Marine Pollution Bulletin 85 (2014) 344–351
Contents lists available at ScienceDirect
Marine Pollution Bulletin
journal homepage: www.elsevier.com/locate/marpolbul
Regulation of CYP11B1 and CYP11B2 steroidogenic genes
by hypoxia-inducible miR-10b in H295R cells
Suraia Nusrin a, Steve K.H. Tong a, G. Chaturvedi a, Rudolf S.S. Wu b,d, John P. Giesy c,d,
Richard Y.C. Kong a,d,⇑
a
Department of Biology and Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative Region
School of Biological Sciences, University of Hong Kong, Pokfulam, Hong Kong Special Administrative Region
Department of Veterinary Biomedical Sciences and Toxicology Centre, University of Saskatchewan, Canada
d
State Key Laboratory in Marine Pollution, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative Region
b
c
a r t i c l e
i n f o
Article history:
Available online 24 April 2014
Keywords:
Hypoxia-inducible factor
miR-10b
CYP11B1
CYP11B2
Aldosterone
Cortisol
a b s t r a c t
Although numerous studies have shown that hypoxia affects cortisol and aldosterone production in vivo,
the underlying molecular mechanisms regulating the steroidogenic genes of these steroid hormones are
still poorly known. MicroRNAs are post-transcriptional regulators that control diverse biological
processes and this study describes the identification and validation of the hypoxia-inducible microRNA,
miR-10b, as a negative regulator of the CYP11B1 and CYP11B2 steroidogenic genes in H295R human
adrenocortical cells. Using the human TaqMan Low Density miRNA Arrays, we determined the miRNA
expression patterns in H295R cells under normoxic and hypoxic conditions, and in cells overexpressing
the human HIF-1a. Computer analysis using three in silico algorithms predicted that the hypoxia-inducible miR-10b molecule targets CYP11B1 and CYP11B2 mRNAs. Gene transfection studies of luciferase constructs containing the 30 -untranslated region of CYP11B1 or CYP11B2, combined with miRNA
overexpression and knockdown experiments provide compelling evidence that CYP11B1 and CYP11B2
mRNAs are likely targets of miR-10b.
Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction
Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that
controls the expression of a number of hypoxia-responsive genes
to help cells adapt and survive under hypoxic stress (Semenza,
1998; Lisy and Peet, 2008). HIF-1 is a heterodimeric protein that
consists of HIF-1a and HIF-1b subunits (Ke and Costa, 2006). Activation of HIF-1 under hypoxia is mediated through stabilization of
the HIF-1a subunit at the post-translational level (Semenza, 1998),
which is rapidly degraded under normoxia, via the ubiquitin–proteosome pathway (Lisy and Peet, 2008).
Steroid hormones such as glucocorticoids are regulators of
many physiological responses to stress, and are produced from
cholesterol through a steroidogenic pathway that occurs in the
mitochondrion of endocrine tissues. For example, adrenal cells
from rats exposed to hypoxia showed a 3–4-fold reduction in
⇑ Corresponding author at: Department of Biology and Chemistry, City University
of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative
Region. Tel.: +852 3442 7794; fax: +852 3442 0522.
E-mail address: bhrkong@cityu.edu.hk (R.Y.C. Kong).
http://dx.doi.org/10.1016/j.marpolbul.2014.04.002
0025-326X/Ó 2014 Elsevier Ltd. All rights reserved.
CYP11B2 (aldosterone synthase) mRNA without a change in other
mitochondrial cytochrome P-450 enzymes (Raff et al., 1996). In
vitro studies in bovine adrenocortical cells have found that hypoxia
directly inhibits aldosterone synthesis (Raff et al., 1989) in the
presence of known stimulators of aldosterone production such as
ACTH, cAMP, potassium and Angiotensin II possibly through the
inhibition of CYP11B2 (Raff et al., 1989; Raff and Kohandarvish,
1990; Brickner et al., 1992). Although numerous studies have
reported that hypoxia affects steroidogenesis in the adrenal gland
(Raff and Kohandarvish, 1990; Brickner et al., 1992; Raff et al.,
1996; Bruder et al., 2002), the underlying molecular mechanisms
remain poorly characterized.
miRNAs are non-coding regulatory RNAs, 20–25 nucleotides in
length, which are implicated in the regulation of numerous biological processes such as cell proliferation, differentiation, and metabolism (Karp and Ambros, 2005; Bartel, 2009). miRNAs regulate
gene expression either directly through translational repression
or by stimulating degradation of their target mRNAs (Bartel,
2009). It is estimated that 20–30% of all human genes are targeted
by miRNAs (Krek et al., 2005). Although miRNAs are implicated in a
diverse array of cellular processes during vertebrate development
345
S. Nusrin et al. / Marine Pollution Bulletin 85 (2014) 344–351
(Guo et al., 2009; Finnerty et al., 2010) and several studies have
demonstrated that miRNAs are implicated in the physiological
functions of various endocrine tissues (Baley and Li, 2012), the role
of miRNAs in adrenal cell physiology remain largely unknown.
Recent studies indicate that HIF-1 directly activates a number of
hypoxia-responsive microRNAs (HRMs) such as miR-210 and
miR-373 which are involved in the regulation of a variety of celland tissue-specific responses to hypoxia (Kulshreshtha et al.,
2008; Crosby et al., 2009). Because HRMs are implicated in diverse
physiological processes, we speculated that the effects of hypoxia
on adrenal steroidogenesis may be mediated by certain HIF1regulated miRNAs. Here, we describe the identification and
characterization of the hypoxia-responsive miR-10b as a negative
regulator of CYP11B1 and CYP11B2, and its inhibitory effect on cortisol and aldosterone production in H295R human adrenocortical
cells.
2. Materials and methods
Table 1
Gene primers for qRT-PCR analysis of steroidogenic enzyme genes.
Primer name
Primer sequence (50 –30 )
Refs.
GLUT-1 forward
GLUT-1 reverse
VEGF-A forward
VEGF-A reverse
b-Actin forward
CCAGCTGCCATTGCCGTT
GACGTAGGGACCACACAGTTGC
AACCATGAACTTTCTGCTGTCTTG
TTCACCACTTCGTGATGATTCTG
CACTCTTCCAGCCTTCCTTCC
b-Actin reverse
AGGTCTTTGCGGATGTCCAC
CYP21A2
forward
CYP21A2
reverse
CYP11B1
forward
CYP11B1
reverse
CYP11B2
forward
CYP11B2
reverse
CGTGGTGCTGACCCGACTG
TCCCGAGGGCCTCTAGGA
This study
This study
This study
This study
Hilscherova et al.
(2004)
Hilscherova et al.
(2004)
Hilscherova et al.
(2004)
Hilscherova et al.
(2004)
Oskarsson et al. (2006)
GGGACAAGGTCAGCAAGATCTT
Oskarsson et al. (2006)
TTGTTCAAGCAGCGAGTGTTG
Oskarsson et al. (2006)
GCATCCTCGGGACCTTCTC
Oskarsson et al. (2006)
GGCTGCATCTTGAGGATGACAC
2.1. Cell culture
H295R cells (ATCC CRL-2128; ATCC, Manassas, VA, USA) were
cultured in a 1:1 mixture of Dulbecco’s Modified Eagle’s medium
and Ham’s F-12 medium (DMEM/F12) (Sigma D-2906; Sigma, St.
Louis, MO, USA) supplemented with 1.2 g/L Na2CO3, 5 ml/L of
ITS + Premix (BD Bioscience; 354352), and 12.5 ml/L of BD NuSerum (BD Bioscience; 355100) at 37 °C in 5% CO2 as described
previously (Hilscherova et al., 2004). Exposure of H295R cells
(1.2 106) to normoxia (20% O2) or hypoxia (1% O2) was carried
out at 37oC for 24 h. Normoxia or hypoxia condition was created
in a CO2 incubator by mixing 1% O2, 94% N2 and 5% CO2 or 20%
O2, 75% N2 and 5% CO2, respectively, using a gas mixer (WITT)
and the O2 level was monitored using a gas meter (BW
Technologies).
2.2. RNA isolation and first-strand cDNA synthesis
Total RNA was isolated with TRIzol reagent (Invitrogen) according to manufacturer’s instructions. Contaminating genomic DNA
was removed with RQ1 RNase-free DNase (Promega). First-strand
cDNA was synthesized using 1 lg total RNA, 1.25 lL dNTP
(10 mM), 2.4 lL random hexamer (50 ng/lL), 1 lL RNaseOUT
(40 U; Invitrogen), and 1 lL M-MLVRT (H-) (200 U/lL; Promega)
in a total volume of 25 lL in 1 MMLVRT reaction buffer at 42 °C
for 50 min. The reaction was terminated by incubation at 70 °C
for 15 min.
2.3. Real-time PCR
Gene expression quantification was achieved by real-time PCR
as previously described (Yu et al., 2012). PCR assays were
conducted using the SYBR Green-based detection method (Kapa
Biosystem, #KK4600) according to the manufacturer’s instructions.
The primer sequences for real-time PCR are listed in Table 1.
Melting curve analysis was performed at the end of each PCR thermal profile to assess amplification specificity. The identity of PCR
amplicons was confirmed by DNA sequencing. Real-time PCR reactions for all samples were performed in triplicate using the 7500
Fast Real-time PCR System (ABI). Cycling conditions were as follows: 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 58 °C for 30 s,
1 min 72 °C and 7 min of final extension at 72 °C for one cycle.
Quantification of SF-1, CITED-2, DAX-1 and NURR-77 expression
was carried out using TaqMan gene expression assays (ABI) according to the manufacturer’s instructions.
2.4. Western blot analysis
Cellular proteins were extracted in 100 lL of RIPA buffer with
protease inhibitor and PMSF (Calbiochem). Protein concentration
was determined using the Bradford assay (Bio-Rad, Hercules, CA).
Proteins (50 lg) were separated on 9% sodium dodecyl sulphate
polyacrylamide gel and transferred onto PVDF membranes (GE
Health Care). Membranes were blocked in PBST (Phosphate-buffered saline with 0.1% of Tween-20) containing 3% nonfat milk
(Carnation), and probed with anti-human CYP11B2 rabbit polyclonal antibody (Novus, #NBP1-56518) (1:500 dilution) overnight
at 4 °C. The anti-CYP11B2 antibody was found in this study to specifically detect the human CYP11B2 (55 kDa) and does not cross
react with CYP11B1 protein (65 kDa) (data not shown). Membranes were washed with PBS-T and incubated with the secondary
antibody conjugated with horseradish peroxidase. Immunoreactivity was visualized by enhanced chemiluminescence (Amersham)
according to the manufacturer’s protocol.
2.5. Measurement of aldosterone and cortisol by ELISA
Quantification of aldosterone and cortisol in culture media was
performed using ELISA as described by Hecker et al. (2006).
Samples were centrifuged for 5 min at 5000g at room temperature,
and the supernatant was collected for hormone extraction.
Samples were spiked with 1,2,6,7-3H-labeled T (0.0002 lCi/lL)
(PerkinElmer) prior to extraction for determination of extraction
efficiency. Hormones were extracted twice with 2.5 mL diethyl
ether, and centrifuged at 2000g for 10 min. The solvent phase containing the steroid hormones was evaporated under a stream of
nitrogen, and the residue was reconstituted in 250 lL EIA buffer
(Cayman Chemical) and diluted 1:2 or 1:3 for aldosterone and cortisol analysis, respectively. Aldosterone and cortisol were measured by competitive ELISA using commercial EIA kits (Cayman
Chemical).
2.6. MicroRNA profiling
Total RNA was isolated using the MirVanaTM miRNA isolation
Kit (Ambion, Inc., TX, USA) according to the manufacturer’s instructions. MicroRNA profiling was carried out using the human
TaqMan Low Density miRNA Arrays (TLDAs) (Invitrogen). Total
RNA from each sample was reverse transcribed using the Megaplex
RT Primers (Human Pools A and B; Applied Biosystems) according
346
S. Nusrin et al. / Marine Pollution Bulletin 85 (2014) 344–351
to manufacturer’s instructions, and the cDNA products preamplified using the Megaplex PreAmp Primers (Applied Biosystems)
according to the manufacturer’s instructions. TLDAs were run on
a 7900HT thermocycler (Applied Biosystems) using sequence
detection systems (SDS) software version 2.4. PCR thermal-cycling
conditions were as follows: 40 cycles of 60 °C for 2 min, 42 °C for
1 min and 50 °C for 1 s and finally 85 °C for 5 min for each sample.
MicroRNA expression was normalized using the endogenous control U6 snRNA. Relative quantification (RQ) was performed using
the 2D(DCT) method). The degree of induction or inhibition (DDCT)
was calculated as fold difference which is expressed as: Xexp/
Xcon = 2DDCT. Xexp and Xcon represent the degree of expression in
test and control samples, respectively. Site predictions for miRNAs
were performed using three in silico algorithms – TargetScan
(http://www.targetscan.org/), PicTar (http://pictar.bio.nyu.edu/),
and Sanger microRNA target (http://microrna.sanger.ac.uk/) – to
identify target binding sites within the 30 -UTR of the CYP21A2,
CYP11B1 and CYP11B2 genes.
2.7. Overexpression and knockdown of miR-10b
Overexpression and knockdown of miR-10b were carried out by
electroporation of pre-miR-10b (100 nM) and antimiR-10b
(100 nM) molecules (purchased from Ambion), respectively, into
H295R cells using the Neon electroporation system (Invitrogen).
Twenty-four hours after electroporation, the medium was replaced
and cells incubated under hypoxia or normoxia for a further 24 h,
and total RNA extracted for qRT-PCR analysis. Quantification of
miR-10b expression was carried out using the TaqMan MicroRNA
Assay kit for hsa-miR-10b (ABI) according to the manufacturer’s
instructions. All reactions were run in triplicate and relative miRNA
expression was normalized against U6 snRNA.
2.8. Construction of luciferase reporter plasmids of CYP11B1/B2 30 UTR
An 879-bp and 1233-bp fragment of the 30 -UTR of CYP11B1 and
CYP11B2, respectively, were amplified by PCR using genomic DNA
from H295R cells and the following two pairs of primers: For
CYP11B1: 50 -GCAAAGCTTACACCTCCAGGTGGAGACAC (forward)
and 50 -CAGACTAGTCCCCACATGACTCTTCCATC (reverse); and for
CYP11B2: 50 -GCAAAGCTTGAAGCACTTCCTGGTGGAGA (forward)
and 50 -CAGACTAGTAGCTGGCTGCTGAGATCTTT (reverse). Both forward and reverse primers contain SpI and HindII restriction sites,
respectively. The PCR products of the CYP11B1 and CYP11B2 30 UTR fragments were double-digested with SpI and HindIII, and
cloned into the pMIR-REPORT luciferase vector (Ambion) which
resulted in linking each 3-UTR fragment to the CMV-driven luciferase reporter gene. The plasmids are designated pMIR-B1-WT and
pMIR-B2-WT. Two mutant constructs with mutations that disrupt
the putative miR-10b binding sites in the 30 -UTR of CYP11B1 and
CYP11B2 were prepared using the GENEARTÒ Site-Directed Mutagenesis System (Invitrogen). For mutation of the mir-10b binding
site in CYP11B1, the following primers were used: 50 -ATCACGTC
TCTGCACCCGATTCCCCAGCCTGGCCACCAG (forward) and 50 -CTGG
TGGCCAGGCTGGGGAATCGGGTGCAGAGACGTGAT (reverse). For
mutation of the mir-10b binding in CYP11B2, the following
primers were used: 5-GTCTTGCATCTGCACCCGATTCCCCAGCCT
GGCCACCAG (forward) and 50 -CTGGTGGCCAGGCTGGGGAATCGG
GTGCAGATGCAAGAC. The corresponding mutant plasmids are designated pMIR-B1-MUT and pMIR-B2-MUT. The plasmid clones
were verified by DNA sequencing.
2.9. Luciferase reporter assay
Hela cells at a density of 1 105 per well in 24-well plates were
cotransfected with pMIR-REPORT luciferase vectors with or
without premiR-10b (100 nM) or scrambled oligos (Ambion) using
Lipofectamine 2000 reagent (Invitrogen). Twenty-four hours posttransfection, cells were harvested and lysed with Glo lysis buffer
(Promega). Reporter assays were performed using a dual-luciferase
reporter assay system (Promega) according to the manufacturer’s
instructions. Results are expressed as relative luciferase unit
(RLU), and b-gal expression from the control plasmid was used to
normalize variability due to differences in cell viability and transfection efficiency. Microplate was read using the FLUOstar Optima
instrument (BMG Labtech, Durham, NC, USA). Data are expressed
as mean ± SD from three independent experiments.
2.10. Statistical analysis
Student’s t-test was used to test the null hypothesis that there is
no significant difference between each individual parameter measured in the control and treatment groups over time. The data are
expressed as mean ± S.E.M, and a p < 0.05 was considered statistically significant. All statistical calculations were performed using
Prism 3.02 (GraphPad, SanDiego, CA).
3. Results
3.1. Effects of hypoxia on expression of steroidogenic genes and
production of corticosteroid hormones in H295R cells
In order to confirm that the HIF-1 pathway is induced in H295R
cells under our experimental conditions, VEGF-A and GLUT-1 (gene
targets of HIF-1) mRNA levels were measured by quantitative
RT-PCR (qRT-PCR) using gene-specific primers (Table 1), and were
found to be upregulated in hypoxic H295R cells by 3.5 ± 0.17
(p < 0.0005) and 4.8 ± 0.19 (p < 0.0005) fold, respectively (data
not shown). The induction of GLUT-1 and VEGF-A mRNA indicated
that the hypoxic conditions used in the study were appropriate.
Cortisol and aldosterone (corticosteroids) are produced from
progesterone by the concerted activities of 21-hydroxylase
(CYP21A2), 11b-hydroxylase (CYP11B1) and aldosterone synthase
(CYP11B2) enzymes (Quinn and Williams, 1988). The effect of
hypoxia on the expression of these genes was measured by
qRT-PCR using gene-specific primers (Table 1). As shown in
Fig. 1A, CYP21A2 and CYP11B2 were significantly upregulated by
2.49 ± 0.42 (p < 0.05) and 5.3 ± 0.73 (p < 0.005) fold, respectively,
in hypoxic H295R cells. However, although CYP11B2 mRNA was
increased under hypoxia, Western blot analysis demonstrated that
the CYP11B2 protein was downregulated 0.38 ± 0.02-fold
(p < 0.0001) (Fig. 1B), which suggests that the CYP11B2 mRNA
transcripts were likely subjected to translational suppression in
hypoxic H295R cells resulting in a reduction in the CYP11B2 protein. No significant difference in CYP11B1 expression was detected
in H295R cells under normoxic and hypoxic conditions.
3.2. Hypoxia effects on adrenal transcription regulatory genes
CYP21A2, CYP11B1 and CYP11B2 are known to be regulated by a
number of transcription regulatory factors such as CITED2 (CBP/
300-interacting transactivator 2), DAX-1 (Dosage-sensitive sex
reversal-1), NURR 77 and NOR1 (members of the NGFI-B nuclear
orphan receptor superfamily, and SF-1 (Steroidogenic Factor-1)
(Bassett et al., 2002; Romero et al., 2007; Nogueira et al., 2009;
Nogueira and Rainey, 2010). As shown in Fig. 1C, the expressions
of NURR-77, CITED2 and NOR-1 were upregulated by 2.9 ± 0.47
(p < 0.01), 2.9 ± 0.19 (p < 001), and 1.8 ± 0.19 (p < 0.05) fold, respectively, while SF-1 and DAX-1 were significantly downregulated
to 0.47 ± 0.05 (p < 0.005) and 0.19 ± 0.01 (p < 0.0001) fold,
respectively, in hypoxic H295R cells.
S. Nusrin et al. / Marine Pollution Bulletin 85 (2014) 344–351
347
Fig. 1. Hypoxia effects on expression of steroidogenic and transcription regulatory genes, and production of corticosteroid hormones (cortisol and aldosterone) in H295R
cells. (A) Expression of CYP21A, CYP11B1 and CYP11B2 was measured by qRT-PCR; (B) western blot analysis of CYP11B2 (lane 1, normoxia; lane 2, hypoxia) and histogram of
the corresponding CYP11B2 protein levels; CYP11B2 protein was normalized to b-actin; (C) expression of five transcription regulatory genes – SF1, Nurr77, CITED-2, DAX-1 and
NOR-1 was measured by qRT-PCR; and (D) Aldosterone and cortisol levels in normoxic and hypoxic H295R cells were measured using commercial ELISA kits. Relative
expression values were normalized to 18S rRNA and are presented as fold change relative to the normoxic controls. Data are presented as mean ± SEM. Asterisk (*) indicates
significant difference between normoxia and hypoxia groups; * p < 0.05, ** p < 0.005, *** p < 0.0005.
3.3. Aldosterone and cortisol levels
Aldosterone and cortisol levels were measured in the spent
medium of H295R cells cultured under normoxic and hypoxic
conditions. As shown in Fig. 1D, the aldosterone and cortisol levels
in hypoxic H295R cells were significantly reduced 0.31 ± 0.08
(p = 0.0002) and 0.61 ± 0.14-fold (p = 0.04), respectively, of that in
normoxic cells. This finding is consistent with previous reports in
bovine and human adrenal cells where these hormones were found
to be significantly reduced under hypoxia (Brickner et al., 1992;
Raff et al., 2005).
The expression pattern of miR-10b was further examined in
normoxic, hypoxic, HIF1a-overexpressing and -knockdown
H295R cells by real-time PCR using TaqMan MicroRNA Individual
assays (Applied Biosystem). Fig. 2 shows that miR-10b is upregulated by 1.48 ± 0.03 (p = 0.001) and 1.3 ± 0.06 (p = 0.05) fold,
respectively, in hypoxic and HIF1a-overexpressing cells, but is
downregulated 0.74 ± 0.006 (p = 0.0001) fold in HIF-1a-knockdown cells. The differential expression pattern of miR-10b in
H295R cells under these conditions suggests that miR-10b is likely
regulated by HIF-1.
3.4. MicroRNA profiling and selection of miR-10b for further analysis
3.5. Effects of miR-10b on CYP21A2, CYP11B1 and CYP11B2 expression
and corticosteroid production
MicroRNA profiling experiments were performed on total RNA
isolated from normoxic and hypoxic H295R cells as well as
H295R cells transfected with the pLenti6-HIF1a plasmid that overexpresses the human HIF-1a (Nusrin, 2013). One hundred and
twenty miRNAs were found to be upregulated in hypoxic H295R
cells (as compared to normoxic cells) and 70 miRNAs were upregulated in H295R cells overexpressing the human HIF-1a protein
(data not shown). Computer analysis of these upregulated miRNAs
using three different algorithms – TargetScan (http://www.targetscan.org/), PicTar (http://pictar.bio.nyu.edu/), and Sanger microRNA target (http://microrna.sanger.ac.uk/) – identified miR-10b to
have target binding sites in both the 30 -UTR of CYP11B1 and
CYP11B2, which suggests that miR-10b may have an important
role in post-transcriptional regulation of these two genes under
hypoxia.
To investigate the effect of miR-10b on the regulation of
CYP21A2, CYP11B1 and CYP11B2, H295R cells were transfected with
synthetic pre-miR-10b, anti-miR-10b inhibitor or scrambled control sequences, and total RNA extracted 48 h post-transfection for
qRT-PCR analyses. As shown in Fig. 3A and B, qRT-PCR confirmed
the overexpression and knockdown of miR-10b by 36.7 ± 7.8 and
0.66 ± 0.03-fold, respectively, in H295R cells following pre-miR10b
and anti-miR-10b transfection, respectively (p < 0.05). Overexpression of miR-10b significantly reduced CYP11B1 mRNA 0.29 ± 0.07fold and CYP11B2 mRNA 0.4 ± 0.01 (p < 0.05) fold relative to the
scrambled control miRNAs; but had no significant effect on CYP21A2
expression (Fig. 3C). Interestingly, knockdown of miR-10b in H295R
cells resulted in increased expression of CYP11B1 and CYP11B2 by
1.4 ± 0.07 (p = 0.008) and 2.1 ± 0.29 (p = 0.025) fold, respectively
(Fig. 3D). These observations are consistent with the notion that
348
S. Nusrin et al. / Marine Pollution Bulletin 85 (2014) 344–351
Fig. 2. Expression pattern of miR-10b. (A) Expression of miR-10b in normoxic and hypoxic H295R cells; (B) miR-10b expression in H295R cells transfected with the pLenti6HIF1a (HIF1a overexpression) plasmid or control pLenti6 vector under normoxia; and (C) miR-10b expression in H295R cells transfected with HIF-1a siRNA, HIF-1ai (HIF1a
knockdown) or negative RNAi control under hypoxia. Expression levels were normalized to U6 snRNA. Data are presented as mean ± SEM. Asterisks (*) indicate significant
difference between control and treated H295R cells under normoxia or hypoxia; * p < 0.05, *** p < 0.0005.
CYP11B1 and CYP11B2 (but not CYP21A2) mRNAs are direct targets
of miR-10b.
To determine the effect of miR-10b on corticosteroid production, aldosterone and cortisol levels were measured in the culture
media of H295R cells following pre-miR-10b or anti-miR-10b
transfection. Overexpression of miR-10b significantly reduced
cortisol level 0.44 ± 0.17-fold (p = 0.032) and aldosterone level
0.36 ± 0.13-fold (p = 0.009) relative to H295R cells transfected with
the scrambled control oligos (Fig. 4), which corresponded to the
reduction in CYP11B1 and CYP11B2 expression, respectively
(Fig. 3C). Interestingly, knockdown of miR-10b (following antimiR-10b transfection) significantly increased aldosterone production by 1.72 ± 0.16-fold (p = 0.027) relative to cells transfected with
scrambled control oligos. In contrast, although a modest increase
in cortisol level was observed in response to anti-miR-10b challenge (0.62 ± 0.25-fold; p = 0) relative to pre-miR-10b-transfected
cells (0.44 ± 0.17-fold; p = 0.027), the increase was not statistically
significant.
3.6. Analysis of the 30 -UTRs of CYP11B1 and CYP11B2 using luciferase
reporter assays
pMIR-B2-WT reporter constructs, respectively. Additionally,
mutant constructs with mutations that disrupt the putative miR10b binding sites in the 30 -UTR of CYP11B1 (pMIR-B1-MUT) and
CYP11B2 (pMIR-B2-MUT) (Fig. 5A and B) were also prepared using
the GENEART Site-Directed Mutagenesis System (Invitrogen). All
constructs were verified by DNA sequencing. The constructs were
cotransfected with premiR-10b or scrambled oligos (control) into
HeLa cells followed by measurement of their luciferase activities.
Overexpression of pre-miR-10b in HeLa cells significantly reduced
the luciferase activity of the wild type CYP11B1-30 -UTR construct
(pMIR-B1-WT) 0.79 ± 0.02-fold (p = 0.0007), and this inhibition
was abolished when the miR-10b binding was mutated in the
mutant CYP11B1-30 -UTR construct (pMIR-B1-MUT) (Fig. 6A). As
expected, miR-10b had no effect on the endogenous luciferase
activity of the control pMIR-REPORT vector. Similarly, overexpression of pre-miR-10b significantly reduced the luciferase activity of
the wild type CYP11B2 30 -UTR construct (pMIR-B2-WT) 0.75 ±
0.044 fold (p = 0.0046), and the inhibitory effect was abolished in
the mutant CYP11B2-30 -UTR construct (pMIR-B2-MUT) where the
miR-10b binding site has been eliminated (Fig. 6B).
4. Discussion
To determine whether miR-10b binds to the 30 -UTR of CYP11B1
and CYP11B2 to downregulate expression of these genes, luciferase
reporter assays were performed. An 879-bp 30 -UTR fragment of the
CYP11B1 gene and a 1233-bp 30 -UTR fragment of the CYP11B2 gene,
which contain the wild-type miR-10b binding site (Fig. 5A and B),
were cloned into the pMIR-REPORT vector (Ambion). This resulted
in fusion of the 30 -UTR fragments of CYP11B1 and CYP11B2 to a
CMV-driven luciferase reporter to generate the pMIR-B1-WT and
This study demonstrated that hypoxia differentially regulates
the expression of three steroidogenic enzyme genes that are
involved in the biosynthesis of cortisol and aldosterone in H295R
cells. Previous studies have reported that CYP11B2 expression
and aldosterone synthesis are downregulated under hypoxia in
rat and bovine adrenocortical cells (Raff and Kohandarvish, 1990;
Brickner et al., 1992; Raff et al., 1996; Bruder et al., 2002). In the
S. Nusrin et al. / Marine Pollution Bulletin 85 (2014) 344–351
349
Fig. 3. Overexpression and knockdown of miR-10b. (A) Overexpression of miR-10b was performed by electroporation of H295R cells with pre-miR-10b molecules under
normoxia; (B) miR-10b knockdown was performed by electroporation of H295R cells with anti-miR-10b inhibitor molecules under hypoxia; (C) effect of miR-10b
overexpression on CYP21A2, CYP11B1 and CYP11B2 expression; (D) effect of miR-10b knockdown on CYP21A2, CYP11B1 and CYP11B2 expression; relative mRNA expression
and miR-10b values were normalized to 18S rRNA and U6 snRNA, respectively. Fold change in miR-10b is relative to the respective negative scrambled controls. Data are
presented as mean ± SEM. Asterisks (*) indicate significant difference between control and pre-miR-10b or anti-miR-10b; * p < 0.05.
Fig. 4. Effect of miR-10b on production of stress steroid hormones in H295R cells.
pre-miR-10b data are relative to cells transfected with control (scrambled) pre-miR,
and anti-miR-10b data are relative to cells transfected with control (scrambled)
antimiR molecules. Data are presented as mean ± SD. Asterisks (*) indicate
significant difference between control and premiR/antimiR-transfected cells,
*
p 6 0.05, ** p 6 0.005.
current study, we demonstrated that although CYP11B2 mRNA is
upregulated in H295R cells under hypoxia, the CYP11B2 protein and aldosterone levels were downregulated 0.38 ± 0.02
(p < 0.0001) fold (Fig. 1B) and 0.31 ± 0.08 (p = 0.0002) fold
(Fig. 1D), respectively, relative to the normoxic control.
A number of transcription regulatory factors such as CITED2,
DAX-1, NURR-77 and NOR1 (NGFI-B nuclear orphan receptor
superfamily) and SF-1 have been shown to play an important role
in CYP21A2, CYP11B1 and/or CYP11B2 gene regulation (Bassett
et al., 2002; Romero et al., 2007; Nogueira et al., 2009; Nogueira
Fig. 5. miR-10b binding sites in the 30 -UTR of CYP11B1 and CYP11B2 genes. Seed
sequence of the putative miR-10b in the 30 -UTR of (A) CYP11B1 and (B) CYP11B2. The
top strand in each pair is in the 50 –30 orientation, and the bottom strand is in the 30 –
50 orientation, with the predicted base pairing between the 30 -UTR (miR-binding
site) and the miRNA seed sequence indicated by vertical lines. The wild-type seed
sequence and complementary bases in the 30 -UTR are highlighted in blue;
mutations in the 30 -UTR binding sites that disrupt base pairing are represented in
red. (For interpretation of the references to colour in this figure legend, the reader is
referred to the web version of this article.)
and Rainey, 2010). For example, it has been demonstrated that
CYP21A2 and CYP11B2 promoter activity are directly activated by
NURR-77 and NOR-1 in gene transfection studies (Nogueira et al.,
2009). Moreover, Bassett et al. (2004) have described the binding
of NURR-77 to cognate DNA elements in the 50 -flanking sequence
350
S. Nusrin et al. / Marine Pollution Bulletin 85 (2014) 344–351
aldosterone) production (Fig. 4). Further gene transfection studies
using luciferase reporter constructs fused to the wild-type or
mutated forms of the 30 -UTRs of CYP11B1 (Fig. 6A) or CYP11B2
(Fig. 6B) demonstrated that an increase in miR-10b levels reduces
the activity of the luciferase genes of the wild-type 30 -UTR constructs (but not the mutant counterparts), which provided additional confirmation that miR-10b negatively regulates CYP11B1
and CYP11B2 mRNAs via binding site to the 30 -UTR sequence.
Many studies have reported that hypoxia affects steroidogenesis in the adrenal gland and may potentially disrupt normal
adrenal functions that could contribute to adrenal hyperplasia.
To better understand the possible role(s) of miRNAs and HIFs in
hypoxic dysregulation of steroid hormone production and the
different forms of adrenal disorders, further investigations on other
hypoxia- or HIF-inducible miRNAs are warranted.
Acknowledgements
This work was supported by a Seed Collaborative Research Fund
(SCRF) (PJ9369101) from the State Key Laboratory in Marine Pollution (SKLMP). The authors wish to acknowledge the support of an
instrumentation grant from the Canada Foundation for Infrastructure. Prof. Giesy was supported by the Canada Research Chair
program, an at-large Chair Professorship at the Department of
Biology and Chemistry and State Key Laboratory in Marine
Pollution, City University of Hong Kong, and the Einstein Professor
Program of the Chinese Academy of Sciences.
Fig. 6. Effect of miR-10b on CYP11B1-30 -UTR luciferase activity. (A) HeLa cells
cotransfected with WT (pMIR-B1-WT) or mutant CYP11B1-30 -UTR (pMIR-B1-MUT)
luciferase constructs plus the scrambled oligos (control) or pre-miR-10b; (B) HeLa
cells cotransfected with WT (pMIR-B2-WT) or mutant CYP11B2-30 -UTR (pMIR-B2MUT) luciferase constructs plus the scrambled oligos (control) or pre-miR-10b. Data
represent mean ± SEM from 3 independent experiments. Asterisk (*) indicates
significant difference between control and premiR-10b- transfected H295R cells,
*
p < 0.05, *** p < 0.0005.
of the human CYP11B2 gene. In addition, Romero et al. (2007) have
reported the stimulatory effect of NURR-77 and CITED2 on
CYP11B1 and CYP11B2 expression in H295R cells. Among the five
transcription regulatory factors examined in the present study,
we found that NURR-77, CITED2 and NOR-1 were significantly
upregulated under hypoxia in H295R cells (Fig. 1C), an observation
that is consistent with results reported in numerous other studies
(Choi et al., 2004; Agrawal et al., 2008; Martorell et al., 2009). All in
all, these results suggest that the hypoxic induction of CYP11B2
mRNA levels in hypoxic H295R cells (Fig. 1A) may be associated
with the increased expression of NURR-77, CITED2 and/or NOR-1
(Fig. 1C). SF-1 is a master regulator of adrenal steroidogenesis
and is known to play an important role in adrenocortical function
and development (Hammer et al., 2005). It has been demonstrated
previously that SF-1 activates CYP11B1 expression in both human
(NCI-H295R) and mouse (Y-1) adrenal cells (Bassett et al., 2002)
and it is possible that the absence of CYP11B1 induction in hypoxic
H295R cells may be related to the reduced expression of SF-1
(Fig. 1A and D).
Recent studies have demonstrated that miRNAs play important
roles in adrenal steroidogenesis and reproductive functions
through the regulation of steroid hormones namely aldosterone,
androgen, and estrogen (Romero et al., 2008; Sirotkin et al.,
2009). In this study, through microRNA expression profiling and
bioinformatic analysis, we have identified the hypoxia-inducible
miR-10b as a putative negative regulator of CYP11B1 and CYP11B2.
Overexpression and knockdown of miR-10b in H295R cells confirmed that miR-10b negatively regulates CYP11B1 and CYP11B2
mRNA abundance (Fig. 3C and D) and corticosteroid (cortisol and
References
Agrawal, A., Gajghate, S., Smith, H., Anderson, D.G., Albert, T.J., Shapiro, I.M., Risbud,
M.V., 2008. Cited2 modulates hypoxia-inducible factor-dependent expression
of vascular endothelial growth factor in nucleus pulposus cells of the rat
intervertebral disc. Arthritis Rheum. 58 (12), 3798–3808.
Baley, J., Li, J., 2012. MicroRNAs and ovarian function. J. Ovarian Res. 5, 8.
Bartel, D.P., 2009. MicroRNAs: target recognition and regulatory functions. Cell 136,
215–233.
Bassett, M.H., Zhang, Y., Clyne, C., White, P.C., Rainey, W.E., 2002. Differential
regulation of aldosterone synthase and 11betahydroxylase transcription by
steroidogenic factor-1. J. Mol. Endocrinol. 28, 125–135.
Bassett, M.H., Suzuki, T., Sasano, H., White, P.C., Rainey, W.E., 2004. The orphan
nuclear receptors NURR1 and NGFIB regulate adrenal aldosterone production. J.
Mol. Endocrinol. 18, 279–290.
Brickner, R.C., Jankowski, B.M., Raff, H., 1992. The conversion of corticosterone to
aldosterone is the site of oxygen sensitivity of the bovine adrenal zona
glomerulosa. Endocrinology 130, 88–92.
Bruder, E.D., Nagler, A.K., Raff, H., 2002. Oxygen-dependence of ACTH-stimulated
aldosterone and corticosterone synthesis in the rat adrenal cortex:
developmental aspects. J. Endocrinol. 172 (3), 595–604.
Choi, J.W., Park, S.C., Kang, G.H., Liu, J.O., Youn, H.D., 2004. Nur77 activated by
hypoxia-inducible factor-1a overproduces proopiomelanocortin in von HippelLindau-mutated renal cell. Cancer Res. 64, 35–39.
Crosby, M.E., Kulshreshtha, R., Ivan, M., Glazer, P.M., 2009. MicroRNA regulation of
DNA repair gene expression in hypoxic stress. Cancer Res. 69, 1221–1229.
Finnerty, J.R., Wang, W.-X., Hébert, S.S., Wilfred, B.R., Mao, G., Nelson, P.T., 2010. The
miR-15/107 group of microRNA genes: evolutionary biology, cellular functions,
and roles in human diseases. J. Mol. Biol. 402, 491–509.
Guo, C.J., Pan, Q., Jiang, B., Chen, G.Y., Li, D.G., 2009. Effects of upregulated
expression of microRNA-16 on biological properties of culture-activated hepatic
stellate cells. Apoptosis 14, 1331–1340.
Hammer, G.D., Parker, K.L., Schimmer, B.P., 2005. Mini review: transcriptional
regulation of adrenocortical development. Endocrinology 146, 1018–1024.
Hecker, M., Newsted, J.L., Murphy, M.B., Higley, E.B., Jones, P.D., Wu, R., Giesy, J.P.,
2006. Human adrenocarcinoma (H295R) cells for rapid in vitro determination of
effects on steroidogenesis: hormone production. Toxicol. Appl. Pharmacol. 217,
114–124.
Hilscherova, K., Jones, P.D., Gracia, T., Newsted, J.L., Zhang, X.W., Sanderson, J.T., Yu,
R.M.K., Wu, R.S.S., Giesy, J.P., 2004. Assessment of the effects of chemicals on the
expression of ten steroidogenic genes in the H295R cell line using real-time
PCR. Toxicol. Sci. 81, 178–189.
Karp, X., Ambros, V., 2005. Developmental biology. Encountering microRNAs in cell
fate signaling. Science 310, 1288–1289.
Ke, Q., Costa, M., 2006. Hypoxia inducible factor 1. Mol. Pharmacol. 70, 1469–1480.
Krek, A., Grun, D., Poy, M.N., Wolf, R., Rosenberg, L., EEpstein, JP., da Piedade, M.I.,
Gunsalus, K.C., Stoffel, M., Rajewsky, N., 2005. Combinatorial microRNA target
predictions. Nat. Genet. 37, 495–500.
S. Nusrin et al. / Marine Pollution Bulletin 85 (2014) 344–351
Kulshreshtha, R., Davuluri, R.V., Calin, G.A., Ivan, M., 2008. A microRNA component
of the hypoxic response. Cell Death Differ. 15, 667–671.
Lisy, K., Peet, D.J., 2008. Turn me on: regulating HIF transcriptional activity. Cell
Death Differ. 15, 642–649.
Martorell, L., Gentile, M., Rius, J., Rodríguez, C., Crespo, J., Badimon, L., MartínezGonzález, J., 2009. The hypoxia-inducible factor 1/NOR-1 axis regulates the
survival response of endothelial cells to hypoxia. Mol. Cell. Biol. 29 (21), 5828–5842.
Nogueira, E.F., Rainey, W.E., 2010. Regulation of aldosterone synthase by activator
transcription factor/cAMP response element-binding protein family members.
Endocrinology 151 (3), 1060–1070.
Nogueira, E.F., Xing, Y., Morris, C.A., Rainey, W.E., 2009. Role of angiotensin IIinduced rapid response genes in the regulation of enzymes needed for
aldosterone synthesis. J. Mol. Endocrinol. 42, 319–330.
Nusrin, S., 2013. Role of Hypoxia-inducible Factors (HIFs) and microRNAs on
regulation of stress steroid production in H295R human adrenocortical cells.
PhD thesis. City University of Hong Kong.
Oskarsson, A., Ullerås, E., Plant, K.E., Hinson, J.P., Goldfarb, P.S., 2006. Steroidogenic
gene expression in H295R cells and the human adrenal gland: adrenotoxic
effects of lindane in vitro. J. Appl. Toxicol. 26, 484–492.
Quinn, S.J., Williams, G.H., 1988. Regulation of aldosterone secretion. Ann. Rev.
Physiol. 50, 409–426.
Raff, H., Kohandarvish, S., 1990. The effect of oxygen on aldosterone release from
bovine adrenocortical cells in vitro: PO2 versus steroidogenesis. Endocrinology
127, 682–687.
351
Raff, H., Ball, D.L., Goodfriend, T.L., 1989. Low oxygen selectively inhibits
aldosterone secretion from bovine adrenocortical cells in vitro. Am. J.
Physiol.: Endocrinol. Metab. 256, E640–E644.
Raff, H., Jankowski, B.M., Engeland, W.C., Oaks, M.K., 1996. Hypoxia in vivo inhibits
aldosterone synthesis and aldosterone synthase mRNA in rats. J. Appl. Physiol.
81, 604–610.
Romero, D.G., Rilli, S., Plonczynski, M.W., Yanes, L.L., Zhou, M.Y., Gomez-Sanchez,
E.P., Gomez-Sanchez, C.E., 2007. Adrenal transcription regulatory genes
modulated by angiotensin II and their role in steroidogenesis. Physiol.
Genomics 30, 26–34.
Romero, D.G., Plonczynski, M.W., Carvajal, C.A., Gomez-Sanchez, E.P., GomezSanchez, C.E., 2008. Microribonucleic acid-21 increases aldosterone secretion
and proliferation in H295R human adrenocortical cells. Endocrinology 149 (5),
2477–2483.
Semenza, G.L., 1998. Hypoxia-inducible factor 1: master regulator of O2
homeostasis. Curr. Opin. Genet. Dev. 8, 588–594.
Sirotkin, A.V., Ovcharenko, D., Grossmann, R., Lauková, M., Mlyncek, M., 2009.
Identification of microRNAs controlling human ovarian cell steroidogenesis via
a genome-scale screen. J. Cell Physiol. 219 (2), 415–420.
Yu, M.K., Chu, L.H., Tan, T.F., Li, V., Chan, A., Giesy, J.P., Cheng, S.H., Wu, S.S., Kong,
Y.C., 2012. Leptin-mediated modulation of steroidogenic gene expression in
hypoxic zebrafish embryos: implications for the disruption of sex steroids.
Environ. Sci. Technol. 46, 9112–9119.