ARTICLE IN PRESS
Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety
journal homepage: www.elsevier.com/locate/ecoenv
In situ hybridization to detect spatial gene expression in medaka$, $$
A.R. Tompsett a,b,, J.W. Park a, X. Zhang a, P.D. Jones b, J.L. Newsted c, D.W.T. Au d, E.X.H. Chen d,
R. Yu d, R.S.S. Wu d, R.Y.C. Kong d, J.P. Giesy a,b,d, M. Hecker b,e
a
Department of Zoology, Center for Integrative Toxicology, Michigan State University, East Lansing, MI, USA
Department of Veterinary Biomedical Sciences and Toxicology Centre, University of Saskatchewan, 44 Campus Drive, Saskatoon, SK, Canada S7N 1N8
ENTRIX, Inc., Okemos, MI, USA
d
Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong, China
e
ENTRIX, Inc., Saskatoon, SK, Canada
b
c
a r t i c l e in fo
abstract
Article history:
Received 28 February 2008
Received in revised form
16 October 2008
Accepted 31 October 2008
Available online 14 January 2009
A whole-animal tissue section in situ hybridization (ISH) system with radio-labeled probes was
developed to detect differential gene expression among tissues of the small, oviparous teleost fish,
Japanese medaka (Oryzias latipes). Because of its tissue- and gender-specific expression, gonadal
aromatase (CYP19a) was selected as a model gene to demonstrate the potential of the system. The ISH
system was validated with a 7 d exposure to the model aromatase inhibitor, fadrozole. Fadrozole did not
affect the magnitude of gene expression in testes, but significantly up-regulated CYP19a gene
expression in ovaries. These results were confirmed with quantitative real-time-polymerase chain
reaction (RT-PCR). Histological evaluation revealed that females exposed to 100 mg/L fadrozole lacked
mature oocytes. Male gonadal morphology was normal in all treatments. The ISH method developed in
this study allowed tissue-specific resolution of gene expression in a whole animal model, as well as the
ability to analyze cellular morphological detail in the same organism.
& 2008 Elsevier Inc. All rights reserved.
Keywords:
Histology
Fadrozole
Aromatase
CYP19
Hormones
Autoradiography
Oryzias latipes
RT-PCR
Gene expression
Endocrine disruption
1. Introduction
New techniques in molecular biology have made it possible to
detect subtle alterations in in vivo expression of genes and their
protein products as a result of exposure to chemicals or other
environmental stressors. These techniques, which include quantitative real-time-polymerase chain reaction (Q-RT-PCR), Western
blotting, Northern blotting, enzyme activity assays, immunohistochemistry (IHC), and in situ hybridization (ISH) of mRNA, have
$
This study was supported by a grant from the US EPA Strategic to Achieve
Results (STAR) program to J.P. Giesy, M. Hecker, J.L. Newsted and P.D. Jones (Project
no. R-831846). The research was also supported by a grant from the University
Grants Committee of the Hong Kong Special Administrative Region, China (Project
no. AoE/P-04/04) to D. Au and J.P. Giesy as well as grant from the City University of
Hong Kong (Project no. 7002117).
$$
The Japanese medaka used in this study were maintained and utilized in
accordance with protocols approved by the Michigan State University Institutional
Animal Care and Use Committee (MSU-IACUC).
Corresponding author at: Department of Veterinary Biomedical Sciences and
Toxicology Centre, University of Saskatchewan, 44 Campus Drive, Saskatoon, SK,
Canada S7N 1N8. Fax: +1 306 966 4796.
E-mail address: amber.tompsett@usask.ca (A.R. Tompsett).
0147-6513/$ - see front matter & 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.ecoenv.2008.10.013
expanded the depth of knowledge about organismal responses to
chemical exposure. However, most studies utilizing these techniques have focused on one tissue and one endpoint at one specific
time in the development of an organism (Halm et al., 2002;
Carlson et al., 2004). Thus, to improve understanding of the
molecular mechanisms of action of chemicals there is need
for methods that allow for the determination of changes in
the expression of genes and/or proteins in an organism on a
spatial scale.
Whole-animal tissue section ISH is a promising method for
determining spatial changes in gene expression since it allows the
determination of effects on expression of a single gene in multiple
tissues simultaneously, with the possibility to alter the system for
analyzing the expression of multiple genes (Peterson and
McCrone, 1993; Lichter, 1997; Hrabovszky et al., 2004; Jezzini
et al., 2005; Ijiri et al., 2006). Overall, this application of ISH allows
the investigation of changes in gene expression in multiple tissues
of small organisms, such as the Japanese medaka, while avoiding
the need for difficult dissection of small tissues as required in
conventional hybridization approaches.
ISH is a sensitive method that, depending on the detection
system employed, can be used to detect as few as 10–100 nucleic
ARTICLE IN PRESS
1258
A.R. Tompsett et al. / Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
acid molecules in a single cell and can provide valuable
information relative to temporal and spatial expression of genes
(Innis et al., 1990). The methods entail the specific annealing of
labeled antisense nucleic acid probes to their complementary
sequences in fixed or frozen tissue samples followed by a
visualization method to reveal the location and quantity of the
probe (Wilkinson, 1998). The major advantage of this method is
that it provides a sensitive means to localize and potentially
quantify mRNA of specific genes in organs, tissues, and/or cells of
interest in a manner that is consistent with other methods that
are used to detect lesions, including histopathology and IHC
(Streit and Stern, 2001). Methods for ISH of mRNA have been
successfully applied to a variety of tissue types including
whole animal embryos, cells in culture, and individual organs in
species as diverse as humans, mice, and fish (Wilkinson, 1998).
The whole-animal tissue section ISH method is a semi-open
format that does not require the pre-selection of a specific tissue
for study.
Chemicals that disrupt the endocrine system can do so by
direct and indirect mechanisms. Some chemicals are direct acting
agonists or antagonists of a receptor while others act indirectly by
modulating signal transduction systems or by interacting with
certain biochemical functions such as enzyme activities. Direct
acting chemicals can be screened using tests such as receptor
binding assays while indirect chemicals cannot be evaluated in
this manner. Since ISH can be used to detect the mRNA of any gene
of interest, this technique can be used to reveal indirect effects
that other more specific assays may miss and also to evaluate
these changes spatially across tissues within an organism.
Interaction of chemicals with cytochrome P450 aromatase has
received considerable attention as a relevant mode of endocrine
disruption over the past decade (Drenth et al., 1998; Letcher et al.,
1999; Scholz and Gutzeit, 2000; Sanderson et al., 2001; Ankley
et al., 2002; Halm et al., 2002; Fenske and Segner, 2004; Hecker
et al., 2006; Patel et al., 2006; Cheshenko et al., 2008). Aromatase
is a member of a super-family of heme-containing proteins, and
converts C19 androgens into C18 estrogens with a phenolic ‘‘A’’
ring (Lephart and Simpson, 1991; Simpson et al., 1994; Simpson
and Davis, 2001). This conversion has been implicated as the rate
limiting step in estrogen biosynthesis (Simpson et al., 1994). The
aromatase enzyme is encoded for by the CYP19 gene, and the
expression of the gene is likely to be an integral part of
maintaining homeostatic balance in levels of circulating androgens and estrogens (Villeneuve et al., 2006). Teleost fish, including
the Japanese medaka, express two separate aromatase isozymes;
mammals, including humans, express only one form of aromatase
(Kazeto et al., 2001). The CYP19a form of aromatase is expressed
mainly in the gonad of teleost fish, while CYP19b is expressed
mainly in the brain, specifically in the hypothalamus and pituitary
(Callard et al., 2001). The gonadal form of the aromatase gene,
CYP19a, was selected as an initial target gene to develop and
optimize the ISH system for medaka due to the fact that its
expression is highly specific to the female gonad and responsive
to endocrine disruptors in teleost fish (Callard et al., 2001;
Villeneuve et al., 2006).
Aromatase activity is inhibited in vitro by numerous chemicals
of environmental concern including polychlorinated dibenzop-dioxins, polychlorinated biphenyls, DDT and its metabolites,
and a number of azoles (Drenth et al., 1998; Letcher et al.,
1999; Vinggaard et al., 2000; Heneweer et al., 2004; Trosken et al.,
2006; Sun et al., 2007). Fadrozole (4-(5,6,7,8-tetrahydroimadazo[1,5-a]-pyridin-5-yl)benzonitrile monohydro-chloride) is a
specific, potent pharmaceutical competitive inhibitor of the
aromatase enzyme (Steele et al., 1987). Fadrozole binds at a site
different from the active site of the enzyme, thereby causing a
conformational change at the active site and blocking the binding
of androgen (Yue and Brodie, 1997). While fadrozole directly
inhibits enzyme activity, treatment of female fathead minnows
(Pimephales promelas) with fadrozole resulted in a dosedependent increase in CYP19a gene expression in the gonad
(Villeneuve et al., 2006). The effects of fadrozole on CYP19a
expression have not been as well studied in males as females.
The Japanese medaka (Oryzias latipes) was chosen as the test
organism for the present study. The physiology, embryology, and
genetics of the medaka have been extensively studied for more
than 100 years (Wittbrodt et al., 2002). The Japanese medaka has
clearly defined sex chromosomes and sex determination (summarized in Wittbrodt et al., 2002). In addition, all mRNA/cDNA
sequences used for this project, which were necessary to design
appropriate RNA probes, are available online in the NCBI database
(www.ncbi.nlm.nih.gov). Therefore, cloning and sequencing the
genes of interest was unnecessary. Finally, there is a marine
species of medaka (Oryzias melastigma) that is very similar to the
freshwater species, such that development of ISH systems in these
two species simultaneously provides a test system that can be
applied to freshwater, marine, and brackish ecosystems (Kong
et al., 2008).
The specific objective of this study was to develop an ISH
method to measure the mRNA present in Japanese medaka on
fixed, whole-animal sagittal tissue sections. We tested the ISH
method using a model chemical, fadrozole, which has been
previously reported to specifically interact with CYP19a gene
expression in teleost fish. Tissue morphology was also evaluated
using standard histological techniques. The method was then
validated by comparing ISH results for gene expression with
RT-PCR gene expression values in fish from the same exposure
using methods already established in our laboratory.
2. Materials and methods
2.1. Test chemical
The fadrozole (CGS016949A; MW: 259.74 g) used in this research was provided
as a gift from Novartis Pharma AG (Basel, CH).
2.2. Animals
Male and female wild-type Japanese medaka (O. latipes) were obtained from
the aquatic culture unit at the US Environmental Protection Agency Mid-Continent
Ecology Division (Duluth, MN, USA). The fish were cultured in flow-through tanks
in conditions that facilitated breeding (23–24 1C; 16:8 light/dark cycle), and that
were in accordance with protocols approved by the Michigan State University
Institutional Animal Care and Use Committee (MSU-IACUC).
2.3. Acclimation and fadrozole exposure
The Japanese medaka used for the current experiment were cared for as
follows. Medaka (14 weeks old) were placed in 8–10 L tanks filled with 6 L of
carbon-filtered water. Each tank contained 5 male and 5 female fish. Fish were fed
Aquatox flake food (Aquatic Ecosystems, Apopka, FL, USA) ad libitum once daily and
held at 24 1C with a 16:8 light/dark cycle. One half of the water in each tank (3 L)
was replaced daily with fresh carbon-filtered water. Temperature was monitored
daily. Water quality parameters (pH, hardness, dissolved oxygen, ammonia
nitrogen, and nitrate nitrogen) were monitored once every 3–4 d. The acclimation
period lasted 12 d. Overall mortality during this period was one individual.
After the acclimation period, all surviving fish were exposed to fadrozole in a
7 d static renewal exposure scenario. The treatments (nominal) were 0, 1, 10, and
100 mg/L fadrozole. Each treatment was run in two replicate tanks. One half of the
water in each tank (3 L) was replaced with fresh carbon-filtered water dosed with
the appropriate amount of fadrozole diluted from a 5 mg/L aqueous stock solution
each day. Water quality parameters (temperature, pH, hardness, dissolved oxygen,
ammonia nitrogen, and nitrate nitrogen) were measured daily. Fish were held
in the same conditions as during the acclimation period (24 1C, 16:8, fed flake
food once daily). No mortalities were observed in any treatment during the
exposure period.
ARTICLE IN PRESS
A.R. Tompsett et al. / Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
2.4. Processing of samples for RT-PCR and ISH at exposure termination
The fadrozole exposure was terminated after 7 d. Medaka were euthanized in
Tricaine S solution (Western Chemical, Ferndale, WA, USA), weighed, measured,
and separated into two groups. From each tank, two medaka of each sex were
processed for the ISH procedures and three medaka of each sex were processed for
RT-PCR analysis, which is discussed elsewhere (Park et al., 2006; Zhang et al.,
2008).
Medaka were prepared for ISH using an adaptation of methods previously
described by our group (Kong et al., 2008). Medaka were gross dissected by
removing the fins, tail, skull roof, otoliths, and opercula. The body cavity was
opened to allow for better penetration of the fixative into the tissues, then medaka
were immersed in individual vials that contained a fixative cocktail (80%
Histochoice MBs [EMS, Hatfield, PA, USA], 2% paraformaldehyde [EMS], 0.05%
glutaraldehyde [EMS]) and were allowed to fix for approximately 22 h at room
temperature. Whole-fish samples were then washed in 70% methanol, dehydrated
through an ascending methanol series (80%, 95%, and 100%), and cleared in
chloroform, all at 4 1C. Fish were infiltrated and embedded in Paraplasts Plus
paraffin (McCormick Scientific, St. Louis, MO, USA) and stored under RNase-free
conditions at 4 1C until sectioned.
Medaka were sectioned on an AO-820 rotary microtome (American Optical,
Buffalo, NY, USA) that had been cleaned and decontaminated with absolute
ethanol and RNase-Zap (Sigma, St. Louis, MO, USA). Briefly, the tissue blocks were
rough cut until the desired part of the fish was exposed. Then, serial 7 mm sagittal
sections were cut, floated onto a nucleic acid-free water bath, picked up on
Superfrost Pluss slides (Erie Scientific, Portsmouth, NH, USA), and allowed to dry
at 40 1C overnight. Slides were stored in clean, dust-free boxes at room
temperature until used for ISH or histological examination.
2.5. RNA probe synthesis for ISH
First, template CYP19a cDNA was synthesized for the gene target of interest.
Total RNA was extracted from whole Japanese medaka using an SV Total RNA
Isolation kit (Promega, Madison, WI, USA). Total RNA was reverse transcribed to
cDNA with a Superscript III first strand synthesis system (Invitrogen, Carlsbad, CA,
USA). The RNA probe sequence was designed using information cataloged in the
NCBI database cDNA library for Japanese medaka. Using Beacon Designer version
2.06 (Premier Biosoft, Palo Alto, CA), primers were developed (Table 1) flanking a
496 bp region of the CYP19a cDNA. Forward and reverse primers were then
ordered from a manufacturer (IDT, Coralville, IA, USA). The primers and medaka
total cDNA were used to synthesize a large amount of the cDNA fragment of
interest using a SYBR Green kit (Applied Biosystems, Warrington, UK) to assure
only one PCR product was being obtained. The cDNA was purified using a Wizard
SV Gel and PCR Clean-Up System (Promega), then sequenced and blasted against
the NCBI database. Suitable cDNA transcripts were cloned into Escherichia 65
JM109 competent cells (Promega), and grown out on LB plates according to
manufacturer’s directions. Successfully transfected Escherichia coli colonies were
grown for 48 h, and plasmid DNA was then purified with the Wizard Plus SV
Minipreps DNA Purification System (Promega). Plasmid DNA was then linearized
using Sal1 (antisense probe) or Nco1 (sense probe) restriction enzyme (Invitrogen),
quantified and run out on an agarose gel to check quality.
The purified plasmid cDNA was used to synthesize RNA probes. Prior to
transcription, 125 mCi of 35S-labeled UTP (Perkin Elmer, Boston, MA, USA) was dried
down under a vacuum. 35S-labeled probes were then synthesized from the cDNA
template with a Riboprobe Combination System-SP6/T7 (Promega) according to
the manufacturer’s protocol, including DNase digestion. DNase-stop solution
(Promega) was then added to the tubes and they were incubated for 15 min
at 65 1C.
Before use in ISH experiments, probes were purified by lithium chloride
(Ambion, Austin, TX, USA) precipitation, reconstituted in nuclease-free water, and
then unincorporated nucleotides were removed from the mixture using Quick Spin
Columns for Radiolabeled RNA Purification (Roche, Indianapolis, IN). Probe quality
and size were evaluated on a MOPS/formaldehyde gel. Probe activity was
determined in dpm/mL in a multi-purpose scintillation counter (Beckman-Coulter,
Fullerton, CA, USA). Probe-specific activity ranged from approximately 1.2–4 107
dpm/mL. Probes were then quantified with a Ribogreen kit (Invitrogen), separated
1259
into aliquots to avoid contamination with RNases, and stored at 80 1C until use.
Probes were stored no longer than 7 d before being used in hybridization
experiments to avoid both radioactive decay and contamination/RNA degradation.
2.6. ISH procedures
Prior to hybridization, sections were completely fused to the slides at 60 1C for
60 min. Sections were then treated to remove paraffin and to re-hydrate the
tissues. Slides were washed with xylene, 2 times for 5 min, then 100% ethanol,
2 times for 5 min, then 95% ethanol for 5 min, then 70% ethanol for 5 min, then
diethylpyrocarbonate-treated water (DEPC-water) for 5 min. Sections were
permeabilized in 0.1 N HCl for 30 min, rinsed in DEPC-water, acetylated in
triethanolamine-hydrochloride (TEA HCl) buffer (0.5 M TEA HCl, 0.75 M NaCl; pH
8.0) with 0.25% acetic anhydride (on a stir plate) for 10 min and then rinsed in
DEPC-water. Sections were dehydrated in 70% ethanol for 5 min and then allowed
to air dry completely before hybridization.
To decrease background signal, slides were allowed to pre-hybridize with
hybridization buffer (50% de-ionized formamide, 10% dextran sulfate, 0.1% sodium
pyrophosphate, 2 SSC (0.3 M sodium chloride, 0.03 M sodium citrate, pH 7.0),
1 Denhardt’s solution, 500 mg/mL yeast tRNA, 0.5 M dithiothreitol (Sigma)) for
1 h at 55 1C. Excess buffer was blotted from the slides prior to hybridization.
Prepared 35S-labeled RNA sense (negative control) and antisense riboprobes were
then diluted to approximately 24,000 dpm/mL with hybridization buffer. Diluted
probes were placed onto fish tissue sections in an amount great enough to cover
the tissue and slides were hybridized at 55 1C for 16 h in a humid box to prevent
sections from drying out.
After hybridization, slides were washed to remove unbound probe. Slides were
rinsed with 1 SSC (0.15 M sodium chloride, 0.015 M sodium citrate, pH 7.0)
to remove excess hybridization buffer, and the following post-hybridization
washes were performed on a stir plate: 2 SSC for 10 min at room temperature,
2 SSC/50% formamide 2 times for 30 min (at 52 1C), 2 SSC for 10 min, 50 mg/mL
RNase A (Roche) in buffer (0.5 M NaCl, 10 mM Tris–HCl, 1 mM EDTA; pH 7.8) for
30 min at 37 1C, 2 SSC for 10 min, 2 SSC/50% formamide for 30 min (at 52 1C),
2 SSC for 10 min at room temperature. Slides were then rinsed in RO water and
dehydrated in 70% ethanol for 5 min. Slides were allowed to air dry completely.
Autoradiography was used to develop ISH signal. In a darkroom under
safelight, a sheet of Kodak Biomax MRs film (Kodak, Rochester, NY, USA) was
placed on top of the dried slides and the film was exposed in a light tight exposure
chamber at 4 1C for 5 d. Then the film was developed in an X-OMAT M43A
Processor (Kodak).
2.7. ISH image classification
Each tissue section image from the developed films was classified according to
the following system: 0—absent to light-gray undefined staining; 1—light-gray
staining with some cellular definition; 2—medium-gray staining with cellular
definition throughout the gonad; 3—dark-gray staining with cellular definition
throughout the gonad (Fig. 1). Four slides with three sagittal sections each, 12
sections total, were evaluated for each fish. Slides were chosen that spanned the
diameter of the ovary/testis. A few fish had individual tissue sections that
classified into more than one category; in these cases, the fish was placed into the
highest expression category exhibited. The scorer of the expression categories had
no prior knowledge of the treatment group of each fish.
2.8. RT-PCR sample processing and gene expression analysis
At exposure termination, gonads were removed from RT-PCR subgroup fish
and flash frozen in liquid nitrogen for storage until analysis. All analyses were
performed on individual gonads. CYP19a gene expression in the gonads was
analyzed by quantitative RT-PCR using methods previously established and
optimized in our laboratory (Park et al., 2006). Briefly, total RNA was extracted
from the gonads using the SV Total RNA Isolation System (Promega) and used
to synthesize cDNA using the SuperScript First-Strand Synthesis System for
RT-PCR (Invitrogen). The target gene was then amplified using gene-specific
primers (Table 1) and SYBR Green I dye as a real-time reporter. The expression level
Table 1
Forward and reverse primer sequences for ISH and RT-PCR.
Gene
Sequence use
Forward primer
Reverse primer
Accession number
CYP19a
CYP19a
b-actin
Riboprobe
RT–PCR
RT–PCR
CCTGTTAATGGTCTGGAGTCAC
GCCCGCTTATGTCCTATTTGAG
GAGGTTCCGTTGCCCAGAG
GAAGAGCCTGTTGGAGATGTC
CCTCTCCGTTGATCCACACTC
TGATGCTGTTGTAGGTGGTCTC
D82968
D82968
S74868
ARTICLE IN PRESS
1260
A.R. Tompsett et al. / Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
Fig. 1. In situ hybridization classification system. Each gonad was classified as expression category 0, 1, 2, or 3. Images of female gonads are presented, with individual
oocyte (O) definition indicated. Expression categories were described as follows: 0—absent to light-gray undefined staining; 1—light-gray staining with some cellular
definition; 2—medium-gray staining with cellular definition throughout the gonad; 3—dark-gray staining with cellular definition throughout the gonad.
of CYP19a mRNA was normalized to an internal control gene, b-actin, and
quantified using the comparative CT method.
3. Results
3.1. Water quality
2.9. Hematoxylin and eosin (H&E) staining and slide image analysis
Tissue morphology was evaluated on slides stained with hematoxylin and
eosin. Slides were immersed in xylene to remove paraffin and then re-hydrated
through a descending ethanol series (100%, 95%, and 70%). Slides were then stained
in Harris’ hematoxylin (EMS) for 3 min, processed through acid alcohol, ammonia,
and ethanol washes, and then stained in 1% Eosin Y (EMS) in 80% ethanol for 1 min.
Slides were then dehydrated through an ethanol series (70%, 95%, and 100%) and
cleared in xylene. Slides were preserved under glass cover slips using Entellan
mounting medium (EMS) and allowed to dry.
Gonadal morphology was evaluated on two slides containing three
sections each, a total of six sections per fish. Slides were chosen to maximize
the area of the gonad observed. Slide observations were made by a reviewer with
no knowledge of the treatment group each slide was associated with to avoid bias.
Male testes were examined for normal testicular morphology. The oocytes in each
female image were developmentally staged according to the system set forth in
Iwamatsu et al. (1988). Briefly, maturing oocytes were classified as either stages VII
and VIII of development or stage IX of development (Iwamatsu et al., 1988).
Stage VII and VIII oocytes are characterized by the lack of a distinct yolk globule,
while stage IX oocytes contain a pink-staining yolk globule. All evaluations
were qualitative in nature. Images of the gonad on each slide were recorded using
a Camedia C-3040 ZOOM digital camera (Olympus, Center Valley, PA, USA)
attached to an Olympus BX41 microscope (Optical Analysis Corporation, Nashua,
NH, USA).
2.10. Statistics
The categorical ISH data for female fish were analyzed using two-way crosstabulation tables and Spearman’s rho test. The normality of the morphometric and
RT-PCR data was determined using the Shapiro–Wilk test. Since the RT-PCR data
were not normally distributed, they were analyzed by non-parametric Kruskal–
Wallis tests. Where applicable, Mann–Whitney U tests were used to determine
differences between treatment groups. The morpho-metric data was normally
distributed, and was subjected to an analysis of variance (ANOVA) followed by
Tukey’s test where applicable. Systat 12 software (Systat Software, Inc., San Jose,
CA, USA) was used for all tests and statistical significance was defined as po0.05.
During the course of the exposure, water quality parameters
ranged as follows in all tanks: temperature (23–25 1C); pH
(7.89–8.13); ammonia nitrogen (o0.02–0.04 mg/L); nitrite nitrogen (o0.02–0.3 mg/L); dissolved oxygen (4.3–6.9 mg/L); and
hardness (370–480 mg/L CaCO3). All values were within a normal
range for water quality.
3.2. Weight and length at exposure termination
Mean weight and length values were calculated for males and
females separately for each treatment (Table 2). There were no
significant differences by treatment in body weight (males
p ¼ 0.350; females p ¼ 0.679) or length (males p ¼ 0.236; females
p ¼ 0.640) at exposure termination.
3.3. CYP19a gene expression—ISH
Expression of CYP19a in gonads of males was classified in the 0
(absent to low, undefined) category for every male fish in every
treatment. Therefore, data from males were not statistically
analyzed. Overall, expression of CYP19a in gonads of females
varied significantly among treatments (p ¼ 0.002) and increased
as a function of fadrozole concentration. Fish from the control and
1 mg/L treatments were all classified as expression category 1, fish
from the 10 mg/L treatment ranged from expression category 0–2,
and fish from the 100 mg/L treatment ranged from expression
category 1–3. Expression of the CYP19a gene was significantly
(p ¼ 0.001) greater in fish exposed to 100 mg fadrozole/L than
unexposed controls (Fig. 2).
ARTICLE IN PRESS
A.R. Tompsett et al. / Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
1261
Table 2
Body weight and length at exposure termination.
Treatment (mg/L fad)
Male weight (g)
Male length (mm)
Female weight (g)
Female length (mm)
0
1
10
100
0.13370.032
0.15070.030
0.17270.021
0.17770.050
19.19571.389
20.34871.344
21.33771.481
21.23071.648
0.16370.033
0.15970.006
0.17670.032
0.17670.022
20.03371.387
20.27370.426
20.31270.973
20.79470.569
Values expressed as mean7S.D.
No significant treatment differences in weight (males p ¼ 0.350, females p ¼ 0.679) or length (males p ¼ 0.236, females p ¼ 0.640) were found.
Fig. 2. ISH-derived CYP19a gene expression in gonads. Categorical ISH expression
values are expressed as median7interquartile range. Male gene expression
showed no trend with fadrozole exposure. Female gene expression was
significantly greater (p ¼ 0.001) than control in the 100 mg/L treatment.
Fig. 3. RT-PCR-derived CYP19a gene expression in gonads. Fold change expression
values are expressed as mean7SE. Male gene expression showed no trend with
fadrozole exposure. Female gene expression was significantly greater than control
in both the 10 and 100 mg/L treatments (p ¼ 0.009 and 0.014, respectively).
3.4. CYP19a gene expression—RT-PCR
In males, there were no significant differences in CYP19a
gene expression among the fadrozole treatments (p ¼ 0.437).
The magnitude of change in gene expression ranged from
0.9 to 2.7-fold (Fig. 3), but CYP19a gene expression remained
near detection limits in each treatment. Therefore, very
small changes in gene copy number led to relatively large fold
changes. Two data points were removed from the male data set
prior to statistical analysis. One value was a severe statistical
outlier with 150-fold greater gene expression than any other
male; the other value was removed by the authors because the
expression value was 16-fold greater than any other fish and
affected fold change calculations for every other fish since it was
in the control. Removal of these data points did not alter statistical
significance.
Expression of CYP19a in female gonadal tissue differed
significantly (p ¼ 0.008) among treatments. Gene expression
was directly proportional to fadrozole concentration. Fold
changes, expressed as mean7SE, were 2.871.2, 6.570.8,
and 1272.6 in gonads of females exposed to 1, 10, and
100 mg fadrozole/L, respectively. Expression of CYP19a in
female fish was significantly greater in the 10 and 100 mg/L
treatments (p ¼ 0.009 and 0.014, respectively) than that
of unexposed fish (Fig. 3). Abundance of CYP19a mRNA in
female ovaries was over 1000-fold greater than that in the testes
of males.
Fig. 4. Male gonadal histology. A control male (left) and exposed male (right) both
exhibited lobules with spermatogenic cysts (SC) and spermatozoa (SZ) in the
lumina.
3.5. Histology
Hematoxylin and eosin-stained tissue sections from each fish
were examined for histological abnormalities. All male fish from
the control and fadrozole treatments were classified as having
normal spermatogenesis; the lumina were filled with mature
spermatozoa and the lobules contained spermatogenic cysts
(Fig. 4). All sections from all female fish from the control, 1, and
10 mg/L fadrozole treatments were classified as normal in terms
of oocyte development. Fish from those treatments exhibited
ARTICLE IN PRESS
1262
A.R. Tompsett et al. / Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
Fig. 5. Female gonadal histology. Normal gametogenesis is exhibited in females from the control (a) and 1 mg/L (b) treatments. Females from the 100 mg/L treatment (c & d)
have no mature oocytes (MO), but many vitellogenic oocytes (VO).
oocytes in all stages of development, which is expected in species
with asynchronous spawning (Fig. 5). Oocytes in all sections from
female fish from the 100 mg/L fadrozole treatment were predominantly at late vitellogenic stages, similar in size, and lacked a
distinct yolk globule (stages VII and VIII of development as
classified by Iwamatsu et al. (1988)). None of the oocytes from
these females was classified as stage IX, or mature, which are
characterized as containing a pink-staining yolk globule inside the
oocyte (Fig. 5). The presence of early vitellogenic oocytes was
similar among all treatments, but the oocyte population of
females exposed to 100 mg/L fadrozole was characterized by the
presence of many late vitellogenic oocytes and fewer mature
oocytes than fish in the other treatments.
4. Discussion
4.1. Gonadal histology and CYP19a gene expression after exposure
to fadrozole
To investigate the effects of fadrozole on the reproductive
health of medaka, measures of reproductive physiology were
evaluated in the male and female fish from the current exposure.
In a previous study with genetically female Japanese medaka that
were exposed to 0.5 mg/g fadrozole in their food from hatch until
sexual maturation (90 d post-hatch), females exhibited normal
oogenesis and folliculo-genesis prior to the vitellogenic phase but
lacked any post-vitellogenic oocytes (Suzuki et al., 2004). Similar
results have been reported in female fish exposed to a different
aromatase inhibitor, letrozole (Sun et al., 2007). In the present
study, final oocyte maturation was retarded in mature female
medaka in a short-term waterborne exposure to fadrozole.
Furthermore, based on the post-exposure histological examination presented here it is doubtful that females from the 100 mg/L
treatment group would have successfully spawned. This hypothesis is supported by the observation that medaka exposed to
625 mg/L letrozole for 21 d ceased spawning (Sun et al., 2007).
While no egg production data was collected from the current
study, subsequent exposures performed in our laboratory have
demonstrated that spawning is significantly inhibited in female
medaka after short-term fadrozole exposure (Park et al., 2008).
The present study is the first documented case of changes in
histological structure in female medaka being linked to short term
(7 d) waterborne fadrozole exposure. These effects suggest that
chronic exposure is not necessary to elicit cellular reorganization
of the female gonad. In addition, we showed that waterborne and
food-borne exposures have the same characteristic histological
effects, although dosing and exposure routes differ greatly
between the two. Little is known about whether female medaka
could recover normal morphology and reproductive abilities if
aromatase inhibitor exposure were halted.
The effects of aromatase inhibitors on male gonadal histology
are more subtle than those in females. Food-borne exposure up to
10 mg/g fadrozole had no effect on testicular histology (Suzuki
et al., 2004). However, exposure of male fish to letrozole resulted
in an enlargement of the lumina and seminiferous tubules and
increased density of spermatozoa, but this only occurred at
relatively great (625 mg letrozole/L) concentrations (Sun et al.,
2007). In the present study, short term (7 d) exposure to
concentrations of fadrozole as great as 100 mg/L had no effect on
the gonadal histology of male fish. Even where effects have been
observed (Sun et al., 2007), it is difficult to decipher whether
fertility and fecundity are actually altered, and gonadal aromatase
is not known to play a pivotal role in spermatogenesis.
Fadrozole has been shown to affect expression of the CYP19a
gene and aromatase activity in the gonads of teleost fish
previously. For instance, in fish exposed to fadrozole during
sexual differentiation, aromatase gene expression was suppressed
in the ovary of genetically female flounder (Kitano et al., 2000)
and zebrafish (Fenske and Segner, 2004) and resulted in
masculinization. Exposure of adult female fathead minnows to
fadrozole increased measurable aromatase activity in ovarian
ARTICLE IN PRESS
A.R. Tompsett et al. / Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
1263
better resolution, such as fluorophore ISH, may have detected the
increase in gene expression in a more quantifiable, as opposed to
categorical, manner and provided data that was more amenable to
statistical analysis. In addition, an ISH method with better
resolution would have also allowed for the classification of the
types of oocytes that were expressing CYP19a. Accordingly, we are
currently designing an ISH system using fluorophore-labeled
probes with detection by confocal fluorescence microscopy that
allows us to distinguish gene expression at the cellular level.
5. Conclusions
Fig. 6. Illustration of a whole-body autoradiograph. A representative image of a
whole fish section showing distinct CYP19a expression in the ovary (O), but only
general background in the liver (L) and brain (B).
microsomes as well as the expression of the CYP19a gene in the
ovary (Villeneuve et al., 2006). Overall, there is little other
information in the literature regarding gonadal aromatase activity
or gene expression after fadrozole exposure. No other studies have
determined the effects of fadrozole on gene expression using ISH
as a detection method.
There is no information in the literature on the effects of
fadrozole on CYP19a expression in mature male medaka. In
the current study, exposure of male medaka to fadrozole up to
100 mg/L had no significant effect on CYP19a expression after a
7 d waterborne exposure using both ISH and RT-PCR as detection
methods, which is in accordance with the lack of physiological
effects of fadrozole in males that have been reported in this and
previous studies.
The increase in CYP19a expression after fadrozole exposure in
this study and in prior studies (Villeneuve et al., 2006) could
possibly be linked to the promoter control and signal transduction
pathway of the CYP19a gene. CYP19a contains a complete SF-1 site
in its promoter (Callard et al., 2001; Kazeto et al., 2001). It has
been suggested that fadrozole alters CYP19a gene expression
via a gonadotropin/cAMP-mediated signal at the SF-1 promoter
(Villeneuve et al., 2006). Fadrozole is expected to cause a
reduction of circulating estrogens, so aromatase gene expression
could be induced in treated animals to correct this steroid
imbalance. The involvement of such a compensatory mechanism
makes it difficult to predict the effects of a chemical that acts
indirectly like fadrozole. These types of effects underscore the
need for laboratory techniques that allow relative quantification
and spatial resolution of gene products in an individual animal,
like ISH. ISH can offer a powerful tool to search out the indirect
effects of chemical exposure in vivo.
CYP19a aromatase expression has previously been demonstrated in the teleost brain (Villeneuve et al., 2006). The
expression is detectable, but at very low levels. In addition, brain
CYP19a expression has not been shown to be responsive to
fadrozole exposure (Villeneuve et al., 2006). Because the current
study used whole-body sagittal tissue sections, we were able to
examine possible CYP19a expression in the medaka brain. Not
surprisingly, CYP19a expression was not detectable above background in the brain or liver in males or females (Fig. 6). RT-PCR
confirmed that CYP19a in the brain was lowly expressed and not
responsive to fadrozole exposure (data not shown).
This study provided a first look at spatial gene expression in
the medaka gonad after fadrozole exposure. One of the major
drawbacks of the applied autoradiographic detection method was
limited resolution and sensitivity which was needed to determine
tissue-specific changes in gene expression. A method that has
Fadrozole increased expression of CYP19a in the gonad of
female fish and induced changes in female gonadal morphology,
by retarding final maturation of oocytes. With some modifications, the ISH method developed in this project will be able to aid
in detecting patterns of gene expression along the HPG-axis in the
Japanese medaka. ISH can also provide insight into the indirect
effects of chemical exposure.
Acknowledgments
This study was supported by a grant from the US EPA Strategic
to Achieve Results (STAR) program to J.P. Giesy, M. Hecker,
J.L. Newsted and P.D. Jones (Project no. R-831846). The research
was also supported by a grant from the University Grants
Committee of the Hong Kong Special Administrative Region,
China (Project no. AoE/P-04/04) to D. Au and J.P. Giesy and a grant
from the City University of Hong Kong (Project no. 7002117). The
authors would also like to thank Eric Higley and Jonathan Naile for
laboratory assistance.
References
Ankley, G., Kahl, M., Jensen, K., Hornung, M., Korte, J., Makynen, E., Leino, R., 2002.
Evaluation of the aromatase inhibitor fadrozole in a short-term reproduction
assay with the fathead minnow (Pimephales promelas). Toxicol. Sci. 67,
121–130.
Callard, G., Tchoudakova, A., Kishida, M., Wood, E., 2001. Differential tissue
distribution, developmental programming, estrogen regulation and promoter
characteristics of cyp19 genes in teleost fish. J. Steroid Biochem. Mol. Biol. 79,
305–314.
Carlson, E.A., Li, Y., Zelikoff, J.T., 2004. Benzo[a]pyrene-induced immunotoxicity in
Japanese medaka (Oryzias latipes): relationship between lymphoid CYP1A1
activity and humoral immune suppression. Toxicol. Appl. Pharmacol. 201,
40–52.
Cheshenko, K., Pakdel, F., Segner, H., Kah, O., Eggen, R., 2008. Interference of
endocrine disrupting chemicals with aromatase CYP19 expression or activity,
and consequences for reproduction of teleost fish. Gen. Comp. Endocrinol. 155,
31–62.
Drenth, H., Bouwman, C., Seinen, W., van den Berg, M., 1998. Effects of some
persistant halogenated environmental contaminants on aromatase (CYP19)
activity in the human choriocarcinoma cell line JEG-3. Toxicol. Appl.
Pharmacol. 148, 50–55.
Fenske, M., Segner, H., 2004. Aromatase modulation alters gonadal differentiation
in developing zebrafish (Danio rerio). Aquat. Toxicol. 67, 105–126.
Halm, S., Pounds, N., Maddix, S., Rand-Weaver, M., Sumpter, J., Hutchinson, T., Tyler,
C., 2002. Exposure to exogenous 17-beta-oestradiol disrupts P450aromB mRNA
expression in the brain and gonad of adult fathead minnows (Pimephales
promelas). Aquat. Toxicol. 60, 285–299.
Hecker, M., Sanderson, J., Karbe, L., 2006. Supression of aromatase activity in
populations of bream (Abramis brama) from the river Elbe, Germany. Chemosphere 66, 542–552.
Heneweer, M., van den Berg, M., Sanderson, J., 2004. A comparison of human
H295R and rat R2C cell lines as in vitro screening tools for effects on
aromatase. Toxicol. Lett. 146, 183–194.
Hrabovszky, E., Kallo, I., Steinhauser, A., Merchenthaler, I., Coen, C., Peterson, S.,
Liposits, Z., 2004. Estrogen receptor-beta in oxytocin and vasopressin neurons
of the rat and human hypothalamus: immunocytochemical and in situ
hybridization studies. J. Comp. Neurol. 473, 315–333.
Ijiri, S., Takei, N., Kazeto, Y., Todo, T., Adachi, S., Yamauchi, K., 2006. Changes in
localization of cytochrome P450 cholesterol side-chain cleavage (P450scc) in
ARTICLE IN PRESS
1264
A.R. Tompsett et al. / Ecotoxicology and Environmental Safety 72 (2009) 1257–1264
Japanese eel testis and ovary during gonadal development. Gen. Comp.
Endocrinol. 145, 75–83.
Innis, M., Gelfand, D., Snisky, J., White, T., 1990. PCR Protocols: A Guide to Methods
and Applications. Academic Press, San Diego.
Iwamatsu, T., Ohta, T., Oshima, E., Sakai, N., 1988. Oogenesis in the medaka Oryzias
latipes—stages of oocyte development. Zool. Sci. 5, 353–373.
Jezzini, S., Bodnarova, M., Moroz, L., 2005. Two-color in situ hybridization in the
CNS of Aplysia californica. J. Neurosci. Methods 149, 15–25.
Kazeto, Y., Ijiri, S., Place, A., Zohar, Y., Trant, J., 2001. The 50 -flanking regions of
CYP19A1 and CYP19A2 in zebrafish. Biochem. Biophys. Res. Commun. 288,
503–508.
Kitano, T., Takamune, K., Nagahama, Y., Abe, S., 2000. Aromatase inhibitor
and 17-alpha-methyltestosterone cause sex-reversal from genetical
females to phenotypic males and suppression of P450 aromatase gene
expression in Japanese flounder (Paralichthys olivaceus). Mol. Reprod. Dev. 56,
1–5.
Kong, R., Giesy, J., Wu, R., Chen, E., Chiang, M., Lim, P., Yuen, B., Yip, B., Mok, H., Au,
D., 2008. Development of a marine fish model for studying in vivo molecular
responses in ecotoxicology. Aquat. Toxicol. 86, 131–141.
Lephart, E., Simpson, E., 1991. Assay of aromatase activity. Methods Enzymol. 206,
477–483.
Letcher, R., van Holsteijn, I., Drenth, H., Norstrom, R., Bergman, A., Safe, S., Pieters,
R., van den Berg, M., 1999. Cytotoxicity and aromatase (CYP19) activity
modulation by organochlorines in human placental JEG-3 and JAR choriocarcinoma cells. Toxicol. Appl. Pharmacol. 160, 10–20.
Lichter, P., 1997. Multicolor fishing: What’s the catch? Trends Genet. 13, 475–480.
Park, J., Hecker, M., Murphy, M., Jones, P., Solomon, K., Van Der Kraak, G., Carr, J.,
Smith, E., du Preez, L., Kendall, R., Giesy, J., 2006. Development and
optimization of a Q-RT PCR method to quantify CYP19 mRNA expression in
testis of male adult Xenopus laevis: comparisons with aromatase enzyme
activity. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 144, 18–28.
Park, J., Tompsett, A.R., Zhang, X., Newsted, J.L., Jones, P.D., Yu, R., Wu, R.S.S., Kong,
R.Y.C., Giesy, J.P., Hecker, M., 2008. Fluorescence in situ hybridization
techniques (FISH) to detect changes in CYP19a gene expression of Japanese
medaka (Oryzias latipes). Toxicol. Appl. Pharmacol. 232, 226–235.
Patel, M., Scheffler, B., Wang, L., Willett, K., 2006. Effects of benzo(a)pyrene
exposure on killifish (Fundulus heteroclitus) aromatase activities and mRNA.
Aquat. Toxicol. 77, 267–278.
Peterson, S., McCrone, S., 1993. Use of dual-label in situ hybridization histochemistry to determine the receptor complement of specific neurons. In: Valentino,
K.L., Eberwine, J.J., Barchas, J.D. (Eds.), In Situ Hybridization Applications to
Neurobiology. Oxford University Press, New York, p. 78.
Sanderson, J., Letcher, R., Heneweer, M., Giesy, J.P., van den Berg, M., 2001. Effects of
Chloro-S-Triazine herbicides and metabolites on aromatase (CYP19) activity in
various human cell lines and on vitellogenin production in male carp
hepatocytes. Environ. Health Perspect. 109, 1027–1031.
Scholz, S., Gutzeit, H., 2000. 17-alpha-ethinylestradiol affects reproduction, sexual
differentiation and aromatase gene expression of the medaka (Oryzias latipes).
Aquat. Toxicol. 50, 363–373.
Simpson, E., Mahendroo, M., Means, G., Kilgore, M., Hinshelwood, M., GrahamLorence, S., Amarneh, B., Ito, Y., Fisher, C., Michael, M., Mendelson, C., Bulun, S.,
1994. Aromatase cytochrome P450, the enzyme responsible for estrogen
biosynthesis. Endocr. Rev. 15, 342–355.
Simpson, E., Davis, S., 2001. Minireview: aromatase and the regulation of estrogen
biosynthesis—some new perspectives. Endocrinology 142, 4589–4594.
Steele, R., Mellor, L., Sawyer, W., Wasvary, J., Browne, L., 1987. In vitro and in vivo
studies demonstrating potent and selective inhibition with the non-steroidal
aromatase inhibitor CGS 16949A. Steroids 50, 147–161.
Streit, A., Stern, C., 2001. Combined whole-mount in-situ hybridization and
immunohistochemistry in avian embryos. Methods 23, 339–344.
Sun, L., Zha, J., Spear, P., Wang, Z., 2007. Toxicity of the aromatase inhibitor letrozole
to Japanese medaka (Oryzias latipes) eggs, larvae and breeding adults. Comp.
Biochem. Physiol. C: Toxicol. Pharmacol. 145, 533–541.
Suzuki, A., Tanaka, M., Shibata, N., 2004. Expression of aromatase mRNA and effects
of aromatase inhibitor during ovarian development in the medaka, Oryzias
latipes. J. Exp. Zool. 301A, 266–273.
Trosken, E., Fischer, K., Volkel, W., Lutz, W., 2006. Inhibition of human CYP19
by azoles used as antifungal agents and aromatase inhibitors, using a new
LC–MS/MS method for the analysis of estradiol product formation. Toxicology
219, 33–40.
Villeneuve, D.L., Knoebl, I., Kahl, M., Jensen, K., Hammermeister, D., Greene, K.,
Blake, L., Ankely, G., 2006. Relationship between brain and ovary aromatase
activity and isoform-specific aromatase mRNA expression in the fathead
minnow (Pimephales promelas). Aquat. Toxicol. 76, 353–368.
Vinggaard, A., Hnida, C., Breinholt, V., Larsen, J., 2000. Screening of selected
pesticides for inhibition of CYP19 aromatase activity in vitro. Toxicol. In Vitro
14, 227–234.
Wilkinson, D., 1998. In Situ Hybridization: A Practical Approach, second ed. Oxford
University Press, New York.
Wittbrodt, J., Shima, A., Schartl, M., 2002. Medaka—a model organism from the Far
East. Nat. Rev. Genet. 3, 53–64.
Yue, W., Brodie, A., 1997. Mechanisms of the actions of aromatase inhibitors
4-hydroxyandrostenedione, fadrozole, and aminoglutethimide on aromatase in
JEG-3 cell culture. J. Steroid Biochem. Mol. Biol. 63, 317–328.
Zhang, X., Hecker, M., Park, J., Tompsett, A., Newsted, J., Nakayama, A., Jones, P., Au,
D., Kong, R., Wu, R., Giesy, J., 2008. Real-time PCR array to study effects of
chemicals on the hypothalamic–pituitary–gonadal axis of the Japanese
medaka. Aquat. Toxicol. 88, 173–182.