This file was created by scanning the printed publication.
Errors identified by the software have been corrected;
however, some errors may remain.
Chapter 19
Molecular Marker Techniques to Study Variability of
Populus Pathogens 1
Girma M. Tabor and Harold S. McNabb, Jr.
Introduction
Molecular genetic techniques are commonly used in
many laboratories and many have been developed that
address diverse problems in plant pathology. In recent
years, tremendous advances have occurred concerning the
molecular genetics of plant/parasite interactions including the cloning of plant genes for (Jones et al. 1994; Martin
et al. 1993; Whitham et al. 1994) and corresponding
avirulence genes in pathogens (Huynh et al. 1989; Kearney
and Staskawicz 1990; Kobayashi et al. 1989, 1990;
Staskawicz et al. 1984). Studies on the molecular genetic
basis of in poplar are also underway (Cervera et al. 1996;
Goue-Mourier et al.1996; Newcombe and Bradshaw 1996).
However, poplar pathogen populations must be characterized before ecological interactions of pathogenesis and
host resistance are fully understood.
The crown gall pathogen (Agrobacterium tumefaciens)
and its host interactions are genetically and biochemically well described (Beneddra et al. 1996; Binns 1990;
Stachel et al. 1985, 1986; Yusibov et al. 1994; Zupan and
Zambryski 1995). However, molecular genetic studies
of other poplar pathogens and their associated diseases
are just developing and are primarily tailored toward
basic questions on taxonomy, epidemiology, and population genetics. An understanding of these basic qu estions is urgently needed so that critical processes
involved in host-pathogens interactions will be defined
and used to establish coherent selection and breeding
programs for Populus spp.
' Klopfenstein, N.B.; Chun, Y. W.; Kim, M.-S.; Ahuja, M.A., eds.
Dillon, M.G.; Carman, R.C .; Eskew, L.G., tech. eds. 1997.
Micropropagation, genetic engineering, and molecular biology
of Populus. Gen. Tech. Rep. RM-GTR-297. Fort Collins, CO:
U.S. Department of Agriculture, Forest Service, Rocky Mountain
Research Station. 326 p.
150
Many molecular marker techniques are available to generate diverse genetic information for various purposes.
Molecular marker techniques used to study Populus pathogens are the same as those used to study the host. Because
these techniques are well described elsewhere in this volume (Cervera et al.; Lin et al.; Noh and Lee), a detailed
description is not presented here. However, various attributes of these techniques are discussed within the context of this chapter.
Polymerase chain reaction (PCR) methods are the most
widely used molecular genetic techniques to study Populus
pathogens. Although PCR ·offers a virtually limitless
source of genetic information, its use is curtailed because
basic information on the taxonomy, etiology, and epidemiology of the p athogens is lacking.
In this chapter, we present some preliminary studies
conducted to gain understanding about 2 economically
important pathogens of Populus, Septaria spp. and
Melampsora spp. Presently, random amplified polymorphic
DNA (RAPD) and site-directed PCR are used in Populus
pathology laboratories to provide basic molecular genetic
information of Populus pathogens.
Random Amplified Polymorphic DNA
{RAPD)
Diseases that are serious problems to many Populus
clones are leaf and stem diseases caused by Septaria spp.
In the north central and northeastern United States, 5.
musiva (teleomorph: Mycosphaerella populorum) is considered a serious pathogen. Besides leaf spot, S. musiva causes
lethal stem cankers on Populus triclzocarpa hybrids. In the
Pacific Northwest (PNW) of North America, S. populicola
(teleomorph: M. populicola) causes leaf spot without lethal
stem cankers. Of current debate is whether these 2 Septaria
populations are different species or whether canker development is limited by the environmental conditions in
the PNW. Using RAPDs, Ward and Ostry (1996) showed
that bulked collections from these 2 pathogen populations
exhibit molecular polymorphism, suggesting that these
populations may be isolated and distinct. They also found
Molecular Genetic Analysis of Populus Chloroplast DNA
that Septaria population from the P NW did no t exhibit
much polymorphism. In contrast, m o lecular po lymorphis m was observed within populations from the North
Central United States (figure 1).
RAPD markers can be reliable for typ ing an individual.
In contras t, ty ping a population using RAPDs is d ifficult
because collected samples mus t accurately rep resent a ll
individua ls of a population. H owever, obtaining a representati ve sample from wild populations is form idable and
often impossible. In addition, RAPD m arkers a re not easy
to reproduce. The problem of obtaining representa ti ve
samples of a p opulation, coupled w ith the re prod ucibility
problems o f RAPD ma rkers, can rende r these m arkers
unreliable for population typing .
RAPD ma rker s linked to plant genes of interest can be
successfull y used for selection, breeding, and other gene tic
manipulations (B radshaw and Stettler 1995; Goue-Mourier
et a l. 1996; H a ley et a l. 1993; Miche lm o re et a l. 1991;
ewcombe and Bradshaw 1996). Similarly, RAPD markers may be important when working w ith pathogen isolates that are inbreds or isogenic.
Site-Directed Polymerase Chain Reaction
(PCR)
Site-directed PCR requires some p rio r knowledge of target D t A sequences to be amplified. The funga l ribosom al
R A (rR A) genes are wid e ly u sed for s ite-d irected PCR
because they comprise domains that are h ig hl y conserved
Figure 1. Random amplified polymorphic DNA (RAPD) of
Septaria spp. isolates from the North Central
states, USA. From the left, lane 1 =1-kb DNA
ladder; lane 2=RAPD control (no template DNA);
and lanes 3 through 20=RAPDs various Septaria
spp. isolates from the North Central s tates using
Operon primer F-1 0, 5' to 3' - GGAAGCTIGG.
USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.
among a wide range of taxa. The conserved nature of these
domains has allowed the synthesis of genera l p rimers that
can a mplify several regions of the rRNA operon from various fungi. Consequently, this has allowed the sy nthesis of
taxa-specific primers (Gard es and Bruns 1993; Tisserat et
a!. 1994; White et al. 1990).
A typ ica l eukaryotic nuclea r rRNA is polycistronic; coding regions for 185, 5.85, and 285 rR ' As are g rouped (in
the order listed) within a single transcription unit. An entire transcribed unit includes 2 noncoding regions, te rmed
the internal transcribed spacers (ITS), w hich separate the
3 coding regions from each other. Sequences in the rRNA
coding. regions a re h ig hly conserved among related taxa.
Little or no va riation is evident among rRNA ~od ing sequences of closely re la ted taxa at the class, family, genus,
o r species level. This lack of variation in the rRNA coding
regions among related taxa limits their use as a di agnos tic
too l.
Bes ides the conserved regions, the rRN A operon of several fungi consists of regions that can vary among species
in a gen us and among subspecies within a species. These
varia ble regions can have practical importance to a Populus
pathologis t. Species, subspecies, and hy brids potentia lly
can be identified based on their differences in the varia ble
regions of the rR TA op eron. Depending on the taxa, the
ITS regions of fungi may vary in length and ON A sequence
(Ga rd es and Bruns 1993; Tisserat e t a l. 1994; Wh ite et al.
1990) und muy be used to identify and classify funga l
pathogens o f Populus.
The other region of the rR I A that may be of practical
value to a p lant pathologist is the intergenic spacer (IGS)
region. In mos t organisms, rRNA genes occur as multip le
copies clus tered in long tandem a rrays on several different chromosomes. A single transcri ption uni t w ith in a cluster is separated by an IGS tha t is not transcribed. In some
fungi, the IGS regions con tain 55 genes, producing 2 IGS
regio ns (Kim e t a l. 1995). IGS lengths and sequences are
known to va ry among related taxa, w h ich can be exp loited
for practical identi fication purposes.
Coding a nd noncodin g regions of rR 'A genes from several fungi can be readily PCR amplified with genera l primers that target rRNA genes from diverse o rganisms. PCR
products then may be sequenced using automated sequencing machines, and these DNA sequences can be used
fo r diagnos ti c and phylogenetic stud ies.
W hen ITS and IGS lengths are the same from separate
pathogen isolates, seque ncing may reveal some d ifferences
in the DNA. Based on the D NA sequence diffe re nces,
unique enzyme restriction sites may be identified and used
to generate D t A restriction patterns that are unique to
these pathogens. In addition, based on D A sequence differences, specific PCR p rimers can be designed for selecti ve a mplifi ca ti o n of D NA fr agments fro m s pecific
pathogen races or species (Gardes and Bruns 1993; Tisserat
et a !. 1994).
151
Section Ill Molecular Biology
In our laboratory, ITS regions a nd th e 5.8S rRNA
genes o f the 3 major Melampsorn species on ~opulus w~ re
a mplified using gene ra l prime rs. Derive~ mf~rmat10n
wi ll be used to ide ntify species and p ossible mte rspecific hybrids among M. medusae, M. occidental is, a nd M.
larici-popul ina .
Materials and Methods
Template DNA
Template DNA was obta ined by e ithe r adding a few
(10 to 30) ured iospores directly to the PCR mi xture or by
extracting genomic 0 'A from urediospores. To extract
genomic DN A, fresh d ry u rediospo res were mi xed w ith
a n equ al volume of d iatoma ceou s earth product a nd
ground w ith a p lastic pestle operated by an electric dri~l.
The lysis buffer containing 50 mM Tris-HCI (pH 7.2), ::JO
mM EDTA (pH 8.0), and 3 percent sod iu m dodecyl sulfate (SDS) was a utoclaved for 15 min . The grinding s lurry
was centrifuged at 800 x g and incuba ted at 65 oc fo r 1 h.
After incubation, standa rd p he no l/ chloroform extraction
and e thanol precipitation were cond ucted to obtain the
temp late DNA.
Primers and PCR Amplification
Primer s u se d
in thi s procedure we re
ITS4 (TCCTCCGCTTATTG AT ATGC) a n d ITS5
(GGAAGTAAAAGTCGTAACAAGG). These primers
a re uni ve rsa l because they amp li fy rR NA ge n es from
wide range o f fun g i (Ga rd es and Bruns 1993; Tissera t
et a l. 1994; White et al. 1990).
The a mplification reaction was performed in 100 1t1
volumes conta ining 10 mM Tris- HC I (pH 8.3), 50 mM
KC I, 200 11M of each dNT P (dATP, d TTP, d GTP, and
dCT P), 0.5 11M of each primer, 2.5 units of Taq polyme rase, a nd 1.5 mM MgC I2• A m p li fica ti on was conducte d for 35 cyc les of d enat uration (1 m in) at 93 °C,
a nneal ing (35 sec) at 58 °C, and ex ten sion (2 min) a t 72
oc. Fin a l extensional 72 oc was pe rformed fu r 10 m in .
All reage nts were obtain ed from the Perkin-Elmer Corporation (No rwa lk, CT, USA).
Restriction Enzyme Digestion
The PCR produc t was electrop horesed in 1.4 percent
aga rose gel, stained with ethidium bromide (0.5Jig / l), and
visualized under UV light. The PCR product then was digested with severa l restriction enzy mes in attempts to detect any restriction fragment leng th polymorphism .
152
Sequencing of PCR Product
The PCR products were purified w ith spin columns
(Amicon, Inc., Beverly, MA, USA). Product concentration
was measured using a fluorometer, and the concentration
was adjusted fo r a utomated seque ncing.
Results
Ampli fied produ cts from intac t spores a nd genom ic
DNA were approximately 700 base p airs and no difference in product size was observed among tested sp ecies
of Melampsorn (fig ure 2). Restriction digestion products of
severa l enzymes did not produce any d e tectable polymorphism for use in distinguishing the 3 s pecies. This also
was supported by DNA sequence data in that ITS and 5.8S
rRNA gene sequences from a ll 3 species showed a very
high degree of similari ty. These ITS and 5.8S sequen~es
from Melmnpsom s pp. were a lso highl y homologous With
those from othe r rus t fung i.
Discussion
Our resu lts indicate that DNA sequences of ITS regions
from the 3 Melampsorn s pecies a rc identical. Thus far, these
sequences ha ve exhibited no distingu ishing characteristics fo r d iagnostic purposes. As expected, the 5.8S genes
were also identica l. Although the ITS a nd 5.8S sequences
cannot be used for disting uishing these 3 species, these
DNA sequences a re useful for phy logenetic comparisons
w ith othe r orga nisms. The ability to amplify rRNA genes
w ithout ex tracting genomic DNA grea tly simplifies studies on rRt A genes o f Me/am psora species.
Figure 2. Polymerase
chain reaction (PCR)
products showing the 2
ITS regions and the
•
5.8S rRNA gene from 3
species of Melampsora
with primers ITS4 and
ITS5. Intact spores
provided as template
DNA. From the left,
lanes 1 through 3=M.
larici-populina; lanes 4 through 6=M. occidentalis; lanes
7 through 9=M. medusae; lane 1O=control (no template) ;
and lane 11 =100 bp ladder.
USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.
Molecular Genetic Analysis of Populus Chloroplast DNA
Acknowledgments
This research was supported under Subcontract No. 19X43391C with Oak Ridge National Laboratory under Martin Marietta Energy Systems, Incorporated contract
DE-ACOS-840R21400 with the U.S. Department of Energy.
We thank Dr. Michael E. Ostry for providing a gel photograph used in this manuscript (figure 1).
Literature Cited
Beneddra, T.; Pecard, C.; Petit, A.; Nesme, X. 1996. CorreIa tion between susceptibility to crown gall and sensitivity to cytokinin in aspen cultivars. Phytopathology.
86: 225-231.
Binns, A.N. 1990. Agrobacterium-mediated gene delivery
and the biology of host range limitations. Physiologia
Plantarum. 79: 135-139.
Bradshaw, H.D., Jr.; Stettler, R.F. 1995. Molecular genetics
of growth and development in Populus. IV. Mapping
QTLs with large effects on growth, form, and phenology traits in a forest tree. Genetics. 139: 963-973.
Cervera, M.-T.; Gusmao, J.; Steenackers, M.; Storme, V.;
Vanden Broeck, A.; Van Mo~tagu, M.; Boerjan, W. 1996.
The use of bulked segregant analysis to identify AFLP"'
molecular markers closely linked to Melampsora laricipopulina resistance in Populus. In: Ahuja, M.R.; Boerjan,
W.; Neale, D.B., eds. Somatic cell genetics and molecular genetics of trees. Dordrecht, The Netherlands:
Kluwer Academic Publishers: 205-210.
Gardes, M.; Bruns, T.D. 1993. ITS primers with enhanced
specificity for Basidiomycetes-application to the identification of mycorrhizae and rusts. Molecular Ecology.
2: 113-118.
Goue-Mourier, M.C.; Faivre-Rampant, P.; Le Guerroue, B.;
Lefevre, F.; Villar, M. 1996. Molecular and genetic approaches to rust resistance (Melampsom sp.) in poplar
(Populus sp.). In: Ahuja, M.R.; Boerjan, W.; Neale, D.B.,
eds. Somatic cell genetics and molecular genetics of
trees. Dordrecht, The Netherlands: Kluwer Academic
Publishers: 249-254.
Haley, S.D.; Miklas, P.N.; Stavely, j.R.; Byrum, J.; Kelly, J.D.
1993. Identification of rapid markers linked to a major
rust resistance gene block in common bean. Theor. Appl.
Genet. 86: 505-512.
Huynh, T.V.; Dahlbeck, D.; Staskawicz, B.J. 1989. Bacterial
blight of soybean: regulation of a pathogen gene determining host cultivar specificity. Science. 245: 1374-1377.
Jones, D.A.; Thomas, C.M.; Hammond-Kosack, K.E.;
USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.
Balint-Kurti, P.J.; Jones, J.D.G. 1994. Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by
transposon tagging. Science. 266: 789-793.
Kearney, B.; Staskawicz, B. 1990. Widespread distribution
and fitness contribution of Xanthomonas campestris
a virulence gene avrBs2. Nature. 346: 385-386.
Kim, W.K.; Mauthe, W.; Harder, D.H.; Klassen, G.R.; Fox,
5. 1995. The 55 ribosomal RNA gene region of several
cereal rust, pine rust and cereal bunt fungi. Proceedings of the fourth IUFRO rusts of pines working party
conference, Tsukuba, Japan: 163-169.
Kobayashi, D.Y.; Tamaki, S.; Keen, N.T. 1989. Cloned
avirulence genes from the tomato pathogen Pseudomonas syringae pv. tomato confer cultivar specificity on soybean. Proc. Natl. Acad. Sci. USA. 86: 157-161.
Kobayashi, D.Y.; Tamaki, S.J.; Trollinger, D.J.; Gold, 5.; Keen,
N.J. 1990. A gene from Pseudomonas syringaepv. glycinea
with homology to avirulence gene from Pseudomonas
syringae pv. tomato but devoid of the avirulence phenotype. Malec. Plant-Microbe Interact. 3: 112-121.
Martin, G.B.; Brommonschenkel, S.H.; Chunwongse, J.;
Frary, A.; Ganal, M.W.; Spivey, R.; Wu, T.; Earle, E.D.;
Tanksley, S.D. 1993. Map-base cloning of a protein kinase gene conferring disease resistance in tomato. Science. 262: 1432-1436.
Michelmore, R.W.; Paran, 1.; Kesseli, R.V. 1991. Identification of markers linked to disease resistance genes by
bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA. 88: 9828-9832.
Newcombe, G.; Bradshaw, H.D., Jr. 1996. Quantitative trait
loci conferring resistance in hybrid poplar to Septaria
populicola, the cause of leaf spot. Can. J. For. Res. 26:
1943-1950.
Stachel, S.E.; Messens, E.; Van Montagu, M.; Zambryski, P.
1985. Identification of signal molecules produced by
wounded plant cells that activate T-DNA transfer in
Agrobacterium tumefaciens. Nature. 318: 624-629.
Stachel, S.E.; Timmerman, B.; Zambryski, P. 1986. Generation of single stranded T-DNA molecules during the initial stages of T-DNA transfer from Agrobacterium
tumefaciens to plant cells. Nature. 322: 706-712.
Staskawicz, B.J.; Dahlbeck, D.; Keen, N.T. 1984. Cloned
a virulence gene of Pseudomonas syringae pv. glycinea determines race-specific incompatibility on Glycine max
(L.) Merr. Proc. Natl. Acad. Sci. USA. 81:6024-6028.
Tisserat, N.A.; Hulbert, S.H.; Sauer, K.M. 1994. Selective
amplification of rONA internal transcribed spacer regions to detect Ophiosphaerella korrae and 0. herpotricha.
Phytopathology. 84:478-482.
Ward, K.T.; Ostry, M.E. 1996. Characterization of the genetic and pathogenic variation in Septaria musiva and
Septoria populicola. In: Analyzing pathogen and pest
populations in poplar and willow. Abstract booklet for
the International Symposium organized by the Inter-
153
Section Ill Molecular Biology
national Energy Agency I Bioenergy agreement task XII
activities: "pests" and "stock improvement and characterization". 1996 September 23-25; Long Ashton Research Station, University of Bristol, UK.: 38. Abstract.
White, T.J.; Bruns, T.; Lee, S.; Taylor, J. 1990. Amplification
and direct sequencing of fungal ribosomal RNA genes
for phylogenetics. In: Innis, M.A.; Gelfand, D.H.;
Sninsk~ J.J.; White, T.J., eds. PCR protocols: A guide to
methods and applications. New York: Academic Press,
Inc.: 315-322.
154
Whitham, S.; Dinesh-Kumar, S.P.; Choi, D.; Hehl, R.; Corr,
C.; Baker, B. 1994. The product of the tobacco mosaic
virus resistance gene N: similarity to Toll and the
Interleukin-1 receptor. Cell. 78: 1101-1115.
Yusibov, V.M.; Steck, T.R.; Gupta, V.; Gelvin, S.B. 1994. Association of single-stranded transferred DNA from
Agrobacterium tumefaciens with tobacco cells. Proc. Natl.
Acad. Sci. USA. 91: 2994-2998.
Zupan, J.R.; Zambryski, P. 1995. Transfer ofT-DNA from Agrobacterium to the plant cell. Plant Physiol. 107: 1041-1047.
USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.