Tissue-specific gene silencing monitored in circulating
RNA
The MIT Faculty has made this article openly available. Please share
how this access benefits you. Your story matters.
Citation
Sehgal, A., Q. Chen, D. Gibbings, D. W. Y. Sah, and D. Bumcrot.
“Tissue-Specific Gene Silencing Monitored in Circulating RNA.”
RNA 20, no. 2 (February 1, 2014): 143–149.
As Published
http://dx.doi.org/10.1261/rna.042507.113
Publisher
Cold Spring Harbor Laboratory Press
Version
Final published version
Accessed
Thu May 26 06:50:11 EDT 2016
Citable Link
http://hdl.handle.net/1721.1/87563
Terms of Use
Creative Commons Attribution-Noncommerical
Detailed Terms
http://creativecommons.org/licenses/by-nc/3.0/
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
Tissue-specific gene silencing monitored in circulating RNA
Alfica Sehgal, Qingmin Chen, Derrick Gibbings, et al.
RNA 2014 20: 143-149 originally published online December 19, 2013
Access the most recent version at doi:10.1261/rna.042507.113
Supplemental
Material
References
Open Access
Creative
Commons
License
Email Alerting
Service
http://rnajournal.cshlp.org/content/suppl/2013/12/04/rna.042507.113.DC1.html
This article cites 26 articles, 5 of which can be accessed free at:
http://rnajournal.cshlp.org/content/20/2/143.full.html#ref-list-1
Freely available online through the RNA Open Access option.
This article, published in RNA, is available under a Creative Commons License
(Attribution-NonCommercial 3.0 Unported), as described at
http://creativecommons.org/licenses/by-nc/3.0/.
Receive free email alerts when new articles cite this article - sign up in the box at the top
right corner of the article or click here.
To subscribe to RNA go to:
http://rnajournal.cshlp.org/subscriptions
© 2014 Sehgal et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
REPORT
Tissue-specific gene silencing monitored in circulating RNA
ALFICA SEHGAL,1,4 QINGMIN CHEN,1 DERRICK GIBBINGS,2 DINAH W.Y. SAH,1 and DAVID BUMCROT3
1
Alnylam Pharmaceuticals, Incorporated, Cambridge, Massachusetts 02142, USA
Department of Cellular and Molecular Medicine, University of Ottawa, Ontario K1H8M5, Canada
3
Koch Institute for Integrative Cancer Research at MIT, Cambridge, Massachusetts 02139, USA
2
ABSTRACT
Pharmacologic target gene modulation is the primary objective for RNA antagonist strategies and gene therapy. Here we show that
mRNAs encoding tissue-specific gene transcripts can be detected in biological fluids and that RNAi-mediated target gene silencing
in the liver and brain results in quantitative reductions in serum and cerebrospinal fluid mRNA levels, respectively. Further,
administration of an anti-miRNA oligonucleotide resulted in decreased levels of the miRNA in circulation. Moreover, ectopic
expression of an adenoviral transgene in the liver was quantified based on measurement of serum mRNA levels. This
noninvasive method for monitoring tissue-specific RNA modulation could greatly advance the clinical development of RNAbased therapeutics.
Keywords: RNAi; circulating RNA; exosome; gene silencing; in vivo delivery
INTRODUCTION
Previously, it has been shown that messenger RNAs and micro
RNAs derived from various tissues can be detected in circulation (Kamm and Smith 1972; Hunter et al. 2008). The circulating RNA is associated with vesicular structures, such as
exosomes, and other ribonucleoprotein particles and is thereby protected from nucleolytic degradation (Smalheiser 2007).
While the function of circulating RNA remains incompletely
described, it has been suggested that it plays a role in intercellular signaling in normal and diseased states (Smalheiser 2007;
Valadi et al. 2007; Hood et al. 2011; Record et al. 2011). In addition, it has been proposed that circulating RNA can be useful
in diagnostic applications in different disease settings (Chan
et al. 2003; O’Driscoll 2007; Conde-Vancells et al. 2008;
Raimondo et al. 2011). However, the quantification of circulating mRNA and micro-RNA (miRNA) as a method for monitoring tissue-specific RNA modulation remains to be
described.
Here we demonstrate that RNAi-mediated target gene silencing in the liver by systemic administration of siRNA results in quantitative reductions in serum mRNA levels that
closely corroborate with the degree and kinetics of tissue
mRNA silencing, including proof of the RNAi mechanism
of action. Further, administration of an anti-miRNA oligonucleotide directed against a liver-specific miRNA was found
to result in decreased levels of the miRNA in circulation.
4
Corresponding author
E-mail asehgal@alnylam.com
Article published online ahead of print. Article and publication date are at
http://www.rnajournal.org/cgi/doi/10.1261/rna.042507.113. Freely available
online through the RNA Open Access option.
Another application of this technique was demonstrated by
quantification of liver expression of an adenoviral transgene
using circulating mRNA. Finally, this technique was extended
to a different tissue, where silencing of a brain-expressed
mRNA was monitored and quantified in cerebrospinal fluid
(CSF) following intraparenchymal CNS infusion of a specific
siRNA.
RESULTS AND DISCUSSION
To confirm that liver-specific mRNAs can be detected in serum, filtered rat serum was subjected to high-speed centrifugation, and total RNA was isolated from the resulting pellet.
To maximize recovery of RNA, LiCl was added to a final concentration of 1 M prior to centrifugation. As shown in Figure
1A, mRNAs corresponding to the liver-expressed genes Ttr,
Serpina1, Alb, and FVII could be detected by reverse-transcription quantitative PCR (RT-qPCR). In addition, mRNA
derived from the ubiquitously expressed gene Gapdh was detected. Similarly, TTR, SERPINA1, and GAPDH mRNA
could be detected in RNA isolated from cynomolgus monkey
(Macaca fascicularis) and human serum processed in a comparable manner (Fig. 1B). Between fourfold and 15-fold
higher levels of Gapdh, Alb, Actb, and Ttr mRNA were detected in rat serum samples prepared with, versus without, LiCl
addition, indicating the importance of this step in the procedure (Fig. 1C). We could also measure levels of liver- and tumor-specific transcripts in serum obtained from patients
© 2014 Sehgal et al. This article, published in RNA, is available under a
Creative Commons License (Attribution-NonCommercial 3.0 Unported),
as described at http://creativecommons.org/licenses/by-nc/3.0/.
RNA 20:143–149; Published by Cold Spring Harbor Laboratory Press for the RNA Society
143
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
Sehgal et al.
FIGURE 1. Detection of specific RNAs in serum from multiple species. (A) Relative levels of liver-specific (Ttr, Serpina1, Alb, FVII) and ubiquitous
(Gapdh) mRNAs, measured by qPCR in RNA isolated from filtered, centrifuged rat serum. Values are relative to Gapdh levels. Rat serum was pooled
from three animals for this analysis; error bars, SD in experimental replicates. (B) Similar analysis of human and cynomolgus monkey (Macaca fascicularis) circulating RNA. Data shown are from one pooled human or monkey sample; error bars, SD among experimental replicates. (C ) Two rat serum
samples (S1, 3 mL; S2, 3.5 mL) were processed for circulating RNA isolation with or without LiCl addition. Relative levels of four different mRNAs were
measured by qPCR (normalized to Gapdh level in the “no LiCl” sample S1). (D) Relative mRNA levels of liver-specific genes TTR and albumin (Alb) as
well as tumor-specific genes AFP and GPC3 as measured by qPCR in RNA isolated from a 75-yr-old male patient with metastatic liver cancer.
with liver tumors, suggesting that this method can be extended into diseased tissues (Fig. 1D). Both α-fetoprotein (AFP)
and glypican-3 (GPC3) are commonly expressed in hepatocellular carcinoma and serve as diagnostic serum protein
markers (Bertino et al. 2012). As expected, the mRNA for
AFP and GPC3 were not detected in normal human plasma
samples (data not shown).
Since liver-specific mRNAs were found in circulation, we
next asked whether siRNA-mediated gene silencing in liver
would result in corresponding reductions in serum mRNA
levels for the specific genes targeted. Accordingly, rats were
treated with a single intravenous dose of 0.3 mg/kg lipid
nanoparticle (LNP) formulated siRNA targeting Ttr, a liverexpressed gene with a well-established role in human disease
(Saraiva 1995). Control animals received LNP-formulated luciferase siRNA. As shown in Figure 2A, treatment with LNPformulated Ttr siRNA resulted in 96 ± 1% (mean ± SD) inhibition of liver Ttr mRNA, normalized to Gapdh, in treated animals 24 h following administration. Regarding mRNA levels
from serum, administration of the LNP-formulated Ttr
siRNA resulted in a 94 ± 2% reduction in circulating Ttr
mRNA (normalized to Serpina1). These results were extended
to a second liver-specific target gene, Tmprss6 (Finberg et al.
144
RNA, Vol. 20, No. 2
2008), which encodes a transmembrane protein whose levels
cannot be measured in blood. Specifically, a single intravenous dose of 0.3 mg/kg LNP-formulated siRNA targeting
Tmprss6 resulted in reductions of 90 ± 1.3% in Tmprss6
mRNA in the liver and 95 ± 2.5% in serum 24 h after administration (Fig. 2B). Thus, siRNA-mediated silencing of liverexpressed genes results in a concomitant reduction in circulating mRNA levels that can be readily detected by analyzing
total RNA obtained by high-speed centrifugation of serum.
These coordinated tissue- and target-specific mRNA reductions validate the method of circulating extracellular mRNA
detection (cERD). In addition to mRNAs, miRNAs have
been detected in circulation (Hunter et al. 2008). To test
the applicability of cERD to monitor the activity of miRNAtargeting oligonucleotides, rats were treated with an LNP-formulated oligonucleotide directed against the liver-specific
miRNA miR-122 (anti-miR) (Krutzfeldt et al. 2005; Esau
et al. 2006); control animals received a mismatched oligonucleotide (MM). Three days later, miR-122 levels were
measured in total RNA isolated from liver and serum. As
shown in Figure 2C, treatment with the miR122-specific oligonucleotide reduced liver miR-122 levels by 88 ± 5% compared with treatment with MM. In serum, a similar decrease
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
Circulating RNA quantification of gene modulation
FIGURE 2. Silencing of liver mRNA is reflected in circulating mRNA levels. (A) Silencing of rat liver and serum Ttr 48 h after intravenous administration of 0.3 mg/kg LNP-formulated Ttr siRNA (si-TTR) or Luc siRNA (si-Luc). Levels of Ttr were normalized to Gapdh (liver) or Serpina1 (serum)
levels. Group averages, relative to the si-Luc group, are shown (n = 6 per group). (B) Silencing of rat liver and serum Tmprss6 48 h after intravenous
administration of 0.3 mg/kg LNP-formulated Tmprss6 siRNA (si-TMPRSS6) or Luc siRNA (si-Luc). Levels of Tmprss6 were normalized to Gapdh
(liver) or Serpina1 (serum) levels. Group averages, relative to the si-Luc group, are shown (n = 6 per group). (C) Relative levels of miR-122 detected
by qPCR in equal amounts of total RNA isolated from rat liver or from filtered, centrifuged rat serum obtained 3 d following intravenous administration of 1 mg/kg LNP-formulated oligonucleotide targeting miR-122 (anti-miR). Group averages compared to a control group receiving 1 mg/kg
LNP-formulated mismatch control oligonucleotide (MM) are shown (n = 5 per group). Significance was determined by Student’s t-test (∗ P < 0.05).
(D) Dose-dependent silencing of cynomolgus monkey (M. fascicularis) liver and serum TTR 48 h after intravenous administration of indicated doses
(mg/kg) of LNP-formulated TTR siRNA (si-TTR). Levels of TTR were normalized to GAPDH (liver) or SERPINA1 (serum) levels. Group averages,
relative to a 3 mg/kg LNP-Luc siRNA-treated control group (si-Luc), are shown (n = 3 per group). Significance relative to the Luc siRNA treated controls was determined by ANOVA (#P < 0.005, †P < 0.05). (E) Relative levels of Snca measured by qPCR in total RNA isolated from the striatum, or
from centrifuged cerebrospinal fluid (CSF) of rats following intraparenchymal CNS infusion of Snca siRNA (siSNCA; n = 27). Snca levels were normalized to Gapdh. Group averages relative to naïve animals (n = 4) are shown. Significance was determined by Student’s t-test (∗ P < 0.001, #P < 0.05).
Error bars, SDs for each group.
(86 ± 9%) was measured, thus establishing the use of cERD
to monitor miRNA inhibition.
A TTR silencing study was conducted in the cynomolgus
monkey (M. fascicularis) to extend these results to higher species. Animals were administered LNP-formulated, TTR-specific siRNA by intravenous infusion at doses of 0.3, 1, and 3
mg/kg; control animals received LNP-formulated luciferase
siRNA (3 mg/kg). Forty-eight hours after LNP-siRNA administration, blood was drawn, and then liver samples were
obtained for analysis. As shown in Figure 2D, liver TTR
mRNA levels were decreased by 34 ± 18% (P < 0.005), 47 ±
15% (P < 0.005), and 59 ± 4% (P < 0.05) following treatment
with 0.3, 1, and 3 mg/kg TTR siRNA, respectively. As monitored by cERD, circulating TTR mRNA levels (normalized to
SERPINA1) were reduced by 40 ± 6% (not significant) and
70 ± 8% (P < 0.005) in the 1 mg/kg and 3 mg/kg dose groups,
respectively, but were unchanged in the 0.3 mg/kg dose
group. Taken together with the rat studies, these data establish the applicability of the cERD method in higher species
and thus the general utility of measuring circulating serum
mRNA to confirm liver gene silencing induced by administered siRNA.
Circulating RNA has also been detected in CSF (Harrington et al. 2009). To determine whether cERD could be applied
to CSF to monitor gene silencing in the brain, we infused
siRNA targeting a Parkinson’s disease–associated gene, Snca
(Spillantini et al. 1997), bilaterally into the striatum of rats.
At the end of the 7-d infusion period, brains and CSF were
collected for analysis. Consistent with previous studies demonstrating gene silencing in neuronal cells by intraparenchymal CNS siRNA infusion (Lewis et al. 2008; Querbes et al.
2009), a 33 ± 13% reduction in striatal Snca mRNA was measured in animals receiving the Snca siRNA compared with
naïve animals. To analyze CSF RNA, pooled samples were
subjected to high-speed centrifugation, and total RNA was
isolated from the pellets. A 61 ± 17% reduction in Snca
mRNA was measured in CSF from Snca siRNA-treated animals versus controls (Fig. 2E). The greater relative degree of
Snca mRNA reduction in the CSF compared with the striatum
could be due to variability in the release of RNA by different
www.rnajournal.org
145
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
Sehgal et al.
regions or cell types of the brain. Regardless, these results confirm the suitability of cERD to monitor silencing of a brainexpressed gene by assaying CSF RNA.
Previous studies have established that administration of
a single dose of LNP-formulated siRNA leads to rapid and
durable target gene silencing in the livers of rodents and
primates (Frank-Kamenetsky et al. 2008; Akinc et al. 2010;
Love et al. 2010). To compare the kinetics of siRNA treatment on levels of circulating and liver mRNA, rats were given
a single dose of 0.1 mg/kg LNP-formulated Ttr siRNA, and
serum and livers were collected 1, 2, 5, 8, 10, and 14 d later;
control animals received LNP-luciferase siRNA. As shown in
Figure 3A, maximal inhibition of Ttr mRNA in the liver (95 ±
2%, normalized to Gapdh) and in serum (92 ± 8%, normalized to Serpina1) as monitored by cERD was observed 1 d
following administration of LNP-siRNA targeting Ttr. This
effect was maintained 2 d post-treatment and returned to
near control levels (as assessed by LNP-siRNA targeting luciferase) by day 10. In a second study, reductions in liver
and serum Ttr mRNA were measured at earlier time points
following siRNA administration. Within 3 h of treatment,
both liver and serum Ttr mRNA levels were reduced by
40%–50%, with peak target reductions of ∼90% achieved
in liver and serum by 12 h (Fig. 3B). Thus, there is a remarkable concordance of the relative Ttr mRNA levels in the liver
and in serum as measured over time following treatment
with LNP-siRNA, with respect to both onset and duration
of target gene silencing. These results support the conclusion
that monitoring circulating mRNA levels of a liver gene by
cERD provides an accurate representation of tissue-specific
target gene silencing.
A modified RACE-PCR technique has been used to confirm the RNA interference mechanism by identification of
the predicted siRNA cleavage product in a number of preclinical and clinical studies (Zimmermann et al. 2006; Frank-
Kamenetsky et al. 2008; Querbes et al. 2009; Davis et al.
2010), including detection of circulating siRNA cleavage in
a recent clinical trial (Coelho et al. 2013). To investigate
whether RNAi in the liver could be demonstrated in circulating RNA, serum was collected from rats 24 h after treatment
with LNP-formulated Ttr siRNA (or luciferase siRNA control) and processed as described above to obtain circulating
RNA. Products generated by the modified RACE-PCR method were cloned, and individual colonies were selected for
sequencing. Out of 45 clones derived from the luciferase
siRNA-treated animals, none corresponded to the predicted
Ttr siRNA cleavage site. In contrast, 15 of 51 clones obtained
from the Ttr siRNA treatment group were found to terminate
precisely at the predicted siRNA cleavage position (P = 0.002)
(for representative sequence traces, see Supplemental Fig.
S1A,B). Similar results were obtained with serum from cynomolgus monkeys treated with LNP-formulated TTR siRNA
(Supplemental Fig. S1C). Therefore, the RNA interference
mechanism occurring in liver was molecularly verified by
analysis of circulating RNA in serum.
To extend the analysis beyond endogenously expressed
genes, rats were injected with an adenoviral vector to induce
GFP expression at various levels in the liver (Herrmann et al.
2004). The relative levels of GFP mRNA measured in circulation were in good agreement with the corresponding liver
mRNA levels for four animals analyzed 5 d after adenoviral
injection (Fig. 4A). Thus, measurement of mRNA levels in
serum can be applied to the analysis of gene therapy delivery
of exogenous genes.
We have shown that analysis of RNA in biological fluids can
be used to quantify the effects of RNA antagonists, such as
siRNA- or miRNA-targeted oligonucleotides, and gene-expression vectors, such as adenoviral constructs, on RNA levels
in rodent and nonhuman primate tissues. Circulating RNA
was found to correspond closely with tissue RNA levels and
FIGURE 3. Concordance of silencing in liver and circulating RNA. (A) Time course of rat liver and serum Ttr silencing following intravenous administration of 0.1 mg/kg LNP-formulated Ttr siRNA (si-TTR). Levels of Ttr were normalized to Gapdh (liver) or Serpina1 (serum) levels. Group
averages, relative to a 0.1 mg/kg LNP-Luc siRNA-treated control group (si-Luc), are shown (n = 7 per group, for each time point). (B) Levels of
rat Ttr mRNA measured by qPCR at the indicated times following intravenous administration of 0.3 mg/kg LNP-formulated Ttr siRNA (si-TTR).
Ttr levels were normalized to levels of Gapdh (liver) or Serpina1 (serum), and group averages were expressed relative to control animals receiving
0.3 mg/kg si-Luc analyzed at 6 h (n = 5 per group). Significance relative to the Luc siRNA-treated control group was determined by ANOVA (∗ P
< 0.001; #P < 0.01). Error bars, SDs for each group.
146
RNA, Vol. 20, No. 2
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
Circulating RNA quantification of gene modulation
similar to those previously described (Zimmermann et al. 2006; Akinc et al. 2010).
Chemically modified siRNAs were synthesized at Alnylam (2′ -O-methyl-modified nucleotides are in lowercase): rat Ttr, sense cA
GuGuucuuGcucuAuAAdTdT and antisense
UuAuAGAGcAAGAAcACUGdTdT; rat Tmprss6, sense uGGuAuuuccuAGGGuAcAdTsdT
and antisense UGuACCCuAGGAAAuACcA
dTsdT; rat Snca, sense AcAccuAAGuGAcuA
ccAcdTsdT and antisense GUGGuAGUcA
CUuAGGUGUdTsdT; cynomolgus monkey
TTR, sense GGAuuucAuGuAAccAAGA and
antisense GUGGuAGUcACUuAGGUGUdTs
dT; and luciferase, sense cuuAcGcuGAGuA
cuucGAdTsdT and antisense UCUUGGUuA
cAUGAAAUCCdTdT. The oligonucleotide
directed against miR-122 and the mismatch
control oligonucleotide were provided by
Regulus Therapeutics, Inc. The sequences
have been described (Krutzfeldt et al. 2005).
Animal experiments
All studies were conducted in accordance with
animal welfare regulations under IACUC-approved research protocols.
Male Sprague-Dawley rats were administered
LNP-formulated siRNA or LNP-formuFIGURE 4. Extending circulating RNA measurements beyond liver gene silencing. (A) Relative
levels of GFP mRNA measured in total RNA isolated from liver and filtered centrifuged serum lated oligonucleotide as a single injection
of four individual rats 4 d following intravenous injection of 1011 pfu Adeno-GFP. Values presented via the tail vein at a dose volume of 3 mL/kg
are the means of two technical replicates for serum and two technical replicates each from two sep- body weight. For the adenovirus studies,
arate pieces of liver from each animal. (B) Relative levels of tissue-specific mRNAs (smooth muscle rats received tail vein injections of 1 × 1011
actin [Acta2], albumin [Alb], aldolase A [AldoA], apolipoprotein B [ApoB], apolipoprotein E pfu Adeno-GFP (Viraquest) in a volume of
[ApoE], Gpx2, hepcidin [Hamp], Ptprc, SerpinA1, Tek, TMPRSS6, transthyretrin [TTR], uro2 mL. Animals were killed at various time
modulin [UMOD]) measured by qPCR in RNA isolated from rat serum (normalized to GAPDH).
points. To prepare serum, blood was collected
The tissue of origin, as verified from NCBI and http://biogps.org, is marked above each bar.
via caudal vena cava into serum separation
tubes and allowed to clot at room temperature
for ∼30 min prior to centrifugation at 4°C. Livers were collected,
their modulation by antagonists, suggesting that RNA levels
frozen in liquid nitrogen, and stored at −80°C.
from biological fluids provide an accurate “real-time” repreFor brain infusion studies, male Sprague-Dawley rats were anessentation of tissue RNA status. Importantly, the RNAs dethetized and placed into a stereotaxic frame (Benchmark Digital
tectable in serum correspond to genes that are very highly
Stereotaxic, myNeuroLab). A 30-gauge osmotic pump infusion canexpressed (Alb, TTR/Ttr, SERPINA1/Serpina1) as well as
nula (Plastics One) was implanted into each hemisphere, targeting
moderately expressed (Tmprss6, F7) in the liver (http://www
the striatum (stereotaxic coordinates AP 0.5, ML 3, and DV 5.1 rel.ncbi.nlm.nih.gov/UniGene). Moreover, we were able to deative to bregma; incisor bar 3.3 mm below the interaural line).
tect several other tissue-specific transcripts in circulating
Osmotic pumps (1 µL/hr flow rate, Alzet) containing 4 mg/mL
RNA isolated from rat serum (Fig. 4B). We envision that
siRNA dissolved in PBS were primed in 0.9% saline overnight at
this cERD method will have broad applicability in clinical
37°C according to the manufacturer’s instructions, and then constudies since it allows the routine, accurate, and frequent meanected to the cannula and implanted subcutaneously. After 7 d of
infusion, rats were anesthetized and mounted in a stereotaxic frame.
surement of organ-specific target gene modulation without
CSF was collected using a syringe with a 30-gauge needle through
the need for tissue biopsies.
the atlanto-occipital membrane. After CSF collection, rats were
killed, and brains were removed. Coronal slices, 1 mm thick,
through the rat brain from anterior to posterior were obtained using
MATERIALS AND METHODS
a brain matrix (Braintree Scientific), and striatum was dissected
from each slice, snap-frozen in liquid nitrogen, and stored at −80°C.
siRNAs, oligonucleotides, and formulations
The nonhuman primate study was conducted at Covance Laboratories (Madison, WI). Male cynomolgus monkeys (M. fascicularis)
The LNP formulations used in the rat and cynomolgus monkey
received 15-min infusions of LNP-formulated siRNA via the
studies were prepared using methods and chemical compositions
www.rnajournal.org
147
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
Sehgal et al.
saphenous vein at a dose volume of 5 mL/kg body weight. Two days
later, animals were anesthetized, and blood was collected from a
femoral vein into serum separator tubes without anticoagulant.
Blood was incubated for 30–60 min at room temperature and centrifuged. Serum was harvested and stored at −80°C. Animals were
killed, and liver samples (∼1 g) were collected, frozen in liquid nitrogen, and stored at −80°C.
Serum sample from healthy donors and patients with liver tumors
were obtained from Bioreclamation.
Isolation and analysis of tissue RNA
Total RNA was extracted from frozen rat liver or striatum using the
Qiagen RNeasy kit. For mRNA quantification, cDNA was prepared
with the high-capacity cDNA reverse transcription kit (Applied
Biosystems) using random primers. For miRNA quantification,
cDNA was prepared with the Taqman MicroRNA reverse transcription kit using a miR-122 specific stem–loop primer (Applied
Biosystems). Quantitative PCR was performed on a Roche
LightCycler 480 using Applied Biosystems Taqman gene expression
or miRNA assays (rat Ttr, Rn 01406102; rat Serpina1, Rn 00574670;
rat Tmprss6, Rn01504810; rat Alb, Rn00592480; rat F7, Rn00596104;
rat Snca, Rn01425140; rat Gapdh, 4352338E; miR-122, 002245). A
custom Taqman assay was used to quantify GFP expression (forward, GACAACCACTACCTGAGCAC; reverse, ACCATGTGAT
CGCGCTTC; probe, FAM-CCCTGAGCAAAGACCCCAACGA).
Cynomolgus monkey TTR and GAPDH liver mRNA levels were
measured in Proteinase K–digested liver lysates using gene-specific
branched DNA assays (Panomics).
Isolation and analysis of RNA from serum and CSF
Human serum was obtained from volunteer donors under an IRBapproved protocol. Rats were killed, and blood was collected from
the vena cava for serum isolation 2.5–3.5 mL serum per rat was
used for each sample. Rat CSF was collected from multiple rats
and pooled for a total volume of 2 mL. Serum (rat, cynomolgus monkey, and human) and CSF (rat) were either filtered (0.4 μm) or centrifuged at 10,000g for 10 min prior to mixing with LiCl (final
concentration 1 M diluted from 8 M stock; Ambion) and incubated
for 1 h at 4°C. Tubes were balanced with 1× PBS before spinning at
110,000g for 100–120 min. Samples were spun in thick-wall polycarbonate tubes in MLA-55 or MLA-130 rotor in Beckman Coulter centrifuge. The combination of differential centrifugation to collect
RNA in circulating vesicles and of LiCl addition to precipitate free
circulating RNA was intended to maximize total RNA yield. Total
RNA was isolated from pellets by Trizol extraction (Invitrogen)
and isopropanol precipitation. Bioanalyzer (Agilent) analysis of selected RNA samples failed to detect a discrete rRNA band, thus yielding unreliable quantitation results. Synthesis of cDNA and Taqman
gene expression analysis were performed as described above. Human
Taqman gene expression assays: TTR, Hs00174914; SERPINA1,
Hs01097800; TMPRSS6, Hs00542184; ALB, Hs00910225; AFP,
Hs00173490_m1, GPC3, Hs01018938_m1 GAPDH, 4326317E. Custom Taqman assays were used to quantify gene expression in cynomolgus monkey serum (TTR: forward, TGGCATCTCCCCATT
CCA, reverse, CGGAATCGTTGGCTGTGAA, probe, FAM-AGCA
TGCAGAGGTGG; SERPINA1: forward, ACTAAGGTCTTCAGC
AATGGG, reverse, GCTTCAGTCCCTTTCTCATCG, probe, FAM-
148
RNA, Vol. 20, No. 2
TGGTCAGCACAGCCTTATGCACG; GAPDH: forward, ATGTT
CCAGTATGATTCCACCC, reverse, CATCGCCCCACTTGATTTT
G, probe, FAM-AGCTTCCCGTTCTCAGCCTTCAC). For the
rat, the assays were the same as described above for tissues and
in addition Acta2, Rn01759928_g1; AldoA, Rn00820577_g1; ApoB,
Rn01499054_m1; ApoE, Rn00593680_m1; Gpx2, Rn00822100_gH;
Hamp, Rn00584987_m1; Ptprc, Rn00709901_m1; Tek, Rn014
33337_m1; and UMOD, Rn00567180_m1.
Ligation-mediated RACE PCR to detect the Ttr siRNA-mediated
cleavage product in rat serum was performed using the GeneRacer
kit (Invitrogen). Nested PCR products were cloned, and individual
clones were sequenced.
SUPPLEMENTAL MATERIAL
Supplemental material is available for this article.
COMPETING INTEREST STATEMENT
A.S., Q.C., and D.W.Y.S. are employees of Alnylam Pharmaceuticals, Inc.
ACKNOWLEDGMENTS
We thank Martin Goulet and Rick Duncan for technical assistance,
the Alnylam formulation and chemistry teams for reagent synthesis,
and John Maraganore for helpful comments and guidance. The
miRNA targeting oligonucleotide and mismatch control were a
gift from Regulus Therapeutics.
Author contributions: D.W.Y.S. and D.G. conceived the project.
A.S., Q.C., D.W.Y.S., and D.B. designed the experiments and interpreted the results. A.S., Q.C., and D.B. performed the experiments.
D.B. wrote the manuscript.
Received September 17, 2013; accepted November 12, 2013.
REFERENCES
Akinc A, Querbes W, De S, Qin J, Frank-Kamenetsky M, Jayaprakash KN, Jayaraman M, Rajeev KG, Cantley WL, Dorkin JR,
et al. 2010. Targeted delivery of RNAi therapeutics with endogenous
and exogenous ligand-based mechanisms. Mol Ther 18: 1357–1364.
Bertino G, Ardiri A, Malaguarnera M, Malaguarnera G, Bertino N,
Calvagno GS. 2012. Hepatocellualar carcinoma serum markers.
Semin Oncol 39: 410–433.
Chan AK, Chiu RW, Lo YM. 2003. Cell-free nucleic acids in plasma, serum and urine: A new tool in molecular diagnosis. Ann Clin Biochem
40 Pt 2: 122–130.
Coelho T, Adams D, Silva A, Lozeron P, Hawkins PN, Mant T, Perez J,
Chiesa J, Warrington S, Tranter E, et al. 2013. Safety and efficacy of
RNAi therapy for transthyretin amyloidosis. N Engl J Med 369:
819–829.
Conde-Vancells J, Rodriguez-Suarez E, Embade N, Gil D, Matthiesen R,
Valle M, Elortza F, Lu SC, Mato JM, Falcon-Perez JM. 2008.
Characterization and comprehensive proteome profiling of exosomes secreted by hepatocytes. J Proteome Res 7: 5157–5166.
Davis ME, Zuckerman JE, Choi CH, Seligson D, Tolcher A, Alabi CA,
Yen Y, Heidel JD, Ribas A. 2010. Evidence of RNAi in humans
from systemically administered siRNA via targeted nanoparticles.
Nature 464: 1067–1070.
Downloaded from rnajournal.cshlp.org on April 3, 2014 - Published by Cold Spring Harbor Laboratory Press
Circulating RNA quantification of gene modulation
Esau C, Davis S, Murray SF, Yu XX, Pandey SK, Pear M, Watts L,
Booten SL, Graham M, McKay R, et al. 2006. miR-122 regulation
of lipid metabolism revealed by in vivo antisense targeting. Cell
Metab 3: 87–98.
Finberg KE, Heeney MM, Campagna DR, Aydinok Y, Pearson HA,
Hartman KR, Mayo MM, Samuel SM, Strouse JJ, Markianos K,
et al. 2008. Mutations in TMPRSS6 cause iron-refractory iron deficiency anemia IRIDA. Nat Genet 40: 569–571.
Frank-Kamenetsky M, Grefhorst A, Anderson NN, Racie TS,
Bramlage B, Akinc A, Butler D, Charisse K, Dorkin R, Fan Y, et al.
2008. Therapeutic RNAi targeting PCSK9 acutely lowers plasma
cholesterol in rodents and LDL cholesterol in nonhuman primates.
Proc Natl Acad Sci 105: 11915–11920.
Harrington MG, Fonteh AN, Oborina E, Liao P, Cowan RP,
McComb G, Chavez JN, Rush J, Biringer RG, Huhmer AF. 2009.
The morphology and biochemistry of nanostructures provide evidence for synthesis and signaling functions in human cerebrospinal
fluid. Cerebrospinal Fluid Res 6: 10.
Herrmann J, Abriss B, van de Leur E, Weiskirchen S, Gressner AM,
Weiskirchen R. 2004. Comparative analysis of adenoviral transgene
delivery via tail or portal vein into rat liver. Arch Virol 149: 1611–
1617.
Hood JL, San RS, Wickline SA. 2011. Exosomes released by melanoma
cells prepare sentinel lymph nodes for tumor metastasis. Cancer Res
71: 3792–3801.
Hunter MP, Ismail N, Zhang X, Aguda BD, Lee EJ, Yu L, Xiao T,
Schafer J, Lee ML, Schmittgen TD, et al. 2008. Detection of
microRNA expression in human peripheral blood microvesicles.
PLoS One 3: e3694.
Kamm RC, Smith AG. 1972. Nucleic acid concentrations in normal human plasma. Clin Chem 18: 519–522.
Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M,
Stoffel M. 2005. Silencing of microRNAs in vivo with ‘antagomirs.’
Nature 438: 685–689.
Lewis J, Melrose H, Bumcrot D, Hope A, Zehr C, Lincoln S,
Braithwaite A, He Z, Ogholikhan S, Hinkle K, et al. 2008. In vivo silencing of α-synuclein using naked siRNA. Mol Neurodegener 3: 19.
Love KT, Mahon KP, Levins CG, Whitehead KA, Querbes W, Dorkin JR,
Qin J, Cantley W, Qin LL, Racie T, et al. 2010. Lipid-like materials
for low-dose, in vivo gene silencing. Proc Natl Acad Sci 107:
1864–1869.
O’Driscoll L. 2007. Extracellular nucleic acids and their potential as diagnostic, prognostic and predictive biomarkers. Anticancer Res 27:
1257–1265.
Querbes W, Ge P, Zhang W, Fan Y, Costigan J, Charisse K, Maier M,
Nechev L, Manoharan M, Kotelianski V, et al. 2009. Direct CNS
delivery of siRNA mediates robust silencing in oligodendrocytes.
Oligonucleotides 19: 23–29.
Raimondo F, Morosi L, Chinello C, Magni F, Pitto M. 2011. Advances in
membranous vesicle and exosome proteomics improving biological
understanding and biomarker discovery. Proteomics 11: 709–720.
Record M, Subra C, Silvente-Poirot S, Poirot M. 2011. Exosomes as intercellular signalosomes and pharmacological effectors. Biochem
Pharmacol 81: 1171–1182.
Saraiva MJ. 1995. Transthyretin mutations in health and disease. Hum
Mutat 5: 191–196.
Smalheiser NR. 2007. Exosomal transfer of proteins and RNAs at synapses in the nervous system. Biol Direct 2: 35.
Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R,
Goedert M. 1997. α-Synuclein in Lewy bodies. Nature 388: 839–840.
Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO. 2007.
Exosome-mediated transfer of mRNAs and microRNAs is a novel
mechanism of genetic exchange between cells. Nat Cell Biol 9:
654–659.
Zimmermann TS, Lee AC, Akinc A, Bramlage B, Bumcrot D,
Fedoruk MN, Harborth J, Heyes JA, Jeffs LB, John M, et al. 2006.
RNAi-mediated gene silencing in non-human primates. Nature
441: 111–114.
www.rnajournal.org
149