Journal of Insect Physiology 82 (2015) 85–91
Contents lists available at ScienceDirect
Journal of Insect Physiology
journal homepage: www.elsevier.com/locate/jinsphys
Effects of environmentally-relevant mixtures of four common
organophosphorus insecticides on the honey bee (Apis mellifera L.)
Yahya Al Naggar a,b,⇑, Steve Wiseman b, Sun Jianxian b, G. Christopher Cutler c, Mourad Aboul-Soud d,
Elsaied Naiem a, Mohamed Mona a, Amal Seif a, John P. Giesy b,e,f,g,h,i
a
Department of Zoology, Faculty of Science, Tanta University, 31527 Tanta, Egypt
Toxicology Centre, University of Saskatchewan, 44 Campus Drive, Saskatoon, SK, Canada
Department of Environmental Sciences, Agricultural Campus, Dalhousie University, Truro, NS, Canada
d
Biochemistry Department, Faculty of Agriculture, Cairo University, Giza 12316, Egypt
e
Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, SK, Canada
f
Department of Zoology, and Center for Integrative Toxicology, Michigan State University, East Lansing, MI, USA
g
Department of Biology & Chemistry and State Key Laboratory in Marine Pollution, City University of Hong Kong, Kowloon, Hong Kong Special Administrative Region
h
School of Biological Sciences, University of Hong Kong, Hong Kong Special Administrative Region
i
State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, People’s Republic of China
b
c
a r t i c l e
i n f o
Article history:
Received 9 March 2015
Received in revised form 15 September
2015
Accepted 16 September 2015
Available online 21 September 2015
Keywords:
Apis mellifera
Organophosphorus insecticides
Proboscis extension reflex (PER)
Acetylcholine esterase
Detoxification genes
Behavior
OPs
a b s t r a c t
We assessed whether exposure to environmentally-relevant mixtures of four organophosphorus insecticides (OPs) exerted adverse effects on honey bees. Adult and worker bees were orally exposed for five
days under laboratory conditions to mixtures of four insecticides, diazinon, malathion, profenofos and
chlorpyrifos at two concentrations. Concentration in the mixtures tested were equivalent to the median
and 95th centile concentrations of the OPs in honey, as reported in the literature. Effects on survival,
behavior, activity of acetylcholinesterase (AChE), and expression of genes important in detoxification
of xenobiotics and immune response were examined. Survival of worker bees was not affected by exposure to median or 95th centile concentrations of the OPs. Activity of AChE was significantly greater in
worker bees exposed to the 95th centile concentration mixture of OPs compared to the median concentration mixture. Expression of genes involved in detoxification of xenobiotics was not affected by treatment, but the abundance of transcripts of the antimicrobial peptide hymenoptaecin was significantly
greater in worker honey bees exposed to the median concentration mixture. Results suggest that
short-term exposure to environmentally relevant concentrations of a mixture of OPs do not adversely
affect worker honey bees.
Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction
There is concern that exposure to agricultural pesticides is compromising the vigor of colonies of the honey bee, Apis mellifera L.
Organophosphorus insecticides (OPs) are one of the most widely
used class of pesticides, which in 2008 comprised 22% of world
market share of insecticides (Lazonby and Waddington, 2015),
and have been implicated in incidents in which bees were poisoned (Fletcher and Barnett, 2003; Kamler et al., 2003). Residues
of OPs have frequently been detected in honey bee colony matrices, and their potential hazard to colonies have been previously
studied (Al Naggar et al., 2015a,b; Chauzat et al., 2011; Cutler
⇑ Corresponding author at: Toxicology Centre, University of Saskatchewan,
Saskatoon, SK S7N 5B3, Canada.
E-mail address: Yehia.elnagar@science.tanta.edu.eg (Y. Al Naggar).
http://dx.doi.org/10.1016/j.jinsphys.2015.09.004
0022-1910/Ó 2015 Elsevier Ltd. All rights reserved.
et al., 2014; Mullin et al., 2010; Wiest et al., 2011). While results
of some studies suggest that OPs might not directly cause colony
failure (Al Naggar et al., 2015a,b), OPs might interact with others
stressors or in combination with each other to compromise the fitness of individual bees or colonies (Cornman et al., 2012).
Most studies of toxic effects of pesticides on bees have focused
on effects of single compounds. Even though honey bees in the
field are rarely exposed to single compounds, few studies have
examined toxic effects of mixtures of pesticides on bees (Gill
et al., 2012; Johnson et al., 2013; Pilling and Jepson, 1993). Results
of surveys in the USA and Canada (Al Naggar et al., 2015b; Mullin
et al., 2010), Europe (Chauzat et al., 2011; Wiest et al., 2011) and
North Africa (Al Naggar et al., 2015a) have shown that colonies
of bees might concurrently be exposed to dozens of different compounds including multiple OPs. In some cases, mixtures of pesticides have been shown to be synergistic, with reported increases
86
Y. Al Naggar et al. / Journal of Insect Physiology 82 (2015) 85–91
in toxicity as great as 100-fold relative to that which would be predicted from a strictly additive model (Thompson, 1996). For example, exposure to field-relevant concentrations of the neonicotinoid
imidacloprid and the OP coumaphos impaired olfactory learning
and memory formation in honey bees (Williamson and Wright,
2013). In a study with four common pesticides (fluvalinate, coumaphos, chlorothalonil, and chloropyrifos), exposure to field-relevant
concentrations either individually or in mixtures caused significant
increases in larval mortality. Synergistic effects were observed
with certain binary mixtures, but a combination of the OPs chlorpyrifos and coumaphos resulted in only additive toxicity (Zhu
et al., 2014).
The objective of the present study was to assess whether exposure to environmentally relevant concentrations of a mixture of
OPs exerts adverse effects on honey bee workers. Effects of the
mixture of OPs on survival, behavior, activity of AChE, and expression of genes involved in detoxification and immune response,
were quantified. It was hypothesized that exposure of bees to a
mixture of OPs that act via the same mode of action could exert
adverse additive effects on the endpoints examined in individual
bees.
concentrations of each OP was calculated (Table 1). Because honey
represents all the nectar sources collected, whether these are
treated crops or wild flowers, and represents food consumed by
adults and juvenile bees inside the colony, we focused on residues
found in honey to derive test concentrations used in our experiments. The median and 95th centile concentrations of each OP
were determined. Stock solutions (1000 ppm) of each insecticide
were prepared in acetone according to guidelines for efficacy and
side effect testing from the European and Mediterranean Plant
Protection Organization (EPPO, 1992) and the International
Commission for Plant-Bee-Relationships (ICPBR) and then required
dilutions were made for the median and 95th centile concentrations of each OP. Insecticides were collectively added to a
500 g L 1 sucrose solution. The final concentration of acetone in
solutions was 1% (v/v). For all experiments, bees were exposed
to: (1) a mixture of the median concentrations of the four OPs;
or (2) a mixture of the 95th centile concentrations of the four
OPs. A solution of 1% acetone (vol/vol) in 500 g L 1 of sucrose
was used as a control. Fresh solutions were prepared for each
bioassay replicate (i.e. repeat of the experiment).
2.2. Exposure protocol and effects on survival
2. Materials and methods
2.1. Pesticides
Diazinon, malathion, profenofos and chlorpyrifos were used in
experiments. These four OPs were chosen because they were the
most frequently detected OPs in honey bee colony matrices in a
recent Egyptian study (Al Naggar et al., 2015a), frequently detected
in other studies (Chauzat et al., 2011; Mullin et al., 2010; Rissato
et al., 2007; Wiest et al., 2011), and are potentially hazardous to
honey bee colonies (Al Naggar et al., 2015a,b; Cutler et al., 2014;
Johnson et al., 2010; Mansour, 2004).
Insecticides used in experiments were technical grade (>98%
purity, Accu Standard, New Haven, CT). The peer-reviewed literature was examined to determine concentrations of each OP in
honey, from which representative median and 95th centile
Table 1
Concentrations of organophosphorus insecticides (OPs) (ng/g, wm) in honey reported
in the peer-reviewed literature, nominal (regular font) and dosed (bold font)a.
OP
Conc.
(ng/g, wm)
References
Medianb
95th
centileb
Diazinon
14
35
Wiest et al. (2011)
Johnson et al.
(2010)
Al Naggar et al.
(2015a)
14.0,
14.7
33.0, 32.9
Johnson et al.
(2010)
Rissato et al.
(2007)
122.0,
112.5
231.0,
217.2
0.25
Malathion
243
0.243
Profenofos
0.27
Al Naggar et al.
(2015a)
0.30,
0.27
0.30, 0.26
Chlorpyrifos
3.27
Al Naggar et al.
(2015a)
Rissato et al.
(2007)
Pareja et al.
(2011)
Johnson et al.
(2010)
9.0, 7.7
70.0, 68.8
0.015
80
15
a
Dosed concentrations were different from nominal concentrations because it
had been measured after treatment sucrose solutions were prepared as a mixture at
field relevant median and 95th centile concentrations.
b
Median and 95th centile concentration were calculated from concentrations
detected for each OP in honey in the peer-reviewed literature.
Experiments were conducted in August 2014 with A. mellifera
workers of indeterminate age obtained from hives maintained in
an apiary near the Dalhousie University Agricultural Campus
(Truro, NS, Canada). Adults collected from frames without brood
were then returned to the laboratory and placed in refrigerator
at 4 °C for approximately 10 min to slow movement of bees. Adult
workers were then transferred to ventilated transparent round
plastic cages (9 cm H 7 cm diam.), with 20–30 bees per cage.
Bees were deprived of food for 4 h prior to commencement of
exposures and thereafter fed treatment or control sucrose solution.
Access to sucrose solution was through a cotton dental wick that
was inserted through a hole in the bottom of the container, which
was soaked in sucrose solution via a 50 mm diameter Petri dish
placed under the container holding the bees. The Petri dish was
covered with a lid and sealed with parafilm to minimize loss
through evaporation. Bees in containers were held in an incubator
(24 h darkness; 32 °C; 60% RH) for up to five days and mortality
was recorded daily. Each bioassay consisted of three replicate containers per treatment, and the bioassay was done on three separate
occasions (i.e. blocks in time). On the fifth day, subsamples of surviving bees were collected from each container to quantify gene
expression (Section 2.3) and AChE activity (Section 2.4). Heads
for quantification of activity of AChE and alimentary canals for
quantification of gene expression were removed from bee specimens by dissection on ice and samples were stored at 80 °C.
2.3. Gene expression
Real-time quantitative PCR (RT-qPCR) was performed to determine the effect of exposure to the mixture of OPs on expression of
genes important for detoxification of pesticides and immunity.
Total RNA was isolated from alimentary canals of worker bees by
use of an RNeasy Lipid Tissue Mini Kit (Qiagen, Toronto, ON,
Canada) according to the protocol provided by the manufacturer.
Immediately after extraction, the concentration of RNA was determined by use of a Nanodrop ND-1000 spectrometer (Nanodrop
Technologies, Wilmington, DE) and first strand cDNA was synthesized from 0.5 lg of RNA by use of a Quantitect cDNA Synthesis
Kit (Qiagen). To perform RT-qPCR, samples of cDNA were diluted
1:5 in water that was free of nucleases. Reactions were performed
using Quantitect SYBR Green Reagent (Qiagen). Briefly, a separate
50 lL PCR reaction consisting of 2 SYBR Green master mix, an
optimized concentration of gene-specific primers, nuclease free
87
Y. Al Naggar et al. / Journal of Insect Physiology 82 (2015) 85–91
Table 2
Sequences of primers and their efficiencies for quantification of abundances of transcripts in honey bees (Apis mellifera).
Gene description
Category
Forward primer
Reverse primer
Efficiency
Actin related protein 1 (AMActin)
Ribosomal protein S5a (RPS5)
Glutathione S-transferase D1 (GSTD1)
Glutathione S-transferase S3 (GSTS3)
Cytochrome P450 4G11(CYP4G11)
Cytochrome P450 CYP6AS14
Cytochrome P450 CYP306A1
Carboxylesterase CRBXase
Abaecin
Defensin1
Hymenoptaecin
House keeping
House keeping
Detoxification
Detoxification
Detoxification
Detoxification
Detoxification
Detoxification
Immunity
Immunity
Immunity
TTGTATGCCAACACTGTCCTTT
AATTATTTGGTC GCTGGAATTG
CTTGCCGATTTAAGCATCGT
TGCATATGCTGGCATTGATT
CAAAATGGTGTTCTCCTTACCG
TGAAACTCATGACCGAGACG
CGCTGGACCTCTCAACTTTC
ACATTTCTGGGGCATCTCAC
CAGCATTCGCATACGTACCA
TGCGCTGCTAACTGTCTCAG
CTCTTCTGTGCCGTTGCATA
TGGCGCGATGATCTTAATTT
TAACGTCCAGCAGAATGTGGTA
ACCCAGCGTTGTTGTACTCC
TCCTCGCCAAGTATCTTGCT
ATGGCAACCCATCACTGC
AAAATTTGGGCCGCTAATAAA
TGCGTTTTATCCTTCCCATC
CTGGTCATTCGTTCCAAGGT
GACCAGGAAACGTTGGAAAC
AATGGCACTTAACCGAAACG
GCGTCTCCTGTCATTCCATT
1.88
1.99
1.95
2.10
1.94
1.86
2.05
1.93
1.84
1.99
2.05
water, and an optimal volume of cDNA was prepared for each sample and gene of interest. Then, 20 lL of reaction mix was transferred to two wells of a 96-well PCR plate. Reactions were
performed in an ABI 7300 Real-Time PCR System (Applied Biosystems, Burlington, ON, Canada). Primers were either from
Boncristiani et al. (2012) or were designed by use of Primer 3 software (Rozen et al., 2000) with sequences available in the NCBI
nucleotide database (Table 2).
The PCR reaction mixture was denatured at 95 °C for 10 min
before the first PCR cycle. The thermal cycle profile was as follows:
denature for 15 s at 95 °C and extension for 1 min at 60 °C for a
total of 40 PCR cycles. The RT-qPCR cycle was followed by a dissociation step to validate that only a single product was amplified in
each reaction. For each target gene, abundance of transcripts was
quantified according to the Mean Normalized Expression (MNE)
method of Simon (2003), and actin-related protein-1 (AMActin)
was used as a reference gene. Efficiency of each set of primers
was determined by use of a standard curve of serial dilutions of
cDNA. Reactions conditions were optimized so that the coefficient
of determination (R2) was at least 0.99 and efficiencies were 1.9–
2.1, where efficiency = 10( 1/slope of standard curve). In total,
qPCR was performed on RNA isolated from a total of six alimentary
canals per treatment; two randomly selected from each set of
treatments from each of the three bioassays (blocks).
After 24 h of exposure to the control diet or the diet containing
the median of 95th centile mixture of OPs, bees were mounted
individually in plastic tubes with only their antennae and mouth
parts left free. Bees were starved for 3–4 h prior to conditioning.
Bees were selected for showing a PER after stimulation of the
antennae with a sucrose solution (300 g L 1) and the number of
individuals exhibiting the reflex response was recorded. Bees were
then placed in an airflow (main airflow of 50 ml s 1) added to a
secondary airflow of 2.5 ml s 1 for 15 s, to familiarize them with
the mechanical stimulation. Conditioning trials were done with a
conditioning stimulus of 10 ll of pure rosemary (Sigma–Aldrich,
Oakville, ON, Canada), a standard floral odor, soaked on a filter
paper strip inserted into a Pasteur pipette. The PER was elicited
after 3 s by contacting the antennae with a sucrose solution
(300 g L 1) as the unconditioned stimulus, and the same solution
was immediately given as a reward, before the odor delivery
ended. Three successive conditioning trials (Cond1–Cond3) were
carried out, followed by a test trial. The time interval between conditioning trials was 20–30 min. During a test trial, the conditioned
stimulus (pure rosemary) was delivered for 6 s. The conditioned
PER was recorded as a yes-or-no response when the odor alone
was delivered during the 6 s of the test trial (Decourtye et al.,
2005).
2.6. Data analyses
2.4. AChE activity
A total of five heads of bees from each of the three bioassays
(blocks) that survived each exposure scenario were randomly
selected, pooled and homogenized in 0.1 M phosphate buffer (pH
7.0). Homogenates were then centrifuged at 5000g for 20 min at
4 °C and supernatants were collected for quantification of activity
of AChE using the Amplex Red Acetylcho-line/Acetylcholinesterase
(AChE) Assay Kit (A-12217) (Life Technologies, Carlsbad, CA, USA),
according to protocol provided by the manufacturer. Fluorescence
was measured at an excitation wavelength of 560 nm and emission
wavelength of 590 nm. All samples were quantified in duplicate.
Specific activity of AChE was expressed as activity/mg protein.
Concentrations of protein in supernatants were determined with
the Bio-Rad Protein Assay (Bio-Rad Laboratories, Mississauga, ON,
Canada) with bovine serum albumin used as a standard. The protocol is based on the method of Bradford (Bradford, 1976).
Data analyses were performed with MINITAB Software
(Minitab, 2013). Normality of data was assessed with a Kolomogrov–Smirnov test, and homogeneity of variance was determined with a Levene’s test. If necessary, data were log 10
transformed to ensure normality and homogeneity of variance.
Mortality was analyzed by a Kruskal–Wallis test. The response of
forager bees to odor stimulus during conditioning trials and testing
were scored as a yes-or-no response and analyzed by Chi Square
(v2) tests. Activity of AChE and abundances of transcripts of genes
involved in detoxification of OPs and immune response were
assessed by one-way analysis of variance (ANOVA) followed by
Tukey’s post hoc test. An alpha level of 0.05 was used for all tests.
3. Results
3.1. Concentrations of OPs in sugar syrup
2.5. Proboscis extension reflex (PER)
In a separate experiment, effects of mixtures of OPs on the proboscis extension reflex (PER) (Frost et al., 2013) of forager bees of
indeterminate age were determined after a 24 h exposure, using
the procedure described above. Returning forager worker bees
were collected into glass jars using a vacuum at the hive entrance.
Bees were placed in a refrigerator at 4 °C until their movement slowed, and then transferred to exposure cages.
Concentrations of OPs were measured after treatment sucrose
solutions were prepared. Greater than 90% recovery of pesticides
was observed (Table 1).
3.2. Honey bee survival
Exposure to either mixture of OPs did not affect cumulative five
day mortality (%) of worker bees (H = 1.41, df = 2, P = 0.49). There
88
Y. Al Naggar et al. / Journal of Insect Physiology 82 (2015) 85–91
was no difference in survival of bees in response to treatments
across experimental blocks (H = 2.44, df = 2, P = 0.30) (Fig. 1).
Average mortality (%)
15
Control
Median
95th centile
10
3.3. Gene expression
5
0
1
2
3
Day
4
5
Fig. 1. Cumulative mortality (%) (mean ± SEM) of worker honey bees exposed to a
control or sucrose solution diet containing a mixture of organophosphorus
insecticides at field-relevant median or 95th centile concentrations.
1.5
1.0
0.5
0.0
Control
Median
1.5
1.0
0.5
0.0
(E)
Median
0.0
Control
1.0
0.5
0.0
95th centile
95th centile
1.5
1.0
0.5
0.0
Control
Abundance of transcripts
(Fold-change from contol)
1.5
Median
GST S3
(F)
2.0
Median
0.5
95th centile
GST D1
Control
1.0
(D)
CYP 306A1
Control
CYP6 AS14
1.5
95th centile
Abundance of transcripts
(Fold-change from control)
Abundance of transcripts
(Fold-change from control)
(C)
Abundance of transcripts
(Fold-change from control)
(B)
CYP 4G11
2.0
Abundance of transcripts
(Fold-change from control)
Abundance of transcripts
(Fold-change from control)
(A)
Expression of genes important for detoxification of OPs was not
significantly different in alimentary canal tissues collected from
worker bees fed the control solution compared to those fed a solution containing either mixture of OPs (CYP 4G11: F = 0.82, df = 2,
P = 0.45; CYP AS14: F = 0.56, df = 2, P = 0.58; CYP 306A1: F = 0.59,
df = 2, P = 0.56; GST S3: F = 0.27, df = 2, P = 0.77; GST D1: F = 1.65,
df = 2, P = 0.22; GARXase: F = 0.43, df = 2, P = 0.65) (Fig. 2). Treatment had an effect on defensin1 gene expression (F = 4.37; df = 2,
P = 0.030), with relative expression in worker bees given sucrose
solution with the median concentration mixture of OPs being
1.6-fold greater than in bees given the diet containing the 95th
centile concentration mixture; however, expression of defensin1
in control bees was not different from that of bees from either
Median
95th centile
CRBXase
1.5
1.0
0.5
0.0
Control
Median
95th centile
Fig. 2. Fold-change in abundance of transcripts of genes involved in pesticide detoxification in worker honey bees exposed to a control or sucrose solution diet containing a
mixture of organophosphorus insecticides at field-relevant median or 95th centile concentrations. Columns represent the mean concentration (±SEM) of six samples.
Y. Al Naggar et al. / Journal of Insect Physiology 82 (2015) 85–91
89
Fig. 4. Acetylcholine esterase (AChE) activity in heads of honey bee workers after
exposure to a control or sucrose solution diet containing a mixture of organophosphorus insecticides at field-relevant median or 95th centile concentrations.
Columns represent the mean concentration (±SEM) of six samples. Different letters
denote significant differences from the control group (one-way ANOVA with Tukey
post hoc test, P < 0.05).
3.5. Proboscis extension reflex
Exposure to a sucrose solution containing either mixture of OPs
did not affect olfactory learning performances represented as the
percentage of PER obtained during (A) the conditioning phases
(Cond1–Cond3) (Cond1: v2 = 0.36, P = 0.83; Cond2: v2 = 1.3,
P = 0.51; Cond3: v2 = 1.03, P = 0.59), and the (B) testing phase
(v2 = 2.2, P = 0.30) of forager bees compared to bees given the control solution (Fig. 5).
Fig. 3. Fold-change in abundances of transcripts of genes involved in immune
responses in worker honey bees exposed to a control or sucrose solution diet
containing a mixture of organophosphorus insecticides at field-relevant median or
95th centile concentrations. Columns represent the mean concentration (±SEM) of
six samples. Different letters denote significant differences among treatments (oneway ANOVA with Tukey post hoc test, P < 0.05).
OP treatment. There was no treatment effect on abaecin gene
expression (F = 0.22; df = 2, P = 0.802) in worker bees fed the control solution compared to those fed a solution containing either
mixture of OPs. Expression of hymenoptaecin was 8.4-fold greater
in bees given sucrose solution containing the median concentration mixture of OPs than in bees given either the control solution
or the solution containing the 95th centile concentration of the
mixture of OPs (F = 9.24; df = 2, P = 0.004) (Fig. 3).
3.4. AChE activity
Activity of AChE was significantly greater in worker bees
exposed to the 95th centile concentration mixture of OPs compared to bees given sucrose solution with the median concentration mixture of OPs, but was not different from worker bees
given the control diet (F = 4.75; df = 2; P = 0.03) (Fig. 4).
Fig. 5. Olfactory learning performance of honey bee forager measured as (%)
(mean ± SEM) of conditioned proboscis extension reflexes during (A) the conditioning phases (Cond1–Cond3) (n = 45 per group), and the (B) testing phase (n = 45
per group) when given (24 h exposure) a control or sucrose solution diet containing
a mixture of organophosphorus insecticides at field-relevant median or 95th centile
concentrations (v2 = 2.2, P = 0.30).
90
Y. Al Naggar et al. / Journal of Insect Physiology 82 (2015) 85–91
4. Discussion
There is increasing concern that agricultural pesticides, including OPs, are causing undue stress and mortality of honey bee colonies. However, there have been few studies of toxic effects of
environmentally relevant concentrations of mixtures of pesticides
on honey bees (Johnson et al., 2013). In the current study, we
tested the hypothesis that a mixture of prominent OP insecticides
– diazinon, malathion, profenofos and chlorpyrifos – at
environmentally-relevant concentrations would adversely affect
worker bee survival, behavior, and expression of genes that are
important for detoxification of OPs and immune-response.
Survival of worker bees was not affected by either the median
or 95th mixtures of OPs we tested. These results differ from those
of Zhu et al. (2014), who reported reduced survival of honey bee
larvae exposed to fluvalinate, coumaphos, chlorpyrifos, and chlorothalonil at 3, 8, 1.5, and 34 mg/L, respectively, either individually
or in mixtures. Two major differences between our study and that
of Zhu et al. (2014) might explain differences in effects on survival. First, concentrations of OPs that bees were exposed to
was much greater in the study by Zhu et al. (2014). Second, bees
used in the study by Zhu et al. (2014) were at the larval stage of
development whereas in the current study the bees were adults,
and in general, early life stages of organisms have greater sensitivity than adults to xenobiotics (Desneux et al., 2007; Wu
et al., 2011).
The primary mechanism of toxicity of OPs against insects and
other organisms is through inhibition of activity of AChE
(McDonough and Shih, 1997; Pope, 1999; Pohanka, 2011). Such
effects on AChE are dose dependent. In the present study, mixtures
of OPs at environmentally relevant concentrations did not inhibit
activity of AChE in honey bees. This is consistent with the lack of
effect of exposure to the same mixtures we observed on bee survival. However, activity of AChE was greater in worker bees
exposed to the greater 95th centile concentration mixture of OPs
compared to worker bees exposed to the median concentration
of the mixture. Greater activity of AChE has been reported infield and laboratory studies of honey bees exposed to OPs
(Badiou et al., 2008; Boily et al., 2013).
Pesticides are well-known to affect the behavior of honey bees
(Desneux et al., 2007), and it is possible that effects on individuals
could transcend to the colony level. However, in the present
study, exposure to a mixture of OP insecticides at
environmentally-relevant median and 95th centile concentrations
for 24 h did not affect the PER response of honey bee foragers.
These results are contrary to some other studies that examined
effects of pesticides on honey bee learning. Prolonged exposure
(4 days) to field-realistic concentrations (100 nM) of the neonicotinoid imidacloprid and the OP coumaphos, or these compounds in combination, impaired olfactory learning and
memory formation in honeybee workers (Williamson and
Wright, 2013). Exposure to sub-lethal concentrations of nine pesticides did not affect olfactory learning performances of honey
bees, but four of the pesticides had effects during the PER assay
(Decourtye et al., 2005). Others found that exposure to diazinon
had a significant effect on odor learning of honey bees (Weick
and Thorn, 2002). Alternatively, though exposure to certain concentrations of OP insecticides like dimethoate can affect survival
of honey bees, the same concentrations might not alter learning
performance (Decourtye et al., 2005). Effects on learning and
recall of visual and olfactory discrimination tasks have also been
studied in bees orally treated with the OP methyl-parathion,
where recall of tasks learned with visual and olfactory discriminates were not affected (Guez et al., 2010). These discrepancies
in the effects of OPs have been observed previously in honey bees
(Belzunces et al., 2012).
Exposure to OP insecticides might make bees more susceptible
to natural or anthropogenic stressors. One indirect effect of OPs
that has been proposed is suppression of immune function. Exposure to OP insecticides has been shown to activate immune
responses in insects (Dubovskiy et al., 2013), and some insecticides
and miticides used for control of parasitic mites can affect immune
competence, thus rendering bees more susceptible to infections
(Boncristiani et al., 2012; Di Prisco et al., 2013). Cellular
immunity-mediated responses by hemocytes, and humoral immunity based on secretion of antimicrobial peptides (AMPs), are
important process of the immune system of honey bees. In the present study, although there was no clear dose response effect of OP
on expression of defensin1, expressions of hymenoptaecin was significantly greater in worker bees given sucrose solution containing
the median concentration mixture of OPs compared to bees given
the diet containing the 95th centile concentration mixture. Several
studies have investigated functioning of the honey bee immune
system when exposed to insecticides, but results of these studies
vary depending on insecticides and methods used (James et al.,
2012). Greater expressions of abaecin, defensin1, apidaecin, and
hymenoptaecin have been reported in honey bees challenged by
mechanical and pathogen-like stressors (Siede et al., 2012). Greater
expression of these genes under mild chemical, pathogen, or physical stress might be an adaptive mechanism that allows honey bees
and other insects to better cope with those stressors (Costantini,
2014; Costantini et al., 2010). It is not clear why expression of
genes responsible for AMP seemed to be more affected by the median concentration OP mixture than the 95th centile concentration
OP mixture.
Cytochrome P450 monooxygenases (P450s), glutathione-S
transferases (GSTs), and carboxyl/cholinesterases (CCEs) are
enzymes used by insects for detoxification of xenobiotics
(Feyereisen, 2012). However, these enzymes appear to play a lesser
role in detoxification of xenobiotics in honey bees compared to
other insects. Based on abundances of transcripts quantified by
use of qPCR, expression of genes that encode for these enzymes
were not affected in worker bees exposed to mixtures of environmentally relevant concentrations of OPs. Results of the current
study are consistent with current understanding of regulation of
these enzymes in honey bees. With the exception of members of
the CYP9 family (Claudianos et al., 2006), P450 enzymes in honey
bees are not induced by exposure to the substrates on which these
enzymes act, including phenobarbital (Glavan and Bozic, 2013;
Mao et al., 2011; Yu et al., 1984). Also, studies indicate that GSTs
and CCEs play only a minor role in detoxification of xenobiotics
(Iwasa et al., 2004; Johnson et al., 2009).
In conclusion, short-term dietary exposure of honey bee workers to environmentally-relevant concentrations of a mixture of OPs
did not adversely affect their survival or behavior, but some effects
were observed on activity of AChE, and expression of genes
involved in detoxification of OPs and immune response. This
results align with those of Al Naggar et al. (2015a,b), in which minimal hazard from direct and or dietary exposures of bee hives to
OPs occurred. Results of the current study suggest that shortterm dietary exposure to a mixtures of OP insecticides, as a singular stress factor, at levels found in honey within hives will not
adversely affect worker bees, and probably have no effect on colony vigor.
Acknowledgments
This study was financially supported by Grants from the
Egyptian Fellowship and Missions Sector, a Natural Science and
Engineering Research Council of Canada (to J.P.G., project #
326415-07; to G.C.C. project # RGPIN-2014-03577), Western
Economic Diversification Canada (to J.P.G., project # 6578 and
Y. Al Naggar et al. / Journal of Insect Physiology 82 (2015) 85–91
6807), and infrastructure from of the Canada Foundation for Innovation (to J.P.G., project XXXX; to G.C.C., project # 17030 and
31633). Prof. Giesy was supported by the Canada Research Chair
program, a Visiting Distinguished Professorship in the Department
of Biology and Chemistry and State Key Laboratory in Marine
Pollution, City University of Hong Kong, the 2012 ‘‘High Level
Foreign Experts” (#GDW20123200120) program, funded by the
State Administration of Foreign Experts Affairs, the P.R. China to
Nanjing University and the Einstein Professor Program of the
Chinese Academy of Sciences.
References
Al Naggar, Y., Codling, G., Vogt, A., Naiem, E., Mona, M., Seif, A., Giesy, J.P., 2015a.
Organophosphorus insecticides in honey, pollen and bees (Apis mellifera L.) and
their potential hazard to bee colonies in Egypt. Ecotoxicol. Environ. Saf. 114, 1–
8.
Al Naggar, Y., Vogt, A., Codling, G., Naiem, E., Mona, M., Seif, A., Robertson, A.J., Giesy,
J.P., 2015b. Exposure of honey bees (Apis mellifera L.) in Saskatchewan, Canada
to organophosphorus insecticides. Apidologie 46, 667–678.
Badiou, A., Meled, M., Belzunces, L.P., 2008. Honeybee Apis mellifera acetylcholinesterase—a biomarker to detect deltamethrin exposure. Ecotoxicol. Environ. Saf.
69, 246–253.
Belzunces, L.P., Tchamitchian, S., Brunet, J.L., 2012. Neural effects of insecticides in
the honey bee. Apidologie 43, 348–370.
Boily, M., Sarrasin, B., DeBlois, C., Aras, P., Chagnon, M., 2013. Acetylcholinesterase
in honey bees (Apis mellifera) exposed to neonicotinoids, atrazine and
glyphosate: laboratory and field experiments. Environ. Sci. Pollut. Res. 20,
5603–5614.
Boncristiani, H., Underwood, R., Schwarz, R., Evans, J.D., Pettis, J., Vanengelsdorp, D.,
2012. Direct effect of acaricides on pathogen loads and gene expression levels in
honey bees Apis mellifera. J. Insect Physiol. 58, 613–620.
Bradford, M.M., 1976. A rapid and sensitive method for the quantification of
microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem. 72, 248–254.
Chauzat, M.P., Martel, A.C., Cougoule, N., Porta, P., Lachaize, J., Zeggane, S., Au-bert,
M., Carpentier, P., Faucon, J.P., 2011. An assessment of honeybee colony
matrices, Apis mellifera (Hymenoptera: Apidae) to monitor pesticide presence in
continental France. Environ. Toxicol. Chem. 30, 103–111.
Claudianos, C., Ranson, H., Johnson, R.M., Biswas, S., Schuler, M.A., Berenbaum, M.R.,
Oakeshott, J.G., 2006. A deficit of detoxification enzymes: pesticide sensitivity
and environmental response in the honeybee. Insect Mol. Biol. 15, 615–636.
Cornman, R.S., Tarpy, D.S., Chen, Y., Jeffreys, L., Lopez, D., Pettis, J.S., VanEngelsdorp,
D., Evans, J.D., 2012. Pathogen webs in collapsing honey bee colonies. PLoS One
7, e43562.
Costantini, D., 2014. Does hormesis foster organism resistance to extreme events?
Front. Ecol. Environ. 12, 209–210.
Costantini, D., Metcalfe, N.B., Monaghan, P., 2010. Ecological processes in a hormetic
framework. Ecol. Lett. 13, 1435–1447.
Cutler, G.C., Purdy, J., Giesy, J.P., Solomon, K.R., 2014. Risk to pollinators from the use
of chlorpyrifos in the United States. Rev. Environ. Contam. Toxicol. 231, 219–
265.
Decourtye, A., Devillers, J., Genecque, E., Le Menach, K., Budzinski, H., Cluzeau, S.,
Pham-Delegue, M.H., 2005. Comparative sublethal toxicity of nine pesticides on
olfactory learning performances of the honeybee Apis mellifera. Arch. Environ.
Contam. Toxicol. 48, 242–250.
Desneux, N., Decourtye, A., Delpuech, J.M., 2007. The sublethal effects of pesticides
on beneficial arthropods. Annu. Rev. Entomol. 52, 81–106.
Di Prisco, G., Cavaliere, V., Annoscia, D., Varricchio, P., Caprio, E., Nazzi, F., Gargiulo,
G., Pennacchio, F., 2013. Neonicotinoid clothianidin adversely affects insect
immunity and promotes replication of a viral pathogen in honey bees. Proc.
Natl. Acad. Sci. 110, 18466–18471.
Dubovskiy, I.M., Yaroslavtseva, O.N., Kryukov, V.Y., Benkovskaya, G.V., Glupov, V.V.,
2013. An increase in the immune system activity of the wax moth Galleria
mellonella and of the Colorado potato beetle Leptinotarsa decemlineata under
effect of organophosphorus insecticide. J. Evol. Biochem. Physiol. 49, 592–596.
European and Mediterranean Plant Protection Organization (EPPO), 1992. Guideline
on test methods for evaluating the side-effects of plant protection products on
honey bees. EPPO Bulletin 22, 203–215.
Feyereisen, R., 2012. Insect CYP genes and P450 enzymes. In: Gilbert, L.I. (Ed.), Insect
Molecular Biology and Biochemistry. Elsevier, London, pp. 236–316.
Fletcher, M.A., Barnett, L., 2003. Bee pesticide poisoning incidents in the United
Kingdom. Bull. Insectol. 56, 141–145.
Frost, E.H., Shutler, D., Hillier, N.K., 2013. Effects of fluvalinate on honey bee
learning, memory, responsiveness to sucrose, and survival. J. Exp. Biol. 216,
2931–2938.
91
Gill, R.J., Ramos-Rodriguez, O., Raine, N.E., 2012. Combined pesticide exposure
severely affects individual- and colony-level traits in bees. Nature 491, 105–
108.
Glavan, G., Bozic, J., 2013. The synergy of xenobiotics in honey bee Apis mellifera:
mechanisms and effects. Acta Biol. Slov. 56, 11–25.
Guez, D., Zhu, H., Zhang, S.W., Srinivasan, M.V., 2010. Enhanced cholinergic
transmission promotes recall in honeybees. J. Insect Physiol. 56, 1341–1348.
Iwasa, T., Motoyama, N., Ambrose, J.T., Roe, R.M., 2004. Mechanism for the
differential toxicity of neonicotinoid insecticides in the honey bee, Apis
mellifera. Crop Prot. 23, 371–378.
James, R.R., Xu, J., 2012. Mechanisms by which pesticides affect insect immunity. J.
Invertebr. Pathol. 109, 175–182.
Johnson, R.M., Dahlgren, L., Siegfried, B.D., Ellis, M.D., 2013. Acaricide, fungicide and
drug interactions in honey bees (Apis mellifera). PLoS One 8, e54092.
Johnson, R.M., Ellis, M.D., Mullin, C.A., Frazier, M., 2010. Pesticides and honey bee
toxicity – USA. Apidologie 41, 312–331.
Johnson, R.M., Pollock, H.S., Berenbaum, M.R., 2009. Synergistic interactions
between in-hive miticides in Apis mellifera. J. Econ. Entomol. 102, 474–479.
Kamler, F., Titera, D., Piskulova, J., Hajslova, J., Mastovska, K., 2003. Intoxication of
honeybees on chemical treated winter rape: problem of its verification. Bull.
Insectol. 56, 125–130.
Lazonby, J., Waddington, D., 2015. The Essential Chemical Industry – Online,
University
of
York,
York,
UK.
Available
online:
<http://www.
essentialchemicalindustry.org/index.php>.
Mansour, S.A., 2004. Pesticides exposure – Egyptian scene. Toxicology 198, 91–115.
Mao, W., Schuler, M., Berenbaum, M., 2011. CYP9Q-mediated detoxification of
acaricides in the honey bee (Apis mellifera). Proc. Natl. Acad. Sci. U.S.A. 108,
12657–12662.
Mcdonough, J., Shih, T.M., 1997. Neuropharmacological mechanisms of nerve agentinduced seizure and neuropathology. Neurosci. Biobehav. Rev. 21, 559–579.
Minitab, 2013. Minitab Version 17.1.0. Penn State University, PA.
Mullin, C.A., Frazier, M., Frazier, J.L., Ashcraft, S., Simonds, R., Pettis, J.S., 2010. High
levels of miticides and agrochemicals in North American apiaries: implications
for honey bee health. PLoS One 5, e9754.
Pareja, L., Colazzo, M., Perez-Parada, A., Niell, S., Carrasco-Letelier, L., Besil, N., Cesio,
M.V., Heinzen, H., 2011. Detection of pesticides in active and depopulated
beehives in Uruguay. Int. J. Environ. Res. Public Health 8, 3844–3858.
Pilling, E.D., Jepson, P.C., 1993. Synergism between EBI fungicides and a pyrethroid
insecticide in the honeybee (Apis mellifera). Pestic. Sci. 39, 293–297.
Pohanka, M., 2011. Cholinesterases, a target of pharmacology and toxicology.
Biomed. Pap. 155, 219–223.
Pope, C.N., 1999. Organophosphorus pesticides: do they all have the same
mechanism of toxicity? J. Toxicol. Environ. Health Part B 2, 161–181.
Rissato, S.R., Galhiane, M.S., De Almeida, M.V., Gerenutti, M., Apon, B.M., 2007.
Multi-residue determination of pesticides in honey samples by gas
chromatography mass spectrometry and application in environmental
contamination. Food Chem. 101, 1719–1726.
Rozen, S., Skaletsky, J.H., 2000. Primer 3 on the WWW for general users and for
biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics
Methods and Protocols: Methods in Molecular Biology. Humana Press,
Totowa, NJ, pp. 365–386.
Siede, R., Meixner, M.D., Büchler, R., 2012. Comparison of transcriptional changes of
immune genes to experimental challenge in the honey bee (Apis mellifera). J.
Apic. Res. 51, 320–328.
Simon, P., 2003. Q-Gene: processing quantitative real-time RT–PCR data.
Bioinformatics 19 (11), 1439–1440.
Thompson, H.M., 1996. Interactions between pesticides; a review of reported effects
and their implications for wildlife risk assessment. Ecotoxicology 5, 59–81.
Weick, J., Thorn, R.S., 2002. Effects of acute sublethal exposure to coumaphos or
diazinon on acquisition and discrimination of odor stimuli in the honey bee
(Hymenoptera: Apidae). J. Econ. Entomol. 95, 227–236.
Wiest, L., Bulete, A., Giroud, B., Fratta, C., Amic, S., Lambert, O., Arnaudguilhem, C.,
2011. Multi-residue analysis of 80 environmental contaminants in honeys,
honeybees and pollens by one extraction procedure followed by liquid and gas
chromatography coupled with mass spectrometric detection. J. Chromatogr. A
1218, 5743–5756.
Williamson, S.M., Wright, G.A., 2013. Exposure to multiple cholinergic pesticides
impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, 1799–
1807.
Wu, J.Y., Anelli, C.M., Sheppard, W.S., 2011. Sub-lethal effects of pesticide residues in
brood comb on worker honey bee (Apis mellifera) development and longevity.
PLoS One 6, e14720.
Yu, S., Robinson, F., Nation, J., 1984. Detoxification capacity in the honey bee Apis
mellifera L. Pestic. Biochem. Physiol. 22, 360–368.
Zhu, W., Schmehl, D.R., Mullin, C.A., Frazier, J.L., 2014. Four common pesticides,
their mixtures and a formulation solvent in the hive environment have high
oral toxicity to honey bee larvae. PLoS One 9, e7754.