doi:10.1016/S0022-2836(03)00992-6
J. Mol. Biol. (2003) 332, 889–899
A Humanized Aldolase Antibody for Selective
Chemotherapy and Adaptor Immunotherapy
Christoph Rader*, James M. Turner, Andreas Heine, Doron Shabat
Subhash C. Sinha, Ian A. Wilson, Richard A. Lerner and
Carlos F. Barbas III*
The Skaggs Institute for
Chemical Biology and the
Department of Molecular
Biology, The Scripps Research
Institute, La Jolla, CA 92037
USA
Mouse monoclonal antibody 38C2 is the prototype of a new class of catalytic antibodies that were generated by reactive immunization. Through
a reactive lysine, 38C2 catalyzes aldol and retro-aldol reactions using the
enamine mechanism of natural aldolases. In addition to its remarkable
versatility and efficacy in synthetic organic chemistry, 38C2 has been
used for the selective activation of prodrugs in vitro and in vivo and
thereby emerged as a promising tool for selective chemotherapy. Adding
another application with relevance for cancer therapy, designated adaptor
immunotherapy, we have recently shown that 38C2 can be chemically
programmed to target tumors by formation of a covalent bond of defined
stoichiometry with a b-diketone derivative of an integrin avb3 targeting
RGD peptidomimetic. However, a major limitation for the transition
from preclinical to clinical evaluation is the human anti-mouse antibody
immune response that mouse 38C2 is likely to elicit in a majority of
patients after single administration. Here, we report the humanization
of mouse 38C2 based on rational design guided by molecular modeling.
In essence, the catalytic center of mouse 38C2, which encompasses a
deep hydrophobic pocket with a reactive lysine residue at the bottom,
was grafted into a human antibody framework. Humanized 38C2 IgG1
was found to bind to b-diketone haptens with conserved affinities and
revealed strong catalytic activity with identical kcat and slightly higher KM
values compared to the parental mouse antibody. Furthermore, humanized 38C2 IgG1 revealed efficiency in prodrug activation and chemical
programming comparable to the parental mouse antibody.
q 2003 Elsevier Ltd. All rights reserved.
*Corresponding authors
Keywords: catalytic antibody; aldolases; prodrug activation; chemical
programming; antibody humanization
Introduction
Present addresses: C. Rader, Experimental
Transplantation and Immunology Branch, Center for
Cancer Research, National Cancer Institute, National
Institutes of Health, 9000 Rockville Pike, Bethesda, MD
20892-1907, USA; A. Heine, Department of
Pharmaceutical Chemistry, Phillips University Marburg,
Merbacher Weg 6, 35032 Marburg, Germany; D. Shabat,
Department of Organic Chemistry, School of Chemistry,
Raymond and Beverly Sackler Faculty of Exact Sciences,
Tel Aviv University, Tel Aviv 69978, Israel.
Abbreviations used: mAb, monoclonal antibody; V,
variable domain; C, constant domain; CDR,
complementarity determining region; FR, framework
region; SDS, sodium dodecyl sulfate; PAGE,
polyacrylamide gel electrophoresis.
E-mail addresses of the corresponding authors:
raderc@mail.nih.gov; carlos@scripps.edu
Reactive immunization differs from conventional immunization in that reactive rather than
inert haptens are used as immunogens. Thus, in a
sense one immunizes with a chemical reaction
rather than a chemical.1,2 The most well-known
products of reactive immunization are catalytic
antibodies that mechanistically mimic natural
aldolases with similar rate accelerations (kcat/kuncat)
and catalytic proficiencies (kcat/kuncatKM).3 – 6 With
the intention of inducing antibodies with aldolase
activity, these catalytic antibodies were generated
by using haptens with b-diketone functionalities
as reactive immunogens. The b-diketone derivatives induced the immune selection of antibodies
with an antigen-binding site whose main feature
0022-2836/$ - see front matter q 2003 Elsevier Ltd. All rights reserved.
890
is a lysine residue that is deeply buried, yet accessible at the base of a hydrophobic pocket. The
hydrophobic microenvironment disfavors the
protonation of the 1-amino group of the lysine residue, thereby reducing its pKa and allowing a
covalent interaction with b-diketone derivatives to
form an enaminone.4 The aldolase activity is based
on the covalent interaction of the 1-amino group
of the reactive lysine residue with a donor ketone
substrate to form an enamine that subsequently
reacts with an acceptor aldehyde substrate to
form, after hydrolysis of the imine, an enantiomerically pure b-hydroxy ketone as the aldol
product. Both aldol and retro-aldol reactions are
catalyzed by aldolase antibodies. Unlike natural
aldolase enzymes, which are restricted in terms of
substrate specificity, aldolase antibodies are very
broad in scope, accepting hundreds of different
substrates. Another key feature of aldolase antibodies is their substrate orthogonality to natural
aldolase enzymes. Typically, natural aldolase
enzymes use highly polar phosphorylated sugar
derivatives, whereas most aldolase antibody substrates are hydrophobic. In particular, tertiary
aldols, which are excellent substrates for some
aldolase antibodies,7 are not acted on by natural
aldolase enzymes.
Both substrate tolerance and substrate orthogonality have been fundamental for the development
of a prodrug activation concept designed for
aldolase antibodies. In this concept, the aldolase
antibody catalyzes a tandem retro-aldol-b-elimination of b-heterosubstituted tertiary aldols. This
reaction sequence has proven to be well suited for
the activation of prodrugs that were derived from
drugs through appropriate modification of amino
or hydroxyl groups. Substrate tolerance and substrate orthogonality have allowed for the application of this concept to a variety of endogenously
stable prodrugs that are selectively activated by
aldolase antibodies.8 Using aldolase antibody
38C2, we have shown the versatility and efficacy
of our prodrug activation concept in vitro8 and in
vivo.9 Our goal is to combine catalytic antibodies
with tumor targeting devices that allow the selective application of chemotherapy to the tumor. In
addition to being able to activate prodrugs that
cannot be activated by endogenous enzymes, an
important advantage of using a catalytic monoclonal antibody (mAb) rather than an enzyme10 for
prodrug activation is the feasibility of antibody
humanization. Like non-human enzymes, nonhuman antibodies are highly immunogenic in
humans, limiting their potential use for selective
chemotherapy if repeated administration is necessary. To reduce their immunogenicity, non-human
antibodies have been humanized using strategies
that are based on rational design, in vitro evolution,
or a combination of both.11 In an effort to conserve
rate acceleration, catalytic proficiency, and scope
between mouse 38C2 (m38C2) and humanized
38C2 (h38C2), we chose an entirely rational design
strategy based on molecular modeling.
Humanized Aldolase Antibody
Designated adaptor immunotherapy, we recently
introduced a new concept based on equipping
small synthetic molecules with both effector
activity and long serum half-life of an aldolase
antibody molecule.12 We proposed that a blend of
the chemical diversity of small synthetic molecules
with the immunological characteristics of a generic
antibody molecule would lead to therapeutic
agents with superior properties. As a prototype,
we developed a targeting device that is based on
the formation of a covalent bond of defined stoichiometry between a b-diketone derivative of an
integrin avb3 targeting RGD peptidomimetic and
the reactive lysine of m38C2. The resulting complex was shown to (i) spontaneously assemble
in vitro and in vivo, (ii) selectively target m38C2 to
the surface of cells expressing integrins avb3,
(iii) dramatically increase the circulatory half-life
of the RGD peptidomimetic, (iv) effectively reduce
tumor growth in animal models of human Kaposi’s
sarcoma and colon cancer.12 In general, the chemical programming of aldolase antibodies through
b-diketone derivatives of drugs could be useful
for a multitude of therapeutic applications, ranging
from a mere prolongation of the circulatory halflife to tumor targeting. The availability of a
humanized aldolase antibody that can be chemically programmed is a key step toward clinical
evaluation of adaptor immunotherapy.
Results
Humanization
Human Vk gene DPK-9 and human Jk gene JK4
were used as frameworks for the humanization of
the k light-chain variable domain, and human VH
gene DP-47 and human JH gene JH4 were used as
frameworks for the humanization of the heavychain variable domain of m38C2. Related frameworks from the same light and heavy-chain subgroups, VkI and VHIII, respectively, were used in
the humanization of other mouse mAbs,13 – 15
including humanized mouse mAb Herceptin, an
approved drug for metastatic breast cancer overexpressing Herceptin’s antigen HER2/neu.16
Combinations of light-chains derived from germline DPK-9 with heavy-chains derived from germline DP-47 are frequently found in native human
antibodies17 and have also been used as template
for synthetic human antibody libraries.18 All complementarity determining region (CDR) residues
as defined by Kabat et al.,19 as well as defined
framework residues in both light-chain and
heavy-chain variable domain, were grafted from
m38C2 onto the human framework. The selection
of grafted framework residues was based on the
crystal structure of mouse mAb 33F12,4 which
shares with m38C2 92% amino acid sequence identity in the variable domains and identical CDR
lengths.6 Furthermore, both 33F12 and m38C2
have similar catalytic activity.3,20 Our assortment
891
Humanized Aldolase Antibody
of grafted framework residues consisted of five
residues in the light-chain and seven residues in
the heavy-chain (Figure 1) and encompassed residues that are likely to participate directly or
indirectly in the catalytic activity of m38C2. These
include the reactive lysine of m38C2, LysH93,
which is positioned in framework region 3 (FR3)
of the heavy-chain. Six residues, SerH35, ValH37,
TrpH47, TyrH95, TrpH103, and PheL98, which are
conserved between mouse mAbs 33F12 and 38C2,
are within a 5-Å radius of the 1 amino group of
LysH93.6 These residues were also conserved in
the humanization. LysH93 lies at the bottom of a
highly hydrophobic substrate-binding site of
mouse mAbs 33F12 and 38C2. In addition to CDR
residues, a number of framework residues line
this pocket.4 Among these, LeuL37, GlnL42,
SerL43, ValL85, PheL87, ValH5, SerH40, GluH42,
GlyH88, IleH89, and ThrH94 were grafted onto
the human framework (Figure 1). As these framework residues line the deep hydrophobic substrate-binding site rather than being exposed on
the antibody surface, their grafting is not likely to
increase the immunogenicity of the humanized
antibody. In fact, in a procedure termed
resurfacing, mouse mAbs have been humanized
by replacing only a small set of surface accessible
residues.21 Models of the variable domains of
h38C2 (Figure 2) were calculated based on the
crystal structure of 33F12 Fab (PDB 1AXT).4 The
structures of 33F12 and h38C2 were virtually
indistinguishable with the exception of a slight
shift in the C-terminal portion of the CDR1 loop of
the light-chain encompassing amino acid residues
AsnL31d, ThrL31e, PheL32, LeuL33, and AsnL34
in 33F12 and SerL31d, ProL31e, TyrL32, LeuL33,
and AsnL34 in h38C2.
Figure 2. Ribbon diagram of the modeled variable
domains of h38C2. Shown is a top view of the active
site. All residues belonging to the complementarity
determining regions, as well as the 12 framework region
residues that were conserved between m38C2 and
h38C2 but differed from the human germlines, are
shown in green. The side-chain of reactive LysH93 is
shown in blue. The Figure was generated with INSIGHT
II software (Accelrys).
Expression
By fusing the humanized variable domains to
human constant domains Ck and Cg11, h38C2 was
initially generated as Fab expressed in Escherichia
coli. Based on preliminary binding and activity
assays, purified h38C2 Fab was found to be comparable to m38C2 Fab generated from m38C2
IgG2a3 by papain digestion (data not shown). We
then converted h38C2 from Fab to IgG using our
recently described vector PIGG engineered for
Figure 1. Amino acid sequence alignment of the variable domains of m38C2, h38C2, and human germlines. Framework regions (FR) and complementarity determining regions (CDR) as defined by Kabat et al.19 are indicated. Asterisks
mark differences between m38C2 and h38C2 or between h38C2 and the human germlines. Boxed asterisks mark
the 12 framework region residues that were conserved between m38C2 and h38C2 but differed from the human
germlines.
892
Humanized Aldolase Antibody
Figure 4. Enaminone formation. h38C2 showed the
characteristic enaminone absorbance at lmax ¼ 318 nm
after incubation with b-diketone 2. Recombinant human
anti-HIV-1 gp120 mAb b12 IgG1 served as negative
control.
human IgG1 expression in mammalian cells.22
Supernatants from transiently transfected human
293T cells were subjected to affinity chromatography on recombinant protein A, yielding
approximately 1 mg/l h38C2 IgG1.
Binding assays
Compounds used for binding and activity assays
are shown in Figure 3. m38C2 was first identified3
by its ability to react covalently with b-diketone 2
to form a stable enaminone with a UV absorbance
at lmax ¼ 318 nm. Like m38C2 IgG, h38C2 IgG
showed the characteristic enaminone absorbance
after incubation with b-diketone 2 (Figure 4). As a
negative control, recombinant human anti-HIV-1
gp120 mAb b1223 with the same IgG1 isotype as
h38C2 but without reactive lysine, did not reveal
enaminone absorbance after incubation with
b-diketone 2. For a quantitative comparison of the
binding of b-diketones to m38C2 and h38C2, we
used a competition ELISA. The antibodies
were incubated with increasing concentrations of
b-diketones 2 and 3 and assayed against immobilized BSA-conjugated b-diketone 1. The apparent
Figure 3. Compounds used for the characterization
of h38C2. A, b-diketones JW (1), pentane-2,4-dione (2),
6-phenyl-hexane-2,4-dione (3). B, Chromogenic and
fluorogenic retro-aldol substrates (S)-cynol (4), methodol
(6), and tert-methodol (8), which are converted to the
corresponding aldehydes 5 and 7 and ketone 9, respectively. C, The doxorubicin prodrug developed for this
study is prodoxorubicin 10. D, Prodoxorubicin 10 acti-
vation by a sequential retro-aldol-b-elimination reaction
catalyzed by aldolase antibody 38C2 followed by a
spontaneous reaction sequence of decarboxylation,
N,N0 -dimethyl urea cyclization, ortho-methoxy quinone
methide formation (subsequently reacting with water to
yield 4-hydroxymethyl-2-methoxy-phenol), and another
decarboxylation to release the free amine. E, RGD
peptidomimetic with (13) and without (12) b-diketone
functionality.
893
Humanized Aldolase Antibody
properties for mouse and humanized antibody
(Figure 5).
Activity assays
Figure 5. Binding of b-diketones to m38C2 and h38C2.
For a quantitative comparison of the binding of b-diketones to m38C2 and h38C2, the antibody was incubated
with increasing concentrations of b-diketone 2 (A) and 3
(B) and assayed for binding to immobilized BSA-conjugated b-diketone 1. Apparent equilibrium dissociation
constants derived from this competition ELISA are
given.
equilibrium dissociation constants were 38 mM
(m38C2) and 7.6 mM (h38C2) for b-diketone 2
and 0.43 mM (m38C2) and 1.0 mM (h38C2) for
b-diketone 3, revealing similar b-diketone binding
To investigate whether the conserved binding
properties of the humanized antibody translate
onto the level of catalytic activity, we studied the
Michaelis– Menten kinetics for several antibody
catalyzed retro-aldol reactions that (i) represent the
broad scope of substrate specificity and (ii) are
relevant for our prodrug activation concept. Two
secondary aldol sensors,24 the chromogenic retroaldol substrate (S)-cynol (4) and the fluorogenic
retro-aldol substrate methodol (6), revealed strong
catalytic activity of h38C2 with the same kcat,
although a two- to threefold higher KM compared
to m38C2 was noted (Table 1). Moreover, by
accepting (S)- but not (R)-cynol as retro-aldol
substrate, h38C2 revealed the same enantioselectivity as m38C2 (data not shown). Most
importantly, h38C2 was found to be capable of catalyzing retro-aldol reactions from tertiary aldol
substrates as revealed by the fluorogenic tertiary
aldol sensor24 tert-methodol (8). Tertiary aldols,
which have been demonstrated to be excellent
substrates for aldolase antibodies 38C2 and
33F12, are not known to be accepted by natural
enzymes and, thus, are ideal prodrug triggers to
facilitate selective activation by aldolase
antibodies.8 Interestingly, both m38C2 and h38C2
exhibited higher rate (higher kcat), but lower binding (higher KM), toward tertiary aldol substrate
tert-methodol when compared with secondary
aldol substrate methodol (Table 1). Taken
together, these data show that h38C2 not only
exhibits strong catalytic activity with identical kcat
and slightly higher KM values, but also displays
Table 1. Kinetic parameters for antibody-catalyzed retro-aldol reactions
Substrate
Antibody
kcat (min21)a
KM (mM)a
kcat/kuncatb
(kcat/KM)/kuncat
m38C2
h38C2
1.1
1.2
28
63
5.9 £ 103
6.8 £ 103
2.2 £ 108
1.1 £ 108
m38C2
h38C2
0.10
0.092
6.1
19
1.0 £ 105
9.2 £ 104
1.7 £ 1010
4.8 £ 109
m38C2
h38C2
0.36
0.36
14
49
2.4 £ 105
2.4 £ 105
1.8 £ 1010
4.9 £ 109
a
The kinetic data of kcat and KM (per antibody active site) were obtained in PBS at pH 7.4 by fitting experimental data to non-linear
regression analysis using KaleidaGraph software.
b
kuncat from Refs. 6 and 24.
894
Humanized Aldolase Antibody
Figure 6. Prodrug activation. Growth inhibition of Kaposi’s sarcoma cell line SLK by 10 mM prodoxorubicin 10 in the
presence of 0 mM, 0.1 mM, and 1 mM m38C2 or h38C2. Bars indicate SD; n ¼ 3:
the same subtle differences in substrate specificity
as m38C2.
Prodrug activation
Addressing selective chemotherapy, we next
analyzed whether h38C2 is capable of prodrug
activation by catalyzing a tandem retro-aldol
b-elimination reaction that activates prodrugs
designed for aldolase antibodies.8 The synthesized
doxorubicin prodrug 10 introduces a self-immolative spacer between the primary amine group of
doxorubicin and the b-heterosubstituted tertiary
aldol group (Figure 3). On the basis of considerations of the 10 Å depth of the hydrophobic-binding
site, a similarly extended trigger was used in
the synthesis of a previously reported etoposide
prodrug.9 In addition to the N,N0 -dimethyl ethylenediamine, which spontaneously cyclizes to
N,N0 -dimethyl urea,9 the self-immolative linker of
prodoxorubicin 10 contains an ortho-methoxy
phenol carbamate group, which spontaneously
forms an ortho-methoxy quinone methide25 (Figure
3). To compare prodrug activation by m38C2 and
h38C2, human Kaposi’s sarcoma cell line SLK22
was subjected to 10 mM of prodoxorubicin 10 in
the presence of 0 mM, 0.1 mM, and 1 mM m38C2 or
h38C2 and growth inhibition was quantified after
72 hours. Whereas the mouse antibody revealed a
stronger prodrug activation capacity at a prodrug:
mAb ratio of 1:0.01, m38C2 and h38C2 showed
comparable capacity at a prodrug: mAb ratio of 1:
0.1 (Figure 6). Control studies with 1 mM m38C2
or h38C2 alone did not reveal any growth inhibition (data not shown). A stronger prodrug activation capacity of m38C2 was also observed at
lower prodrug concentrations (data not shown),
which conceivably is a consequence of its two- to
threefold lower KM compared to h38C2.
Chemical programming
We have recently shown that a targeting module
derivatized with a 1,3-diketone linker can program
the specificity of m38C2 through reaction with its
catalytic lysine residue.12 As a prototype in that
study we synthesized SCS-873 (13), a 1,3-diketone
derivative of RGD peptidomimetic 12 (Figure 3),
which mediated selective targeting of m38C2 to
cells expressing integrin avb3. To compare chemical
programmability, we analyzed the binding of
m38C2 and h38C2 to integrin avb3 expressing
human Kaposi’s sarcoma SLK cells in the presence
of 13. As shown in Figure 7, both mouse and
humanized antibody were effectively programmed
for cell surface targeting. A molar excess of 12,
which binds to integrin avb3 but not to the aldolase
antibody, competed with cell binding.
Discussion
The humanization of a catalytic antibody
encounters challenges far beyond established
humanization strategies due to the fact that substrate binding, catalysis, and product release have
to be preserved in the process. This requires a comprehensive knowledge of all structural parameters
that contribute to the antibody’s catalytic activity.
On the other hand, a successful humanization of a
catalytic antibody validates our understanding of
the underlying molecular machinery.
Based on the proposed mechanism for its
aldolase activity, the active site of m38C2 was
grafted into a generic framework of human variable domains and linked to human constant
domains for whole antibody assembly. The resulting h38C2 IgG1 was expressed in mammalian
cells, purified, and analyzed for b-diketone
binding, enaminone formation, catalytic activity,
prodrug activation, and chemical programming.
Collectively, our studies demonstrate that binding
and catalytic activity of m38C2 were well conserved during the process of humanization,
making h38C2 an excellent tool for a clinical
evaluation of our recently introduced concepts for
selective chemotherapy8,9 and adaptor immunotherapy.12 Moreover, the fact that we were able to
895
Humanized Aldolase Antibody
Figure 7. Chemical programming. Flow cytometry
histograms showing the binding of m38C2 (A) and
h38C2 (B) to integrin avb3 expressing Kaposi’s sarcoma
cell line SLK in the presence of a twofold molar excess
of b-diketone 13, a RGD peptidomimetic that programs
m38C2 and h38C2 by covalent binding to the reactive
lysine (bold line, right). FITC-conjugated goat antimouse or goat anti-human polyclonal antibodies were
used for detection. m38C2 and h38C2 alone (dotted line,
left) was indifferent from the background signal of secondary antibodies alone (not shown). In the presence of
a 25-fold molar excess of competitor 12, a RGD peptidomimetic without b-diketone functionality, cell surface
binding was diminished (fine line, center). The y axis
gives the number of events in linear scale, the x axis the
fluorescence intensity in logarithmic scale.
rationally redesign aldolase antibody 38C2 based
on the crystal structure of the related aldolase
antibody 33F12, strongly supports our proposed
molecular mechanism for aldolase activity.4
Considering our detailed structural information
about antibody 33F124 and in regard of our
assumption that a highly conserved active site is
essential to maintain rate acceleration, catalytic
proficiency, and scope of reactions catalyzed by
m38C2, we chose a rational design strategy to
build h38C2. Provided the antibody structure is
known, humanization by rational design as pioneered by Winter and colleagues26 can be a favorable alternative to humanization by in vitro evolution.11 This is generally true for the humanization
of catalytic antibodies if the in vitro evolution is
based on substrate binding rather than on catalytic
activity.27,28 Although selection strategies based on
catalytic activity have been suggested,29 these are
generally confined to a single substrate and, thus,
clearly limited with respect to maintaining a broad
scope in substrate specificity. Furthermore, using
defined human framework regions can be of
advantage in achieving high expression yields,
which is critical for a fast transition from preclinical to clinical evaluations. As a consequence
of rational design, further improvements of the
humanized antibody can be assessed by mutating
individual framework residues. With respect to
h38C2, subsequent framework fine tuning rounds
could pinpoint additional mouse residues whose
grafting into the human framework might further
improve the conservation of catalytic activity in
terms of KM.
In addition to providing a tool of clinical relevance, the generation of recombinant aldolase
antibody h38C2 is an important step toward the
engineering of bifunctional antibody constructs
that equip the catalytic antibody with a targeting
device for selective chemotherapy. For example,
the h38C2 heavy-chain encoding expression cassette of vector PIGG could be extended by adding
an scFv encoding cDNA downstream of the CH3
exon,22 yielding a bifunctional and tetravalent
IgG1-scFv construct.30 The scFv module of the
recombinant h38C2 IgG1-scFv construct would
serve as targeting device that permits selective
binding to antigens expressed on the surface of
target cells, thereby allowing localized prodrug
activation by h38C2. As an alternative and more
generic approach, recombinant h38C2 IgG1-avidin
constructs31 would allow a stoichiometrically and
structurally defined conjugation of h38C2 to a
variety of biotinylated targeting devices. With
respect to adaptor immunotherapy,12 the availability of recombinant h38C2 provides a means of
tuning circulatory half-life, valency, biodistribution, and effector activities of the chemically
programmed antibody through immunoglobulin
isotype switching.
Materials and Methods
Molecular modelling
A molecular model of h38C2 was constructed by
homology modeling using the crystal structure of a
related aldolase antibody, mouse 33F12 Fab (Protein
Data Bank ID: 1AXT), as a template. The crystal structure
of mouse 33F12 Fab was previously determined at a
resolution of 2.15 Å.4 Alignment of mouse 33F12 and
38C2 amino acid sequences using the HOMOLOGY
module within INSIGHT II software (Accelrys) confirmed that both sequences are highly homologous.
They differ from each other by 19 out of 226 amino acid
residues in the two variable domains, and their CDRs
share the same lengths.6 In addition to the high sequence
homology, both structures exhibit considerable structural
similarity, as observed by a low-resolution crystal
structure of 38C2 (A.H. & I.A.W., unpublished results).
Residues in the model were mutated to conform to the
h38C2 amino acid sequence and side-chains were placed
based on standard rotamers. This model was then
minimized with the DISCOVER module in INSIGHT II
using 100 steps each of steepest descent minimization
followed by conjugate gradient minimization.
896
Construction of h38C2 Fab
The sequences of the variable light and heavy-chain
domains of m38C26 as well as the sequences of human
germline sequences DPK-9, JK4, DP-47, and JH4 (V
BASE)† were used to design overlapping oligonucleotides for the synthetic assembly of humanized Vk and
VH, respectively. N-glycosylation sites with the sequence
NXS/T as well as internal restriction sites HindIII, Xba I,
Sac I, Apa I, and Sfi I were avoided. PCR was carried out
by using the Expand High Fidelity PCR System (Roche
Molecular Systems). The humanized Vk oligonucleotides
were: L flank sense;32 h38C2L1 (sense; 50 -GAGCTCCAG
ATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAG
GTGACCGCGTCACCATCACTTG-30 ); h38C2L2 (antisense; 50 -ATTCAGATATGGGCTGCCATAAGTGTGCAG
GAGGCTCTGACTGGAGCGGCAAGTGATGGTGACGC
GGTC-30 ); h38C2L3 (sense; 50 -TATGGCAGCCCATATCT
GAATTGGTATCTCCAGAAACCAGGCCAGTCTCCTAA
GCTCCTGATCTAT-30 ); h38C2L4 (antisense; 50 -CTGAA
ACGTGATGGGACACCACTGAAACGATTGGACACTT
h38C2L5
TATAGATCAGGAGCTTAGGAGACTG-30 );
(sense; 50 -AGTGGTGTCCCATCACGTTTCAGTGGCAG
TGGTTCTGGCACAGATTTCACTCTCACCATCAGCAG
TCTGCAACCTGAAGATTTTGCAGTG-30 );
h38C2L6
(antisense; 50 -GATCTCCACCTTGGTCCCTCCGCCGAA
AGTATAAGGGAGGTGGGTGCCCTGACTACAGAAGT
ACACTGCAAAATCTTCAGGTTGCAG-30 ); L antisense
flank.32 The humanized VH oligonucleotides were: H
flank sense;32 h38C2H1 (sense; 50 -GAGGTGCAGCTG
GTGGAGTCTGGCGGTGGCTTGGTACAGCCTGGCG
GTTCCCTGCGCCTCTCCTGTGCAGCCTCTGGCT-30 );
h38C2H2 (antisense; 50 -CTCCAGGCCCTTCTCTGGAG
ACTGGCGGACCCAGCTCATCCAATAGTTGCTAAAG
GTGAAGCCAGAGGCTGCACAGGAGAG-30 ); h38C2H3
(sense; 50 -TCTCCAGAGAAGGGCCTGGAGTGGGTCTCAGAGATTCGTCTGCGCAGTGACAACTACGCCACG
CACTATGCAGAGTCTGTC-30 ); h38C2H4 (antisense;
50 -CAGATACAGCGTGTTCTTGGAATTGTCACGGGAG
ATGGTGAAGCGGCCCTTGACAGACTCTGCATAGTG
CGTG-30 ); h38C2H5 (sense; 50 -CAATTCCAAGAACAC
GCTGTATCTGCAAATGAACAGCCTGCGCGCCGAGG
ACACGGGCATTTATTACTGTAAAACG-30 ); h38C2H6
(antisense; 50 -TGAGGAGACGGTGACCAGGGTGCCCT
GGCCCCAGTAGCTGAAACTGTAGAAGTACGTTTTAC
AGTAATAAATGCCCGTG-30 ); H flank antisense.32
Following assembly, humanized Vk and VH were fused
to human Ck and Cg11, respectively, and the resulting
light-chain and heavy-chain fragment were fused
and Sfi I-cloned into phagemid vector pComb3X as
described.32,33 To enrich for clones with the correct
h38C2 sequence, Fab were displayed on phage and
selected by one round of panning against the immobilized b-diketone 1 (JW) conjugated to BSA.3 Soluble Fab
were produced from single clones and tested for binding
to immobilized JW-BSA by ELISA using donkey antihuman F(ab0 )2 polyclonal antibodies conjugated to
horseradish peroxidase (Jackson ImmunoResearch
Laboratories) as secondary antibody. Light-chain and
heavy-chain encoding sequences of positive clones
were analyzed by DNA sequencing using the primers
OMPSEQ and PELSEQ,33 respectively, to confirm the
assembled Vk and VH sequences of h38C2.
† http://www.mrc-cpe.cam.ac.uk/vbase
Humanized Aldolase Antibody
Construction, production, and purification of
h38C2 IgG1
The recently described vector PIGG22 was used for
mammalian expression of h38C2 IgG1. Using primers
PIGG-h38C2H (sense; 50 -GAGGAGGAGGAGGAGGAG
CTCACTCCGAGGTGCAGCTGGTGGAGTCTG-30 ) and
GBACK,33 the VH coding sequence from h38C2 Fab in
phagemid vector pComb3X was amplified, digested
with Sac I and Apa I, and cloned into the appropriately
digested vector PIGG. Using primers PIGG-h38C2L
(sense; 50 -GAGGAGGAGGAGGAGAAGCTTGTTGCTC
TGGATCTCTGGTGCCTACGGGGAGCTCCAGATGAC
CCAGTCTCC-30 ) and LEADB,33 the light-chain coding
sequence from h38C2 Fab in phagemid vector pComb3X
was amplified, digested with HindIII and Xba I, and
cloned into the appropriately digested vector PIGG that
already contained the h38C2 heavy-chain. Intermediate
and final PIGG vector constructs were amplified in
E. coli strain SURE (Stratagene) and prepared with the
QIAGEN Plasmid Maxi Kit. h38C2 IgG1 were produced
from the prepared final PIGG vector construct by
transient transfection of human 293T cells using
Lipofectamine 2000 (Invitrogen). Transfected cells were
maintained in GIBCO 10% (v/v) ultra-low IgG (, 0.1%)
FCS (Invitrogen) in RPMI 1640 (Hyclone) for two weeks.
During this time, the medium was collected and
replaced three times. The collected medium was subjected to affinity chromatography on a recombinant
Protein A HiTrap column (Amersham Biosciences). This
purification step yielded 2.45 mg h38C2 IgG1 from
2300 ml collected medium as determined by measuring
the optical density at 280 nm using an Eppendorf
BioPhotometer. Following dialysis against PBS in a
Slide-A-Lyzer 10K dialysis cassette (Pierce), the antibody
was concentrated to 760 mg/ml using an Ultrafree-15
Centrifugal Filter Device (UFV2BTK40; Millipore), and
sterile filtered through a 0.2-mm Acrodisc 13 MM S-200
Syringe Filter (Pall). The final yield was 2.13 mg (87%).
Purified h38C2 IgG1 was confirmed by non-reducing
SDS-PAGE followed by Coomassie Blue staining.
Compounds
b-Diketones 1 (JW) and 3 were described.3,34
b-Diketone 2 was purchased from Sigma-Aldrich.
Synthesis of racemic aldols 6 and 8 was described.24
(S)-cynol (4) was synthesized by an antibody catalyzed
kinetic resolution of the racemic aldol.35 Synthesis of
prodoxorubicin 10 will be described elsewhere. Synthesis
of RGD peptidomimetics 12 and 13 was described.12
Enaminone formation
Antibody (h38C2 IgG1 or b12 IgG1) was added to
b-diketone 2 to a final concentration of 25 mM antibodybinding site and 125 mM b-diketone. This mixture was
incubated at room temperature for ten minutes before a
UV spectrum was acquired on a SpectraMax Plus 384
UV plate reader (Molecular Devices) using SOFTmax
Pro software (version 3.1.2).
Binding assays
Unless noted otherwise, all solutions were phosphate
buffered saline (pH 7.4). A two times solution of either
b-diketone 2 or 3 (50 ml) was added to 50 ml of the antibody (either h38C2 or m38C2) and allowed to incubate
897
Humanized Aldolase Antibody
at 37 8C for one hour. Solutions were mixed by pipetting.
Final concentrations of antibody were 0.4 – 8 nM
antibody-binding site, and final concentrations of
b-diketones 2 and 3 were 1029 M to 1022 M and 10210 M
to 1024 M, respectively. Each well of a Costar 3690 96well plate (Corning) was coated with 100 ng of the BSA
conjugate3 of b-diketone 1 in TBS. Wells were then
blocked with 3% (w/v) BSA in TBS. Then, 50 ml of the
antibody/b-diketone mixture was added, followed by
50 ml of a 1:1,000 dilution of either goat anti-human Fc
IgG polyclonal antibodies (Pierce) or rabbit anti-mouse
Fc IgG polyclonal antibodies (Jackson ImmunoResearch
Laboratories) conjugated to horseradish peroxidase.
This was followed by 50 ml ABTS substrate solution.33
Between each addition, the plate was covered, incubated
at 37 8C for one hour, and then washed five times
with deionized water. The absorbance at 405 nm was
monitored as described above until the reaction with no
b-diketone reached an appropriate value ð0:5 , A405 ,
1:0Þ: For each well, the fractional inhibition of ELISA
signal ðvi Þ was calculated using equation (1):
vi ¼ ðA0 2 Ai Þ=ðA0 Þ
ð1Þ
where A0 is the ELISA absorbance obtained in the
absence of b-diketone and Ai is the absorbance obtained
in the presence of b-diketone. For monovalent-binding
proteins, the fraction of antibody bound to soluble
b-diketone ( f) is equal to vi. However, the IgG antibody
is bivalent, and the ELISA signal is inhibited only by the
presence of doubly liganded antibody and not by monovalent binding. Therefore, the Stevens correction for a
bivalent antibody was used:36
fi ¼ ðvi Þ1=2
ð2Þ
The following relationship was used to determine the
apparent equilibrium dissociation constant (modified
from Ref. 37):
fi ¼ fmin þ ðfmax 2 fmin Þð1 þ KD =a0 Þ21
ð3Þ
where a0 corresponds to the total b-diketone concentration, KD is the equilibrium dissociation constant, and
fmin and fmax represent the experimentally determined
values when the antibody-binding sites are unoccupied
or saturated, respectively. Because this equation is only
valid when the KD values are at least ten times higher
than the antibody concentration, it was verified that
the KD values determined from equation (3) met this
criterion. Data were fit using a non-linear least-squares
fitting procedure of KaleidaGraph (version 3.0.5,
Abelbeck software) with KD, fmax, and fmin as the adjustable parameters and normalized using equation (4):
fnorm ¼ ðfi 2 fmin Þ=ðfmax 2 fmin Þ
ð4Þ
Activity assays
All solutions were phosphate buffered saline (pH 7.4).
The reaction was initiated by adding 50 ml of a two times
antibody solution (1 mM binding sites) to 50 ml of a two
times substrate solution. Initial rates were measured
and fit to the Michaelis – Menten equation, with kcat and
KM as adjustable parameters (KaleidaGraph, version
3.0.5, Abelbeck Software). For aldol substrate 4, initial
rates were determined by monitoring the UV absorbance
of the product 5 at lmax ¼ 400 nm.24 UV measurements
were acquired as described above. For aldol substrates 6
and 8, initial rates were determined by monitoring fluorescence of their respective products 7 and 9 (lext ¼ 330
nm, lem ¼ 452 nm).24 Fluorescence was measured on a
SpectraMax Gemini spectro-fluorometer plate reader
(Molecular Devices) using SOFTmax Pro software
(Version 2.6.1).
Prodrug activation
Inhibition of cell growth by a combination of prodoxorubicin 10 and m38C2 or h38C2 was analyzed
using a described assay.8 Briefly, cells of the Kaposi’s
sarcoma cell line SLK22 were plated in triplicates at a
density of 5000 cells per well in a 96-well tissue culture
plate and maintained in 10% (v/v) fetal calf serum in
RPMI 1640 medium. After 24 hours, the medium was
replaced by fresh 10% fetal calf serum in RPMI 1640
medium containing 10 mM of prodoxorubicin 10 mM
and 0 mM, 0.1 mM, or 1 mM m38C2 or h38C2. The cells
were lysed 72 hours after drug addition, and the activity
of the released cytoplasmic enzyme lactate dehydrogenase was detected in a colorimetric assay as described.8
Chemical programming
m38C2/SCS-873 and h38C2/SCS-873 complexes were
formed by incubating 3.3 mM (500 mg/ml) m38C2 or
h38C2 with 6.6 mM (5.8 mg/ml) SCS-873 (13) in 50 ml
metal buffer (25 mM Tris – HCl (pH 7.4), 137 mM NaCl,
1.25 mM KCl, 1 mM MgCl2, 1 mM CaCl2) for five hours
at room temperature. Kaposi’s sarcoma SLK cells were
detached by brief trypsinization with 0.25% (w/v)
trypsin, 1 mM EDTA, washed with 10% fetal calf serum
in RPMI 1640 medium, and resuspended at a concentration of 106 cells/ml in flow cytometry metal buffer
(1% (w/v) BSA, 25 mM Hepes, 0.03% (w/v) NaN3 in
metal buffer, pH 7.4). Aliquots of 100 ml containing 105
cells were distributed into wells of a V-bottom 96-well
plate (Corning) for indirect immunofluorescence staining
using a 1:20 dilution (25 mg/ml) of the preformed complexes in flow cytometry metal buffer supplemented
with 1 mM MnCl2 and a 1:100 dilution of FITC-conjugated goat anti-mouse or goat anti-human polyclonal
antibodies (Jackson ImmunoResearch Laboratories) in
the same buffer. Incubation with complexes was for one
hour and with secondary antibodies for 45 minutes at
room temperature. Flow cytometry was performed
using a FACScan instrument from Becton-Dickinson.
Acknowledgements
We thank John A. Neves, Sujatha Thundivalappil, and Roberta Fuller for excellent technical
assistance. This study was supported by a Howard
Hughes Predoctoral Fellowship (to J.M.T.), an
Investigator Award from the Cancer Research
Institute (to C.R.), and by National Institutes of
Health Grants CA 27489 (to C.F.B. III, I.A.W., &
R.A.L) and CA 94966 (to C.R.).
References
1. Lerner, R. A., Barbas, C. F., III & Janda, K. D. (1998).
Making enzymes. Harvey Lect. 92, 1– 40.
2. Tanaka, F. & Barbas, C. F., III (2002). Reactive
898
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
immunization: a unique approach to catalytic antibodies. J. Immunol. Methods, 269, 67 – 79.
Wagner, J., Lerner, R. A. & Barbas, C. F., III (1995).
Efficient aldolase catalytic antibodies that use the
enamine mechanism of natural enzymes. Science,
270, 1797– 1800.
Barbas, C. F., III, Heine, A., Zhong, G., Hoffmann, T.,
Gramatikova, S., Bjoernstedt, R. et al. (1997). Immune
versus natural selection: antibody aldolases with
enzymic rates but broader scope. Science, 278,
2085– 2092.
Zhong, G., Lerner, R. A. & Barbas, C. F. (1999).
Broadening the aldolase catalytic antibody repertoire
by combining reactive immunization and transition
state theory: new enantio- and diastereoselectivities.
Angew. Chem. Int. Ed. 38, 3738– 3741.
Karlström, A., Zhong, G., Rader, C., Larsen, N. A.,
Heine, A., Fuller, R. et al. (2000). Using antibody catalysis to study the outcome of multiple evolutionary
trials of a chemical task. Proc. Natl Acad. Sci. USA,
97, 3878– 3883.
List, B., Shabat, D., Zhong, G., Turner, J. M., Li, A.,
Bui, T. et al. (1999). A catalytic enantioselective route
to hydroxy-substituted quaternary carbon centers:
resolution of tertiary aldols with a catalytic antibody.
J. Am. Chem. Soc. 121, 7283– 7291.
Shabat, D., Rader, C., List, B., Lerner, R. A. & Barbas,
C. F., III (1999). Multiple event activation of a generic
prodrug trigger by antibody catalysis. Proc. Natl
Acad. Sci. USA, 96, 6925– 6930.
Shabat, D., Lode, H. N., Pertl, U., Reisfeld, R. A.,
Rader, C., Lerner, R. A. & Barbas, C. F., III (2001). In
vivo activity in a catalytic antibody-prodrug system:
antibody catalyzed etoposide prodrug activation for
selective chemotherapy. Proc. Natl Acad. Sci. USA,
98, 7528– 7533.
Springer, C. J. & Niculescu-Duvaz, I. (1997). Antibody-directed enzyme prodrug therapy (ADEPT): a
review. Advan. Drug Deliv. Rev. 26, 151–172.
Rader, C. (2001). Antibody libraries in drug and
target discovery. Drug Discov. Today, 6, 36 – 43.
Rader, C., Sinha, S. C., Popkov, M., Lerner, R. A. &
Barbas, C. F., III (2003). Chemically programmed
monoclonal antibodies for cancer therapy: adaptor
immunotherapy based on a covalent antibody catalyst. Proc. Natl Acad. Sci. USA, 100, 5396– 5400.
Carter, P., Presta, L., Gorman, C. M., Ridgway, J. B.,
Henner, D., Wong, W. L. et al. (1992). High level
Escherichia coli expression and production of a bivalent humanized antibody fragment. Proc. Natl Acad.
Sci. USA, 89, 4285– 4289.
Werther, W. A., Gonzalez, T. N., O’Connor, S. J.,
McCabe, S., Chan, B., Hotaling, T. et al. (1996).
Humanization of an anti-lymphocyte functionassociated antigen (LFA)-1 monoclonal antibody
and reengineering of the humanized antibody for
binding to rhesus LFA-1. J. Immunol. 157, 4986– 4995.
Presta, L. G., Chen, H., O’Connor, S. J., Chisholm, V.,
Meng, Y. G., Krummen, L. et al. (1997). Humanization of an anti-vascular endothelial growth factor
monoclonal antibody for the therapy of solid tumors
and other disorders. Cancer Res. 57, 4593– 4599.
Carter, P. (2001). Improving the efficacy of antibodybased cancer therapies. Nature Rev. Cancer, 1,
118 –129.
de Wildt, R. M., Hoet, R. M., van Venrooij, W. J.,
Tomlinson, I. M. & Winter, G. (1999). Analysis of
heavy and light chain pairings indicates that receptor
Humanized Aldolase Antibody
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
editing shapes the human antibody repertoire. J. Mol.
Biol. 285, 895– 901.
de Wildt, R. M., Mundy, C. R., Gorick, B. D. &
Tomlinson, I. M. (2000). Antibody arrays for highthroughput screening of antibody – antigen interactions. Nature Biotechnol. 18, 989– 994.
Kabat, E. A., Wu, T. T., Perry, H. M., Gottesman, K. S.
& Foeller, C. (1991). Sequences of Proteins of Immunological Interest, 5th edit., US Department of Health
and Human Services, Public Health Service, National
Institutes of Health, Bethesda, MD.
Hoffmann, T., Zhong, G., List, B., Shabat, D.,
Anderson, J., Gramatikova, S. et al. (1998). Aldolase
antibodies of remarkable scope. J. Am. Chem. Soc.
120, 2768– 2779.
Roguska, M. A., Pedersen, J. T., Keddy, C. A., Henry,
A. H., Searle, S. J., Lambert, J. M. et al. (1994).
Humanization of murine monoclonal antibodies
through variable domain resurfacing. Proc. Natl
Acad. Sci. USA, 91, 969– 973.
Rader, C., Popkov, M., Neves, J. A. & Barbas, C. F., III
(2002). Integrin avb3 targeted therapy for Kaposi’s
sarcoma with an in vitro evolved antibody. FASEB J.
16, 2000– 2002.
Burton, D. R., Pyati, J., Koduri, R., Sharp, S. J.,
Thornton, G. B., Parren, P. W. et al. (1994). Efficient
neutralization of primary isolates of HIV-1 by a
recombinant human monoclonal antibody. Science,
266, 1024– 1026.
List, B., Barbas, C. F., III & Lerner, R. A. (1998). Aldol
sensors for the rapid generation of tunable fluorescence by antibody catalysis. Proc. Natl Acad. Sci.
USA, 95, 15351– 15355.
Papot, S., Tranoy, I., Tillequin, F., Florent, J.-C. &
Gesson, J.-P. (2002). Design of selectively activated
anticancer prodrugs: elimination and cyclization
strategies. Curr. Med. Chem.: Anti-Cancer Agents, 2,
155– 185.
Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S. &
Winter, G. (1986). Replacing the complementaritydetermining regions in a human antibody with
those from a mouse. Nature, 321, 522– 525.
Baca, M., Scanlan, T. S., Stephenson, R. C. & Wells,
J. A. (1997). Phage display of a catalytic antibody to
optimize affinity for transition-state analog binding.
Proc. Natl Acad. Sci. USA, 94, 10063– 10068.
Tanaka, F., Lerner, R. A. & Barbas, C. F., III (2000).
Reconstructing aldolase antibodies to alter their
substrate specificity and turnover. J. Am. Chem. Soc.
122, 4835– 4836.
Gildersleeve, J., Janes, J., Ulrich, H., Yang, P., Turner,
J., Barbas, C. & Schultz, P. G. (2002). Development of
a genetic selection for catalytic antibodies. Bioorg.
Med. Chem. Letters, 12, 1691– 1694.
Coloma, M. J. & Morrison, S. L. (1997). Design and
production of novel tetravalent bispecific antibodies.
Nature Biotechnol. 15, 159– 163.
Shin, S. U., Wu, D., Ramanathan, R., Pardridge, W. M.
& Morrison, S. L. (1997). Functional and pharmacokinetic properties of antibody –avidin fusion proteins. J. Immunol. 158, 4797– 4804.
Rader, C., Ritter, G., Nathan, S., Elia, M., Gout, I.,
Jungbluth, A. A. et al. (2000). The rabbit antibody
repertoire as a novel source for the generation of
therapeutic human antibodies. J. Biol. Chem. 275,
13668– 13676.
Barbas, C. F. III, Burton, D. R., Scott, J. K. & Silverman, G. J. (2001). Phage Display: A laboratory Manual,
Humanized Aldolase Antibody
Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
34. Tanaka, F. & Barbas, C. F., III (2001). Phage display
selection of peptides possessing aldolase activity.
Chem. Commun., 769– 770.
35. Turner, J. M., Bui, T., Lerner, R. A., Barbas, C. F., III &
List, B. (2000). An efficient benchtop system for
multigram-scale kinetic resolutions using aldolase
antibodies. Chem. Eur. J. 6, 2772– 2774.
899
36. Stevens, F. J. (1987). Modification of an ELISA-based
procedure for affinity determination: correction
necessary for use with bivalent antibody. Mol. Immunol. 24, 1055– 1060.
37. Seligman, S. J. (1994). Influence of solid-phase antigen in competition enzyme-linked immunosorbent
assays (ELISAs) on calculated antigen– antibody
dissociation constants. J. Immunol. Methods, 168,
101 –110.
Edited by J. Karn
(Received 16 April 2003; received in revised form 28 July 2003; accepted 29 July 2003)