Inhibition of GSK-3 Ameliorates Ab Pathology in an
Adult-Onset Drosophila Model of Alzheimer’s Disease
Oyinkan Sofola1., Fiona Kerr1,2., Iain Rogers1., Richard Killick3, Hrvoje Augustin1, Carina Gandy1,2,
Marcus J. Allen4, John Hardy5, Simon Lovestone3, Linda Partridge1,2*
1 Institute of Healthy Ageing and Research Department of Genetics, Evolution, and Environment, University College London, London, United Kingdom, 2 Max Planck
Institute for Biology of Ageing, Köln, Germany, 3 Institute of Psychiatry, King’s College London, London, United Kingdom, 4 School of Biosciences, University of Kent,
Canterbury, United Kingdom, 5 Institute of Neurology, University College London, London, United Kingdom
Abstract
Ab peptide accumulation is thought to be the primary event in the pathogenesis of Alzheimer’s disease (AD), with
downstream neurotoxic effects including the hyperphosphorylation of tau protein. Glycogen synthase kinase-3 (GSK-3) is
increasingly implicated as playing a pivotal role in this amyloid cascade. We have developed an adult-onset Drosophila
model of AD, using an inducible gene expression system to express Arctic mutant Ab42 specifically in adult neurons, to
avoid developmental effects. Ab42 accumulated with age in these flies and they displayed increased mortality together with
progressive neuronal dysfunction, but in the apparent absence of neuronal loss. This fly model can thus be used to examine
the role of events during adulthood and early AD aetiology. Expression of Ab42 in adult neurons increased GSK-3 activity,
and inhibition of GSK-3 (either genetically or pharmacologically by lithium treatment) rescued Ab42 toxicity. Ab42
pathogenesis was also reduced by removal of endogenous fly tau; but, within the limits of detection of available methods,
tau phosphorylation did not appear to be altered in flies expressing Ab42. The GSK-3–mediated effects on Ab42 toxicity
appear to be at least in part mediated by tau-independent mechanisms, because the protective effect of lithium alone was
greater than that of the removal of tau alone. Finally, Ab42 levels were reduced upon GSK-3 inhibition, pointing to a direct
role of GSK-3 in the regulation of Ab42 peptide level, in the absence of APP processing. Our study points to the need both
to identify the mechanisms by which GSK-3 modulates Ab42 levels in the fly and to determine if similar mechanisms are
present in mammals, and it supports the potential therapeutic use of GSK-3 inhibitors in AD.
Citation: Sofola O, Kerr F, Rogers I, Killick R, Augustin H, et al. (2010) Inhibition of GSK-3 Ameliorates Ab Pathology in an Adult-Onset Drosophila Model of
Alzheimer’s Disease. PLoS Genet 6(9): e1001087. doi:10.1371/journal.pgen.1001087
Editor: Bingwei Lu, Stanford University School of Medicine, United States of America
Received August 5, 2009; Accepted July 23, 2010; Published September 2, 2010
Copyright: ß 2010 Sofola et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Alzheimer’s Society, the European Commission, Wellcome Trust, Eisai London Research Laboratories (UK), and the Max Planck Institute for the Biology
of Ageing. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: l.partridge@ucl.ac.uk
. These authors contributed equally to this work.
been linked to familial AD, but rather to fronto-temporal
dementia, in which Ab plaques are absent [3,4]. The amyloid
cascade has also been tested experimentally in various ways. For
example, a double transgenic mouse model expressing APPV7171 and Tau-P301L, develops amyloid pathology similarly to
mice transgenic for APP-V7171 alone, whereas tauopathy is
dramatically enhanced in the double transgenic compared to mice
transgenic for Tau-P301L alone. This implies that Ab pathology
affects tauopathy but not vice versa [5]. Also, clearance of Ab using
Ab-specific antibodies reduced early tau burden, while elevating
tau burden in transgenic mice had no effect on Ab accumulation
[6,7]. Furthermore, a reduction in tau levels rescued learning and
memory impairment induced by Ab in a mouse model expressing
human APP [8].
Ab increases the phosphorylation of tau protein and concomitantly activates glycogen synthase kinase, GSK-3 [9,10]. GSK-3 is
a multi-functional kinase involved in regulating various cellular
processes, including growth and differentiation [9,11]. There are
two isoforms of the protein, GSK-3a and GSK-3b. They share
98% identity within their kinase domain, but are not functionally
identical, although both have been suggested to be involved in AD
Introduction
Alzheimer’s disease (AD) is the leading cause of dementia in the
ageing population. Symptoms include, but are not limited to,
memory loss, cognitive decline, and deterioration of language
skills. The pathological hallmarks of AD are the presence of
plaques and neurofibrillary tangles [1]. The tangles are composed
of hyperphosphorylated tau protein while the plaques are
comprised of amyloid beta (Ab) peptides, various species of which
are derived from the amyloid precursor protein (APP), the most
abundant being Ab40 and Ab42 [2]. AD-causing mutations either
increase the level of Ab42 or the ratio of Ab42/Ab40, indicating
that this is the more toxic form of the peptide [2].
The leading candidate explanation for the molecular basis of
AD pathology is the amyloid cascade hypothesis. This states that
the Ab protein initiates the disease process, activating downstream
neurotoxic mechanisms including the dysregulation of tau.
Perhaps the strongest support for the amyloid cascade hypothesis
is that all of the mutations implicated in early-onset, familial AD,
such as the Ab Arctic mutation, increase the aggregation or
production of Ab [1]. Although tau mutations exist, none have
PLoS Genetics | www.plosgenetics.org
1
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
APP orthologue exists in flies, the Ab sequence is not conserved, and
Drosophila models directly expressing Ab allow study of Ab toxicity in
the absence of any endogenous amyloid production [29].
In this study we have generated a fly model that expresses Arctic
mutant Ab42 peptide in the nervous system of adult flies, using an
inducible system for gene expression, because we wished to
understand the underlying mechanism of disease progression of
AD in adults, without complications from developmental effects.
We first characterised this model, and then used it to investigate
the amyloid cascade hypothesis, by modulating the levels of
endogenous fly tau and examining the effects on phenotypes
consequent upon expression of Ab. We also investigated the
requirement for GSK-3 in Ab pathology and its role in direct
regulation of Ab peptides.
Author Summary
Alzheimer’s disease (AD) is the leading cause of dementia
in the ageing population. Symptoms include memory loss
and decline in understanding and reasoning. Alois
Alzheimer, who reported the first case of AD, observed
plaques and tangles in the brains of patients. The plaques
are made up of amyloid protein, while the tangles are of
tau protein. One of the main scientific ideas about AD is
that it starts with build-up of amyloid, which then alters
tau protein, causing the disease. Another protein, called
GSK-3, also seems to play a part. Simple invertebrates such
as flies are useful for understanding human diseases. We
have created an AD model in the fruit fly Drosophila where
amyloid protein is present in the nerve cells of the adult
fly; this caused the flies to be impaired in their survival,
nerve function, and behavior. We found that amyloid
increased the activity of GSK-3, and so we experimentally
turned down its activity and found that this improved the
survival and behavior of the flies. Importantly, turning
down the activity of GSK-3 in flies that did not have
amyloid did not seem to harm them. GSK-3 could
therefore be a good target for drugs against AD.
Results
Arctic Ab42 expression can be induced in adult
Drosophila neurons
To generate an adult-onset fly model of Alzheimer’s disease, we
expressed Arctic mutant Ab42 peptides using an inducible panneuronal driver. An elav GeneSwitch (elavGS) driver line [30–31]
that has been used previously to develop an adult-onset Drosophila
model of spinocerebellar ataxia (SCA) [32] was used to direct
expression of a UAS-Arctic Ab42 transgene [33] both spatially and
temporally, to neurons of the adult fly (Figure 1A). A UAS-Ab40
line [33] was used as a control for over-expression of non-toxic
forms of Ab in fly neurons, since this form of the peptide has
previously been shown to have no detrimental effect in flies [26–28].
We measured expression of Ab peptides in adult neurons when
we treated elavGS;UAS-Arctic Ab42 flies with the activator
mifepristone (RU486;RU) from two days post-eclosion, by measuring RNA and protein levels at 4 and 21 days into treatment
(Figure 1B and 1C). Ab transcripts were clearly elevated in RUtreated elavGS;UAS-Arctic Ab42 flies in comparison with untreated (2RU) flies at both time-points (Figure 1B). Moreover, an Ab42specific ELISA confirmed that Ab42 protein was elevated in
elavGS;UAS-Arctic Ab42 (+RU) flies compared to untreated
(2RU) flies and that the level of protein increased with age
(Figure 1C). Since RNA transcript level decreased with age, this agedependent accumulation of Ab42 protein is most likely to be
attributable to an increased rate of translation of the protein relative
to the rate of protein degradation.
Aggregation of Ab has been shown to be of critical importance
for its pathogenicity [34]. Therefore, we assessed the state of
aggregation of Ab42 in the mutant flies by separating soluble and
insoluble protein fractions from fly brain extracts. At day 15, when
the first signs of pathology were observed in the Arctic Ab42 flies
(see below), we found that most of the Ab42 protein had
accumulated into an insoluble, fibrillar form (Figure 2), consistent
with the aggregation-promoting effects of the Arctic mutation [35].
Overall these results confirm that the elavGS-UAS system used
in this study is sufficient to induce over-expression of Ab peptides
specifically in the adult fly nervous system, and that Arctic mutant
Ab42 protein accumulates with age.
pathogenesis [11]. GSK-3a has been implicated in the amyloidogenic processing of APP to yield Ab peptides [12], while GSK-3b
has been implicated in the tau-related pathogenesis of AD, by
colocalizing with tau tangles and phosphorylating tau [9]. As yet,
the exact role of GSK-3 in the generation of Ab peptides is not
known. GSK-3 itself is also regulated by phosphorylation.
Phosphorylation at Ser9 of GSK-3b and the equivalent Ser21 of
GSK-3a inhibits activity, while phosphorylation at Tyr216/
Tyr279 of GSK-3b and GSK-3a, respectively, is thought to
increase activity [13].
Remarkable similarities are seen between double transgenic mice
expressing tau either with APP or with GSK-3b. This finding is
consistent with the hypothesis that amyloid acts via activation of
GSK-3 to modulate tau function [5,9,14]. Lithium chloride, which
is used as a mood stabilizing agent in patients with bipolar disorders,
inhibits GSK-3 activity, either by competing with magnesium ions
[15] or by increasing Ser9 phosphorylation [16]. Lithium reduces
amyloid production by altering the role of GSK-3a in APP
processing/cleavage; selective inhibition of GSK-3 by siRNA or
expressing a dominant negative form of GSK-3 also decreases Ab
production in cultured cells and mice [12,17]. Furthermore, lithium
reduces both tau phosphorylation at several GSK-3 epitopes and
tauopathy in a mouse model expressing mutant human tau [12,18].
However, in another study, lithium was seen to reduce tau
phosphorylation but not to affect Ab load in a triple mutant mouse
expressing human APPswe, human tauP301L and with mutant
presenilin 1 PS1M146V knock-in. The differing observations might
be due to variations in the age at which the mice were treated with
lithium, as suggested by the authors [19].
Fruit flies, Drosophila melanogaster, can provide useful invertebrate
models of neurodegeneration because of their complex brains, short
lifespans and relative ease of genetic manipulation. Several fly
models of aspects of AD biology have been made, including ones
that over-express either Drosophila or human tau, and show neuronal
dysfunction phenotypes [20–22]. Co-expression of human tau
protein with Shaggy (Sgg), the Drosophila homologue of GSK-3 [23],
exacerbates these neurotoxic phenotypes and leads to the
appearance of neurofibrillary tangles [22,24,25]. Fly models
expressing Ab peptides have also been generated, and show
neurodegeneration and amyloid deposits [26,28]. Although an
PLoS Genetics | www.plosgenetics.org
Over-expression of Arctic Ab42 peptide in adult neurons
increases mortality and induces neuronal dysfunction in
Drosophila, without evidence of neuronal cell loss
Previously published studies have shown that constitutive
expression of Arctic Ab42 peptide in fly neurons significantly
shortens lifespan, induces behavioural impairments and causes
neuronal death [26–28]. To determine whether adult-onset
expression of Arctic Ab42 peptide in neurons causes similar
2
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 1. Adult-onset induction of Arctic Ab42 peptide in the Drosophila nervous system. (A) A schematic representation of the
GeneSwitch-UAS expression system (based on [30]). Driver lines expressing the transcriptional activator GeneSwitch under control of the nervous
system-specific elav promoter (elavGS) are crossed to flies expressing an Ab transgene fused to a GAL4-binding upstream activation sequence (UASAb). In the absence of the activator mifepristone (RU486; 2RU), the GeneSwitch protein is expressed in neurons but remains transcriptionally silent,
so that Ab is not expressed. Following treatment with RU486 (+RU; green) the GeneSwitch protein is transcriptionally activated, binds to UAS and
thus mediates expression of Ab peptide specifically in the fly nervous system. Ab42 RNA (B) and protein (C) levels were quantified at four days and 21
days post-RU486 treatment (see Materials and Methods). Data are presented as means 6 SEM and were analysed by two-way ANOVA and Tukey’s
honestly significant difference (HSD) post-hoc comparisons. P,0.05 comparing Ab RNA expression in RU486-treated UAS-ArcAb42/+;elavGS/+ flies to
their 2RU486 controls at both time-points (Tukey’s HSD). P,0.01 comparing Ab42 protein levels in RU486-treated UAS-ArcAb42/+;elavGS/+ flies to
untreated controls at both time-points.
doi:10.1371/journal.pgen.1001087.g001
phenotypes, we examined survival, neuronal and behavioural
dysfunction in our inducible Drosophila model of AD.
First, we measured the effects of Arctic Ab42 expression on
lifespan, by treating elavGS;UAS-Arctic Ab42 and elavGS;UASAb40 flies with RU from two days post-eclosion and recording
their survival. Expression of Arctic Ab42 in adult neurons
shortened median lifespan by about 50% and maximum lifespan
by about 45% in comparison to non-RU-treated flies, and to Ab40
+RU and 2RU control flies (Figure 3), demonstrating a specific
lifespan-shortening effect of Arctic Ab42 compared to the Ab40
form of the peptide.
Next, we determined whether adult-onset expression of Arctic
Ab42 peptide in fly neurons caused neuronal toxicity, by analysing
neuronal function. As a direct measure of physiological activity, we
examined the electrophysiological responses of the Drosophila giant
fibre system (GFS; Figure 4A). Adult elavGS;UAS-Arctic Ab42
flies were fed + or 2 RU486 media from two days post-eclosion,
and GFS activity measured at day 16 and day 28 into treatment.
PLoS Genetics | www.plosgenetics.org
Giant fibres (GF) were stimulated via electrodes inserted inside the
compound eye, and post-synaptic potentials recorded in the
tergotrochanteral muscle (TTM) and the dorsal longitudinal flight
muscle (DLM) (Figure 4A); parameters measured were the latency
from GF stimulation to muscle response and the stability of the
response to high frequency stimulation. At day 16, response
latencies in the TTM, DLM and the TTM to high frequency
stimulation were comparable between elavGS;UAS-Arctic Ab42
flies on + and 2 RU486 food (Figure 4B and Figure S1). However,
at day 28, expression of Arctic Ab42 peptide significantly increased the response latency measured in both the TTM and
DLM, and inhibited the stability of the TTM response to high
frequency stimulation (at 100, 200 and 250 Hz) in comparison to
untreated control flies (Figure 4C and Figure S1). This indicates a
progressive neuronal dysfunction following adult-onset induction
of Arctic Ab42, with young flies exhibiting no dysfunction in the
GFS, while older flies showed obvious defects in response to both a
single stimulus and to high frequency stimuli.
3
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 2. Arctic Ab42 peptide in the adult Drosophila nervous system is mostly in an insoluble fibrillar state. In the absence of the activator
mifepristone (RU486; 2RU), a negligible amount of soluble protein is observed at day 15. Following treatment with RU486 (+RU; dark green) the Ab
peptide expression is seen in both soluble and insoluble fractions with a significant proportion observed in the insoluble fraction. Data are presented as
means 6 SEM and were analysed by ANOVA, P,0.01 when protein levels of soluble and insoluble fractions of Ab42 expressing flies were compared.
doi:10.1371/journal.pgen.1001087.g002
important in suppressing its kinase activity. We found that
expression of Arctic Ab42 in the adult nervous system decreased
the Ser9 phosphorylation level of Sgg, indicating an up-regulation
of the activity of the kinase (see Figure 6). This increase in Sgg
activity could have contributed to the toxicity we observed in our
Ab42 expressing flies. Lithium is a GSK-3 inhibitor, and we
therefore tested its effect on Ser9 phosphorylation in the Ab42 flies
and, indeed, we found an increase in Ser9 phosphorylation
compared to untreated controls (Figure 6).
As a behavioural measure of neuronal dysfunction in our
inducible model, locomotor activity was assessed using a negative
geotaxis (climbing) assay that has been used extensively to
characterise fly models of neurodegenerative diseases [33,36].
Drosophila display an age-related decline in climbing behaviour,
and this was apparent in the non-RU-treated and elavGS;UASAb40 +RU control flies used in the current study (Figure 5). We
found that flies expressing Arctic Ab42 displayed a reduced
negative geotaxis in comparison to their 2RU control flies and the
Ab40 +RU and 2RU flies (Figure 5). The climbing behaviour of
the Arctic Ab42 flies had declined to a level by day 15 that was
reached by the control flies only by day 28.
Finally, we quantified neuronal loss, as measured by the number
of cell bodies in one hemisphere, in flies over-expressing Arctic
Ab42 peptide in adult neurons compared to non-expressing
controls. No neuronal loss was evident in the brains of these flies
(Figure S2).
Collectively, these data demonstrate that expression of Arctic
Ab42 specifically in the neurons of the adult fly leads to early death
and progressive neuronal dysfunction, in the apparent absence of
neuronal loss. Hence we have successfully developed an inducible
Drosophila model of AD that will provide a useful system in which
to further investigate the potential mechanisms underlying
pathogenesis in Alzheimer’s disease, without any confounding
effects on neuronal development.
Inhibition of Shaggy activity in the adult nervous system
suppresses the toxicity of Arctic Ab42
We next investigated if the increase in Sgg activity that we
observed in the Artic Ab42-expressing flies contributed to Ab42
toxicity. To do this, we co-expressed in adult neurons a dominant
negative form of Sgg, the S9E mutant, which mimics an inhibited
state of the kinase [37,38] and renders it inactive. Expression of this
dominant-negative Sgg increased the median and maximum
lifespan of flies expressing Arctic Ab42. Flies co-expressing Arctic
Ab42 and the dominant negative mutant S9E lived significantly
longer than control flies co-expressing Arctic Ab42 and GFP
(Figure 7), to control for any titration effect of GAL4 in the presence
of a second UAS-transgene. Furthermore, inactivation of Sgg, either
by expressing the dominant negative mutant S9E or feeding the flies
lithium in adulthood, significantly suppressed the climbing deficit of
the Arctic Ab42-expressing flies (Figure 8). Two different doses of
lithium (30mM and 100mM) both rescued the climbing deficit of
the Ab42-expressing flies. These data demonstrate that inhibiting
the activity of Sgg in neurons in adults suppresses the adult onset
Arctic Ab42 induced toxicity, and demonstrate experimentally a
functional role of GSK-3 in mediating Ab42 toxicity.
Adult-onset expression of Ab42 increases the activity of
Shaggy in the adult nervous system
Because of the described role of GSK-3 in Alzheimer’s disease,
we investigated the activity of the fly orthologue of GSK-3, Sgg, in
the Ab42-expressing flies. Phosphorylation at Ser9 of Sgg is
PLoS Genetics | www.plosgenetics.org
4
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 3. Expression of Arctic Ab42 specifically in the adult nervous system shortens lifespan. Lifespans were determined as described in
materials & methods. Survival curves are depicted and data were compared using the log-rank test. P,0.01 comparing median lifespan of UASArcAb42/+;elavGS/+ +RU flies to their 2RU controls. P,0.01 comparing UAS-ArcAb42/+;elavGS/+ +RU flies to UAS-Ab40/+;elavGS/+ +RU controls.
Induction of Ab40 in the adult nervous system did not alter lifespan in comparison to non-RU486-treated controls.
doi:10.1371/journal.pgen.1001087.g003
The phosphorylation sites on fly tau have not yet been
extensively characterized. Drosophila-specific phosphorylation-dependent antibodies are hence not available for the examination of
specific sites. However, several GSK-3 specific sites [41,42], and
sites reported to be altered by Ab42 peptide [43–45], on human
tau appear to be conserved in the Drosophila tau sequence (Figure
S4). Of these, Ser262, and Ser356 phosphorylation-dependent
human tau antibodies were found to detect fly tau protein
specifically (Figure 9B and Figure S3B). We therefore used these
antibodies to examine the effects on tau phosphorylation at these
sites. Arctic Ab42 over-expression, or treatment of Ab42expressing flies with lithium, did not modify phosphorylation at
the Ser262 or Ser356 homologous tau epitopes (Figure 9B). This
suggests that neither Ab42 nor GSK-3 are predominant in vivo
regulators of the phosphorylation of these sites on fly tau.
Arctic Ab42 toxicity, and protection by Shaggy inhibition,
is not mediated predominantly through alterations in tau
phosphorylation
Since GSK-3 is a well-established tau kinase, and tau is
abnormally phosphorylated in AD, we next investigated whether
the protective effect of Sgg inhibition on Ab42 toxicity in our fly
model is mediated via alterations in tau phosphorylation. Hence,
we examined the phosphorylation of Drosophila tau in flies overexpressing Arctic Ab42 peptide in the absence or presence of
lithium-treatment (Figure 9).
We analysed tau phosphorylation using Phos-tag acrylamide gels, a
technique for separating phosphorylated protein isoforms [39], which
has been employed previously to investigate the phosphorylation of
fly proteins [40]. Phos-tag is a phosphate-binding compound which,
when incorporated into polyacrylamide gels, can result in an
exaggerated mobility shift for phosphorylated proteins, dependent
on the degree of phosphorylation. When heat-stable fly head
homogenates were run on Phos-tag gels, several prominent tau
bands were detected, implying that endogenous tau is phosphorylated
at multiple sites in WT tissue (Figure 9A). De-phosphorylation using
l-protein phosphatase confirmed that the high molecular weight
bands were due to tau phosphorylation, and that non-phosphorylated
fly tau runs as a doublet (Figure 9A). This method is thus capable of
detecting at least some phosphorylation changes on the endogenous
fly tau. Using this method, no difference in the level of tau
phosphorylation was observed in flies over-expressing Arctic Ab42
compared to non-expressing controls or to Arctic Ab42 flies treated
with lithium chloride (Figure 9A and Figure S3A).
PLoS Genetics | www.plosgenetics.org
Loss of Tau reduces adult-onset Ab42 toxicity
Although we could not uncover a role for tau phosphorylation
in Ab42 toxicity, we investigated whether the presence of tau
modulates Ab42 pathology. We found that loss of tau reduced the
Arctic Ab42 climbing dysfunction. UAS-ArcAb42/+;elavGS tau
EP3203/tau deficiency (dfc) flies, which express Arctic Ab42 in a
genetic background homozygous mutant for tau (see Figure 10A
for tau expression levels; tau antibody has previously been
described [46]), had improved locomotor ability compared to
UAS-ArcAb42/+;elavGS tau EP2303/TM6 flies, which express a
much greater level of tau (P,0.0001, two-way ANOVA;
Figure 10A) and UAS-ArcAb42/+;elavGS/+ flies, which express
5
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
PLoS Genetics | www.plosgenetics.org
6
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 4. Arctic Ab42 peptides induce progressive, adult-onset neuronal defects in Drosophila. (A) A schematic illustration of the
Drosophila giant fibre system (GFS; adapted from [74]). Giant fibres (GFs; blue) relay signals from the brain to the thoracic musculature via mixed
electrochemical synapses with the motorneurons (TTMn, red) of the tergotrancheral muscle (TTM; left), and the peripherally synapsing interneuron
(PSI; green), which subsequently forms chemical synapses with the motorneurons (DLMn; orange) of the dorsal longitudinal muscles (DLM; right).
Note only one of the TTMn axons is shown exiting the nervous system and contacting the muscle on the left hand side and one set of the DLMns and
corresponding neuromuscular junctions are depicted on the right hand side. GFS activity was measured in UAS-ArcAb42;elavGS flies at (B) 16 days
and (C) 28 days post-RU486 treatment (see Materials and Methods); parameters measured were the latencies from GF stimulation to muscle response
(response latency DLM and TTM) and the stability of the response to high frequency stimulation at 100, 200 and 250 Hz (high frequency stimulation
TTM). Data are presented as the mean response 6 SEM and were analysed by student’s t-test, at each time point, on log-derived data. *P,0.05,
**P,0.01 comparing response latency or response to high frequency stimulation of UAS-ArcAb42/+;elavGS/+ +RU flies to 2RU controls at 28 days
post-induction.
doi:10.1371/journal.pgen.1001087.g004
wild-type tau levels (P = 0.0002, two-way ANOVA; Figure 10B),
on +RU food. It is important to note, however, that tau loss of
function flies themselves displayed some locomotor dysfunction
compared to controls (Figure 10B; P,0.0001 comparing UASArcAb42/+;elavGS/+ to UAS-ArcAb42/+;elavGS tau EP3203/
tau dfc on 2RU486, two-way ANOVA), thus potentially reducing
the apparent protective effect of removing tau on Ab42 pathology.
These data parallel observations in mammals, where loss of
murine Tau rescued Ab-induced behavioural deficits in a mouse
AD model [8].
We further investigated interactions between Drosophila tau and
GSK-3 in the protection against Ab42 pathology, to determine if
they might act in the same biochemical pathway (Figure 10B).
Lithium treatment alone had a greater protective effect against
Ab42 toxicity than did loss of tau function alone, although this
may have been confounded by the reduced climbing ability of flies
with reduced tau. Moreover, lithium treatment rescued Ab42induced climbing dysfunction to the same extent in the presence or
absence of tau, (P = 0.692 comparing UAS-ArcAb42/+;elavGS/+
and UAS-ArcAb42/+;elavGS tau EP3203/tau dfc flies on +RU, +
lithium food, two-way ANOVA) suggesting that endogenous tau is
not required for the lithium effect. This suggests that a large
proportion of the protective effect of GSK-3 inhibition on Ab42
toxicity is mediated via non-tau-dependent mechanisms. We also
show that tau is required for the manifestation of Ab42 effects.
Our experimental design does not address, neither excludes, the
possibility that a direct interaction of GSK-3 and tau may also
affect Ab42 toxicity.
Inhibition of Shaggy in the adult nervous system reduces
Ab load in Arctic Ab42-expressing flies
Because the amelioration of Ab42 toxicity by reduced GSK-3
activity did not appear to be mediated mainly through tau, we
next examined the direct effect of GSK-3 inhibition on Ab42
levels. Interestingly, we found by ELISA analysis that Ab peptide
was significantly reduced in flies expressing Arctic Ab42 when Sgg
activity was reduced. Adult flies that co-expressed Arctic Ab42 and
the inactive dominant negative mutant Sgg S9E, or adult flies that
expressed Arctic Ab42 and were fed lithium, showed a major
reduction in total Ab42 levels in comparison to flies expressing
Arctic Ab42 alone and reared on food without lithium
(Figure 11A). The transcript levels of Ab42 in the presence of
functional or inhibited Sgg activity were not significantly different
Figure 5. Expression of Arctic Ab42 peptides in the adult fly nervous system causes locomotor dysfunction. Climbing ability of UASArcAb42/+;elavGS/+ and UAS-Ab40/+;elavGS/+ flies on + and 2 RU486 SY medium was assessed at the indicated time-points (see Materials and
Methods). Data are presented as the average performance index (PI) 6 SEM and were compared using two-way ANOVA and Tukey’s honestly
significant difference (HSD) post-hoc analyses (number of independent tests (n) = 3, number of flies per group (nt) = 39–45). *P,0.05 comparing PI of
UAS-ArcAb42/+;elavGS/+ +RU486 flies to that of untreated and Ab40 over-expressing controls at the indicated time points (Tukey’s HSD).
doi:10.1371/journal.pgen.1001087.g005
PLoS Genetics | www.plosgenetics.org
7
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 6. Flies expressing Ab42 in adult neurons show a decrease in Shaggy inhibitory Ser9 phosphorylation. (A) Western blot analyses
for pan-Sgg and phospho Ser9 Sgg revealed a decrease in Ser9 phosphorylation in flies expressing Ab42 by RU induction for 15 days (UAS-ArcAb42/
+;elavGS/+ or UAS-ArcAb42/GFP;elavGS/+) in comparison to their 2RU controls, while an increase in Ser9 phosphorylation was observed when the
Ab42 expressing flies were fed lithium (+RU +Li). Flies over expressing Sgg were used as positive control. (B) Quantification of the western blot
analysis in (A), n = 3, is depicted in the bar chart, with significant differences seen between ArcAb42/+;elavGS/+ +RU flies to 2RU controls (P,0.01),
and between ArcAb42/+;elavGS/+ +RU +Li flies to +RU controls (P,0.001).
doi:10.1371/journal.pgen.1001087.g006
through its well-established role as a tau kinase [48–52]. Although
previous studies in mice have suggested that GSK-3 alters Ab
levels via modulation of APP processing [12,17], the direct effects
of the enzyme on Ab toxicity, and in the adult nervous system,
have not been examined. We therefore performed a more direct
analysis of the specific role of GSK-3 in regulating Ab42 toxicity in
adult neurons in vivo, by modulating its activity in an adult-onset
Drosophila model of Alzheimer’s disease. Our study shows for the
first time that GSK-3 inhibition ameliorates Ab42 toxicity in adult
flies, and also highlights a novel mechanism of protection by which
GSK-3 directly regulates Ab42 levels in the absence of any effects
on APP processing.
We have generated an inducible Drosophila model of Alzheimer’s
disease. Over-expression of the Arctic Ab42 peptide in adult fly
neurons led to shortened lifespan, neuronal dysfunction and
behavioural impairments. However, no neuronal loss was evident
(Figure 11B), suggesting that Sgg does not affect transgene
expression, but rather acts directly or indirectly on Ab degradation/sequestration. These data demonstrate for the first time a role
of GSK-3 in determining the level of Ab42 peptide, in the absence
of effects on APP processing. Furthermore, this reduction in the
levels of Ab42 peptide by GSK-3 inhibition is most likely not
mediated by tau, since loss of tau function partially rescued Ab
toxicity, but did not affect Ab42 levels (Figure 10A and Figure S5).
These data again suggest that GSK-3 can modify Ab42 toxicity via
tau-independent mechanisms.
Discussion
Glycogen synthase kinase-3 is increasingly thought to play a
pivotal role in the pathogenesis of Alzheimer’s disease, both as a
regulator of the accumulation of Ab peptide [12,17,47] and
PLoS Genetics | www.plosgenetics.org
8
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 7. Expression of the dominant negative mutant Shaggy S9E in the adult nervous system extends the median and maximum
lifespan of Arctic Ab42 flies. (A). Survival curves of flies co-expressing Arctic Ab42 and SggS9E are depicted and data were compared using the
log-rank test. P,0.001 comparing UAS-ArcAb42/+;elavGS/UAS-SggS9E +RU flies to UAS-ArcAb42/UAS-gfp;elavGS/+ +RU controls. No significant
PLoS Genetics | www.plosgenetics.org
9
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
difference was seen in the 2RU controls. (B). Expression of Shaggy S9E alone did not affect control lifespan. No significant difference was observed
comparing elavGS/UAS-SggS9E +RU to either elavGS/UAS-SggS9E 2RU, or UAS-gfp/elavGS/+ +RU control lifespans.
doi:10.1371/journal.pgen.1001087.g007
neuronal loss is generally not evident in murine models of
amyloidosis, such as in mice transgenic for the amyloid precursor
protein [53]. Moreover, our study has provided direct evidence of
neuronal dysfunction in response to Ab42, by electrophysiological
methods, at a timepoint more suitable to understanding the early
events that lead to neuronal decline in AD.
GSK-3 activity was increased in our flies upon Arctic Ab42
over-expression, as measured by reductions in phosphorylation of
endogenous Sgg at the inhibitiory Ser9 site. This is consistent with
previous observations showing that Ab42 alters GSK-3 phosphorylation in cells [54] and in mice [14]. Contrary to these findings,
in the brains of these flies. This finding contrasts with previous
reports that flies over-expressing Arctic Ab42, using a constitutive
neuronal driver, develop vacuoles [28,33], These contrasting
results could be reconciled if neuronal loss upon Ab42 overexpression is a consequence of developmental abnormalities in the
Drosophila brain or if neuronal loss represents an end-stage event in
response to Ab42 toxicity, since vacuolation has been reported
only under the most extreme conditions of expression, age and
temperature, while neuronal toxicity in these models is already
apparent under less stringent conditions [33]. Importantly, our
findings agree with those of other studies demonstrating that
Figure 8. Inhibition of Shaggy, either by expression of SggS9E in the adult nervous system or treatment with lithium, suppresses
the locomotor dysfunction phenotype of Arctic Ab42 flies. (A) Climbing ability of UAS-ArcAb42/UAS-gfp;elavGS/+ and UAS-ArcAb42/
+;elavGS/UAS-SggS9E flies on +RU486 SY medium was assessed at the indicated time-points (see Materials and Methods). Data are presented as the
percentage climbing performance of flies 6 SD. P,0.001 when UAS-ArcAb42/UAS-gfp;elavGS/+ and UAS-ArcAb42/+;elavGS/UAS-SggS9E flies are
compared at day 21 (one-way ANOVA, number of independent tests (n) = 3). Graph shows one representative data of repeated experiments. (B)
Expression of Shaggy S9E alone does not reduce climbing ability of control flies. elavGS/UAS-SggS9E +RU flies display a similar locomotor function
compared to both elavGS/UAS-SggS9E 2RU and UAS-gfp/+;elavGS/+ +RU control flies. (C) Climbing ability of UAS-ArcAb42/+;elavGS/+ and UASArcAb42/UAS-gfp;elavGS/+ on +RU486 SY medium was assessed in the presence and absence of lithium chloride (30mM and 100mM). P,0.001 when
UAS-ArcAb42 flies were fed lithium and compared to flies not fed lithium at day 18 (one-way ANOVA, n = 3). Graph shows one representative data of
repeated experiments. (D) Lithium had no effect on negative geotaxis of control flies. UAS-gfp/+;elavGS/+ +RU and UAS-gfp/+;elavGS/+ +RU in the
presence of lithium had similar locomotor function. The crosses were performed at 27uC.
doi:10.1371/journal.pgen.1001087.g008
PLoS Genetics | www.plosgenetics.org
10
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 9. Flies expressing Ab42 in adult neurons show no changes in total tau phosphorylation and at Ser 262 and Ser 356 specific
epitopes. (A) Western blot analyses for total tau phosphorylation using phos-tag gels and (B) phospho Ser262 and Ser356. Tau showed no changes in
phosphorylation in flies expressing Ab42 (UAS-ArcAb42/GFP;elavGS/+) in comparison to their 2RU controls, and when the Ab42 expressing flies were
fed lithium (+RU +Li). Flies were collected 17 days post RU induction, and maintained at 27uC. Quantification of the western blot analysis in (A), phosphotau or non-phospho-tau normalised to total tau per sample (n = 4), and in (B) n = 4 for total tau and n = 3 for the Ser sites depicted in the bar chart,
showed no significant differences between ArcAb42/+;elavGS/+ +RU flies to 2RU controls or to ArcAb42/+;elavGS/+ +RU +Li flies (one-way ANOVA).
doi:10.1371/journal.pgen.1001087.g009
PLoS Genetics | www.plosgenetics.org
11
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 10. Lithium treatment alone has a greater protective effect against Ab42 toxicity than loss of tau function alone. (A) Loss of
tau partially suppressed the locomotor dysfunction phenotype of Arctic Ab42 flies. Expression of Arctic Ab42 peptide in a tau heterozygous
background in the adult fly nervous system caused locomotor dysfunction. This phenotype was suppressed when Arctic Ab42 peptide was expressed
in a homozygous tau mutant background. Climbing ability of UAS-ArcAb42/+;elavGS Tau EP3203/TM6 and UAS-ArcAb42/+;elavGS Tau EP3203/Tau
Dfc flies on +RU486 SY medium was assessed at the indicated time-points (see Materials and Methods). Data are presented as the average
performance index (PI) 6 SEM (number of independent tests (n) = 3, number of flies per group (nt) = 45). P,0.0001 comparing the PI of UAS-ArcAb42/
+;elavGS Tau EP3203/Tau Dfc to UAS-ArcAb42/+;elavGS Tau EP3203/TM6 flies (two-way ANOVA). The crosses were performed at 27uC. Western
blotting analysis, using a non-phosphorylation dependent antibody to Drosophila tau, confirmed that endogenous tau protein levels were greatly
reduced in UAS-ArcAb42/+;elavGS tau EP3203/tau Dfc flies in comparison to tau heterozygous flies (UAS-ArcAb42/+;elavGS tau EP3203/TM6) and
control w1118 flies. (B) Arctic Ab42 toxicity was suppressed when the peptide was expressed in a homozygous tau mutant background or when flies
were treated with lithium. Lithium treatment alone had a greater protective effect against Ab42 toxicity than did loss of tau function alone, and was
not dependent on tau. Climbing ability of UAS-ArcAb42/+;elavGS/+ and UAS-ArcAb42/+;elavGS tau EP3203/tau Dfc flies on 2 or +RU486 SY medium,
in the presence or absence of lithium, was assessed at the indicated time-points. Data are presented as the average PI 6 SEM and were analysed by
two-way ANOVA (number of independent tests (n) = 4, number of flies per group (nt) = 60). Comparing PI of UAS-ArcAb42/UAS-gfp;elavGS/+ and
UAS-ArcAb42/+;elavGS tau EP3203/tau Dfc flies on 2RU, significant differences between genotypes (P,0.0001) were observed. P = 0.0002 comparing
PI of UAS-ArcAb42/UAS-gfp;elavGS/+ and UAS-ArcAb42/+;elavGS tau EP3203/tau Dfc flies on +RU food. No significant differences were observed
comparing UAS-ArcAb42/+;elavGS/+ and UAS-ArcAb42/+;elavGS tau EP3203/tau Dfc flies on +RU +lithium (P = 0.692).
doi:10.1371/journal.pgen.1001087.g010
however, one other study has shown that WT Ab42 expression
does not alter phosphorylation of Sgg in flies [55]. These
differences may reflect varying mechanisms by which Arctic
mutant Ab42 and WT Ab42 peptides modulate GSK-3 activity, or
a distinction in the effect of expressing Ab42 throughout
development compared to adult-only expression. Hence, our
PLoS Genetics | www.plosgenetics.org
observed increase in Sgg activity may reflect an age-dependent
effect. We aimed, therefore, to further investigate the functional
role of this kinase in mediating Ab toxicity in our adult-onset AD
model.
GSK-3 plays an important role in neuronal development
[56,57]. Previous analyses of the role of GSK-3 in amyloid toxicity
12
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
Figure 11. Inhibiting Shaggy activity reduces amyloid levels of Arctic Ab42 flies. (A) Protein levels of UAS-ArcAb42/UAS-gfp;elavGS/+ and
UAS-ArcAb42/+;elavGS/UAS-SggS9E flies on +RU486 SY medium, and UAS-ArcAb42/UAS-gfp;elavGS/+ flies on +RU +Lithium (Li), were measured by
ELISA at 15 days post-induction (see Materials and Methods). Data were compared using one-way ANOVA, number of independent tests (n) = 3.
P,0.01, and P,0.0001 when comparing UAS-ArcAb42/UAS-gfp;elavGS/+ to UAS-ArcAb42/+;elavGS/UAS-SggS9E flies on +RU486 SY medium, and
UAS-ArcAb42/UAS-gfp;elavGS/+ +RU to UAS-ArcAb42/UAS-gfp;elavGS/+ +RU +Li respectively. (B) RNA levels of UAS-ArcAb42/UAS-gfp;elavGS/+, UASArcAb42/+;elavGS/UAS-SggS9E +RU486 SY medium and UAS-ArcAb42/UAS-gfp;elavGS/+ +RU + lithium flies were measured at day 5. No significant
difference was seen in the levels of RNA expression, number of independent tests (n) = 3.
doi:10.1371/journal.pgen.1001087.g011
using constitutive expression systems may, therefore, represent
abnormal neuronal development in addition to the response to AD
pathology in the adult period. Hence, we confined GSK-3
inhibition to the adult neurons of Arctic Ab42-expressing flies,
by over-expressing a dominant negative form of the Drosophila
orthologue Sgg, using our inducible expression system, or we
treated whole adult flies with the GSK-3 inhibitor, lithium. GSK-3
inhibition extended lifespan of Arctic Ab42-expressing flies and
suppressed the locomotor dysfunction caused by expression of the
peptide in adult neurons. This is an important finding because it
demonstrates a definitive role for GSK-3 in Ab42 pathogenesis in
PLoS Genetics | www.plosgenetics.org
adult flies. Moreover, we found that inhibiting Sgg in adulthood
had no adverse effect on wild type flies. Hence, our study provides
further support for the therapeutic potential of GSK-3 inhibitors
in treating Alzheimer’s disease. Further studies are required to test
this potential in mammalian models, firstly to confirm the
relevance of GSK-3 for direct regulation of Ab42 toxicity and
secondly to establish a therapeutic index for GSK-3 inhibition in
the treatment of AD.
Ab42 has been shown previously to increase tau phosphorylation in cells [45] and in mice [5,43]. Correlative evidence has
suggested that GSK-3 may mediate the effects of Ab on tau
13
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
activity [17]. Our inducible Drosophila model, however, expresses the
Arctic Ab42 peptide directly, thus circumventing the requirement
for APP processing. We found that inhibition of GSK-3 caused a
reduction in the level of Ab42 peptide, but not in RNA transcript
levels. Hence, although previous studies have indicated that GSK-3
does not affect Ab degradation [17], our findings demonstrate a
novel effect of GSK-3 in Ab metabolism, irrespective of APP
processing, in the adult nervous system. Furthermore, this
observation may, partially, explain the non-tau-dependent effect
of GSK-3 in protecting against Ab toxicity in our flies.
Our study, therefore, implies that GSK-3 may increase Ab
degradation or clearance. Candidate in vivo Ab degrading enzymes
include neprilysin (NEP) [62], insulin degrading enzyme (IDE)
[63–64] and to a lesser extent endothelin converting enzymes
(ECE-1,2) [65] and plasmin [66]. Mice deficient in IDE [63,64] or
NEP [62] display increased levels of Ab peptides in the brain.
Conversely, increasing expression and activity of NEP or IDE
reduces the cerebral amyloid plaque burden observed in APP
over-expressing mice [67], further implying that these are
predominant in vivo Ab degrading enzymes. Direct interactions
between GSK-3 and IDE or neprilysin activities in relation to Ab
degradation, however, have not been extensively investigated.
Studies examining the effects of reduced insulin signalling on
amyloid toxicity in APP over-expressing mice have reported either
increased GSK-3 activity, reduced IDE activity and increased
amyloidosis [68] or decreased GSK-3 activity, increased IDE
expression and reduced amyloidosis [69] in the brain, suggesting
an inverse correlation between GSK-3 and IDE activities in
relation to Ab metabolism. Other studies have reported no
correlation between inhibition of GSK-3 activity and neprilysin
levels in relation to reduced Ab load in mice [17], but NEP activity
was not measured and may provide a more accurate indication of
the role of this enzyme in Ab metabolism downstream of GSK-3.
As most information from mouse models is correlative, however,
further work is required to determine whether these degrading
enzymes are direct mediators of Ab degradation in response to
GSK-3 inhibition, by modulating their activities in our inducible
Drosophila model. Drosophila homologues of both IDE and NEP
exist, and over-expression of both NEP [26,70] and IDE [71] have
been shown to reduce Ab induced neurotoxicity in flies. This
suggests that these degradation mechanisms may be generally
conserved, and that the fly is a valuable model for the direct
analysis of these genetic interactions with respect to the role of
GSK-3 in AD.
The more general proteosome degradation pathway could also
play a role in regulating Ab degradation or sequestration. Heat
shock protein 90 (Hsp90), a protein chaperone involved in the
proteosome degradation pathway, is thought to phosphorylate
GSK-3 and regulate its activity [13]. In addition, an increase in
levels of GSK-3 down-regulates the transcriptional activity of Heat
shock factor-1 (HSF-1) and Hsp70 [72]; thus a decrease in GSK-3
activity could lead to an increase in levels/activity of these
chaperone molecules and augment the levels of Ab. In a
Caenorhabdits elegans worm model of AD, the aggregation-mediated
Ab42 toxicity was regulated by modulating the levels of hsf-1; a
reduction in hsf-1 increased paralysis in these worms, suggesting a
role of hsf-1 in the dis-aggregation of Ab toxic oligomers [73].
Thus, any of these pathways/molecules could play a role in
affecting Ab load in our fly model and will require detailed
exploration in the future.
Our data highlight that this fly model is suitable for the study of
AD pathology, since we observe neuronal dysfunction and toxicity
that are particular to the expression of Ab42 peptide. Furthermore, we have been able to test the amyloid cascade hypothesis in
phosphorylation, since Ab increases GSK-3 activity [10]. Furthermore, GSK-3 and APP cause similar increases in tau
phosphorylation and aggregation in tau over-expressing mice
[14]. Because both tau and GSK-3 appeared to play a causal role
in Arctic Ab42 toxicity in our flies, we examined whether the
protective effect of GSK-3 inhibition on Ab toxicity might be
mediated via alterations in phosphorylation of endogenous
Drosophila tau. We found that Arctic Ab42 over-expression and
lithium treatment of Ab42-expressing flies did not have an
observable effect on overall tau phosphorylation, as revealed both
by generic measures, and at two specific sites by examination of
phosphorylation of fly tau at Ser262 and Ser356 epitopes.
However, because the Ser 262 and 356 sites are also predominant
in vivo substrates for MARK (microtubule-associated protein
(MAP)-microtubule affinity regulating kinase) [58,59], further
investigation of more specific GSK-3 sites on Drosophila tau, using
mass spectrometric methods, would provide a more definitive
analysis of the role of tau phosphorylation by GSK-3 in mediating
Ab42 toxicity in the fly.
Our data suggest that tau phosphorylation may not be the only
mechanism by which Ab42 exerts its toxic effect in Drosophila, since
phosphorylation sites thought to be important for mediating Ab42
effects on tau (Thr212/Ser214 [43], Thr231 [45], Ser422, Ser262
[44]) are predominantly not conserved in the fly, or are not altered
by Ab42 over-expression in our AD model. These findings seem to
contradict previous studies showing that Ab42 increases phosphorylation of human tau in Drosophila [55,60], and indicating that
particular sites, such as Ser262, are important in mediating Ab
toxicity in the fly [60]. This disparity could reflect a lack of
conservation of the mechanisms through which Ab42 regulates
human and Drosophila tau proteins. However, the endogenous fly
tau does appear to be an important downstream mediator of Ab42
toxicity, since loss of tau function partially reduced Ab42
pathology in our study. This protective effect of tau against
Ab42 toxicity, however, may have been masked by the locomotor
dysfunction from reducing levels of tau itself in flies that do not
over-express the Ab42 peptide. As a previous study has reported
similar tau-dependent neuropathological phenotypes in an APPoverexpressing mouse model of AD [8], our findings suggest that
the role of tau in amyloid toxicity is conserved over large
evolutionary distances.
We further examined the epistatic interaction between GSK-3
inhibition and tau loss of function in protecting against Ab42
toxicity in our fly model. Lithium alone had a greater protective
effect against Ab42 toxicity than loss of tau function alone, and
lithium could prevent Ab42-induced dysfunction in the presence
or absence of tau. This suggests that a large proportion of the
protective effect of GSK-3 inhibition on Ab42 toxicity is mediated
via non-tau-dependent mechanisms and that tau is not required
for this effect. We observed no additive effect of combining lithium
treatment and tau loss of function in protection against Ab42induced pathology; however, this could have been a consequence
either of toxicity of loss of tau in the absence of Ab42 or of the level
of protection afforded by lithium, which could have produced a
ceiling effect. Our findings agree with other recently published
studies, showing that loss of tau only partially protects against
GSK-3-induced neuronal degeneration in adult mice [61],
suggesting that other non-tau-dependent mechanisms of GSK-3
neuro-toxicity exist.
Previous studies have shown a reduction in Ab load in mice as a
result of GSK-3 inhibition, but this has been explained mainly by
dysregulation of APP processing, either by increasing c-secretase
activity [12] or by increasing the phosphorylation of APP and
therefore directing its subcellular location to sites of secretase
PLoS Genetics | www.plosgenetics.org
14
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
part, to show that tau is acting downstream of Ab pathology. This
inducible model of AD will also open the way to understanding the
role of events at different ages and of the ageing process itself in the
biological pathway leading to this ageing related disease. We have
shown the involvement of GSK-3, particularly in adulthood, in
AD pathogenesis, and also uncover a novel mechanism by which
GSK-3 could be acting directly or indirectly on Ab, by reducing
Ab load. These results raise new potential therapeutic benefits of
GSK-3 in AD pathology.
the top (ntop), the mean number of flies at the bottom (nbottom) and
the total number of flies assessed (ntot). A performance index (PI)
defined as K(ntot+ntop2nbottom)/ntot) was calculated. Data are
presented as the mean PI 6 SEM obtained in three independent
experiments for each group, and analysis of variances (ANOVA)
and post hoc analyses were performed using JMP 7.0 software.
To assess various modifiers of the adult-onset neuronal
dysfunction in Arctic Ab42 over-expressing flies, a less stringent
climbing assay was performed at 27uC. Thirty flies expressing Arctic
Ab42 with or without co-expressing modifiers in the neurons (elavGAL4GS) were used for the climbing assay, adapted from Ganetzky
et al. [76]. Climbing performance (ability to climb past a 5cm mark
in 18s) was assessed after eclosion post RU486 treatment.
Materials and Methods
Fly stocks and maintenance
All fly stocks were maintained at 25uC or 27uC on a 12:12-h
light:dark cycle at constant humidity on a standard sugar-yeast
(SY) medium (15gl21 agar, 50 gl21 sugar, 100 gl21 autolysed
yeast, 100gl21 nipagin and 3ml l21 propionic acid). Adult-onset
neuronal-specific expression of Arctic mutant Ab42 peptide or
constitutively active Sgg was achieved by using the elav
GeneSwitch (elavGS)-UAS system [GAL4-dependant upstream
activator sequence; [30]]. ElavGS was derived from the original
elavGS 301.2 line [30] and obtained as a generous gift from Dr H.
Tricoire (CNRS, France). UAS-ArcAb42 and UAS-SggS9E were
obtained from Dr D. Crowther (University of Cambridge, UK)
and the Bloomington Drosophila Stock Centre respectively. Tau
dfc (9530) and EP line 3203 (17098) were received from
Bloomington Drosophila stock centre. The EP line orientation is
opposite to tau expression and causes a reduction in tau expression
[46]. elavGS and UAS-lines used in all experiments were
backcrossed six times into the w1118 genetic background. Male
flies expressing UAS-constructs were crossed to female flies
expressing elavGS, and adult-onset neuronal expression induced
in female progeny by treatment with mifepristone
(RU486;200mM) added to the standard SY medium.
Electrophysiology
Recordings from the GFS of adult flies were made essentially as
described in [77]; a method based on those described by Tanouye
and Wyman (1980) [78] and Gorczyca and Hall (1984) [79]. Flies
were anaesthetized by cooling on ice and secured in wax, ventral
side down, with the wings held outwards in the wax. A tungsten
earth wire (ground electrode) was placed into abdomen; tungsten
electrodes were pushed through the eyes and into the brain to
deliver a 40V pulse for 0.03ms using a Grass S48 stimulator.
Recordings were made from the TTM and contralateral DLM
muscle using glass microelectrodes (resistance: 40–60 MV). The
electrodes were filled with 3M KCl and placed into the muscles
through the cuticle. Responses were amplified using Getting 5A
amplifiers (Getting Instruments, USA) and the data digitized using
an analogue-digital Digidata 1320 and Axoscope 9.0 software
(Axon Instruments, USA). For response latency recordings, at least
5 single stimuli were given with a 5s rest period between each
stimulus; trains of 10 stimuli, at either 100Hz, 200 Hz or 250Hz,
were given a 5s rest interval between each train.
Histology
Lithium treatment protocol
Lithium Chloride was made at 1M concentration and added to
200mM RU486 standard SY medium at a final concentration of
30mM or 100mM.
For neuronal cell loss, adult heads were fixed, dehydrated and
transverse sections were stained with Toluidine blue. Cell bodies
were then counted blind for each genotype.
Lifespan analyses
Quantitative RT–PCR
For all experiments, flies were raised at a standard density on
standard SY medium in 200 mL bottles. Two days after eclosion
once-mated females were transferred to experimental vials
containing SY medium with or without RU486 (200mM) at a
density of 10 flies per vial. Deaths were scored almost every other
day and flies were transferred to fresh food three times a week.
Statistical analyses were performed using JMP (version 7.0)
software (SAS Institute, Cary, NC, USA). Data are presented as
survival curves and analysis was performed using log-rank tests to
compare between groups.
Total RNA was extracted from 20–25 fly heads using Trizol
(GIBCO) according to the manufacturers’ instructions. The
concentration of total RNA purified for each sample was
measured using an eppendorf biophotometer. 1mg of total RNA was
then subjected to DNA digestion using DNAse I (Ambion),
immediately followed by reverse transcription using the Superscript II system (Invitrogen) with oligo(dT) primers. Quantitative
PCR was performed using the PRISM 7000 sequence-detection
system (Applied Biosystems), SYBR Green (Molecular Probes),
ROX Reference Dye (Invitrogen), and Hot Star Taq (Qiagen,
Valencia, CA) by following manufacturers’ instructions. Each
sample was analysed in triplicate with both target gene (Arctic
Ab42) and control gene (RP49) primers in parallel. The primers
for the Ab transgenes were directed to the 59 end and 39 end of the
Ab coding sequence: forward GATCCTTCTCCTGCTAACC;
reverse CACCATCAAGCCAATAATCG. The RP49 primers
were as follows: forward ATGACCATCCGCCCAGCATCAGG;
reverse ATCTCGCCGCAGTAAACG.
Negative Geotaxis Assays
To characterise the adult-onset behavioural effects of Arctic
Ab42 peptide on neuronal function, climbing assays were initially
performed at 25uC according to previously published methods [75].
Climbing ability was analysed every 2–3 days post-RU486
treatment. Briefly, 15 adult flies were placed in a vertical column
(25cm long, 1.5cm diameter) with a conic bottom end, tapped to the
bottom of the column, and their subsequent climb to the top of the
column was analysed. Flies reaching the top and flies remaining at
the bottom of the column after a 45 sec period were counted
separately, and three trials were performed at 1 min intervals for
each experiment. Scores recorded were the mean number of flies at
PLoS Genetics | www.plosgenetics.org
Quantification of total, soluble, and aggregated Ab42
To extract total Ab42, five fly heads were homogenised in 50 ml
GnHCl extraction buffer (5 M Guanidinium HCl, 50 mM Hepes
pH 7.3, protease inhibitor cocktail (Sigma, P8340) and 5mM
15
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
phospho S9/S21 GSK-3 antibody (AB 9331 Cell Signaling) at a 1
in 250 dilution was detected using an anti-rabbit 800 nm
flourophore conjugate (Rockland, USA). Monoclonal antibody,
pan Sgg mouse monoclonal (4G1G) at a 1 in 2000 dilution was a
kind gift from Marc Bourouis, which was subsequently detected
using a 680 nm anti-mouse flourophore conjugate (Invitrogen,
UK). Membranes were sequentially scanned at 700 and 800 nm
using a Licor Odyssey infrared scanner. Densitometric measurements were taken in both wavelengths. Relative phospho-serine 9
Sgg levels were determined by dividing the signal at 800 nm by
that obtained at 700 nm. Details of secondary antibodies and
Odyssey analysis have been previously described in [69].
EDTA), centrifuged at 21,000 g for 5 min at 4uC, and cleared
supernatant retained as the total fly Ab42 sample. Alternatively,
soluble and insoluble pools of Ab42 were extracted using a protocol
adapted from previously published methods [80]: 200 fly heads
were homogenised in 200 ml tissue homogenisation buffer (250mM
sucrose, 20mM Tris base, 1mM EDTA, 1mM EGTA, protease
inhibitor cocktail (Sigma) then mixed further with 200ml DEA buffer
(0.4% DEA, 100mM NaCl and protease inhibitor cocktail). Samples
were centrifuged at 135,000 g for 1 hour at 4uC (Beckman Optima
Max centrifuge, TLA120.1 rotor), and supernatant retained as the
cytosolic, soluble Ab42 fraction. Pellets were further resuspended in
400ml ice-cold formic acid (70%), and sonicated for 2630 sec on ice.
Samples were re-centrifuged at 135,000 g for 1 hour at 4uC, then
210 ml of supernatant diluted with 4ml FA neutralisation buffer (1M
Tris base, 0.5M Na2HPO4, 0.05% NaN3) and retained as the
insoluble, formic acid-extractable Ab42 fraction.
Total, soluble or insoluble Ab42 content was measured in Arctic
mutant Ab42 flies and controls using the hAmyloid b42 ELISA kit
(HS) (The Genetics Company, Switzerland). Total Ab42 samples
were diluted 1:100, and soluble versus insoluble Ab42 samples
diluted 1:10 in sample/standard dilution buffer, then ELISA
performed according to the manufacturers’ instructions. Protein
extracts were quantified using the Bradford protein assay (Bio-Rad
protein assay reagent; Bio-Rad laboratories Ltd (UK)) and the
amount of Ab42 in each sample expressed as a ratio of the total
protein content (pmoles/g total protein). Data are expressed as the
mean 6 SEM obtained in three independent experiments for each
genotype. ANOVAs and Tukey’s-HSD post-hoc analyses were
performed using JMP 7.0 software.
Supporting Information
Figure S1 Neuronal electrophysiology of flies over-expressing
Arctic Ab42 peptide in adulthood. Representative traces for (A)
TTM and DLM response latencies and (B) TTM responses to high
frequency stimulation (100 Hz) measured in elavGS/+;UASArcAb42/+ flies fed with + or 2 RU486 medium at days 16
and 28. TTM and DLM response latency was increased in Arctic
Ab42 over-expressing flies at day 28, but not at day 16 (marked
with arrows). Vertical scale bars, 50 mV (TTM) and 60mV (DLM)
for response latencies, 20 mV for following at 100Hz; horizontal,
2 ms for response latencies, 20ms for following at 100 Hz.
Found at: doi:10.1371/journal.pgen.1001087.s001 (0.11 MB
DOC)
Figure S2 Neuronal cell loss is not evident in flies over-
expressing Arctic Ab42 peptide in adulthood. Cell loss was
quantified at day 21 in elavGS/+;UAS-ArcAb42/+ flies, fed with
+ or 2 RU486 medium and maintained at 27 degrees, by
counting the number of cell bodies per brain hemisphere. No
significant difference was observed when the two genotypes were
compared (student’s t-test), N = 7 per genotype.
Found at: doi:10.1371/journal.pgen.1001087.s002 (0.22 MB
DOC)
Analysis of tau phosphorylation by Phos-tag SDS-PAGE
Fly heads were homogenised in Mes buffer (100 mM Mes,
pH 6.5, 1 M NaCl, 0.5 mM MgCl2, 1 mM EGTA, 10 mM NaF,
Protease inhibitor cocktail [Sigma, P8340] and Phosphatase
inhibitor cocktail 2 [Sigma, P5726]), centrifuged at 20,000 g for
30 minutes at 4uC, then supernatants adjusted to 0.5% bmercaptoethanol, boiled for 5 minutes and re-centrifuged. Cleared
supernatants were then retained as heat-stable soluble tau. Control
samples were dephosphorylated by incubating with l-protein
phosphatase (NEB, P0753) for 3 hours at 30uC.
To detect phosphorylated and non-phosphorylated tau, samples
were separated by SDS-PAGE, using Phos-tag AAL-107 (FMS
laboratory) according to the manufacturers’ instructions. Western
blotting was then performed using a non-phosphorylation
dependent Drosophila rabbit anti-tau antibody (1:5000). Quantitation was performed using Image J software (National Institutes of
Health). Phosphorylated and non-phosphorylated tau was expressed as a percentage of the total amount of tau present in each
sample. ANOVA and Tukey’s-HSD post-hoc analyses were
performed using JMP 7.0 software.
Figure S3 Investigating tau phosphorylation. (A) Western blot
analyses of tau phosphorylation using phos-tag polyacrylamide
gels. Tau showed no changes in phosphorylation in flies expressing
Ab42 (UAS-ArcAb42/GFP;elavGS/+) in comparison to their
2RU controls, and when the Ab42 expressing flies were fed
lithium (+RU +Li). (B) Phospho-Ser262 and Ser356 human tau
antibodies specifically detect tau in fly head homogenates. The
55 kDa tau band is reduced in tau lof/TM6 and absent in tau lof/
tau lof flies compared to w1118 controls.
Found at: doi:10.1371/journal.pgen.1001087.s003 (1.23 MB
DOC)
Figure S4 Full-length Tau (P10636), the longest CNS Tau
isoform (P10636-8) and Drosophila Tau were aligned by Clustal W
alignment. *Shaded in sky and light blue are sites conserved between
human and Drosophila tau that are phosphorylated by GSK-3 in
vitro. The two Ser sites 262 and 356 (light blue) had available human
tau antibodies that detect those conserved sites in Drosophila.
** Shaded in red are likely GSK-3 sites and Abeta sites (212 and
214 for Abeta) that we had available antibodies for and tested in
Drosophila, but did not work since they are not conserved. ***Shaded
in yellow is an Abeta site (Ser 422) that is conserved in Drosophila,
which we had an antibody for; Ser 262 is also a likely Abeta site.
Found at: doi:10.1371/journal.pgen.1001087.s004 (0.03 MB
DOC)
Western blotting
Drosophila heads were pooled and homogenised in 26Laemmli
sample buffer containing b-mercaptoethanol and boiled for
10 mins. Proteins were separated on SDS polyacrylamide gels
and blotted onto nitrocellulose. Membranes were incubated in a
blocking solution containing 5% milk proteins either in TBST for
1hr at room temperature for Tau blot or in PBST for 20 min for
Sgg blot, then probed with primary antibodies overnight at 4uC.
Mouse anti-actin antibody (Santacruz) was used at a 1 in 1000
dilution. Tau antibody (rabbit) was a kind gift from Nick Lowe,
and used at a 1 in 2000 dilution. Rabbit anti-phospho S262 and
S356 (Abcam) were used at a dilution of 1:1000 in 5% BSA TBST.
Quantitation was performed using Image J software. Rabbit antiPLoS Genetics | www.plosgenetics.org
Figure S5 Reduction in tau levels does not affect amyloid levels
of Arctic Ab42 flies. Protein levels of UAS-ArcAb42/+;elavGS
Tau EP3203/Tau Dfc to UAS-ArcAb42/+;elavGS Tau EP3203/
16
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
TM6 flies flies on +RU486 SY medium, were measured by ELISA
at 21 days post-induction. Data are presented as the average
protein concentration, 6 standard error of mean, data were
compared using one-way ANOVA and student t-test, number of
independent tests (n) = 3. No significant difference was seen in the
levels of Ab42.
Found at: doi:10.1371/journal.pgen.1001087.s005 (0.08 MB
DOC)
(CNRS, France) for kind donation of elavGS fly stocks, Dr. N. Lowe
(University of Cambridge) for the Drosophila tau antibody, Dr. M. Bourouis
(CNRS, France) for the pan-Sgg antibody, and Dr. J. Fitzgerald (Institute
of Neurology, UCL) for advice on using the phos-tag methods.
Author Contributions
Conceived and designed the experiments: OS FK IR SL LP. Performed
the experiments: OS FK IR RK HA CG MJA. Analyzed the data: OS FK
IR RK HA CG MJA. Contributed reagents/materials/analysis tools: OS
FK MJA. Wrote the paper: OS FK IR JH SL LP.
Acknowledgments
We thank Dr. D. Crowther (University of Cambridge) for helpful
discussions and kind donation of UAS-Ab42 fly stocks, Dr. H. Tricoire
References
1. Spires TL, Hyman BT (2005) Transgenic models of Alzheimer’s disease:
learning from animals. NeuroRx 2: 423–437.
2. Selkoe DJ, Schenk D (2003) Alzheimer’s disease: molecular understanding
predicts amyloid-based therapeutics. Annu Rev Pharmacol Toxicol 43:
545–584.
3. Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, et al. (1998) Association
of missense and 59-splice-site mutations in tau with the inherited dementia
FTDP-17. Nature 393: 702–705.
4. Rizzu P, Van Swieten JC, Joosse M, Hasegawa M, Stevens M, et al. (1999) High
prevalence of mutations in the microtubule-associated protein tau in a
population study of frontotemporal dementia in the Netherlands. Am J Hum
Genet 64: 414–421.
5. Lewis J, Dickson DW, Lin WL, Chisholm L, Corral A, et al. (2001) Enhanced
neurofibrillary degeneration in transgenic mice expressing mutant tau and APP.
Science 293: 1487–1491.
6. Oddo S, Billings L, Kesslak JP, Cribbs DH, LaFerla FM (2004) Abeta
immunotherapy leads to clearance of early, but not late, hyperphosphorylated
tau aggregates via the proteasome. Neuron 43: 321–332.
7. Oddo S, Caccamo A, Cheng D, Jouleh B, Torp R, et al. (2007) Genetically
augmenting tau levels does not modulate the onset or progression of Abeta
pathology in transgenic mice. J Neurochem 102: 1053–1063.
8. Roberson ED, Scearce-Levie K, Palop JJ, Yan F, Cheng IH, et al. (2007)
Reducing endogenous tau ameliorates amyloid beta-induced deficits in an
Alzheimer’s disease mouse model. Science 316: 750–754.
9. Muyllaert D, Kremer A, Jaworski T, Borghgraef P, Devijver H, et al. (2008)
Glycogen synthase kinase-3beta, or a link between amyloid and tau pathology?
Genes Brain Behav 7 Suppl 1: 57–66.
10. Wang ZF, Li HL, Li XC, Zhang Q, Tian Q, et al. (2006) Effects of endogenous
beta-amyloid overproduction on tau phosphorylation in cell culture.
J Neurochem 98: 1167–1175.
11. Forde JE, Dale TC (2007) Glycogen synthase kinase 3: a key regulator of cellular
fate. Cell Mol Life Sci 64: 1930–1944.
12. Phiel CJ, Wilson CA, Lee VM, Klein PS (2003) GSK-3alpha regulates
production of Alzheimer’s disease amyloid-beta peptides. Nature 423: 435–439.
13. Lochhead PA, Kinstrie R, Sibbet G, Rawjee T, Morrice N, et al. (2006) A
chaperone-dependent GSK-3beta transitional intermediate mediates activationloop autophosphorylation. Mol Cell 24: 627–633.
14. Terwel D, Muyllaert D, Dewachter I, Borghgraef P, Croes S, et al. (2008)
Amyloid activates GSK-3beta to aggravate neuronal tauopathy in bigenic mice.
Am J Pathol 172: 786–798.
15. Ryves WJ, Harwood AJ (2001) Lithium inhibits glycogen synthase kinase-3 by
competition for magnesium. Biochem Biophys Res Commun 280: 720–725.
16. Chalecka-Franaszek E, Chuang DM (1999) Lithium activates the serine/
threonine kinase Akt-1 and suppresses glutamate-induced inhibition of Akt-1
activity in neurons. Proc Natl Acad Sci U S A 96: 8745–8750.
17. Rockenstein E, Torrance M, Adame A, Mante M, Bar-on P, et al. (2007)
Neuroprotective effects of regulators of the glycogen synthase kinase-3beta
signaling pathway in a transgenic model of Alzheimer’s disease are associated with
reduced amyloid precursor protein phosphorylation. J Neurosci 27: 1981–1991.
18. Noble W, Planel E, Zehr C, Olm V, Meyerson J, et al. (2005) Inhibition of
glycogen synthase kinase-3 by lithium correlates with reduced tauopathy and
degeneration in vivo. Proc Natl Acad Sci U S A 102: 6990–6995.
19. Caccamo A, Oddo S, Tran LX, LaFerla FM (2007) Lithium reduces tau
phosphorylation but not A beta or working memory deficits in a transgenic
model with both plaques and tangles. Am J Pathol 170: 1669–1675.
20. Mershin A, Pavlopoulos E, Fitch O, Braden BC, Nanopoulos DV, et al. (2004)
Learning and memory deficits upon TAU accumulation in Drosophila
mushroom body neurons. Learn Mem 11: 277–287.
21. Ubhi KK, Shaibah H, Newman TA, Shepherd D, Mudher A (2007) A
comparison of the neuronal dysfunction caused by Drosophila tau and human
tau in a Drosophila model of tauopathies. Invert Neurosci 7: 165–171.
22. Wittmann CW, Wszolek MF, Shulman JM, Salvaterra PM, Lewis J, et al. (2001)
Tauopathy in Drosophila: neurodegeneration without neurofibrillary tangles.
Science 293: 711–714.
PLoS Genetics | www.plosgenetics.org
23. Ruel L, Bourouis M, Heitzler P, Pantesco V, Simpson P (1993) Drosophila
shaggy kinase and rat glycogen synthase kinase-3 have conserved activities and
act downstream of Notch. Nature 362: 557–560.
24. Jackson GR, Wiedau-Pazos M, Sang TK, Wagle N, Brown CA, et al. (2002)
Human wild-type tau interacts with wingless pathway components and produces
neurofibrillary pathology in Drosophila. Neuron 34: 509–519.
25. Mudher A, Shepherd D, Newman TA, Mildren P, Jukes JP, et al. (2004) GSK3beta inhibition reverses axonal transport defects and behavioural phenotypes in
Drosophila. Mol Psychiatry 9: 522–530.
26. Finelli A, Kelkar A, Song HJ, Yang H, Konsolaki M (2004) A model for studying
Alzheimer’s Abeta42-induced toxicity in Drosophila melanogaster. Mol Cell
Neurosci 26: 365–375.
27. Crowther DC, Page R, Chandraratna D, Lomas DA (2006) A Drosophila model
of Alzheimer’s disease. Methods Enzymol 412: 234–255.
28. Iijima K, Liu HP, Chiang AS, Hearn SA, Konsolaki M, et al. (2004) Dissecting
the pathological effects of human Abeta40 and Abeta42 in Drosophila: a
potential model for Alzheimer’s disease. Proc Natl Acad Sci U S A 101:
6623–6628.
29. Rosen DR, Martin-Morris L, Luo LQ, White K (1989) A Drosophila gene
encoding a protein resembling the human beta-amyloid protein precursor. Proc
Natl Acad Sci U S A 86: 2478–2482.
30. Osterwalder T, Yoon KS, White BH, Keshishian H (2001) A conditional tissuespecific transgene expression system using inducible GAL4. Proc Natl Acad
Sci U S A 98: 12596–12601.
31. McGuire SE, Mao Z, Davis RL (2004) Spatiotemporal gene expression targeting
with the TARGET and gene-switch systems in Drosophila. Sci STKE 2004: pl6.
32. Latouche M, Lasbleiz C, Martin E, Monnier V, Debeir T, et al. (2007) A
conditional pan-neuronal Drosophila model of spinocerebellar ataxia 7 with a
reversible adult phenotype suitable for identifying modifier genes. J Neurosci 27:
2483–2492.
33. Crowther DC, Kinghorn KJ, Miranda E, Page R, Curry JA, et al. (2005)
Intraneuronal Abeta, non-amyloid aggregates and neurodegeneration in a
Drosophila model of Alzheimer’s disease. Neuroscience 132: 123–135.
34. Bharadwaj PR, Dubey AK, Masters CL, Martins RN, Macreadie IG (2009)
Abeta aggregation and possible implications in Alzheimer’s disease pathogenesis.
J Cell Mol Med 13: 412–421.
35. Nilsberth C, Westlind-Danielsson A, Eckman CB, Condron MM, Axelman K,
et al. (2001) The ‘Arctic’ APP mutation (E693G) causes Alzheimer’s disease by
enhanced Abeta protofibril formation. Nat Neurosci 4: 887–893.
36. Feany MB, Bender WW (2000) A Drosophila model of Parkinson’s disease.
Nature 404: 394–398.
37. Papadopoulou D, Bianchi MW, Bourouis M (2004) Functional studies of
shaggy/glycogen synthase kinase 3 phosphorylation sites in Drosophila
melanogaster. Mol Cell Biol 24: 4909–4919.
38. Bourouis M (2002) Targeted increase in shaggy activity levels blocks wingless
signaling. Genesis 34: 99–102.
39. Kinoshita E, Kinoshita-Kikuta E, Takiyama K, Koike T (2006) Phosphatebinding tag, a new tool to visualize phosphorylated proteins. Mol Cell
Proteomics 5: 749–757.
40. Oh H, Irvine KD (2008) In vivo regulation of Yorkie phosphorylation and
localization. Development 135: 1081–1088.
41. Hanger DP, Byers HL, Wray S, Leung KY, Saxton MJ, et al. (2007) Novel
phosphorylation sites in tau from Alzheimer brain support a role for casein
kinase 1 in disease pathogenesis. J Biol Chem 282: 23645–23654.
42. Hanger DP, Anderton BH, Noble W (2009) Tau phosphorylation: the
therapeutic challenge for neurodegenerative disease. Trends Mol Med 15:
112–119.
43. Gotz J, Chen F, van Dorpe J, Nitsch RM (2001) Formation of neurofibrillary
tangles in P301l tau transgenic mice induced by Abeta 42 fibrils. Science 293:
1491–1495.
44. Perez M, Ribe E, Rubio A, Lim F, Moran MA, et al. (2005) Characterization of
a double (amyloid precursor protein-tau) transgenic: tau phosphorylation and
aggregation. Neuroscience 130: 339–347.
17
September 2010 | Volume 6 | Issue 9 | e1001087
GSK-3 Inhibition Ameliorates Ab Pathology
45. Pennanen L, Gotz J (2005) Different tau epitopes define Abeta42-mediated tau
insolubility. Biochem Biophys Res Commun 337: 1097–1101.
46. Doerflinger H, Benton R, Shulman JM, St Johnston D (2003) The role of PAR-1
in regulating the polarised microtubule cytoskeleton in the Drosophila follicular
epithelium. Development 130: 3965–3975.
47. Su Y, Ryder J, Li B, Wu X, Fox N, et al. (2004) Lithium, a common drug for
bipolar disorder treatment, regulates amyloid-beta precursor protein processing.
Biochemistry 43: 6899–6908.
48. Hanger DP, Hughes K, Woodgett JR, Brion JP, Anderton BH (1992) Glycogen
synthase kinase-3 induces Alzheimer’s disease-like phosphorylation of tau:
generation of paired helical filament epitopes and neuronal localisation of the
kinase. Neurosci Lett 147: 58–62.
49. Mandelkow EM, Drewes G, Biernat J, Gustke N, Van Lint J, et al. (1992)
Glycogen synthase kinase-3 and the Alzheimer-like state of microtubuleassociated protein tau. FEBS Lett 314: 315–321.
50. Lovestone S, Reynolds CH, Latimer D, Davis DR, Anderton BH, et al. (1994)
Alzheimer’s disease-like phosphorylation of the microtubule-associated protein
tau by glycogen synthase kinase-3 in transfected mammalian cells. Curr Biol 4:
1077–1086.
51. Brownlees J, Irving NG, Brion JP, Gibb BJ, Wagner U, et al. (1997) Tau
phosphorylation in transgenic mice expressing glycogen synthase kinase-3beta
transgenes. Neuroreport 8: 3251–3255.
52. Lucas JJ, Hernandez F, Gomez-Ramos P, Moran MA, Hen R, et al. (2001)
Decreased nuclear beta-catenin, tau hyperphosphorylation and neurodegeneration in GSK-3beta conditional transgenic mice. Embo J 20: 27–39.
53. McGowan E, Eriksen J, Hutton M (2006) A decade of modeling Alzheimer’s
disease in transgenic mice. Trends Genet 22: 281–289.
54. Magrane J, Rosen KM, Smith RC, Walsh K, Gouras GK, et al. (2005)
Intraneuronal beta-amyloid expression downregulates the Akt survival pathway
and blunts the stress response. J Neurosci 25: 10960–10969.
55. Folwell J, Cowan CM, Ubhi KK, Shiabh H, Newman TA, et al. Abeta
exacerbates the neuronal dysfunction caused by human tau expression in a
Drosophila model of Alzheimer’s disease. Exp Neurol 223: 401–409.
56. Joutel A, Tournier-Lasserve E (1998) Notch signalling pathway and human
diseases. Semin Cell Dev Biol 9: 619–625.
57. Dierick H, Bejsovec A (1999) Cellular mechanisms of wingless/Wnt signal
transduction. Curr Top Dev Biol 43: 153–190.
58. Drewes G, Ebneth A, Preuss U, Mandelkow EM, Mandelkow E (1997) MARK,
a novel family of protein kinases that phosphorylate microtubule-associated
proteins and trigger microtubule disruption. Cell 89: 297–308.
59. Nishimura I, Yang Y, Lu B (2004) PAR-1 kinase plays an initiator role in a
temporally ordered phosphorylation process that confers tau toxicity in
Drosophila. Cell 116: 671–682.
60. Iijima K, Gatt A, Iijima-Ando K (2010) Tau Ser262 phosphorylation is critical
for A{beta}42-induced tau toxicity in a transgenic Drosophila model of
Alzheimer’s disease. Hum Mol Genet. epub ahead of print.
61. Gomez de Barreda E, Perez M, Gomez Ramos P, de Cristobal J, MartinMaestro P, et al. Tau-knockout mice show reduced GSK-3-induced hippocampal degeneration and learning deficits. Neurobiol Dis 37: 622–629.
62. Iwata N, Tsubuki S, Takaki Y, Shirotani K, Lu B, et al. (2001) Metabolic
regulation of brain Abeta by neprilysin. Science 292: 1550–1552.
63. Farris W, Mansourian S, Chang Y, Lindsley L, Eckman EA, et al. (2003) Insulindegrading enzyme regulates the levels of insulin, amyloid beta-protein, and the
beta-amyloid precursor protein intracellular domain in vivo. Proc Natl Acad
Sci U S A 100: 4162–4167.
PLoS Genetics | www.plosgenetics.org
64. Miller BC, Eckman EA, Sambamurti K, Dobbs N, Chow KM, et al. (2003)
Amyloid-beta peptide levels in brain are inversely correlated with insulysin
activity levels in vivo. Proc Natl Acad Sci U S A 100: 6221–6226.
65. Eckman EA, Watson M, Marlow L, Sambamurti K, Eckman CB (2003)
Alzheimer’s disease beta-amyloid peptide is increased in mice deficient in
endothelin-converting enzyme. J Biol Chem 278: 2081–2084.
66. Melchor JP, Pawlak R, Strickland S (2003) The tissue plasminogen activatorplasminogen proteolytic cascade accelerates amyloid-beta (Abeta) degradation
and inhibits Abeta-induced neurodegeneration. J Neurosci 23: 8867–8871.
67. Leissring MA, Farris W, Chang AY, Walsh DM, Wu X, et al. (2003) Enhanced
proteolysis of beta-amyloid in APP transgenic mice prevents plaque formation,
secondary pathology, and premature death. Neuron 40: 1087–1093.
68. Ho L, Qin W, Pompl PN, Xiang Z, Wang J, et al. (2004) Diet-induced insulin
resistance promotes amyloidosis in a transgenic mouse model of Alzheimer’s
disease. Faseb J 18: 902–904.
69. Killick R, Scales G, Leroy K, Causevic M, Hooper C, et al. (2009) Deletion of
Irs2 reduces amyloid deposition and rescues behavioural deficits in APP
transgenic mice. Biochem Biophys Res Commun 386: 257–262.
70. Iijima-Ando K, Hearn SA, Granger L, Shenton C, Gatt A, et al. (2008)
Overexpression of neprilysin reduces alzheimer amyloid-beta42 (Abeta42)induced neuron loss and intraneuronal Abeta42 deposits but causes a reduction
in cAMP-responsive element-binding protein-mediated transcription, agedependent axon pathology, and premature death in Drosophila. J Biol Chem
283: 19066–19076.
71. Tsuda M, Kobayashi T, Matsuo T, Aigaki T Insulin-degrading enzyme
antagonizes insulin-dependent tissue growth and Abeta-induced neurotoxicity in
Drosophila. FEBS Lett.
72. He B, Meng YH, Mivechi NF (1998) Glycogen synthase kinase 3beta and
extracellular signal-regulated kinase inactivate heat shock transcription factor 1
by facilitating the disappearance of transcriptionally active granules after heat
shock. Mol Cell Biol 18: 6624–6633.
73. Cohen E, Bieschke J, Perciavalle RM, Kelly JW, Dillin A (2006) Opposing
activities protect against age-onset proteotoxicity. Science 313: 1604–1610.
74. Allen MJ, Godenschwege TA, Tanouye MA, Phelan P (2006) Making an escape:
development and function of the Drosophila giant fibre system. Semin Cell Dev
Biol 17: 31–41.
75. Rival T, Soustelle L, Strambi C, Besson MT, Iche M, et al. (2004) Decreasing
glutamate buffering capacity triggers oxidative stress and neuropil degeneration
in the Drosophila brain. Curr Biol 14: 599–605.
76. Ganetzky B, Flanagan JR (1978) On the relationship between senescence and
age-related changes in two wild-type strains of Drosophila melanogaster. Exp
Gerontol 13: 189–196.
77. Allen MJ, Shan X, Caruccio P, Froggett SJ, Moffat KG, et al. (1999) Targeted
expression of truncated glued disrupts giant fiber synapse formation in
Drosophila. J Neurosci 19: 9374–9384.
78. Tanouye MA, Wyman RJ (1980) Motor outputs of giant nerve fiber in
Drosophila. J Neurophysiol 44: 405–421.
79. Gorczyca M, Hall JC (1984) Identification of a cholinergic synapse in the giant
fiber pathway of Drosophila using conditional mutations of acetylcholine
synthesis. J Neurogenet 1: 289–313.
80. Burns M, Gaynor K, Olm V, Mercken M, LaFrancois J, et al. (2003) Presenilin
redistribution associated with aberrant cholesterol transport enhances betaamyloid production in vivo. J Neurosci 23: 5645–5649.
18
September 2010 | Volume 6 | Issue 9 | e1001087