991) and 4-aminopyridine (Koh et al. 1998).
In cholinergic basal forebrain neurones, TEA and 4-AP
(5 mm) blocked only 27.4 ± 4.2% (n = 6) and 2.75 ±
2.75% (n = 4), respectively, of tolbutamide-sensitive (200
µm) K ATP current.
Single-channel properties
Information about the subunit composition of the
channels can be also obtained from their single-channel
characteristics. In order to correlate the whole-cell K ATP
current with the underlying single channels, an initial
series of experiments was carried out to record singlechannel activity using simultaneous cell-attached patch
and macroscopic whole-cell current recording from the
same cell. Figure 7 shows an example of a dual recording
from a cholinergic basal forebrain neurone. In this
case, the cell had been obtained from a 14-day-old
animal and maintained in culture for 3 weeks. The
basic configuration for the recording is shown in the
top right panel. The whole-cell voltage-clamp recording
was carried out as previously described. In addition, a
second electrode containing the same filling solution as
the whole-cell electrode was used to obtain a cell-attached
patch recording from the same cell. A holding potential of
+40 mV was applied to the patch pipette, whilst the cell
was voltage clamped at –40 mV. This produced a driving
C The Physiological Society 2003
365
force for K+ ion movement across the patch of 80 mV and
approximately 50 mV for the whole-cell current. Following
run-up of the whole-cell current, channel activity in the
form of bursts of openings with many brief closures
was observed in the patch (see lower panel in Fig. 7).
Application of 100 µm tolbutamide reduced both the
standing whole-cell current and inhibited channel activity
in the patch. Both the whole-cell current and associated
channel activity recovered upon washing.
Inside-out patches
In order to directly compare the properties of these K ATP
channels with those from cells in other studies, recordings
were also carried out using inside-out patches excised
cholinergic BF neurones maintained in culture. Patches
were excised into high 140 mm K+ containing solution.
On excision into solutions containing 0 mm ATP, initial
K ATP channel activity was usually quite high but generally
declined to a much lower value within a few seconds.
The extent of this initial loss of activity varied greatly
between patches and in many cases channel activity was
almost totally lost in less than a minute. Furthermore,
most patches also contained other constitutively active
inwardly rectifying K+ channels (Bajic et al. 2002), making
it relatively difficult to study K ATP channel activity in
isolation. In patches containing only K ATP channels,
their activity was characterized by bursts of openings
containing many brief closures (see Figs 8A and 9Ai), with
individual bursts of channel openings being interspersed
by prolonged closed states.
Single-channel conductance
Figure 8A shows typical channel activity over a range
of membrane potentials between –80 and +80 mV.
Under these conditions the channels displayed inward
rectification at all potentials more positive than –20 mV. A
plot of single-channel current versus membrane potential
for the same patch is shown in panel B. Figure 8C shows
channel rectification in a second patch in response to
ramping the patch potential from –60 to +60 mV. In the
example shown, the patch contained at least two channels
and the dashed lines indicate the predicted single-channel
currents in the absence of any rectification. Single-channel
slope conductance was measured over the relatively linear
region of the I–V curve between –80 and –30 mV. Under
these conditions channel conductance ranged between 60
and 74.5 pS (mean 66.2 ± 1.9 pS, n = 7).
tjp˙031
TJP-xml.cls
December 16, 1904
16:12
366
T. G. J. Allen and D. A. Brown
ATP sensitivity
Application of MgATP at concentrations =20 µm was
observed to stimulate K ATP channel activity. At higher
concentrations (=50 µm) MgATP reduced channel
activity and at concentrations (=500 µm) it virtually
suppressed all K ATP channel activity (Fig. 9A). Prolonged
exposure to MgATP (0.2–1 mm) resulted, on washout,
in transient refreshment of channel activity, restoring
it to levels similar to those observed immediately
following patch excision and significantly higher than
that immediately prior to ATP application (n = 6; see
Fig. 9A). In the presence of blocking concentrations of
MgATP (100–500 µm), application of MgADP (200–500
µm) increased channel activity in 4 out of 5 patches tested.
Effects of K+ channel openers (KCOs)
on single-channel currents
The sensitivity of K ATP channels to KCOs can also be
indicative of the sulphonylurea subunit composition.
Diazoxide strongly activates channels with subunit
composition SUR1–Kir6.2, but is largely ineffective on
channels of composition SUR2A–Kir 6.2. In BF neurones,
application of diazoxide (200–500 µm) in the presence
of 100 µm MgATP strongly activated the K ATP channels
(mean increase in NP o 486 ± 120%; n = 5; see Fig.
9B). By contrast pinacidil (200–500 µm), which most
potently activates SUR2A/Kir 6.2 and has only a very weak
effect upon SUR2B–Kir6.2- or SUR1–Kir6.2-containing
channels, had no discernable effect (n = 5).
Glucose sensing
Within the brain a subpopulation of the neurones
expressing K ATP channels are also glucose responsive, i.e.
regulate their firing rate by modulating K ATP channel
activity in response to changes in the extracellular
glucose concentration (Levin et al. 2001). The possibility
that some basal forebrain neurones might be glucose
responsive/sensing was examined using perforated-patch
recording. In vitro, BF neurones rarely exhibit any
spontaneous action potential discharge. Therefore the
effect of acute changes in extracellular glucose on resting
membrane potential (V m ), input resistance (R in ) and
excitability were assessed in response to direct current
stimulation on switching from normal (2 mm) to low (0.1–
0.2 mm; n = 11) or high (10–12 mm; n = 6) extracellular
glucose for a period of 5 min (bath temperature 34–
36◦ C; see Fig. 10A). Under these conditions, no consistent
changes in V m , R in , the amplitude of the stimulating
J Physiol 554.2 pp 353–370
current required to evoke an action potential or the pattern
of spike discharge in response to 100–500 ms depolarizing
current stimuli were observed. By contrast metabolic
inhibition in response to exposure to NaN 3 (1 mm) for
=5 min consistently activated K ATP channels and reduced
excitability (n = 5; see Fig. 10B).
Discussion
The results of the present study indicate that virtually
all magnocellular cholinergic basal forebrain neurones
express functional K ATP channels and that when activated
they exert a profound inhibitory effect upon cell
excitability. The single-channel conductance of basal
forebrain K ATP channels measured in symmetrical high
K+ -containing solutions ranged between 60 and 74.5 pS
(mean 66.2 ± 1.9 pS). These values are similar to that
which have been reported in several other central neurones
(Ohno-Shosaku & Yamamoto, 1992; Schwanstecher &
Panten, 1993) and consistent with the reported unitary
conductance values for channels composed of SUR1–
K ir 6.2 (pancreatic β cell type) subunits (50–75 pS;
Findlay et al. 1985; Ashcroft et al. 1988; Williams et al.
1993). By contrast SUR2A–K ir 6.2 (cardiac ventricular
type) containing channels have conductances of 67–90 pS
(Nakayama et al. 1991; Babenko et al. 1998b; Kono
et al. 2000) whilst SUR2B–K ir 6.2 (smooth muscle type)
channels range between 27 and 59 pS (Koh et al. 1998; Lee
et al. 1999; Teramoto et al. 2000).
Pharmacologically the high affinity for glibenclamide
coupled with the irreversible nature of the block is also
consistent with BF K ATP channels cells being composed
of SUR1–K ir 6.2 subunits (Gribble & Ashcroft, 2000). The
affinity of the channels for tolbutamide (IC 50 of 34.1 ±
6.5 µm) was somewhat lower than has previously been
reported for SUR1–K ir 6.2-containing channels (4–7 µm;
Trube et al. 1986; Sakura et al. 1995; Gribble et al. 1998).
This could indicate that these cells express multiple K ATP
channels isoforms. However, in all of the cells studied,
the dose–response curves could be well fitted to a single
binding equation.
Studies with KCOs were rather equivocal. Pinacidil,
which strongly stimulates cardiac channels with almost
no effect on pancreatic β-cell-type channels (Babenko
et al. 1998b), was ineffective when applied either to excised
patches or under whole-cell conditions. Diazoxide, which
has a broader spectrum of activity, clearly activated K ATP
channels in excised membrane patches in the presence
of low (0.5 mm) MgATP. However, under whole-cell
perforated-patch recording conditions in the presence of
normal extracellular glucose it was ineffective. This lack of
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
J Physiol 554.2 pp 353–370
16:12
Effect of K ATP channels on BF neuronal activity
effect of the KCOs could be due to the presence of a high
intracellular ATP concentration which would compete
with KCOs for the active site on the SUR subunit (Dunne
et al. 1987; Fan et al. 1990). Consistent with this idea,
reducing the intracellular ATP concentration by placing
the cells in low glucose-containing solutions did increase
the number of cells responding to diazoxide. A further
contributory factor to the weak effect of diazoxide could
be the presence of high levels of phosphatidlyinositol 4,5bisphosphate (PIP 2 ) within the cell (see below), which
is also known to reduce the effectiveness of diazoxide
(Baukrowitz et al. 1998).
Data from the present study, in particular, the
observation that a large proportion of the K ATP channels
activated even when the recording electrode contained
a high concentration of MgATP (4–6 mm), suggest that
in intact cholinergic basal forebrain neurones the K ATP
channels exhibit a low affinity for ATP. In intact cells,
reported values for the intracellular ATP concentration
range from about 1.5 mm to 5 mm (Ashcroft & Ashcroft,
1990; Gribble & Ashcroft, 2000). Thus, if the ATP affinity
of the K ATP channels in intact BF cells is in the millimolar
range then one might expect to observe some tonic
activation, and indeed, using perforated-patch recordings
which cause minimal disruption to the cell cytoplasm, a
small proportion of the K ATP channels were found to be
tonically activated in a significant proportion of the cells
tested.
In excised membrane patches the ATP affinity of the
channels is in the micromolar range. Whilst a number
of factors can subtly modulate the ATP affinity of K ATP
channels, the most likely explanation for the much lower
affinity of the macroscopic current is the presence of high
levels of PIP 2 , which has been reported to be capable
of reducing the ATP affinity of the channels by several
orders of magnitude (Baukrowitz et al. 1998). If PIP 2 is
involved, then this also raises the possibility that activation
of receptor pathways resulting in changes in membrane
phosphoinositide levels could indirectly modulate the
excitability of BF cells by shifting the K ATP channel
activation threshold by altering channel affinity for ATP.
What is the functional role of the K ATP channels
expressed by cholinergic basal forebrain neurones? Within
the CNS, a small population of so-called, glucoseresponsive cells use K ATP channels to directly regulate
their firing in response to changes in ambient glucose
levels (Miki et al. 2001). Short-term exposure (=5 min)
of BF neurones to low or high extracellular glucose was
found to have no discernable effect upon excitability.
This apparent lack of a direct glucose-sensing role is
similar to that which has been reported in the vast
C The Physiological Society 2003
367
majority of other CNS neurones expressing K ATP channels.
The difference between the cells that can sense glucose
and those that can’t is believed to be the result of
differential expression of the genes involved in glucose
metabolism such that only the glucose-sensing neurones
express the low affinity glucose transporter GLUT2
and the glucose phosphorylating enzyme glucokinase
(Miki et al. 2001). Whilst basal forebrain neurones
do not appear to be glucose responsive, their K ATP
channels could be activated in response to a reduction
in intracellular ATP levels following metabolic inhibition
with sodium azide. The most common role ascribed
to K ATP channels in non-glucose-sensing neurones is
neuroprotection against excessive transmitter release and
excitotoxicity or depolarization leading to excessive cell
discharge as a result of hypoxia or ischaemia (Fellows et al.
1993). Under these conditions, the K ATP channels open
and hyperpolarize the cell membrane to protect them. The
protective role of K ATP channels may not be restricted to
short-term metabolic insults. Chronic metabolic stress is
also believed to play a role in various neurodegenerative
disorders, including Alzheimer’s disease (Mattson et al.
2001). Glucose administration has been shown to improve
memory in Alzheimer’s patients (Manning et al. 1993),
whilst in rats glucose-induced improvements in memory
have been shown to be attenuated by glibenclamide
(Rashidy-Pour, 2001). Thus K ATP channels could play a
role in neuropathological conditions involving prolonged
metabolic dysfunction.
All of the roles for the K ATP channels discussed so
far are pathophysiological in nature. However, the K ATP
channels may play an important physiological role. K ATP
channels have been implicated in several types of memory
processes (Stefani et al. 1999; Stefani & Gold, 2001).
Substantial evidence indicates that glucose may enhance
memory by augmenting cholinergic functions (Durkin
et al. 1992; Ragozzino et al. 1996). Intraseptal injections of
glibenclamide or glucose to block K ATP channels enhances
spatial working memory (Stefani et al. 1999), whilst
intrahippocampal infusion of glibenclamide increases
ACh output and spatial memory (Stefani & Gold, 2001).
K ATP channel activators such as lemakalim have the
converse effect (Stefani & Gold, 2001).
A high level of ascending cholinergic excitation from the
basal forebrain is vital for maintaining cortical activation
(Jones, 1993; Everitt & Robbins, 1997). However, during
prolonged periods of wakefulness, there is a slow decline
in glucose and ATP levels and a rise in the extracellular
adenosine concentration (Netchiporouk et al. 2001; Van
den Noort & Brine, 1970). The magnitude of the adenosine
rise and thus by association the level of energy depletion
tjp˙031
TJP-xml.cls
December 16, 1904
368
16:12
T. G. J. Allen and D. A. Brown
is not homogeneous throughout the brain; rather, it is
site specific, being significantly higher in the cholinergic
region of the basal forebrain and, to a lesser extent the
cortex, than in other brain regions (Porkka-Heiskanen
et al. 1997, 2000). The adenosine activates inhibitory
A1 receptors, resulting in a reduction in acetylcholine
release and cortical excitation (Fredholm et al. 1990; Mogul
et al. 1993). This scheme places adenosine as the prime
candidate for the induction of sleep (Porkka-Heiskanen,
1999). One source for the extracellular adenosine is the
hydrolysis of [ATP] i and its subsequent transport to the
extracellular space by nucleoside transporters (PorkkaHeiskanen et al. 1997). As a consequence, there will
also be a parallel fall in the intracellular ATP/ADP ratio,
potentially leading to activation of K ATP channels. The
present study shows that if activated in this manner they
could exert an additional, very powerful inhibitory effect
on the excitability of cholinergic BF neurones that could
also contribute, along with adenosine, to the induction, or
maintenance of the duration or depth of sleep.
In conclusion, cholinergic basal forebrain neurones
express K ATP channels with properties very similar to those
of channels composed of SUR1–Kir6.2 subunits. These
channels exhibit a low affinity for [ATP] i and in many cells
a small proportion of the channels are tonically activated
and may thus play a modulatory role in controlling resting
excitability. Further activation of these channels as a result
of metabolic stress has a profound effect upon their
excitability which may have important consequences for
the maintenance of normal levels of cortical arousal and
certain mneumonic processes.
References
Allen TGJ (2003). Regulation of excitability in cholinergic basal
forebrain neurones by K ATP channels. J Physiol 547.P, C23.
Ashcroft FM (1988). Adenosine 5 -triphosphate-sensitive
potassium channels. Annu Rev Neurosci 11, 97–118.
Ashcroft FM, Ashcroft SJ & Harrison DE (1988). Properties of
single potassium channels modulated by glucose in rat
pancreatic β-cells. J Physiol 400, 501–527.
Ashcroft FM & Gribble FM (1998). Correlating structure and
function in ATP-sensitive K+ channels. Trends Neurosci 21,
288–294.
Ashcroft SJ & Ashcroft FM (1990). Properties and functions of
ATP-sensitive K-channels. Cell Signal 2, 197–214.
Babenko AP, Aguilar-Bryan L & Bryan J (1998a). A view of
sur/KIR6.X, K ATP channels. Annu Rev Physiol 60, 667–687.
Babenko AP, Gonzalez G, Aguilar-Bryan L & Bryan J (1998b).
Reconstituted human cardiac K ATP channels: functional
identity with the native channels from the sarcolemma of
human ventricular cells. Circ Res 83, 1132–1143.
J Physiol 554.2 pp 353–370
Bajic D, Koike M, Albsoul-Younes AM, Nakajima S & Nakajima
Y (2002). Two different inward rectifier K+ channels are
effectors for transmitter-induced slow excitation in brain
neurons. Proc Natl Acad Sci U S A 99, 14494–14499.
Baukrowitz T, Schulte U, Oliver D, Herlitze S, Krauter T,
Tucker SJ, Ruppersberg JP & Fakler B (1998). PIP2 and PIP
as determinants for ATP inhibition of K ATP channels. Science
282, 1141–1144.
Benson DM, Blitzer RD & Landau EM (1988). An analysis of
the depolarization produced in guinea-pig hippocampus by
cholinergic receptor stimulation. J Physiol 404, 479–496.
Brice A, Berrard S, Raynaud B, Ansieau S, Coppola T, Weber
MJ & Mallet J (1989). Complete sequence of a cDNA
encoding an active rat choline acetyltransferase: a tool to
investigate the plasticity of cholinergic phenotype
expression. J Neurosci Res 23, 266–273.
Brown DA & Selyanko AA (1985). Membrane currents
underlying the cholinergic slow excitatory post-synaptic
potential in the rat sympathetic ganglion. J Physiol 365,
365–387.
Clement J, Pt Kunjilwar K, Gonzalez G, Schwanstecher M,
Panten U, Aguilar-Bryan L & Bryan J (1997). Association
and stoichiometry of K(ATP) channel subunits. Neuron 18,
827–838.
Dunne MJ, Illot MC & Peterson OH (1987). Interaction of
diazoxide, tolbutamide and ATP4− on nucleotide-dependent
K+ channels in an insulin-secreting cell line. J Membr Biol
99, 215–224.
Dunn-Meynell AA, Rawson NE & Levin BE (1998).
Distribution and phenotype of neurons containing the
ATP-sensitive K+ channel in rat brain. Brain Res 814, 41–54.
Durkin TP, Messier C, de Boer P & Westerink BH (1992).
Raised glucose levels enhance scopolamine-induced
acetylcholine overflow from the hippocampus: an in vivo
microdialysis study in the rat. Behav Brain Res 49, 181–188.
Everitt BJ & Robbins TW (1997). Central cholinergic systems
and cognition. Annu Rev Psychol 48, 649–684.
Fan Z, Nakayama K & Hiraoka M (1990). Pinacidil activates the
ATP-sensitive K+ channel in inside-out and cell-attached
patch membranes of guinea-pig ventricular myocytes.
Pflugers Arch 415, 387–394.
Fatherazi S & Cook DL (1991). Specificity of
tetraethylammonium and quinine for three K channels in
insulin-secreting cells. J Membr Biol 120, 105–114.
Fellows LK, Boutelle MG & Fillenz M (1993). ATP-sensitive
potassium channels and local energy demands in the rat
hippocampus: an in vivo study. J Neurochem 61, 949–954.
Findlay I, Dunne MJ & Petersen OH (1985). ATP-sensitive
inward rectifier and voltage- and calcium-activated K+
channels in cultured pancreatic islet cells. J Membr Biol 88,
165–172.
Fredholm BB, Duner-Engstrom M, Fastbom J, Hu PS & van der
Ploeg I (1990). Role of G proteins, cyclic AMP, and ion
channels in the inhibition of transmitter release by
adenosine. Ann N Y Acad Sci 604, 276–288.
C The Physiological Society 2003
tjp˙031
TJP-xml.cls
December 16, 1904
J Physiol 554.2 pp 353–370
16:12
Effect of K ATP channels on BF neuronal activity
Gribble FM & Ashcroft FM (2000). Sulfonylurea sensitivity of
adenosine triphosphate-sensitive potassium channels from
beta cells and extrapancreatic tissues. Metabolism 49, 3–6.
Gribble FM, Tucker SJ & Ashcroft FM (1997). The interaction
of nucleotides with the tolbutamide block of cloned ATPsensitive K+ channel currents expressed in Xenopus oocytes:
a reinterpretation. J Physiol 504, 35–45.
Gribble FM, Tucker SJ, Seino S & Ashcroft FM (1998). Tissue
specificity of sulfonylureas: studies on cloned cardiac and
beta-cell K(ATP) channels. Diabetes 47, 1412–1418.
Inagaki N, Gonoi T, Clement JP, Namba N, Inazawa J,
Gonzalez G, Aguilar-Bryan L, Seino S & Bryan J (1995).
Reconstitution of IK ATP : an inward rectifier subunit plus the
sulfonylurea receptor. Science 270, 1166–1170.
Jones BE (1993). The organization of central cholinergic
systems and their functional importance in sleep-waking
states. Prog Brain Res 98, 61–71.
Karschin C, Ecke C, Ashcroft FM & Karschin A (1997).
Overlapping distribution of K (ATP) channel-forming Kir6.2
subunit and the sulfonylurea receptor SUR1 in rodent brain.
FEBS Lett 401, 59–64.
Koh SD, Bradley KK, Rae MG, Keef KD, Horowitz B & Sanders
KM (1998). Basal activation of ATP-sensitive potassium
channels in murine colonic smooth muscle cell. Biophys J 75,
1793–1800.
Kono Y, Horie M, Takano M, Otani H, Xie LH, Akao M, Tsuji K
& Sasayama S (2000). The properties of the Kir6.1–6.2
tandem channel co-expressed with SUR2A. Pflugers Arch
440, 692–698.
Lee K, Dixon AK, Richardson PJ & Pinnock RD (1999).
Glucose-receptive neurones in the rat ventromedial
hypothalamus express K ATP channels composed of Kir6.1
and SUR1 subunits. J Physiol 515, 439–452.
Levin BE, Dunn-Meynell AA & Routh VH (2001). Brain
glucosensing and the K(ATP) channel. Nat Neurosci 4,
459–460.
Manning CA, Ragozzino ME & Gold PE (1993). Glucose
enhancement of memory in patients with probable senile
dementia of the Alzheimer’s type. Neurobiol Aging 14,
523–528.
Mattson MP, Duan W, Pedersen WA & Culmsee C (2001).
Neurodegenerative disorders and ischemic brain diseases.
Apoptosis 6, 69–81.
Miki T, Liss B, Minami K, Shiuchi T, Saraya A, Kashima Y,
Horiuchi M, Ashcroft F, Minokoshi Y, Roeper J & Seino S
(2001). ATP-sensitive K+ channels in the hypothalamus are
essential for the maintenance of glucose homeostasis. Nat
Neurosci 4, 507–512.
Millar JA, Barratt L, Southan AP, Page KM, Fyffe RE,
Robertson B & Mathie A (2000). A functional role for the
two-pore domain potassium channel TASK-1 in cerebellar
granule neurons. Proc Natl Acad Sci U S A 97,
3614–3618.
Mogul DJ, Adams ME & Fox AP (1993). Differential activation
of adenosine receptors decreases N-type but potentiates
C The Physiological Society 2003
369
P-type Ca2+ current in hippocampal CA3 neurons. Neuron
10, 327–334.
Mourre C, Widmann C & Lazdunski M (1990). Sulfonylurea
binding sites associated with ATP-regulated K+ channels in
the central nervous system: autoradiographic analysis of
their distribution and ontogenesis, and of their localization
in mutant mice cerebellum. Brain Res 519, 29–43.
Nakayama K, Fan Z, Marumo F, Sawanobori T & Hiraoka M
(1991). Action of nicorandil on ATP-sensitive K+ channel in
guinea-pig ventricular myocytes. Br J Pharmacol 103,
1641–1648.
Netchiporouk L, Shram N, Salvert D & Cespuglio R (2001).
Brain extracellular glucose assessed by voltammetry
throughout the rat sleep-wake cycle. Eur J Neurosci 13,
1429–1434.
Ohno-Shosaku T & Yamamoto C (1992). Identification of an
ATP-sensitive K+ channel in rat cultured cortical neurons.
Pflugers Arch 422, 260–266.
Porkka-Heiskanen T (1999). Adenosine in sleep and
wakefulness. Ann Med 31, 125–129.
Porkka-Heiskanen T, Strecker RE & McCarley RW (2000).
Brain site-specificity of extracellular adenosine concentration
changes during sleep deprivation and spontaneous sleep: an
in vivo microdialysis study. Neuroscience 99, 507–517.
Porkka-Heiskanen T, Strecker RE, Thakkar M, Bjorkum AA,
Greene RW & McCarley RW (1997). Adenosine: a mediator
of the sleep-inducing effects of prolonged wakefulness.
Science 276, 1265–1268.
Rae J, Cooper K, Gates P & Watsky M (1991). Low access
resistance perforated patch recordings using amphotericin B.
J Neurosci Meth 37, 15–26.
Ragozzino ME, Unick KE & Gold PE (1996). Hippocampal
acetylcholine release during memory testing in rats:
augmentation by glucose. Proc Natl Acad Sci U S A 93,
4693–4698.
Rashidy-Pour A (2001). ATP-sensitive potassium channels
mediate the effects of a peripheral injection of glucose on
memory storage in an inhibitory avoidance task. Behav Brain
Res 126, 43–48.
Sakura H, Ammala C, Smith PA, Gribble FM & Ashcroft FM
(1995). Cloning and functional expression of the cDNA
encoding a novel ATP-sensitive potassium channel subunit
expressed in pancreatic beta-cells, brain, heart and skeletal
muscle. FEBS Lett 377, 338–344.
Schwanstecher C & Panten U (1993). Tolbutamide- and
diazoxide-sensitive K+ channel in neurons of substantia
nigra pars reticulata. Naunyn Schmiedebergs Arch Pharmacol
348, 113–117.
Schwanstecher M, Sieverding C, Dorschner H, Gross I,
Aguilar-Bryan L, Schwanstecher C & Bryan J (1998).
Potassium channel openers require ATP to bind to and act
through sulfonylurea receptors. EMBO J 17, 5529–5535.
Sim JA & Allen TG (1998). Morphological and membrane
properties of rat magnocellular basal forebrain neurons
maintained in culture. J Neurophysiol 80, 1653–1669.
tjp˙031
TJP-xml.cls
370
December 16, 1904
16:12
T. G. J. Allen and D. A. Brown
Standen NB & Stanfield PR (1979). Potassium depletion and
sodium block of potassium currents under hyperpolarization
in frog sartorius muscle. J Physiol 294, 497–520.
Stefani MR & Gold PE (2001). Intrahippocampal infusions of
K-ATP channel modulators influence spontaneous
alternation performance: relationships to acetylcholine
release in the hippocampus. J Neurosci 21, 609–614.
Stefani MR, Nicholson GM & Gold PE (1999). ATP-sensitive
potassium channel blockade enhances spontaneous
alternation performance in the rat: a potential mechanism
for glucose-mediated memory enhancement. Neuroscience
93, 557–563.
Teramoto N, Brading AF & Ito Y (2000). Possible
underestimation of the channel conductance underlying
pinacidil-induced K+ currents using noise analysis in pig
urethral myocytes. J Pharm Pharmacol 52, 1395–1403.
Treherne JM & Ashford ML (1991). The regional distribution
of sulphonylurea binding sites in rat brain. Neuroscience 40,
523–531.
Trube G, Rorsman P & Ohno-Shosaku T (1986). Opposite
effects of tolbutamide and diazoxide on the ATP-dependent
K+ channel in mouse pancreatic beta-cells. Pflugers Arch
407, 493–499.
Van den Noort S & Brine K (1970). Effect of sleep on brain
labile phosphates and metabolic rate. Am J Physiol 218,
1434–1439.
J Physiol 554.2 pp 353–370
Williams BA, Smith PA, Leow K, Shimizu S, Gray DW &
Ashcroft FM (1993). Two types of potassium channel
regulated by ATP in pancreatic B cells isolated from a type-2
diabetic human. Pflugers Arch 423, 265–273.
Xu XH, Pan YP & Wang XL (2002). mRNA expression
alterations of inward rectifier potassium channels in rat
brain with cholinergic impairment. Neurosci Lett 322, 25–28.
Yamaguchi K, Nakajima Y, Nakajima S & Stanfield PR (1990).
Modulation of inwardly rectifying channels by substance P
in cholinergic neurones from rat brain in culture. J Physiol
426, 499–520.
Yan Z & Surmeier DJ (1996). Muscarinic (m2/m4) receptors
reduce N- and P-type Ca2+ currents in rat neostriatal
cholinergic interneurons through a fast,
membrane-delimited, G-protein pathway. J Neurosci 16,
2592–2604.
Acknowledgements
The authors would like to thank Dr M. Mistry and Dr F.
Abogadie for their help with the single-cell RT-PCR. This work
was supported by the Medical Research Council.
C The Physiological Society 2003