Population-Specific Regulation of Chmp2b by Lbx1
during Onset of Synaptogenesis in Lateral Association
Interneurons
Jun Xu1, Mariko Nonogaki1, Ravi Madhira1, Hsiao-Yen Ma1, Ola Hermanson2, Chrissa Kioussi1,
Michael K. Gross1*
1 Department of Pharmaceutical Sciences, Oregon State University, Corvallis, Oregon, United States of America, 2 Department of Neuroscience, Karolinska Institutet,
Stockholm, Sweden
Abstract
Chmp2b is closely related to Vps2, a key component of the yeast protein complex that creates the intralumenal vesicles of
multivesicular bodies. Dominant negative mutations in Chmp2b cause autophagosome accumulation and neurodegenerative disease. Loss of Chmp2b causes failure of dendritic spine maturation in cultured neurons. The homeobox gene Lbx1
plays an essential role in specifying postmitotic dorsal interneuron populations during late pattern formation in the neural
tube. We have discovered that Chmp2b is one of the most highly regulated cell-autonomous targets of Lbx1 in the
embryonic mouse neural tube. Chmp2b was expressed and depended on Lbx1 in only two of the five nascent, Lbx1expressing, postmitotic, dorsal interneuron populations. It was also expressed in neural tube cell populations that lacked
Lbx1 protein. The observed population-specific expression of Chmp2b indicated that only certain population-specific
combinations of sequence specific transcription factors allow Chmp2b expression. The cell populations that expressed
Chmp2b corresponded, in time and location, to neurons that make the first synapses of the spinal cord. Chmp2b protein
was transported into neurites within the motor- and association-neuropils, where the first synapses are known to form
between E11.5 and E12.5 in mouse neural tubes. Selective, developmentally-specified gene expression of Chmp2b may
therefore be used to endow particular neuronal populations with the ability to mature dendritic spines. Such a mechanism
could explain how mammalian embryos reproducibly establish the disynaptic cutaneous reflex only between particular cell
populations.
Citation: Xu J, Nonogaki M, Madhira R, Ma H-Y, Hermanson O, et al. (2012) Population-Specific Regulation of Chmp2b by Lbx1 during Onset of Synaptogenesis in
Lateral Association Interneurons. PLoS ONE 7(12): e48573. doi:10.1371/journal.pone.0048573
Editor: Thomas H. Gillingwater, University of Edinburgh, United Kingdom
Received April 6, 2012; Accepted September 27, 2012; Published December 21, 2012
Copyright: ß 2012 Xu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This research was supported by National Institutes of Health-NIAMS grant AR054406 to Chrissa Kioussi. URL of the funder: http://www.niams.nih.gov/
default.asp. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: michael.gross@oregonstate.edu
exosome formation, as well as for cytokinesis, and viral budding.
The ESCRT-0, -I, and -II complexes sequester ubiquitinated
cargo and nucleate a nascent ILV bud. The ESCRT-III proteins
assemble into a tightening spiral complex at the neck of the bud to
pinch it off. None of the early ESCRT III steps are thought to be
ATP-dependent, yet the subsequent dissociation of the spiral
ESCRT-III complex is. The Vps2 protein occupies a central
position in the spiral complex at the end of its assembly and
attaches, by a C-terminal domain, to the Vps4 ATPase that drives
complex dissociation at the expense of ATP. Vps2 is therefore well
positioned to control the rate of ESCRT complex function
[13,14,15,16,17,18].
Several lines of evidence indicate that Chmp2b is involved in
dendritic spine maturation, while Chmp2a plays the role of Vps2
in the late endosomes, multivesicular bodies, and autophagosomes
of mammals. First, the Chmp2a protein is more closely related to
Vps2 than Chmp2b at the protein sequence level. Second, twohybrid interaction screens reveal strong physical interactions
between Chmp2a and both mammalian Vps4 ATPases, whereas
Chmp2b fails to interact [19,20]. The Chmp2b C-terminal
domain forms a far weaker interaction with Vps4 MIT domains
Introduction
Chmp2b mutations have been observed in Danish [1], Belgian
[2], Dutch [3], American [4], and French [5] patients with
frontotemporal dementia (FTD). Chmp2b mutations have also
been observed in ALS patients [6,7]. These mutations appear to
act in a dominant negative fashion by debilitating autophagosome
fusion to lysosomes [8].
Chmp2b and Chmp2a are the two mammalian orthologs of
yeast Vps2, a key component of the endosomal sorting complexes
required for transport (ESCRT) system. The ESCRT-0, -I, -II,
and -III complexes are essential for moving ubiquitinated
transmembrane proteins into intralumenal vesicles (ILVs) as
endosomes mature into multivesicular bodies (MVBs)
[9,10,11,12]. MVBs either fuse with lysosomes to degrade the
transmembrane proteins or they fuse with the cell membrane to
release the ILVs as exosomes. The ESCRT system creates
membrane vesicles that bud away from the cytosol. The
biochemical mechanism of budding-away differs fundamentally
from the clathrin-dependent mechanism of budding-into the
cytosol. Budding-away is used during ILV, autophagosome and
PLOS ONE | www.plosone.org
1
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
occur at this axial level. Genetic control of Chmp2b expression
may therefore be used to endow particular embryonic neuronal
populations with the ability to stabilize or potentiate excitatory
synapses at specific times in development. Overall, the results
suggest a molecular mechanism by which developmental gene
expression programs could insure that only the appropriate cell
types contribute productively to the emergent spinal reflexes and
somatosensory circuits.
than the Chmp2a C-terminal domain [21,22]. Third, loss of
Chmp2b function in cultured cortical [23] or hippocampal [24]
neurons failed to produce the defects in vesicular trafficking,
autophagosome accumulation, or neuronal death observed with
the dominant negative mutations, mentioned above, that cause
genetic disease. Instead, the knock-down of Chmp2b levels leads to
a reduced ability to mature dendritic spines to form the mushroom
shape that is characteristically found in potentiated synapses [24].
Finally, the immunohistochemical puncta observed with normal
Chmp2b in hippocampal neurons do not colocalize with early or
late endosome markers [24].
Neuronal specification occurs in the embryonic neural tube of
mice between embryonic day (E) 9.5 and E13, prior to the
elaboration of neuron-specific functions. After dividing cells of the
ventricular zone withdraw from the cell cycle, their daughter cells
migrate to the mantle zone. Cells at different spatial positions in
the dividing ventricular layer express distinct combinations of
sequence specific DNA binding transcription factors (SSTFs). The
postmitotic daughter neurons that emerge laterally from each
spatial domain express new, distinct combinations of SSTFs.
Population partitioning analysis has been used to estimate that at
30–45% of the SSTFs in the mammalian genome have spatially
constrained expression patterns in the neural tube [25]. A
combinational code of SSTF expression is used to define
populations of neurons along both the dorsal–ventral and
anterior-posterior axes in both the ventricular and mantle zones
[26,27,28]. These SSTFs are typically linked in cross-regulatory
interactions with each other, so that specific combinations of SSTF
are likely to form transcriptional network kernels that specify
neural tube cell types [29].
Lbx1 is a homeodomain SSTF that is expressed in postmitotic
neurons of the dorsal, embryonic neural tube [30,31]. Lbx1 is
essential to the specification of five dorsal interneuron populations,
namely dI4, dI5, dI6, dI4LA and dI4LB. Each of these populations
expresses a unique, yet only partially known, combination of
SSTFs. It has been demonstrated that Lbx1 alters RNA expression
levels of 8% of the genome’s 1700 SSTF genes in these five
interneuron populations [29]. Lbx1 regulates SSTF target genes in
a population-specific manner. For example, Lbx1 activates Pax2
and represses Foxd3 expression in dI4, dI6 and dI4LA cells, but
not in dI5, or dI4LB cells. Conversely, Lbx1 activates Lmx1b and
represses Isl1 expression in dI5 and dI4LB cells, but not in dI4, dI6
or dI4LA cells. Therefore, the 8% of SSTF genes that are
identified as Lbx1 genetic targets are not targets in each of the five
Lbx1-expressing populations. Instead, Lbx1 regulates a different set
of SSTF targets in each population where it is expressed. It is
therefore likely that Lbx1 acts as a patterning SSTF by
contributing Boolean input to the cis-regulatory modules (CRMs)
of target genes [29].
We demonstrate in this report that Lbx1 regulates many nonSSTF target genes in the embryonic neural tube in a cellautonomous manner and provide a detailed analysis of one of
these target genes. The second most strongly regulated non-SSTF
target gene was Chmp2b, which is required for dendrite
maturation in cultured neurons. Lbx1-dependent Chmp2b gene
expression was only observed in a specific populations of nascent
postmitotic neurons in the embryonic mouse neural tube. Chmp2b
protein was observed in the lateral white matter, where the earliest
known synapses form in the cervical/thoracic embryonic mouse
neural tube at E11.5. These early synapses are known to create the
disynaptic spinal reflex, which involves association and motor
neurons. Similarly, Chmp2b protein was observed in the
dorsolateral funiculus at E12.5, when the first synaptic interactions
between the central and peripheral nervous systems are known to
PLOS ONE | www.plosone.org
Materials and Methods
Immunohistochemistry, flow sorting, microarray sample preparation, microarray processing, microarray analysis, and qPCR
confirmation procedures, as well another subset of the data of the
indicated arrays have been described previously [25,30]. For the
present report we developed a new in situ hybridization procedure
for mouse embryos that uses RNA probes prepared with
biotinylated–UTP.
Antibody Characterization
Commercially available primary antibodies against Chmp2b
(Abcam 33174); Isl1/2 (40.2d6, Developmental Studies Hybridoma Bank); Lhx1/5 (4F2; Developmental Studies Hybridoma
Bank), Brn3a (Eric Turner), Lmx1b (Tom Jessell), ß-tubulin class
III isoform (clone TU-20; Mab 1637; Millipore; Tuj1-like),
MAP2a (clone AP20; MAB3418 Millipore), and Nestin (DSHB
rat-401) were used. The primary antibody against GFP was affinity
purified from the serum of rats injected with a His6-tagged full
length EGFP protein that had been purified from bacteria. The
specificity and background staining of this antibody was
established by comparing titrations on sections from Lbx1GFP/+
and ICR embryos. Cy2, Cy3, and Cy5 labeled donkey-anti-IgG
secondary antibodies that had been preabsorbed against extensive
panels of IgGs of other species were obtained from Jackson
Immunoresearch.
Mouse Embryo Preparation
The Institutional Animal Care and Use Committee at Oregon
State University approved all animal procedures. The Lbx1GFP
allele [32] has been maintained in outbred ICR mice by
continuous outcrossing with ICR males purchased from the
Jackson Laboratories for over 20 generations. The day of vaginal
plug was considered E0.5. Embryos were dissected from the uterus
in ice-cold phosphate buffered saline (16PBS; 2.7 mM KCl,
1.37 M NaCl, 10 mM Na2HPO4 and 1.7 mM KH2PO4 adjusted
to pH7.4) and genotyped by inspection under a fluorescent
dissection microscope. Lbx1+/+ mice lack green fluorescence,
Lbx1GFP/+ embryos have fluorescent neural tubes and limb buds,
and Lbx1GFP/GFP embryos have fluorescent neural tubes but nonfluorescent limb buds. Embryos were fixed in 4% PF (1 part 20%
paraformaldehyde in 16PBS, 1 part 1M sodium phosphate
(pH 7.4), 3 parts water) at 4uC. Fixation was typically 0.5 h for
immunohistochemistry and 48 h for in situ hybridization. Embryos were cryoprotected for 24 hours each in 10% and 25% sucrose
at 4uC. Pairs, or triplets, of stage-matched littermates of different
genotypes were aligned and embedded together in single blocks of
OCT (Sakura, Ltd) in a dry ice/ethanol bath. This insured that all
subsequent processing conditions were identical between the
genotypes to be compared. Blocks were stored at 270uC in airtight, dessicated containers until cryostat sections of 16–20 mm
were cut and lifted onto Superfrost Plus slides (VWR). Slides airdried on a warm block (25uC) for several hours prior to desiccated,
frozen storage (270uC) or direct use.
2
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
Slides were placed on racks in a humidified chamber and
Blocking Solution (4% nonfat dry milk in TBS) was applied for
30 min at RT. Streptavidin conjugated alkaline phosphatase (SAAP; 1 mg/ml; Jackson Immunoresearch) was diluted 1:500 in
Blocking Solution and applied overnight at RT. Slides were
washed 36209 with TBST at RT and transferred to slide mailers
containing Color Reaction Buffer (0.1 M NaCl, 50 mM MgCl2,
10 mM Tris-HCl pH 9.5, 0.1% Tween and 2 mM levamisole) at
RT for 10 min. Slides were incubated at 37uC in Color Reaction
Buffer containing 0.33 mg/ml nitro-blue tetrazolium chloride
(NBT; CAS 298-83-9; Amresco) and 0.165 mg/ml 5-bromo-4chloro-39-indolyphosphate p-toluidine salt (BCIP; CAS 6578-06-9;
Amresco). Frozen NBT and BCIP stocks were prepared at 5% (w/
v) in 70% and 100% dimethylformamide, respectively. Color
reactions were stopped with PBS when signal to noise ratios were
judged to be optimal. Slides were rinsed briefly with water,
dehydrated using an alcohol series (5 min each in 50%, 70%,
95%, 100% ethanol) followed by xylene (2659) that was kept
anhydrous by Molecular Sieves (Sigma), and mounted with DPX
(VWR).
Preparation of Biotinylated RNA Probes
PCR generated template (PGT) for in vitro transcription was
produced by amplifying the cDNA insert of pYX-Chmp2b (MGC:
67644; IMAGE clone: 6414077) using T7 (TAATACGACTCACTATAGGG) and T3 (AATTAACCCTCACTAAAGGG)
primers. Similar PGTs were created for full-length protein coding
sequences of mouse Pax2, mouse Lmx1b, and EGFP. Antisense
RNA probes were prepared from 100 ng PGT in a 20 ml reaction
containing 40 mM Tris pH7.9, 10 mM NaCl, 6 mM MgCl2,
2 mM spermidine, 1 mM DTT, 20 U T3 RNA Polymerase
(Promega), 40 U RNase OUT (Fermentas), 0.35 mM biotinylated–UTP (biotin-16-UTP-Li4; 987.5 g/mol; Epicentre),
0.65 mM UTP, 1 mM ATP, 1 mM GTP and 1 mM CTP
(Bioline). Reactions were incubated at 37uC for 6 hours.
Additional T3 polymerase (1 ml, 20 U) was added and incubation
continued overnight. Probes were purified on calibrated G50 gel
filtration columns. A 5 ml disposable plastic pipette was cut at the
top, fitted with a frit of baked glass wool, and filled to the 5 ml
mark with Sephadex G50 (fine), swollen in DEPC-H2O. Reactions
were layered onto the surface of the matrix and DEPC-H2O was
applied. Elution fractions were taken at 0.5 ml intervals and their
absorbance at 260 nm was measured on aliquots using a
Nanodrop spectrophotometer. The first peak to be eluted was
used as the RNA probe. Absorbance returned to baseline before a
second peak, presumably containing unincorporated nucleotides,
was observed. Virtually all unincorporated biotinylated-UTP was
therefore removed from probes. Less rigorous purification
methods such as spin columns yielded probe preparations that
produced high levels of nonspecific signal in hybridizations.
Approximately 20 mg of probe were typically recovered.
Image Acquisition and Processing
NBT/BCIP colored in situ images were recorded with a
Micropublisher 5.0 (QImaging) camera, which contains a CCD
chip with a 3-color Bayer filter. Images were converted to grey
scale in Adobe Photoshop and then assigned false colors using red,
blue, or green color tables. False color images were combined and
aligned as layers in Adobe Photoshop.
Immunofluorescence images were recorded on a Zeiss Axioplan
Microscope using a 16 bit Zeiss Axiocam monochrome camera.
Monochrome images taken with appropriate filter sets for Cy2,
Cy3, or Cy5 were imported into the RGB color channels of Adobe
Photoshop at full spatial resolution. Exposure times were manually
fixed (automation off) for each color during the recording of
images across experiments to insure that identical exposures were
taken of sections that were to be directly compared. Only a subset
of the 16-bit dynamic range acquired by Axiocam contains
relevant image data. Automation selects a subset of the range for
display and export based on the individual image, rather than
across an experiment. Automation was therefore turned off and
the subset of the 16 bit dynamic range that was exported to Adobe
Photoshop was manually fixed across experiments for each color.
This portion of the acquired dynamic range was scaled to 256
levels within each color channel of Adobe Photoshop (8 bit color).
Level adjustment layers were applied to individual images in the
figure layouts to further refine the dynamic range selection of each
color channel for optimal representation. These level adjustments
were similar, but not identical, across experiments. Brightness,
contrast, and gamma values were never altered. Images shown in
this report are therefore direct linear representations of recorded
image intensities. Comparison shown between genotypes represent
identical sample processing and image acquisition times, and have
only very minor differences in the selection of dynamic range.
Channel Mixer Adjustment layers were used to rotate the colors of
images for optimal representation, as indicated in the figure
legends.
In situ Hybridization with Biotinylated Probes
All reagents used prior to the first wash step were prepared with
water, 206SSC (3 M NaCl, 0.3 M Sodium Citrate and adjusted
pH to 7.0 with HCl), 1 M Na PO4, or 16PBS that had been
stirred vigorously with 0.1%(v/v) diethylpyrocarbonate (DEPC)
overnight and autoclaved for 2 h. Formamide (Sigma) was
deionized by stirring with 100 g/L mixed-bed ion exchange resin
(IONAC NM-60 H+/OH2 form type I beads;16–50 mesh; J. T.
Baker) for 24 h. Resin was removed by Büchner filtration and
aliquots were frozen.
Slides were post-fixed in a humidified chamber for 30 min in
4% PF at room temperature (RT), washed three times for five
minutes (3659) with 16PBS at RT, transferred to 5-slot slide
mailers (12.5 ml with 5 slides; Healthrow Scientific) and prehybridized for 2 h at 68uC in hybridization buffer (50% deionized
formamide, 56SSC, 50 mg/ml yeast tRNA (Boehringer Mannheim), 50 mg/ml Heparin (Sigma), 50 mM NaPO4 pH 4.0, 0.1%
SDS). Probes were denatured 15 min at 75uC, snap-chilled on ice,
added to 68uC hybridization buffer at 0.5 ng/ml, and applied to
the slides in parafilm-sealed slide mailers at 68uC for 16 h. Slides
were quickly, and individually, rinsed by dunking into prewarmed
(68uC) Wash Buffer (50% deionized formamide, 56SSC and 1%
SDS) and placed into prewarmed (68uC) 26SSC for 20 min in a
fresh slide mailer. Slides were washed once more with prewarmed
(68uC) 26SSC for 20 min, treated with 0.05 mg/ml RNase in
prewarmed (37uC) RNase buffer (0.5 M NaCl, 10 mM Tris-HCl
pH 7.5, 1 mM EDTA) for 5 min, rinsed with RNase Buffer
(lacking RNAse) at RT, washed 3659 with RNase Buffer (lacking
RNAse) at RT, washed 3659 with prewarmed (68uC) 0.26SSC,
and washed 3659 with TBST (TBS (25 mM Tris pH 7.5,
137 mM NaCl, 5 mM KCl, 0.5 mM MgCl2) containing 0.1%
Tween 20) at RT. Washes were done by exchanging fluids in each
mailer and gently rocking in a water bath.
PLOS ONE | www.plosone.org
Results
Activation of Chmp2b Expression by Lbx1
The enhanced green fluorescent protein (GFP) coding sequence
has been knocked-in to the Lbx1 locus to create the Lbx1GFP null
allele, which expresses GFP instead of Lbx1 protein [32]. Neural
tubes were dissected from heterozygous (Lbx1GFP/+) and mutant
3
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
(Lbx1GFP/GFP) embryos at E12.5. Dissected neural tubes were
dissociated and sorted into GFP+ (green) and GFP2 (white) cell
types as previously described [25]. RNA from these cells was used
to probe Affymetrix U430 2.0 microarrays. Three biological
replicates were prepared for each of the four conditions (hG,
heterozygous green; mG, mutant green; hW, heterozygous white;
mW, mutant white). The average signal of the three replicates was
used to identify Lbx1-dependent changes in expression of nonSSTF genes (Fig. 1 A, B). There were far more Lbx1-dependent
changes in green cells than white cells. White cells normally lack
Lbx1 expression. Consequently, the loss of both Lbx1 alleles would
not be expected to cause cell-autonomous changes in gene
expression in white cells. In contrast, green cells normally express
Lbx1 protein and the loss of the final functional Lbx1 allele in these
cells leads to a large number of significant changes in gene
expression in non-SSTF genes. In this report we will focus on only
one of these genetic target genes, namely Chmp2b.
Two of the largest Lbx1-dependent fold-changes were observed
with the two Chmp2b probe sets (Fig. 1A, circled). These probe
sets were directed against the 39 nontranslated region and last two
exons of Chmp2b (Fig. 1E), and showed 25- and 35- fold higher
signals in green cells of heterozygotes than in green cells of mutants
(Fig. 1C). Thus, Lbx1 function was required for Chmp2b
expression in green cells. Heterozygous white cells expressed 6fold less Chmp2b mRNA than heterozygous green cells (compare
black bars in Fig. 1C, D). However, no Lbx1-dependent difference
in Chmp2b expression was observed in white cells (compare black
and white bars in Fig. 1D). Chmp2b expression was therefore
Lbx1-independent in cells lacking Lbx1 expression.
expression domain.. Its presence in mutants suggests that Chmp2b
RNA expression was initiated but not maintained in some of the
populations that normally express Lbx1.
Double-labeling immunohistochemistry confirmed the RNA
analyses at the protein level (Fig. 2C,D). In heterozygotes, the GFP
antibody labeled both newborn neurons in an intermediate zone,
adjacent to the ventricular zone, and more mature neurons in the
lateral mantle zone. The anti-Chmp2b antibody only labeled cells
in the lateral mantle zone of heterozygotes. The ventral half of the
Chmp2b expression domain did not overlap with the GFP
expression domain and was not lost in mutants. It was therefore
Lbx1-independent. The dorsal half of the Chmp2b expression
domain overlapped with the GFP expression domain and was
absent in mutant embryos. It was therefore Lbx1-dependent
(Fig. 2D). Approximately half (52%) of the Chmp2b+ surface in
heterozygotes was colabeled with GFP. This dropped to a 3% in
mutants (Fig. 2F), indicating a complete loss of Chmp2b in the
GFP+ cell populations. No GFP+Chmp2b+ cells could be
confirmed in mutants.
Chmp2b protein was not detected medially in the GFP
expression domain of heterozygotes, suggesting that Lbx1 protein
appears prior to Chmp2b protein in dorsal interneurons. Chmp2b
protein was also not observed in the medial column of mutants
where intense Chmp2b RNA had been observed, indicating that
the RNA was not translated into sufficient Chmp2b protein to
detect. Very low levels of Chmp2b protein were detected in motor
neurons and along the circumferential trajectory in subsequent
analyses.
Lbx1-expressing neuronal populations are respecified in Lbx1
mutants. They begin to resemble more dorsal populations. They
alter their normal lateral migration route and move, instead, along
the circumferential trajectory associated with commissural neurons
[30]. GFP+ cells become more numerous along the circumferential
trajectory of mutants (Fig. 2 C,D,white arrows). Very little
Chmp2b RNA expression was observed along this trajectory in
heterozygotes (Fig. 2A, white arrow/circled area), indicating that
Chmp2b RNA was not expressed in the dI6 population. This was
confirmed by immunohistochemistry (Fig. 2C).
Some Chmp2b RNA was observed in the circumferential
trajectory of mutants (Fig. 2B; white arrow/circled area), but did
not persist to the floor plate. Chmp2b protein was also not
observed in the circumferential trajectory of mutants (Fig. 2 D;
white arrows), again consistent with the idea that respecified cells
initiate Chmp2b RNA expression, but do not maintain it or
produce protein from it.
Lbx1-Dependent and -Independent Chmp2b Expression
Domains
The green cells of E12.5 neural tubes are postmitotic, occupy
most of the dorsal half of the neural tube, and give rise to the
substantia gelatinosa and other cell types of the adult dorsal horn.
A biotinylated probe directed against the entire Chmp2b open
reading frame (ORF) was used to detect Chmp2b RNA expression
in neural tube cross sections of heterozygote and mutant embryos
at E12.5 (Fig. 2). Several sets of serial sections along the body axis
from pairs of embryos were analyzed. Representative images at
forelimb levels are shown. Chmp2b RNA was observed in
heterozygotes, within the dorsal region where the flow-sorted
green cells normally reside, as well as in more ventral regions of
the mantle zone (Fig. 2A). Chmp2b RNA expression in mutants
was not observed in the dorsal region, but was still observed in the
more ventral region of the mantle zone (Fig. 2B). The selective loss
of Chmp2b expression above the sulcus limitans strikingly confirmed
the loss of expression observed in green cells in the microarray
analysis. The retention of signal below the sulcus limitans
confirmed the Lbx1-independent expression in white cells in the
microarray analysis.
The loss of Chmp2b RNA was not complete. Three residual
expression domains remained in mutants. One robust domain was
located in the mantle zone immediately below the sulcus limitans
and another weak domain was located in the ventral horn near the
motor neurons (black arrow). Both of these were clearly outside of
the normal Lbx1 expression domain, and therefore represented
Lbx1-independent domains of Chmp2b expression. The third
residual expression domain of mutants was observed as a medial
column, at the position where Lbx1+ neurons normally emerge
from the ventricular zone (between arrowheads). Based on
Nomarski viewing, this intense column of RNA expression
appeared to be more closely associated with the ventricular zone,
and more dense, than the medial edge of the heterozygote
PLOS ONE | www.plosone.org
Chmp2b Expression Present in dI4LA and Not Detected in
dI4LB
Chmp2b protein signal in the dorsolateral neural tube above the
sulcus limitans was associated with only a subset of the GFP+
neurons (Fig. 2E). Approximately half of the cells in this region
were yellow (Lbx1(GFP)+Chmp2b+; arrowheads) and half were
green (Lbx1(GFP)+Chmp2b2; arrows). This observation indicates
that Chmp2b was expressed in only a subset of the Lbx1expressing dorsolateral cells of heterozygotes.
The selective expression of Chmp2b in only a subset of
Lbx1(GFP)+ cells of the nascent dorsal horn was interesting
because the five Lbx1 expressing populations are anatomically
intermingled. A spatial signaling cue from an exterior anatomical
structure that effects selective Chmp2b activation, would be
expected to lead to graded, rather than intermingled, Chmp2b
expression. Local signaling from afferent axons to individual cells
in the horn is not possible because primary afferents have not
entered the dorsal gray matter at this stage of development [33]. A
4
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
Figure 1. Non-SSTF, Cell-Autonomous, Neural Tube, Genetic Target Genes. Neural tubes were dissected from heterozygote Lbx1GFP/+(h)
and mutant Lbx1GFP/GFP (m) E12.5 embryos. Pools of neural tubes from each genotype were rapidly dissociated, flow sorted into GFP+ (green; G) and
GFP2 (white; W) cells, and total RNA prepared. Three replicates of the flow sort experiment were used to produce triplicate array data for each of the
four conditions, namely heterozygous green (hG), mutant green (mG), heterozygous white (hW), and mutant white (mW). Error bars in each direction
indicate the standard deviation in three biological replicates. Only 41,500 of the array’s probe sets, corresponding to 22,300 non-sequence specific
transcription factor (non-SSTF) genes are shown. (A) Cell autonomous changes in gene expression due to loss of Lbx1 function were measured in cells
that normally express Lbx1 (green cells). Chmp2b probe sets are circled. Significant (P,0.05; t-test) changes in 3400 probes sets, corresponding to
2200 genes were observed. Similar numbers of probe sets had significantly higher (1660) or lower (1730) signals in mG, respectively. At least 1000 and
1200 genes were genetically repressed and activated by Lbx1, respectively. (B) Non-cell autonomous changes in gene expression due to loss of Lbx1
function were measured in cells that normally lack Lbx1 expression (white cells). Significant (P,0.05; t-test) changes in 1600 probe sets,
corresponding to 930 genes were observed. Similar numbers of probe sets had significantly higher (880) or lower (690) signals in mW, respectively. At
least 550 and 700 genes were genetically repressed and activated by Lbx1, respectively. The magnitude of cell autonomous changes (shown in A) was
generally far greater than the magnitude of non-cell autonomous changes (shown in B). (C–E) Array data for two different Chmp2b probe sets (E)
shown as bar graphs for green cells (C) and white cells (D).
doi:10.1371/journal.pone.0048573.g001
PLOS ONE | www.plosone.org
5
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
Lbx1-independent, respectively. RNA expression in the motor columns
(black arrow) varied considerably in adjacent sections, but was not
generally affected when series of sections along corresponding parts of
the body axis were compared. Arrowheads indicate the region of the
intermediate zone (IZ), where Chmp2b RNA signal remains intense in
mutants. The IZ lies lateral and adjacent to the ventricular zone (VZ).
Chmp2b signal can be compared in the circumferential trajectory at the
level of the sulcus limitans (SL), in the circled region (white arrow). (C, D)
Chmp2b protein at E12.5 at mid-forelimb levels in the dorsal and
ventral portions of the mantle zone (MZ) is Lbx1-dependent and Lbx1independent, respectively. The dorsolateral funiculus (DLF; *) and
ventrolateral funiculus (VLF; **) are indicated. (E) Only a subset of the
Lbx(GFP)+ cells within the lateral dorsal horn express Chmp2b
(arrowheads). Green cells lacking Chmp2b protein are intermingled
(arrows). (F) Quantitative evaluation of the fraction of Chmp2b+ area in
the neural tube that was colabeled by GFP. All images of the neural
tube in this report will be oriented medial to lateral (left to right) and
dorsal to ventral (top to bottom).
doi:10.1371/journal.pone.0048573.g002
final possibility is that population-specific Chmp2b expression is
brought about by cell-intrinsic mechanisms like the ones that
control many SSTF expression patterns during neuronal specification.
It is well established that two distinct, Lbx1+ populations born
from the dI4 progenitor layer between E11.75 and E13 colonize
this region. These populations, referred to as dI4LA and dI4LB, are
distinguished by their mutually exclusive expression of Pax2 and
Lmx1b, respectively. Unlike the three earlier-born Lbx1+ populations (dI4, dI5, and dI6), they are not born in dorso-ventrally
segregated groups. Instead, they are born in an intermingled
fashion. After birth they move laterally to mix with the earlier born
populations.
Co-labeling immunohistochemistry of anti-Chmp2b antibody
together with various combinations of antibodies against GFP,
Pax2, Lmx1b, Brn3a, and Lhx1/5 at E12.5 (Figs. 3, 4) was used to
ask if Chmp2b expression was restricted to specific Lbx1+ cell
populations. Pax2 or Lhx1/5 antibodies are typically used, in
conjunction with an Lbx1 antibody, to identify the dI4LA, dI4,
and dI6 populations. A direct comparison of Pax2 and Chmp2b
was precluded because both available antibodies are derived in
rabbits. However, triple labeling with GFP, Chmp2b, and Lhx1/5
antibodies revealed that Chmp2b expression was within the dI4LA
population (Fig. 3). Lhx1/5 staining was largely confined to the
lateral mantle zone region and therefore marks more mature cells.
High magnification triple stained images of the dorsal horn were
photographed and the color channels were dissociated into pairs to
allow the cytoplasmic Chmp2b, whole-cell GFP, and nuclear
Lhx1/5 immunoreativities to be more readily compared (Fig. 3 E–
H). Chmp2b immunoreactivity (Fig. 3E) surrounded the Lhx1/5+
Lbx1(GFP)+ nuclei in the dorsal horn (arrows). In contrast,
intermingled Lhx1/52 Lbx1(GFP)+ nuclei were not associated
with Chmp2b staining (arrowheads). The Chmp2b staining
associated with Lhx1/5+ Lbx1(GFP)+ nuclei in the dorsal horn
was not detected in this region in mutants (Fig. 3 A vs. B, C vs. D).
Consequently, the Lbx1-dependent expression domain of Chmp2b
is composed mainly, or entirely, of dI4 and/or dI4LA cells.
Cells were marked as circles in the relevant area of the dorsal
horn using the GFP and Lhx1/5 staining channels in the absence
of Chmp2b signal. Cells were then blindly scored for Lhx1/
5+GFP+ (Chmp2b channel off), Lhx1/52GFP+ (Chmp2b channel
off), Chmp2b+(Lhx1/5, GFP channels off), and Chmp2b2 (Lhx1/
5, GFP channels off). The results from eight dorsal horn images
indicate that 90% of the Lhx1/5+GFP+ cells are associated with
Chmp2b signal, whereas only 9% of the Lhx1/52GFP+ cell are
associated with Chmp2b signal (Fig. 3 J). The large percentage of
Lhx1/5+GFP+ cells that express Chmp2b at E12.5 precludes the
Figure 2. Lbx1-Dependent and Lbx1-Independent Chmp2b
Expression Domains. (A,B) Chmp2b RNA at mid-forelimb levels in the
dorsal and ventral portions of the mantle zone is Lbx1-dependent and
PLOS ONE | www.plosone.org
6
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
against GFP (rat), Lhx1/5 (mouse), and Chmp2b (rabbit) were detected
using appropriate Cy2 (green), Cy3 (red), and Cy5 (infrared) secondary
antibodies, respectively. Colors in the images were switched for clarity
to those indicated by the labels.(I, J) Blind quantification of cells in GFP/
Lhx1/5/Chmp2b stained sections of heterozygote (n = 8) and mutant
(n = 6). VZ, ventricular zone; IZ, intermediate zone; MZ, mantle zone; SL,
sulcus limitans; DLF (*), dorsolateral funiculus.
doi:10.1371/journal.pone.0048573.g003
idea that these are merely early born dI4 cells. A similar analysis in
mutants was irrelevant because no Chmp2b+GFP+ cells can be
confirmed (Fig. 3I).
The Lmx1b and Brn3a antibodies, which mark both the dI4LB
and dI5 populations, stain nuclei in both the medial intermediate
zone and the lateral mantle zone regions of the dorsal horn at
E12.5 (Fig. 4 A, E). The nuclei of the medial intermediate zone are
adjacent to the ventricular zone, in a region containing
predominantly newborn neurons. Although Chmp2b RNA was
readily observed in this medial zone (Fig. 2A), robust Chmp2b
protein expression was typically only detected laterally (Fig. 4A,E).
Low levels of Chmp2b protein were sometimes observed in the
intermediate zone in particularly well-developed stains. Some
Brn3a+ or Lmx1b+ nuclei were embedded in the Chmp2b stained
dorsolateral region that contains more mature dI4LB cells (Fig. 4
A, E and top insets B, F) and in a lateral cell cluster near the sulcus
limitans that contains dI5 cells (Fig. 4 A, E and bottom insets C,
G). High magnification insets show that the Brn3a+ or Lmx1b+
nuclei are not associated with cytoplasmic Chmp2b immunoreactivity (Fig. 4 B, C, F, G). Lhx1/5+ nuclei neatly fill nuclear-shaped
holes in the Chmp2b stain (Fig. 3), while Lmx1b+ and Brn3a+
nuclei do not (Fig. 4).
GFP+ cells were marked in the relevant area of micrographs in
the absence of Chmp2b signal. The relevant area did not include
the Chmp2b2 GFP+ medial area. Marked cells were blindly
scored for Brn3a (Chmp2b channel off), Lmx1b(Chmp2b channel
off), or Chmp2b (Brn3a, Lmx1b, GFP channels off). Only 5% of
the Brn3a+GFP+ or Lmx1b+GFP+ cells were associated with
Chmp2b signal (Fig. 4I). Few, if any Brn3a+GFP+ or Lmx1b+GFP+
cells were detected in heterozygotes or mutants (Fig. 4J). In
contrast, 95% of the Brn3a2GFP+ or Lmx1b2GFP+ in th relevant
area were associated with Chmp2b signal (Fig. 4I). Taken together
the data show that Chmp2b was selectively expressed in Lbx1+
dI4/dI4LA cells but not in the intermingled Lbx1+ dI5/dI4LB
cells.
dI4-Specific Expression of Chmp2b in Early-Born Lbx1+
Cells
Lbx1 is also expressed in the earlier-born dI4, dI5, and dI6
populations. These three early populations are best observed at
E10.5 at forelimb levels. Chmp2b RNA or protein expression was
not observed anywhere in the neural tube at this stage (data not
shown). Chmp2b RNA was first observed at E11.5 in a lateral
column at all axial levels of the spinal cord (Fig. 5 A–D). The two
late populations, dI4LA and dI4LB, are not yet born at E11.5.
Chmp2b RNA was therefore expressed in at least a subset of the
three early populations. Its expression domain resembled the
known Lbx1 expression domain.
In situ hybridizations were performed on adjacent sections using
probes against Chmp2b, GFP, Pax2, or Lmx1b (Fig. 5, A–D).
Purple color from the color reactions were rendered in false color
using red or green color tables in Adobe Photoshop. The basal
lamina and lumen were traced and adjacent sections were aligned
by these traces to determine the relative positions of the RNA
signals. Clearly, Chmp2b RNA was expressed lateral to the
Lbx1(GFP) and Pax2 RNAs (Fig. 5A, B), but dorsal to the Lmx1b
Figure 3. Population-Specific Chmp2b in dI4LA. (A, B) Low
magnification overviews of heterozygote and mutant E12.5 dorsal horn
at mid-forelimb levels. Note both the loss of Chmp2b and the severe
reduction of Lhx1/5 in the dorsal horn mantle of mutants below the
DLF (*). Note retention of Chmp2b in a more ventral GFP2 zone below
the sulcus limitans. Supernumerary GFP+ cells are seen in circumferential trajectory (white arrows) ventral to this zone. (C, D) Insets shown in
A and B. (E–H) Magnified images of the triple labeled inset shown in C.
This region contains spatially intermingled dI4LA (GFP+Lhx1/5+) and
dI4LB (GFP+Lhx1/52) cells. Dual and single channel images of the same
field are used to illustrate the selective expression of Chmp2b in dI4LA
cells. The arrows or arrowheads indicate the same two sets of cells in all
four panels. Arrows indicate GFP stained cells that contain Lhx1/5
stained nuclei. Chmp2b signal tightly surrounds these nuclei. Arrowheads indicate GFP stained cells that lack Lhx1/5 stained nuclei.
Chmp2b staining is not associated with these cells. Primary antibodies
PLOS ONE | www.plosone.org
7
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
RNA (Fig. 5C). The column of Chmp2b RNA was lateral only to
dorsal portions of the Pax2 and Lbx1(GFP) columns. Quantitative
evaluations of dorso-ventral extent of each of the RNAs expression
domains (Fig. 5D) suggested that Chmp2b was expressed in the
dI4, but not the dI5 or dI6 populations.
Immunohistochemical experiments confirmed this interpretation. Lhx1/5 expression marks both the dI2 and dI4 populations
at E11.5. The dI2 population is commissural, located along the
circumferential trajectory, and lacks Lbx1. The dI4 population is
located in a lateral column, and expresses Lbx1. Triple labeling
with Chmp2b, GFP, and Lhx1/5 antibodies can therefore be used
to identify the dI4 population positively (Fig. 5 E–H). Chmp2b
protein was observed in Lbx1(GFP)+Lhx1/5+ cells (arrows) in the
lateral column, but was not observed in Lbx1(GFP)2Lhx1/5+ cells
(arrowheads) along the circumferential trajectory. Thus, Chmp2b
was expressed in dI4, but not dI2 cells.
Lmx1b is expressed only in the dI5 neurons at E11.5. No colabeling was observed with Lmx1b and Chmp2b antibodies
(Fig. 5I, J; single channel images of Fig. 5I are shown in Fig. S1).
Chmp2b was also not observed in cells in the circumferential
trajectory ventral to the Lmx1b expression domain, and was
therefore not expressed in dI6 cells (Data not shown). Although the
three genetically-specified, early, Lbx1+ populations (dI4, dI5, and
dI6) are spatially adjacent at E11.5, only the dI4 population
expressed Chmp2b.
Chmp2b Expression in a Subset of the dI1 Population
Chmp2b protein expression at E11.5 was also observed in
vertically oriented neurons along the circumferential trajectory
followed by commissural interneurons. These neurons are seen as
blue-only cells in Fig. 5E, or as green-only cells in Fig. 6 E and G.
The dI1, dI2, dI3, dI6, and V0 populations, as well as a subset of
the dI5 population, are known to contribute neurons to the
circumferential, commissural trajectory. The observed verticallyoriented Chmp2b+ neurons lacked Lbx1(GFP) and were therefore
not dI5 or dI6 neurons. They were located just medial to the
column of Lhx1/5+ dI4 association interneurons at E11.5 and
lacked the Lhx1/5 expression seen in dI2 neurons (Fig. 5E,
arrowheads). Isl1 is expressed in the dI3 population of commissural interneurons. Chmp2b staining was not observed in Isl1+
cells along the circumferential trajectory (data not shown). Lmx1b
is expressed in both circumferential and lateral dI5 neurons.
Chmp2b staining was not observed in Lmx1b+ cells (Fig. 5 I, J)).
Evx1 is expressed in V0 neurons. Chmp2b expression was not
observed in Evx1+ neurons (data not shown). Assuming that the
known dI2, dI3, and dI5 SSTF markers are not downregulated,
the data above eliminate all except the dI1 population as potential
sources of this Chmp2b expression domain.
Brn3a is expressed in dI2, dI3, dI5. It is expressed in only a
subset of the dI1 population at E11.5 [34]. Chmp2b expression
was also not observed in Brn3a+ neurons (Fig. 5 K, L; single
channel images of Fig. 5K are shown in Fig. S1). Thus, the
vertically oriented Chmp2b+Lbx1(GFP)2 neurons along the
circumferential trajectory belong either to the subset of dI1
neurons that lack Brn3a expression (dI1B) or to some as yet
undefined population. The dI1B population at E12.5 moves out of
the circumferential trajectory and settles at the lateral margin
below the sulcus limitans [35,36]. This is precisely the location of
the Lbx1-independent Chmp2b expression domain at E12.5.
Figure 4. Lack of Chmp2b in dI4LB Late Population. Lmx1b and
Brn 3a mark both the dI4LB and dI5 populations of interneurons at E12.5
in mid-forelimb cross sections. These populations express Lbx1(GFP) (not
shown), but lack Chmp2b. (A–C) Nuclei stained with the Brn3a antibody
are located within the region stained by Chmp2b antibodies. Dorsal and
ventral clusters of these nuclei correspond to the dI4LB and dI5
populations, respectively. Brn3a stained nuclei (arrowheads) in these
regions are not associated with Chmp2b staining. Other cell bodies in the
immediate vicinity lack Brn3a and are stained for Chmp2b (arrows). (D)
Loss of Chmp2b and severe reduction of Brn3a in dorsal horn of mutants.
(E–G) Nuclei stained with the Lmx1b antibody are located within the
region stained by Chmp2b antibodies. Dorsal and ventral clusters of
these nuclei correspond to the dI4LB and dI5 populations, respectively.
Lmx1b stained nuclei (arrowheads) in these regions are not associated
with Chmp2b staining. Other cell bodies in the immediate vicinity lack
Lmx1b and are stained for Chmp2b (arrows). (H) Loss of Chmp2b and
severe reduction of Lmx1b in dorsal horn of mutants. Primary antibodies
against GFP (rat), Brn3a (guinea pig) or Lmx1b (guinea pig), and Chmp2b
(rabbit) were detected using appropriate Cy2(green), Cy3(red), and Cy5
(infrared) secondary antibodies. The Lbx1(GFP) channel was omitted and
the colors of the remaining channels switched for clarity to those
indicated by the labels. (I, J) Blind quantification of cells in Brn3a/GFP/
Chmp2b stained sections for heterozygote (n = 7) and mutants (n = 4),
and Lmx1b/GFP/Chmp2b stained sections for heterozygote (n = 5) and
mutants (n = 6). VZ, ventricular zone; IZ, intermediate zone; MZ, mantle
zone; SL, sulcus limitans; DLF (*), dorsolateral funiculus.
doi:10.1371/journal.pone.0048573.g004
PLOS ONE | www.plosone.org
Thoracic-Restricted dI1 Expression of Chmp2b
The laterally-settling dI1B population is present at thoracic but
not cervical levels at E12.5 [36]. Chmp2b RNA expression in
E11.5 heterozygotes and mutants was compared along the entire
8
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
Figure 5. Population-specific Expression at Early Stage. Lbx1 expressing cells emerge as a single column from the ventricular zone from E10.5
to E11.75. They belong to three populations, named dI4, dI5, and dI6, adjacent to each other along the dorsal-ventral axis. (A–C) In situ hybridizations
with the indicated probes were done on adjacent E11.5 sections of heterozygotes at mid-forelimb level. Signals were photographed in color,
converted to greyscale, and rendered false color using color tables. The contours of the basal lamina and lumen were traced and used to align
images. Chmp2b RNA is observed adjacent to the dorsal portion of the Lbx1(GFP) RNA column (A) where Pax2 RNA (B) but not Lmx1b RNA (C) is
expressed. (D) Summary of parallel section analyses along the body axis. (E–H) A single triple-labeled image (E) is shown in single color channels (F–
H). Arrows and arrowheads indicate the same two sets of cells in these four images. Arrows indicate dI4 cells that co-label with the Lbx1(GFP) and
Lhx1/5 antibodies. Chmp2b antibody stains these cells. They are either within the lateral column or horizontally-oriented and appear to be moving
toward the lateral column. Arrowheads indicate cells dI2 cells that stain with Lhx1/5 but not Lbx1(GFP). These cells are vertically oriented and are not
stained by the Chmp2b antibody. (I) Cells of the dI5 populations are labeled by Lmx1b, but not by Chmp2b, antibodies. Single channel images of this
image are shown in Fig. S1. (J) Quantification of cells in Chmp2b/Lmx1b/GFP stained heterozygote sections (n = 4). (K) Cells of the dI1, dI2, dI3, and
dI5 populations are labeled by Brn3a, but not by Chmp2b, antibodies. Single channel images of this image are shown in Fig. S1. (L) Quantification of
cells in Chmp2b/Brn3a/GFP stained heterozygote sections (n = 4). Signals for Lhx1/5, Brn3a, and Lmx1b were developed with Cy3(red) secondary
antibodies. Signals for Lbx1(GFP) and Chmp2b were developed with Cy2 (green) and Cy5 (infrared) secondary antibodies, respectively. Channels were
omitted or colors were switched, for clarity, to those indicated by the labels.
doi:10.1371/journal.pone.0048573.g005
cervical levels (Fig. 6. A, C, G, E; single channel images of panels
C and G are given in Fig. S2). The expression of Chmp2b in these
cells was retained in mutants, indicating that it did not depend on
Lbx1. The quantified results (Fig. 6 I, J) graphically illustrate the
presence of an Lbx1-independent, GFP2 population of Chmp2b+
cells that exists at thoracic, but not cervical levels. The Lbx1independent Chmp2b expression domain therefore shares the
migration route at E11.5, the settlement zone at E12.5, and
anterior-posterior restriction across the cervical-thoracic boundary
at E12.5 with the dI1B population. In addition, it lacks markers for
all of the other populations known to exist at these locations..
Chmp2b expression in the dI4 column depended on Lbx1 both
at cervical and thoracic levels (Fig. 6). The SSTF code of dI4
neurons is respecified to a dI2-like code in Lbx1 mutants. This
respecification is accompanied by altered migratory behavior.
Respecified dI4 neurons move along the circumferential trajectory
body axis. Mutant sections taken at cervical levels showed a
complete loss of the lateral column of Chmp2b RNA expression,
whereas mutant sections taken at more caudal levels retained a
column of Chmp2b expression (data not shown). These data
suggested that the dI1-specific Lbx1-independent expression
domain of Chmp2b was absent at cervical levels but present at
thoracic levels. Immunohistochemistry confirmed this hypothesis.
A Lbx1(GFP)+ Lhx1/5+ Chmp2b+ column of neurons was
observed at the lateral margin of the neural tube at both cervical
and thoracic levels (Fig. 6A, C, E, G; single channel images of
panels C and G are given in Fig. S2). These triple labeled cells
were lost in mutants (Fig. 6 B, D, F, H; single channel images of
panels D and H are given in Fig. S2), indicating that they were the
dI4 population for which Chmp2b expression is Lbx1-dependent.In contrast, Chmp2b+Lbx1(GFP)2 Lhx1/52 neurons along the
circumferential trajectory were observed at thoracic levels but not
PLOS ONE | www.plosone.org
9
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
Figure 6. Lbx1-Independent Domain Absent at Cervical Levels. (A–D) Dorsolateral neural tube at cervical levels. A lateral column (bracketed
by arrowheads) shows cells that are colabeled by Lbx1(GFP) and Lhx1/5. A subset of these cells are also labeled by Chmp2b in heterozygotes but not
in mutants. The size of the lateral column is also reduced, possibly reflecting the loss of dI4 cells, as observed at thoracic levels. The Lbx1-independent
expression domain in the circumferential trajectory, representing dI1B cells, is absent in both genotypes. (E–H). Dorsolateral neural tube at thoracic
levels. A lateral column (bracketed by arrowheads) shows dI4 cells that are colabeled by Lbx1(GFP) and Lhx1/5. Almost all of the cells in this column
are labeled by Chmp2b in heterozygotes. The column is absent in mutants. A large Lbx1-independent expression domain in the circumferential
trajectory, representing dI1B cells, is present in both genotypes. It is adjacent to the dI4 column and obscured the loss of Chmp2b RNA in the dI4
column at thoracic levels (see results). (I, J) Quantification of cells in GFP/Lhx1/5/Chmp2b labeled heterozygote sections at cervical (n = 4) and thoracic
(n = 4) levels, respectively. Primary antibodies against GFP, Lhx1/5, and Chmp2b were detected using appropriate Cy2 (green), Cy3 (red), and Cy5
(infrared)secondary antibodies, respectively. Colors were electronically switched, for clarity, to those indicated by the labels.
doi:10.1371/journal.pone.0048573.g006
rather than moving laterally to aggregate into a lateral column.
The apparent loss of the Chmp2b+ lateral column could therefore
be due to relocation of these cells rather than a gene regulatory
PLOS ONE | www.plosone.org
event. However, it appears that this is not the case. No ectopic
Chmp2b+Lbx1(GFP)+ cells were observed in the circumferential
trajectory of mutants. This was particularly evident at cervical
10
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
levels, where such a population could not be obscured by the Lbx1independent Chmp2b expression of the circumferentially migrating dI1 population (Fig. 6 B, D). The loss of the Chmp2b+ column
in mutants is therefore due to gene regulation rather than cell
relocation.
Dendritic Deployment of Chmp2b Protein to the
Dorsolateral Funiculus
Chmp2b protein staining in the white matter was first observed
at E12.5 (Fig. 2E, Fig. 7). Chmp2b protein is therefore moved into
neurite projections during the time when synapses in the mouse
neural tube can first be readily observed by electron microscopy
[37]. Dorsolateral (between arrowheads) and ventrolateral (between arrows) zones of Chmp2b staining were observed in the
white matter of heterozygotes at E12.5 (Fig. 7A). Young E12.5
embryos contain Chmp2b protein at the ventral edge of the
dorsolateral funiculus (DLF), which can be labeled by tubulin
staining (Fig. 7C), in an area (between arrowheads) that was
defined as the association neuropil by early electron microscopy
studies of the mouse neural tube [38]. Slightly older E12.5
embryos showed many Chmp2b+ projections or puncta within the
DLF (Fig. 7A), which were clearly intermingled with the tubulin+
axons that course longitudinally along the DLF at this stage
(Fig. 7E; single channel images in Fig. S3 A–C).
Chmp2b immunoreactivity in the DLF was lost in mutants
(Fig. 7B, D), indicating that it comes from Lbx1-dependent sources
such as dI4 and/or dI4LA neurons, rather than from Lbx1independent sources such as the dI1B or motor neurons (see
below). GFP+ cytoplasm in this area can be observed at high
magnification, and is tightly associated with Chmp2b+ puncta (Fig.
S3D–F).
Chmp2b+ projections in the DLF are unlikely to be afferent
axons because Chmp2b RNA or protein were not detected at
significant levels in the dorsal root ganglion between E10.5 to
E13.5 (data not shown). The Chmp2b+ projections in the DLF
were also not axons of the dI4 or dI4LA association interneurons
because the axons of these neurons are located in the lateral
funiculus (LF) and ventrolateral funiculus (VLF) and are redirected
toward the floor plate in Lbx1 mutants [30]. This can be observed
here by the loss of tubulin staining from the LF and VLF, but not
the DLF, of mutants (Fig. 7C, D and Fig. 8 G, H). The Chmp2b+
projections within the DLF are therefore dendrites, rather than
axons, of the dI4 and/or dI4LA neurons. MAP2a is classic marker
of dendrites, whereas ß-tubulin is typically associated with axons
[39]. MAP2a staining of within the DLF coincides closely with
Chmp2b staining, whereas tubulin staining only intermingles
closely with it (Fig. 9 J–R).
Figure 7. Funicular Localization of Chmp2b Protein. (A) Chmp2b
staining between the cellular region and basal lamina was observed in a
dorsolateral zone (between arrowheads) and a ventrolateral zone
(between arrows)in heterozygotes. (B) The dorsolateral zone is lost in
mutants while the ventrolateral zone is retained. (C–E) ß-tubulin Stains
longitudinal axons in the lateral white matter as blue puncta. (C) The
dorsolateral zone of Chmp2b expression is located between the tubulin
stained DLF (*) and lateral funiculus (LF; {) in heterozygotes. It appears
smaller in this section than in panel A. (D) Tubulin staining at the sulcus
limitans (horizontal line) and in the VLF is severely reduced in mutants.
The LF appears to be absent and Chmp2b staining in the VLF has an
altered appearance. (E) Chmp2b stained projections enter the
heterozygote DLF at E12.5. Afferent projections in this funiculus project
longitudinally and have not entered the grey matter at this stage. They
are labeled with tubulin (blue). Single channel images of this panel are
shown in Fig. S3 A–C. GFP/Chmp2b double labels of the insets are
enlarged in Fig. S3D–F. They show coincident labeling of GFP and
Chmp2b in the white matter (F–K) The red channel of the color images
in F, H, J were converted to greyscale images in G, I, and K, respectively.
This allows Chmp2b staining in the circumferential trajectory (arrows) to
be seen at thoracic levels at E11.5 (G) and E12.5 (I). No such staining can
be seen at cervical levels at E12.5 (K). Note that Chmp2b staining is only
seen in GFP stained areas at cervical levels (J), whereas it is observed
outside of the GFP stained areas at thoracic levels (F, H).
doi:10.1371/journal.pone.0048573.g007
both the VLF and LF of mutants (Fig. 7C, D; Fig. 8G, H). In
contrast, tubulin+ puncta were not lost from the DLF or ventral
funiculus of mutants. The loss of axons from the LF and VLF is
due to a re-direction of association axons to the circumferential
trajectory in Lbx1 mutants [30].
High magnification images show that both Chmp2b and tubulin
immunoreactivities are punctate within the DLF (Fig. 7E) and
VLF (Fig. 8 G, I). Tubulin+ puncta mark cross sections of the
longitudinally projecting axons. Chmp2b+ puncta were closely
intermingled, but only rarely overlapped with, the tubulin+ puncta
of both the DLF and VLF. MAP2a colabels Chmp2b+ structures
within the VLF, whereas ß-tubulin only intermingles closely with
them (Fig. 9 A–I). The Chmp2b expressing neurites in the white
matter therefore appear to be dendrites rather than longitudinal
axons. Moreover, the punctate nature of the Chmp2b+ structures
contrasts sharply with the larger, more flowing nature of GFP+
Dendritic Deployment of Chmp2b Protein in the
Ventrolateral Funiculus
The ventrolateral zone (between arrows) of Chmp2b protein
staining in the white matter corresponded to the VLF. Staining
was of similar intensity in mutants and heterozygotes, indicating
that Chmp2b was carried into the VLF from one or more of the
neuronal populations that express Chmp2b in an Lbx1-independent fashion, either dI1B and/or motor neurons (see below).
Chmp2b immunoreactivity was abnormally localized within the
VLF of E12.5 mutants. It was less finely speckled and distributed
in later embryos (Fig. 7 A, B), and aggregated along the inside of
the basal lamina in earlier embryos (Fig. 8 G, H). The severe loss
of longitudinally projecting tubulin+ axons in the VLF and LF
(dagger) can explain the abnormal localization of the Chmp2b
protein in mutants. Far fewer tubulin+ puncta were observed in
PLOS ONE | www.plosone.org
11
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
Figure 8. Chmp2b Protein in Soma and Dendrites of Motor Neurons. Chmp2b and Isl1 are co-expressed in motor columns of the ventral
horn. (A, C, E) Isl1 primary antibody was detected with Cy3 (red). Chmp2b antibody was detected with Cy5 (infrared) and is shown in green. (B, D, F)
Greyscale images of the green channel of images shown in A, C, and E, respectively. Chmp2b staining within soma can be distinguished from staining
of projections between soma. The most sensitive secondary antibody (Cy3) and relatively long image acquisition times are required to detect
Chmp2b signal in the motor columns. (G, H) Comparison of the VLF of heterozygotes and mutants stained with Chmp2b (red; Cy3) and tubulin (blue;
Cy5). Radial breaks in the tubulin stains of heterozygotes (indicated by pairs of arrowheads) may represent the endfeet of radial glial cells (see inset I)
that dendrites of motor neurons have been shown to follow into the VLF during early synaptogenesis (diagrammed by flow arrow). Note the loss of
tubulin staining in the LF ({) and in the VLF below the sulcus limitans (horizontal line). Chmp2b staining in the VLF is present but distributed
differently in mutants. (I) High magnification image of a putative radial glial endfoot that can be seen by background stain in the green channel. Note
that Chmp2b and tubulin staining do not colocalize but appear to associate closely on the surface of the endfoot.
doi:10.1371/journal.pone.0048573.g008
cytoplasm (Fig. S3 D–F) in the DLF. Chmp2b may therefore be
associated with filipodia or nascent dendritic spines.
We could detect Chmp2b protein readily in the dI4, dI4LA, and
dI1B populations, but required higher sensitivity to detect it in the
in motor neurons. This could be explained in a variety of ways.
The Chmp2b RNA could be less efficiently translated or the
Chmp2b protein could be more rapidly degraded in motor
neurons than in interneurons. More likely, the Chmp2b protein
could be moved rapidly into the dendrites of motor neurons as
they extend into the VLF.
The dendritic projections of motor neurons at this stage at
thoracic levels have been described by electron microscope studies
in mouse embryos [38,40,41,42]. These electron microscope
studies show that the dendritic growth cones of motor neurons
ascend dorsally at the edge of the gray matter until they come into
contact with the laterally directed projections of radial glial cells.
They turn and crawl laterally along these projections into the
ventrolateral funiculus, where they begin to make synapses with
longitudinally projecting axons. The collaterals that begin to
mature synapses move, or grow away from, the radial glial
projection (see arrow in Fig. 8G).
Chmp2b+ tubulin2 puncta intermingled with Chmp2b2tubulin+ puncta in the VLF (Fig. 7C, 8G). Both types of puncta were
associated with a much larger, laterally-oriented structures that
lacked both tubulin and Chmp2b signal, but which could be
observed by background signal in the green channel. These
structures appear to emerge from the grey matter and span the
Lbx1-independent Chmp2b Expression in Motor Neurons
Chmp2b protein in dendrites within the VLF was Lbx1independent and should therefore come from the dI1B population
rather than the dI4 and/or dI4LA populations. However, electron
microscopy studies show that the dendrites of motor neurons make
the first synapses of the mouse neural tube within the VLF [40],
and we had observed Lbx1-independent Chmp2b RNA expression
in the motor columns at E12.5 (Fig. 1A, B). Chmp2b protein was
not immediately apparent in the motor columns because levels
were much lower than in the dI4, dI4LA and dI1B populations
(Fig. 1C, D).
High gain exposures with high magnification lenses were used
to determine that Chmp2b staining was associated with the cell
bodies surrounding Isl1+ nuclei at E12.5 (Fig. 8A–F; single channel
Isl1 images in Fig. S4) It should be emphasized that Chmp2b
immunoreactivity in motor neurons was far weaker than in dI4,
dI4LA or dI1B cells. Chmp2b protein could not be detected in the
ventral horn at E11.5 using the same high-gain methods (data not
shown). Chmp2b RNA was also not ever observed in the ventral
horn at E11.5 (Fig. 5A–C; data not shown). Chmp2b gene
expression in motor neurons therefore initiates between E11.5 and
E12.5.
PLOS ONE | www.plosone.org
12
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
the binding specificity of the SSTF itself, but depends strongly on
the cell type in which it is deployed. This has previously been
observed for SSTF target genes of Lbx1, such as Pax2, Lmx1b,
Isl1, and Foxd3. Here we show cell-type specific regulation by
Lbx1 also occurs in a non-SSTF gene, namely Chmp2b.
While temporal and spatial considerations suggest that these five
target genes are direct target genes of Lbx1, physical occupancy of
CRMs near any of these five target genes by the Lbx1 protein has
not yet been demonstrated. Even if these targets are indirectly
regulated by an intermediate SSTF, the cell-type specificity of
their Lbx1-dependent regulation implies that the Lbx1 homeodomain protein does not trigger a standard hierarchical transcriptional cascade wherever it is expressed. If it did, then one would
expect to see identical changes in the expression of target genes in
all cells where Lbx1 protein is expressed. The set of Lbx1 target
genes is likely to differ in each cell type where the Lbx1 protein is
deployed. The fact that Lbx1 does not equivalently regulate nonSSTF target genes in each cell type where Lbx1 is expressed
indicates that Lbx1 plays different functional roles in each Lbx1+
cell type. It is therefore inappropriate to ascribe specific biological,
physiological, or neural functions to Lbx1 without specifying the
cell type(s) or population(s) in which it performs these specific
functions.
Figure 9. Chmp2b Colocalization with MAP2a in DLF and VLF.
(A–I) Comparison of Chmp2b/MAP2a colabeling with Chmp2b/ßtubulin colabeling in the VLF in adjacent sections (J–R) Comparison of
Chmp2b/MAP2a colabeling with Chmp2b/ß-tubulin colabeling in the
DLF in adjacent sections. Note that Chmp2b and MAP2a colocalize,
while Chmp2b and ß-tubulin are only in close apposition.
doi:10.1371/journal.pone.0048573.g009
Population-Specific Regulation
The precise mechanism which produces population-specific
Chmp2b expression patterns is likely to remain unresolved until
the CRMs in the Chmp2b locus are identified and their occupancy
by SSTFs characterized in each neural tube population as a
function of developmental time. Clusters of CRMs work together
to generate the correct temporal and spatial expression of each
gene during embryogenesis of metazoans. The direct interaction
between SSTFs and CRMs has been intensively studied in more
tractable systems than mammals [44,45,46,47,48,49]. One of the
paradigms to emerge from these studies is that CRM clusters
integrate developmental history with time/space-dependent signaling cues to produce spatial gene expression patterns.
This paradigm provides the most cogent means to explain the
observed population-specific expression and Lbx1-dependence/
independence of Chmp2b expression. It is reasonable to suppose
that Lbx1 acts as a patterning SSTF and contributes to the
Boolean input of particular patterning CRMs near the Chmp2b
gene. In each population where Lbx1 is expressed, it is in the
company of a different combination of SSTFs. For example, Lbx1
is co-expressed with Pax2 and Ptf1a, but not with Lmx1b or
Brn3a, in dI4LA cells. A patterning CRM near Chmp2b that is in
the ‘‘block’’ state could be switched to the ‘‘allow’’ state by
assembling a Lbx1/Ptf1a/Pax2 complex on it. This would make
the Chmp2b gene available for expression in dI4LA, but not
dI4LB, cells. Conversely, Lbx1 is co-expressed with Lmx1b and
Brn3a, but not with Pax2 or Ptf1a, in dI4LB cells. A patterning
CRM near Chmp2b that is in the ‘‘allow’’ state could by switched
to the ‘‘block’’ state by assembling a Lbx1/Lmx1b/Brn3a complex
on it. This would make the Chmp2b gene unavailable for
expression in dI4LB, but not dI4LA, cells. Once the Chmp2b gene
is made available for expression by appropriate switching at
Boolean CRMs, then it must still be activated by time/space
dependent signaling cues. Such cues may exist at the periphery of
the neural tube and may account for the strong lateral/weak
medial Chmp2b protein signals observed at all stages.
Lbx1 regulates hundreds of other non-SSTFs genes and
regulation of these targets is also likely to be population-specific.
Future array studies should therefore be performed on progressively more ‘‘pure’’ populations, or cell types, rather than on
nascent white matter all the way to the basal lamina. They
therefore closely match the morphological descriptions of radial
glial end-feet. Paired arrowheads indicate the location of these
structures in the VLF (Fig. 8G). An enlargement shows how the
two types of intermingled puncta associate with them (Fig. 8I).
Radial glia can be labeled by epitopes, such as RC2 or Rat-401
[43] of the neurofilament protein nestin. Nestin also marks the
ventricular zone of the neural tube. Chmp2b immunoreactivity
does not coincide, but associates closely with nestin immunoreactivity (Fig. S5), indicating that the radial glial endfeet do not
express Chmp2b, but come into close apposition with structures
that do.
The axons of motor neurons project through the ventral root,
where no Chmp2b protein was observed (Fig. 7C). The dendrites
of motor neurons in the VLF tend to come from the lateral, rather
than the medial, motor columns at this stage. The lateral motor
columns showed more intense RNA (Fig. 2; data not shown), but
less intense protein (arrow, Fig. 8A), stains than the medial
columns. Taken together, the observations are consistent with the
idea that protein translated from Chmp2b RNA in motor neurons
of the lateral column are rapidly moved into dendrites in the VLF.
Discussion
Lbx1 Target Selection Depends on the Precise Molecular
State of the Cell
Specification of SSTF combinations in postmitotic neuronal
populations is thought to bring about the cell-type specific
expression of non-SSTF genes, so that the appropriate collective
of catalytic, trafficking, signaling, and structural proteins becomes
available to each developmentally-specified population as it
matures. Our results indicate that the set of target genes influenced
by a homeodomain gene such as Lbx1 is not only determined by
PLOS ONE | www.plosone.org
13
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
population mixtures. The effects of genetic perturbations on gene
expression and SSTF occupancy in CRM chromatin should be
evaluated across the genome in such studies.
Biochemical Role of Chmp2b in Nascent Interneurons
Biochemical studies indicate that the ESCRT proteins play a
role in endocytic sorting, recycling, and destruction of monoubiquitinated transmembrane proteins. All cells have transmembrane proteins and need to turn them over. The ESCRT system
therefore performs a housekeeping function and all of its essential
protein components should be expressed in all cells. Our studies
indicate that Chmp2b RNA is selectively expressed at very high
levels in three nascent interneuronal populations and at moderate
levels in motor neurons. The lack of any Chmp2b expression prior
to E11.5 and throughout most of the embryo between E11.5 and
E13.5 is incongruous with a housekeeping role.
One explanation is that Chmp2b is expressed in all cells, but at
much lower levels than in these few populations. Very sensitive
techniques were required to visualize Chmp2b protein in the cell
bodies of motor neurons (Fig. 8). Light speckling throughout much
of the neural tube was also observed in those assays. This speckling
was not due to precipitates in our reagents, because it was not
observed in the ventricular zone. Clearly, the dividing cells of the
ventricular zone also have a need to turn over transmembrane
proteins and can do this without Chmp2b protein.
A second possibility is that Chmp2a and Chmp2b perform
redundant functions. The array data showed that all 30 of the
other ESCRT RNAs were expressed at identical levels in green
and white cells (data not shown), which according to the
population partitioning model [25], indicated that they are
uniformly expressed in the neural tube. The arrays also showed
that none of the other ESCRT genes were Lbx1-dependent.
Chmp2b expression was therefore not required in the dI4, dI4LA,
dI1B, and motor neuron populations to make up for a lack of
Chmp2a. Moreover, loss of Chmp2b in cultured neurons produces
a phenotype, indicating that Chmp2a function is not completely
redundant [24].
It is likely that Chmp2a is the Vps2 ortholog and performs the
housekeeping tasks, while Chmp2b performs a specialized task in
neurons that express it at high levels. Chmp2b is structurally
related to Chmp6, Chmp4b, Chmp3, and Chmp2a. All of these
proteins appear to function in the budding-out of membranes that
is performed by the core ESCRTIII complex during ILV
formation in endosomes. Other budding-out events include
exosome formation, viral bud formation and cytokineses. Dendritic spines are also budding-out from the membrane and
Chmp2b has been implicated in their stabilization [24].
Possible Sources of Cell-Type Specificity
Chmp2b expression depends strongly on Lbx1 function in the
Lbx1-expressing dI4LA cell type but fails to be established in the
Lbx1-expressing dI4LB cell type. These two cell types are spatially
intermingled from the time they emerge as post-mitotic Lbx1+ cells
until these observations were made, less than 24 hours later.
Consequently, both cell types are subject to an identical signaling
milieu and cell-type specific upregulation of Chmp2b is unlikely to
arise from differential signaling to the two cell types.
The primary cause of differential Chmp2b activation is likely to
be due to intrinsic differences in the two cell types that exist prior
to the onset of Lbx1 expression. It has been reported that
individual late progenitor (dL) cells can asymmetrically divide, into
a dI4LA cell and a dI4LB cell, or into a dI4LA cell and dL
progenitor cell [50]. Several SSTFs genes expressed in the dL
progenitors (Gsh1/2, Mash1, Ptf1a) are known to influence the
development of the two cell types that emerge from them, but only
the expression of Ptf1a is selectively carried into the dI4/dI4LA
cell types as they are born [51,52,53]. Differential partitioning of a
SSTF, such as Ptf1a, during this division would create differential
regulatory paradigms in the two daughter cells. Ptf1a and Lbx1
proteins could then act cooperatively at a CRM to bring about
selective expression of Chmp2b in dI4/dI4LA cells.
Several SSTFs begin to be selectively expressed in dI4LA
(Lhx1/5, Pax2) or dI4LB (Tlx3, Lmx1b) cells shortly after the final
cell division and the onset of Lbx1 protein expression. The
maintenance, but not the onset, of expression of these proteins
appears to be Lbx1-independent [30,31,54]. These factors could
cooperate with Lbx1 at a CRM near Chmp2b to bring about celltype specific, yet Lbx1-dependent activation of Chmp2b.
Fewer Lbx1-Targets Per Cell Type
Homeobox proteins function collectively in various combinations, at CRMs, to generate new cellular states from previous
cellular states. The sensitivity of Lbx1 function to cellular state is
unlikely to apply merely to its regulation of Chmp2b. One of the
pressing issues in analyses of homeobox gene function has long
been the identification of target genes that would help explain their
biological function. We initially undertook flow sorting/microarray experiments to meet this issue head-on in a mammalian
system. One of the surprising outcomes was the sheer number of
Lbx1-dependent targets, both in the SSTF [29] and non-SSTF
(this report) subsets of the data. In our previous reports, we
carefully evaluated the issues of significance by a method called
fold-scanning and concluded that these many changes are
reproducible and do not merely result from measurement noise.
In this report, we examine a single non-SSTF target, which
showed a large fold-change, and show that it is not uniformly
regulated in all Lbx1-expressing cell types. Thus, the hundreds of
Lbx1-targets observed in pooled Lbx1-expressing cell types (Fig. 1)
appear to be an aggregate target set, consisting of many different,
partially overlapping, cell-type specific target sets. The current
state of knowledge indicates that there are five Lbx1-expressing
cell types. However, it is likely that more cell types will be defined
as SSTF codes become more refined. The number of Lbx1dependent targets in each cell type is therefore expected to be
smaller than initially suggested by array analyses of flow-sorted
Lbx1GFP cells.
PLOS ONE | www.plosone.org
Lbx1-Independent Chmp2b Protein Expression in the VLF
Chmp2b is the only ESCRT component associated with
neurodegenerative disease and appears to be required for dendritic
spine potentiation in cultured hippocampal neurons. Chmp2b
expression was observed only in the embryonic dI4, dI4LA, dI1B,
and motor neurons populations. The dI4 and dI4LA populations
contribute to the association interneurons of the substantia
gelatinosa [30], a structure consisting largely of ipsilaterally
projecting, local-circuit interneurons [55]. Both the dI4 [51] and
dI4LA [53,54,56] populations give rise to inhibitory interneurons.
The dI1B population gives rise to spinocerebellar neurons [36].
These are excitatory neurons that project long distances to the
cerebellum by both ipsilateral and contralateral trajectories. Motor
neurons project axons out of the ventral root and are cholinergic.
Clearly, the populations that express Chmp2b do not have a
common neurotransmitter phenotype, axonal projection trajectory, or axonal projection distance.
However, Chmp2b protein expression appears to be closely
associated with the neuronal populations, projections, and
synaptogenic areas that form the first cutaneous reflexes. We
14
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
[33]. Afferent projections from the dorsal root ganglia begin to
gather and extend rostro-caudally in the DLF from E10.5–E12.5.
The first afferent neurites enter the dorsal grey matter from this
funiculus at E12.5. Lateral association neurons lack dendrites at
E10.5, but have primary dendrites that project dorsally at E11.5
[59]. Projections in this direction would reach the lateral
‘‘association neuropil’’ prior to the DLF. Our data indicate that
the Chmp2b+ dendrites of dI4 and/or dI4LA neurons gradually
encroach on the DLF from the ‘‘association neuropil’’ very close to
the time when the first afferent axons enter the grey matter.
observed that Chmp2b protein was transported into dendrites in
the DLF and VLF at the time when the spinal cord’s first
synaptogenesis ramps up in these locations. The Chmp2b+
dendrites of the motor and/or dI1B populations entered the
ventrolateral funiculus at the time and place when the axons of
lateral association interneurons make synapses with the dendrites
of motor neurons. The Chmp2b+ dendrites of the dI4 and/or
dI4LA populations entered the DLF at the time and place where
primary afferent axons make the first synapses with the dendrites
of lateral association interneurons.
The first two types of synapses in the developing neural tube are
thought to create the disynaptic reflex in a retrograde manner.
Quantitative electron microscope studies in mouse embryos show
that the first synapses form in the lateral marginal zone. Very few
synapses can be found at E11, but their density increases 50-fold
by E12, and steadily rises thereafter [37]. Synapses are only found
in the lateral marginal zones from E11 until E14. Synaptogenesis
in the ‘‘motor neuropil’’ was found to slightly precede the
‘‘association neuropil’’ in both rats [57] and mice [38]. In these
studies, the ‘‘motor neuropil’’ was defined as the marginal zone
dorsolateral to the lateral motor column. This corresponds to the
dorsal half of the VLF. The ‘‘association neuropil’’ was defined as
the marginal zone dorsolateral to an ‘‘association nucleus…exhibiting irregular contours’’ [38,57]. This ‘‘nucleus’’ corresponds in
appearance and location to a cluster of Lmx1b+ dI5 cells that
forms at the lateral margin at E12.5 (compare Fig. 10 of [57] with
Fig. 3G in [30]). The ‘‘association neuropil’’ is therefore located
between the DLF (Bundle of Hiss) and LF and corresponds exactly
to the dorsolateral zone of Chmp2b expression in the white matter
(Fig. 7). The two zones of Chmp2b protein expression therefore
correspond to the two successive zones where synaptogenesis
begins in the spinal cord to form the disynaptic reflex.
Axon and dendrite formation on both motor [58] and
association [59] neurons was studied by Golgi impregnation in
mouse embryos between E9.5 and E11.5. Motor and association
neurons begin to project axons as their somata migrate away, and
their apical projection are withdrawn, from the ventricular zone
during the E9.5 to E11.5 interval. Primary dendrites are formed
later, after cells pass through a unipolar stage and reorient dorsoventrally. The axons of motor and association neurons project
ipsilaterally, through the ventral root or longitudinally, along the
lateral marginal zone (VLF, LF), almost as soon as they are
formed. The VLF contains axons from the V1 [60], V2 [61,62],
and Lbx1-expressing populations [30]. The LF contains axons
from one or more Lbx1-expressing populations [30] and from the
lateral dI1B population [36]. Golgi impregnations of longitudinal
axons in the lateral marginal zone of mouse embryos at E12 show
that they are thin, extend no more than two segments, rarely have
collaterals, and are connected to the soma of lateral association
neurons [63]. These relatively immature axons appear to develop
synapses with the newly-formed, Chmp2b+ dendritic growth cones
or dendrites of motor neurons and/or dI1B association neurons
from E12 onward.
Biological Role of Population-Specific Chmp2b
Expression
The biochemical literature indicates that Chmp2b is part of the
ESCRTIII complex that mechanically executes budding-out of
membranes. The medical and cell biology literature indicates that
normal Chmp2b is essential for formation of potentiated,
mushroom-shaped dendritic spines, rather than filipodia or
immature spines. This study indicates that Chmp2b expression is
restricted to specific populations of postmitotic, yet immature,
neurons by a pattern formation SSTF at precisely the time when
these neurons are making the first synapses of the first spinal reflex
circuit, the cutaneous disynaptic reflex. The Chmp2b protein is
being selectively moved into dendritic projections that enter the
white matter to contact either longitudinal ipsilateral axons in the
VLF or longitudinal afferent axons in the DLF.
We propose that development uses selective Chmp2b expression as a means to imbue particular populations of neurons with
the capability to potentiate immature synapses to mature dendritic
spines. This capability would only be realized in those particular
neurons that create excitatory synapses in appropriate circuits. In
this way a genetically-specified developmental program can
reproducibly control which types of newborn neurons will
contribute to the boot-up the neural network of the spinal cord
in each animal and generation without having to hard wire each
particular cell. Interestingly, the Chmp2b null mutant appears to
have a coordination phenotype [64].
Similar control by Chmp2b may exist in other areas of active
synaptogenesis that involve dendritic spines. Notably, the highest levels
of Chmp2b expression in adults are observed in regions of the
hippocampus and cerebellum that contain the Purkinje and Pyramidal
cells, respectively (Allen Brain Atlas [Internet]. Seattle (WA): Allen
Institute for Brain Science. ß2009. Available from: http://mouse.
brain-map.org.; [65]). It has not escaped our notice that the underlying
principle of limiting an essential protein component of a synapse by
gene regulatory mechanisms can be broadly applied to constrain the
types of neurons that can engage in that type of synapse at each stage of
development. In this way, developmental gene regulatory neworks can
constrain synapse-formation to particular populations of neurons
without dictating the exact outcome.
Supporting Information
Figure S1 Single Channel Images of Figure 5I and 5K.
(A,B) Red and Green channels of Panel 5I in greyscale. (C, D Red
and Green channels of Panel 5K in greyscale.)
(TIF)
Lbx1-Dependent Chmp2b Protein Expression in the DLF
Chmp2b protein expression in the dI4 and dI4LA populations
depends on Lbx1, whereas Chmp2b protein in the VLF and LF
does not. Dendrites of the dI4 and dI4LA populations therefore
contributes little to VLF or LF synpatogenesis described above.
Instead their dendrites project into the dorsomedial zone that
corresponds to the ‘‘association neuropil’’, which contains the first
synapses between primary afferent axons and dorsally projecting
dendrites of association interneurons. A detailed DiI tracing study
documents the timing of afferent innervation in mouse embryos
PLOS ONE | www.plosone.org
Figure S2 Single Channel Images for Panels C, D, G,
and H of Figure 6.
(TIF)
Figure S3 Single Channel Images and Double Labeled
Enlargements of Figure 7E.
(TIF)
15
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
Figure S4 Red Channel Image of Figure 8a, C and E in
Acknowledgments
Greyscale.
(TIF)
We would like to thank Sten Linnarsson at the Karolinska Institutet for
providing an academic home during the writing of this manuscript.
Figure S5 Close Apposition of Chmp2b with Nestin in
VLF. Nestin marks the endfeet of radial glial cells that traverse the
VLF. Chmp2b labeling was observed in close apposition to the
Nestin label, but was not colcalized.
(TIF)
Author Contributions
Conceived and designed the experiments: MKG JX. Performed the
experiments: JX MN RM HYM MKG. Analyzed the data: MKG JX CK
OH. Contributed reagents/materials/analysis tools: CK MKG. Wrote the
paper: MKG JX.
References
26. Jessell TM (2000) Neuronal specification in the spinal cord: inductive signals and
transcriptional codes. Nat Rev Genet 1: 20–29.
27. Helms AW, Johnson JE (2003) Specification of dorsal spinal cord interneurons.
Curr Opin Neurobiol 13: 42–49.
28. Caspary T, Anderson KV (2003) Patterning cell types in the dorsal spinal cord:
what the mouse mutants say. Nat Rev Neurosci 4: 289–297.
29. Kioussi C, Gross MK (2008) How to build transcriptional network models of
mammalian pattern formation. PLoS ONE 3: e2179.
30. Gross MK, Dottori M, Goulding M (2002) Lbx1 specifies somatosensory
association interneurons in the dorsal spinal cord. Neuron 34: 535–549.
31. Muller T, Brohmann H, Pierani A, Heppenstall PA, Lewin GR, et al. (2002)
The homeodomain factor lbx1 distinguishes two major programs of neuronal
differentiation in the dorsal spinal cord. Neuron 34: 551–562.
32. Gross MK, Moran-Rivard L, Velasquez T, Nakatsu MN, Jagla K, et al. (2000)
Lbx1 is required for muscle precursor migration along a lateral pathway into the
limb. Development 127: 413–424.
33. Ozaki S, Snider WD (1997) Initial trajectories of sensory axons toward laminar
targets in the developing mouse spinal cord. J Comp Neurol 380: 215–229.
34. Gowan K, Helms AW, Hunsaker TL, Collisson T, Ebert PJ, et al. (2001)
Crossinhibitory activities of Ngn1 and Math1 allow specification of distinct
dorsal interneurons. Neuron 31: 219–232.
35. Lee KJ, Mendelsohn M, Jessell TM (1998) Neuronal patterning by BMPs: a
requirement for GDF7 in the generation of a discrete class of commissural
interneurons in the mouse spinal cord. Genes Dev 12: 3394–3407.
36. Miesegaes GR, Klisch TJ, Thaller C, Ahmad KA, Atkinson RC, et al. (2009)
Identification and subclassification of new Atoh1 derived cell populations during
mouse spinal cord development. Dev Biol 327: 339–351.
37. Vaughn JE, Sims T, Nakashima M (1977) A comparison of the early
development of axodendritic and axosomatic synapses upon embryonic mouse
spinal motor neurons. J Comp Neurol 175: 79–100.
38. Vaughn JE, Henrikson CK, Chernow CR, Grieshaber JA, Wimer CC (1975)
Genetically-associated variations in the development of reflex movements and
synaptic junctions within an early reflex pathway of mouse spinal cord. J Comp
Neurol 161: 541–553.
39. Matus A, Bernhardt R, Bodmer R, Alaimo D (1986) Microtubule-associated
protein 2 and tubulin are differently distributed in the dendrites of developing
neurons. Neuroscience 17: 371–389.
40. Vaughn JE, Henrikson CK, Grieshaber JA (1974) A quantitative study of
synapses on motor neuron dendritic growth cones in developing mouse spinal
cord. J Cell Biol 60: 664–672.
41. Vaughn JE (1989) Fine structure of synaptogenesis in the vertebrate central
nervous system. Synapse 3: 255–285.
42. Henrikson CK, Vaughn JE (1974) Fine structural relationships between neurites
and radial glial processes in developing mouse spinal cord. J Neurocytol 3: 659–
675.
43. Hockfield S, McKay RD (1985) Identification of major cell classes in the
developing mammalian nervous system. J Neurosci 5: 3310–3328.
44. Bolouri H, Davidson EH (2002) Modeling DNA sequence-based cis-regulatory
gene networks. Dev Biol 246: 2–13.
45. Bolouri H, Davidson EH (2002) Modeling transcriptional regulatory networks.
Bioessays 24: 1118–1129.
46. Davidson EH, McClay DR, Hood L (2003) Regulatory gene networks and the
properties of the developmental process. Proc Natl Acad Sci U S A 100: 1475–
1480.
47. Davidson EH, Erwin DH (2006) Gene regulatory networks and the evolution of
animal body plans. Science 311: 796–800.
48. Davidson EH (2006) The Regulatory Genome. London: Academic Press. 289 p.
49. Istrail S, De-Leon SB, Davidson EH (2007) The regulatory genome and the
computer. Dev Biol 310: 187–195.
50. Wildner H, Muller T, Cho SH, Brohl D, Cepko CL, et al. (2006) dILA neurons
in the dorsal spinal cord are the product of terminal and non-terminal
asymmetric progenitor cell divisions, and require Mash1 for their development.
Development 133: 2105–2113.
51. Glasgow SM, Henke RM, Macdonald RJ, Wright CV, Johnson JE (2005) Ptf1a
determines GABAergic over glutamatergic neuronal cell fate in the spinal cord
dorsal horn. Development 132: 5461–5469.
1. Skibinski G, Parkinson NJ, Brown JM, Chakrabarti L, Lloyd SL, et al. (2005)
Mutations in the endosomal ESCRTIII-complex subunit CHMP2B in
frontotemporal dementia. Nat Genet 37: 806–808.
2. van der Zee J, Urwin H, Engelborghs S, Bruyland M, Vandenberghe R, et al.
(2008) CHMP2B C-truncating mutations in frontotemporal lobar degeneration
are associated with an aberrant endosomal phenotype in vitro. Hum Mol Genet
17: 313–322.
3. Rizzu P, van Mil SE, Anar B, Rosso SM, Kaat LD, et al. (2006) CHMP2B
mutations are not a cause of dementia in Dutch patients with familial and
sporadic frontotemporal dementia. Am J Med Genet B Neuropsychiatr Genet
141: 944–946.
4. Ferrari R, Kapogiannis D, Huey ED, Grafman J, Hardy J, et al. (2010) Novel
Missense Mutation in Charged Multivesicular Body Protein 2B in a Patient With
Frontotemporal Dementia. Alzheimer Dis Assoc Disord.
5. Ghanim M, Guillot-Noel L, Pasquier F, Jornea L, Deramecourt V, et al. (2010)
CHMP2B mutations are rare in French families with frontotemporal lobar
degeneration. J Neurol 257: 2032–2036.
6. Cox LE, Ferraiuolo L, Goodall EF, Heath PR, Higginbottom A, et al. (2010)
Mutations in CHMP2B in lower motor neuron predominant amyotrophic
lateral sclerosis (ALS). PLoS One 5: e9872.
7. Parkinson N, Ince PG, Smith MO, Highley R, Skibinski G, et al. (2006) ALS
phenotypes with mutations in CHMP2B (charged multivesicular body protein
2B). Neurology.
8. Ghazi-Noori S, Froud KE, Mizielinska S, Powell C, Smidak M, et al. (2012)
Progressive neuronal inclusion formation and axonal degeneration in CHMP2B
mutant transgenic mice. Brain 135: 819–832.
9. Piper RC, Katzmann DJ (2007) Biogenesis and function of multivesicular bodies.
Annu Rev Cell Dev Biol 23: 519–547.
10. Hurley JH, Emr SD (2006) The ESCRT complexes: structure and mechanism of
a membrane-trafficking network. Annu Rev Biophys Biomol Struct 35: 277–298.
11. Hurley JH (2008) ESCRT complexes and the biogenesis of multivesicular
bodies. Curr Opin Cell Biol 20: 4–11.
12. Raiborg C, Stenmark H (2009) The ESCRT machinery in endosomal sorting of
ubiquitylated membrane proteins. Nature 458: 445–452.
13. Nickerson DP, Russell MR, Odorizzi G (2007) A concentric circle model of
multivesicular body cargo sorting. EMBO Rep 8: 644–650.
14. Teis D, Saksena S, Emr SD (2008) Ordered assembly of the ESCRT-III
complex on endosomes is required to sequester cargo during MVB formation.
Dev Cell 15: 578–589.
15. Wollert T, Wunder C, Lippincott-Schwartz J, Hurley JH (2009) Membrane
scission by the ESCRT-III complex. Nature 458: 172–177.
16. Wollert T, Hurley JH (2010) Molecular mechanism of multivesicular body
biogenesis by ESCRT complexes. Nature 464: 864–869.
17. Hurley JH, Hanson PI (2010) Membrane budding and scission by the ESCRT
machinery: it’s all in the neck. Nat Rev Mol Cell Biol 11: 556–566.
18. Nickerson DP, West M, Henry R, Odorizzi G (2010) Regulators of Vps4
ATPase activity at endosomes differentially influence the size and rate of
formation of intralumenal vesicles. Mol Biol Cell 21: 1023–1032.
19. von Schwedler UK, Stuchell M, Muller B, Ward DM, Chung HY, et al. (2003)
The protein network of HIV budding. Cell 114: 701–713.
20. Martin-Serrano J, Yarovoy A, Perez-Caballero D, Bieniasz PD (2003) Divergent
retroviral late-budding domains recruit vacuolar protein sorting factors by using
alternative adaptor proteins. Proc Natl Acad Sci U S A 100: 12414–12419.
21. Obita T, Saksena S, Ghazi-Tabatabai S, Gill DJ, Perisic O, et al. (2007)
Structural basis for selective recognition of ESCRT-III by the AAA ATPase
Vps4. Nature 449: 735–739.
22. Stuchell-Brereton MD, Skalicky JJ, Kieffer C, Karren MA, Ghaffarian S, et al.
(2007) ESCRT-III recognition by VPS4 ATPases. Nature 449: 740–744.
23. Lee JA, Beigneux A, Ahmad ST, Young SG, Gao FB (2007) ESCRT-III
dysfunction causes autophagosome accumulation and neurodegeneration. Curr
Biol 17: 1561–1567.
24. Belly A, Bodon G, Blot B, Bouron A, Sadoul R, et al. (2010) CHMP2B mutants
linked to frontotemporal dementia impair maturation of dendritic spines. J Cell
Sci 123: 2943–2954.
25. Kioussi C, Shih HP, Loflin J, Gross MK (2006) Prediction of active nodes in the
transcriptional network of neural tube patterning. Proc Natl Acad Sci U S A
103: 18621–18626.
PLOS ONE | www.plosone.org
16
December 2012 | Volume 7 | Issue 12 | e48573
Population-Specific Chmp2b
59. Wentworth LE (1984) The development of the cervical spinal cord of the mouse
embryo. II. A Golgi analysis of sensory, commissural, and association cell
differentiation. J Comp Neurol 222: 96–115.
60. Saueressig H, Burrill J, Goulding M (1999) Engrailed-1 and netrin-1 regulate
axon pathfinding by association interneurons that project to motor neurons.
Development 126: 4201–4212.
61. Lundfald L, Restrepo CE, Butt SJ, Peng CY, Droho S, et al. (2007) Phenotype of
V2-derived interneurons and their relationship to the axon guidance molecule
EphA4 in the developing mouse spinal cord. Eur J Neurosci 26: 2989–3002.
62. Li S, Misra K, Xiang M (2010) A Cre transgenic line for studying V2 neuronal
lineages and functions in the spinal cord. Genesis 48: 667–672.
63. Vaughn JE, Sims TJ (1978) Axonal growth cones and developing axonal
collaterals form synaptic junctions in embryonic mouse spinal cord. J Neurocytol
7: 337–363.
64. Froud KE, Ghazi-Noori S, Powell C, O’Malley C, Linehan JM, et al. (2011)
Phenotypic Characterization of Chmp2b Knockout Mice. Australian Neuroscience Society Annual Meeting; Aukland, New Zealand.
65. Filimonenko M, Stuffers S, Raiborg C, Yamamoto A, Malerod L, et al. (2007)
Functional multivesicular bodies are required for autophagic clearance of
protein aggregates associated with neurodegenerative disease. J Cell Biol 179:
485–500.
52. Kriks S, Lanuza GM, Mizuguchi R, Nakafuku M, Goulding M (2005) Gsh2 is
required for the repression of Ngn1 and specification of dorsal interneuron fate
in the spinal cord. Development 132: 2991–3002.
53. Mizuguchi R, Kriks S, Cordes R, Gossler A, Ma Q, et al. (2006) Ascl1 and
Gsh1/2 control inhibitory and excitatory cell fate in spinal sensory interneurons.
Nat Neurosci 9: 770–778.
54. Cheng L, Samad OA, Xu Y, Mizuguchi R, Luo P, et al. (2005) Lbx1 and Tlx3
are opposing switches in determining GABAergic versus glutamatergic
transmitter phenotypes. Nat Neurosci 8: 1510–1515.
55. Willis WD, Coggeshall RE (2004) Sensory Mechanisms of the Spinal Cord. New
York: Plenum Press.
56. Cheng L, Arata A, Mizuguchi R, Qian Y, Karunaratne A, et al. (2004) Tlx3 and
Tlx1 are post-mitotic selector genes determining glutamatergic over GABAergic
cell fates. Nat Neurosci 7: 510–517.
57. Vaughn JE, Grieshaber JA (1973) A morphological investigation of an
early reflex pathway in developing rat spinal cord. J Comp Neurol 148:
177–209.
58. Wentworth LE (1984) The development of the cervical spinal cord of the mouse
embryo. I. A Golgi analysis of ventral root neuron differentiation. J Comp
Neurol 222: 81–95.
PLOS ONE | www.plosone.org
17
December 2012 | Volume 7 | Issue 12 | e48573