Functional analysis of the histone variant H2A.Z during
lineage commitment
Lauren E. Surface
B.S. Neurobiology, University of Washington, 2006
SUBMITTED TO THE DEPARTMENT OF BIOLOGY IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
AT THE
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
JUNE 2014
© Massachusetts Institute of Technology
All rights reserved.
Signature of Author: _________________________________________________
Lauren E Surface
Department of Biology, MIT
Certified by:________________________________________________________
Laurie A. Boyer
Associate Professor of Biology, MIT
Thesis Advisor
Accepted by:________________________________________________________
Amy E. Keating
Associate Professor of Biology, MIT
Chair, Biology Graduate Committee
2 Functional analysis of the histone variant H2A.Z during lineage
commitment
by
Lauren E. Surface
Submitted to the Department of Biology on May 23, 2014 in partial fulfillment of the
requirements for the degree of Doctor of Philosophy in Biology
ABSTRACT
The histone variant H2A.Z is essential for development, yet its function in this process has
remained enigmatic. In this thesis, we dissect the role of H2A.Z during lineage commitment. In
particular, we focused on the Polycomb-mediated mono-ubiquitylation of H2A.Z. We found that
this modification regulates the differentiation potential of mouse embryonic stem cells (mESCs).
Loss of H2A.Z ubiquitylation leads to a disrupted chromatin state and derepression of key
developmental regulators in mESCs. Furthermore, we show that H2A.Zub is a crucial
component required for regulating canonical Wnt signaling, a key pathway in early
embryogenesis. Consistent with hyperactivation of Wnt signaling, ESCs lacking H2A.Zub fail to
differentiate into neuronal lineages. Therefore, we suggest that modification of H2A.Z is crucial
for the response to stimuli.
Using quantitative proteomics, we uncovered a role for H2A.Z ubiquitylation in modulating the
protein interaction landscape of H2A.Z. H2A.Zub impacts a specific subset of protein
interactions. By investigating several of these differential interactions, we revealed a role for
H2A.Zub in regulation of DNA methylation, the deposition of repressive histone modifications,
as well as a potential connection between H2A.Zub and DNA damage. Therefore, ubiquitin may
serve as a binding platform for subsequent recruitment of chromatin-associated factors.
These data suggest a mechanism by which post-translation modification of H2A.Z can allow for
rapid changes in cell state in a context dependent manner. On a broader level, our work
contributes mechanistic insights into the essential requirement of H2A.Z across eukaryotes.
Collectively, this work sets the stage for understanding how post-translation modifications can
contribute to further specialization of H2A.Z in a context-dependent manner.
Thesis Supervisor: Laurie Boyer
Title: Associate Professor of Biology
3 4 Acknowledgments
What an experience graduate school has been. Thrilling, slogging, stimulating, depressing, and a
kick in the pants. I am so appreciative of the chance my advisor, Laurie Boyer, took on me, when
she was just starting to build her research program. I will be forever grateful to have been a part
of this adventure with her. Laurie has never wavered in her passion and creativity about science,
dedication to doing it the right way, and emails at 2am with thoughts about my research. The lab
she has built is an incredibly supportive, generous, inspiring environment, and is a testament to
the care she feels for her people.
Thanks should also be given to my committee members, Drs. Paul Chang and Phil Sharp, whose
advice and encouragement were always appreciated. I always looked forward to sharing my
latest research in our committee meetings together, and hope there are more opportunities to do
so in the future.
The people of the Boyer lab and Saeij lab, too many to name, too vital to leave out. It has been a
pleasure. To Sera and Lilly, the beginning blonde trio, for forging ahead with (or behind) the
lady in charge. Thank goodness for Emily, Lindsay and Joe, who brought spunkiness,
enthusiasm and friendship to the many long days and nights spent in 68. The incomparable
Vidya, a better baymate and friend, a gal could never find. By her example, I continue learning
how to be a better scientist, but more importantly, a better person.
As always, a support network of caring, loving friends has been vital. Though our paths have
diverged, I must thank Blair for growing and adventuring with me, and for food more delicious
than any graduate student has the right to eat. In addition, who knew that graduate school would
foster such deep, caring friendships? I can only thank the MIT biology program for bringing
together such dynamic, interesting people. My classmates are challenging, hilarious, motivating
and a joy to spend time with. I hope our connections only grow in the years to come.
Yarden, Yarden. How lucky I have been. Such a delight of humor, goodness, and curiosity. What
a continual source of inspiration and motivation. The wonders the 68 library can bring are many.
Most of all, this experience has been possible because of my family, both related and not, in the
beautiful state of Washington. My parents never thought of pressuring my sister and I to follow a
predetermined path, and instead showed us we were loved, important, smart individuals who
could choose our own destiny. They instilled into us that a job should be more than a job; it
should be a love and a passion. Their sense of adventure, joy, and deep integrity continue to
provide an example of how a life should be lived. I hope they realize how very much they mean
to me.
This thesis is dedicated to them, and my beautiful, clever sister, Suzanne, who was only just
beginning to pursue her dreams.
5 6 Table of Contents
1.
Introduction
1.1
1.2
1.3
1.4
1.5
2.
9
Significance ………………………………………………………………9
Early mammalian development and embryonic stem cells ……………...10
Chromatin regulates gene expression patterns…………………………...14
The role of the histone variant H2A.Z in lineage commitment………......26
References………….………………………………………………….....32
H2A.Z mono-ubiquitylation regulates canonical WNT signaling and
neural differentiation
53
2.1 Introduction………….…………………………………………………….55
2.2 Results………….………………………………………………………….57
2.3 Discussion….……………………………………………………………...70
2.4 Experimental Procedures………………………………………………….72
2.5 Supplementary Figures.…………………………………………………...80
2.6 References..………….…………………………………………………….85
3.
Ubiquitylation mediates the protein interaction landscape of H2A.Z 93
3.1
3.2
3.3
3.4
3.5
4.
Introduction………….…………………………………………………….95
Results and Discussion…………………………………………………….96
Concluding Remarks......…………………………………………………106
Experimental Procedures.......………………………………………….....106
References...………………………………………………………….......109
Conclusions and Future Directions
115
4.1 Summary and Significance……………………………………………….115
4.2 Future Directions…………………………………………………………116
4.3 Concluding Remarks……………………………………………………..121
4.4 References………………………………………………………………..121
7 8 Chapter 1
Introduction
1.1 Significance
Understanding how a fertilized egg specifies the diverse cell types that comprise the adult
organism remains a fundamental question in biology. This process requires precise temporal and
spatial coordination of gene expression programs that drive lineage specification and tissue
morphogenesis. In particular, substantial changes in cell state must accompany the transition
from the pluripotent state associated with the inner cell mass of the developing blastocyst to the
committed state during gastrulation. Investigating transcriptional mechanisms that control early
mammalian development has been greatly facilitated by the derivation of embryonic stem cells
(ESCs) from the ICM, and their ability to both self-renew and to recapitulate pluripotency.
Studies in ESCs have uncovered many of the key processes that regulate this transition,
including the role of signaling pathways, cell-type specific transcription factors, and more
recently, chromatin structure.
Emerging evidence has highlighted the significance of chromatin regulation during lineage
commitment. Establishing proper chromatin structure allows the genome of pluripotent cells to
respond appropriately to developmental signals and to modify transcriptional outputs. Alterations
in chromatin structure and the pathways that regulate it can have deleterious developmental
consequences or can lead to disease. While it is clear that dramatic changes in the chromatin
landscape accompany changes in gene expression during lineage commitment, the factors that
9 Chapter 1 | Introduction coordinate this process are poorly understood. Thus, determining the molecular mechanism by
which cells are able to rapidly respond to differentiation cues is crucial for understanding
development as well as disease, and may lead to an enhanced ability to exploit ESCs for a
number of exciting applications, including disease modeling, personalized diagnostics and
regenerative therapies.
The work presented in this thesis focuses on the role of the essential histone variant H2A.Z in
lineage commitment. While H2A.Z is critical for mediating the switch from pluripotency to
differentiation, how it regulates this transition is not understood. H2A.Z has been implicated in a
number of seemingly diverse and sometimes contrasting regulatory functions (see section 1.4),
however, its role in mediating developmental decisions was unclear. Our results suggest that
post-translational modification of H2A.Z modulates its function in regulating developmental
gene expression patterns in response to signaling cues in ESCs. In particular, we show that
Polycomb Repressive Complex 1 (PRC1)-mediated mono-ubiquitylation of H2A.Z is critical for
the appropriate regulation of signaling pathways that regulate differentiation.
1.2 Early mammalian development and embryonic stem cells as a model system
The generation of organs and tissues with distinct morphologies and functions is a highly
coordinated process. A seemingly uniform ball of cells must ultimately become hundreds of
distinct cell types in the adult organism. Post-fertilization, the embryo undergoes a series of
cleavage cell divisions where the cells maintain totipotency. The first overt differentiation occurs
upon cavitation in day ~E3-3.5 to produce the blastocyst, when a layer of trophectodermal cells,
which give rise to extraembryonic tissues, envelope a fluid-filled cavity containing the
pluripotent cells of the inner cell mass (ICM) (Figure 1.1). The pluripotent cells of the ICM
eventually give rise to all the somatic tissues and germ cells that comprise the developing
organism, but have not yet committed to any particular lineage. By E4.5, separation between the
trophectoderm, epiblast and primitive endoderm has occurred, implantation is initiated and the
process of cell specialization begins. A dramatic migration and reorganization accompanies
gastrulation at ~E6.5, where a subset of epiblast cells migrate to form the primitive streak which
goes on to generate the mesoderm and endoderm lineages in the early egg cylinder. Cells that
remain in the epiblast layer constitute the neuroectoderm germ layer, and produce neural and
10 Chapter 1 | Introduction epidermal tissues (reviewed in (Arnold and Robertson, 2009; Saiz and Plusa, 2013; SolnicaKrezel and Sepich, 2012; Tam and Loebel, 2007)). Remarkably, the lineage patterning and
tissues generated during this process are established from a common blueprint that serves as the
foundation for all of development.
A key question then is how does a pluripotent cell become a particular differentiated cell type?
Lineage commitment is initiated by several coordinated mechanisms that converge to regulate
gene expression patterns, including signaling pathways, chromatin regulators, and cell-type
specific transcription factors. While we have gained an understanding of these circuits through
the use of model organisms, including transgenic mouse models, studies using embryonic stem
cells (ESCs) have allowed investigators to take a systems level approach to dissecting the
molecular mechanisms that govern cell fate transitions during mammalian development.
Understanding how cells regulate lineage decisions in ESCs is a crucial step for identifying the
key control points that mediate this process.
ESCs are isolated from the ICM of the developing blastocyst and can be cultured in a dish. These
cells have the capacity for unlimited self-renewal while maintaining their pluripotent potential
(Figure 1.1). ESCs are thought to recapitulate the properties of the ICM and can be induced to
differentiate into a large number of defined cell types that display highly similar features
compared to their in vivo counterparts as discussed below. Moreover, ESCs are amenable to
genetic manipulation making them an ideal in vitro system to investigate the factors that control
both self-renewal and differentiation into a fully committed cell type ((Wamstad et al., 2012), for
example). By genetic manipulation of ESCs and subsequent injection into a recipient blastocyst,
transgenic mouse models can also be generated to functionally test these regulatory components
in vivo.
In culture, ESCs can be induced to generate hundreds of differentiated cell types (Murry and
Keller, 2008), both enabling the unlimited production of uniform, defined cell populations, and
allowing for the study of this process. For example, dissecting the transcriptional mechanisms
that regulate the ESC state has led to the discovery of a core transcriptional regulatory circuitry
of pluripotency(Boyer et al., 2005; Loh et al., 2006; 2007; Thomson et al., 2011), which includes
11 Chapter 1 | Introduction a small number of key transcription factors, including Oct4, Sox2 and Nanog. ESCs can undergo
undirected differentiation into all three germ layers by allowing these cells to aggregate into
embryoid bodies in the absence of the pluripotency growth factor leukemia inhibitory factor
(LIF) (Martin, 1980). Alternatively, ESCs can be directed to differentiate specifically into a
particular cell type by the addition of cocktails cytokines and growth factors to cultures (Li et al.,
2013; Murry and Keller, 2008). These properties make it possible to use ESCs as a model to
dissect the roles of a diverse set of factors that direct cell fate.
12 Chapter 1 | Introduction Signaling pathways converge onto transcriptional networks to direct cell type specification. The
signaling networks that control ESC state largely recapitulate those that drive early
embryogenesis (Arnold and Robertson, 2009; Pera and Tam, 2010; Tam and Loebel, 2007), and
include a broad range of pathways such at TGFβ/Nodal, BMP, MEK/ERK, LIF and WNT.
Transcription factors associated with these signaling networks (such as Stat3, Tcf3, Smad1) often
co-occupy sites bound by the core ESC transcription factors (Chen et al., 2008; Cole et al., 2008;
Tam et al., 2008). Thus, modulation of these signaling pathways can have dramatic
consequences on pluripotency and differentiation. For example, Wnt signaling appears to affect
both maintenance of the pluripotent state and proper lineage commitment (Merrill, 2012; Wray
and Hartmann, 2012). For pluripotent cells, addition of a Wnt activator is a vital component of
chemically defined ESC media (Berge et al., 2011; Ying et al., 2008); while addition of Wnt
factors to differentiating ESCs biases these cells toward mesoderm differentiation. Conversely,
Wnt antagonists lead to neuroectoderm differentiation(Berge et al., 2008). Thus, similar to the
developing embryo, the precise regulation of signaling networks is a fundamental aspect of ESC
biology.
The ability to rapidly execute a broad range of differentiation programs in response to cues is a
key feature of pluripotency. In order the preserve this capacity, ESCs are thought to maintain an
accessible, hyperdynamic, ‘open’ chromatin state (Ahmed et al., 2010; Gaspar-Maia et al., 2011;
Meshorer and Misteli, 2006). ESCs express genes responsible for basic cellular functions and
promotion of pluripotency, while maintaining lineage specific genes in a repressed, responsive
state, ready to be activated upon differentiation cues. The mechanisms that regulate this poised
chromatin state are becoming increasingly understood, and will be discussed further in this
chapter. Recent large-scale profiling efforts in ESCs have revealed strong correlations between
chromatin state and gene expression (de Wit et al., 2013; Gifford et al., 2013; Mikkelsen et al.,
2007; Smith et al., 2012; Wamstad et al., 2012) and have begun to elucidate the connections
between signaling networks, chromatin state and transcriptional output. The research presented
in this dissertation aims to provide novel insights into how this complex regulation is
accomplished. My work focuses particular attention on the role of the histone variant H2A.Z in
13 Chapter 1 | Introduction establishing chromatin states in ESCs that set the stage for cell fate transitions and
responsiveness to developmental cues.
1.3 Chromatin regulates gene expression patterns
The ability to precisely regulate the activation and silencing of subsets of genes allows a cell to
sense and respond to its environment. Transcriptional regulation is accomplished by complex
interactions between elements of the genome and regulatory factors, and by modulating the
recruitment and processivity of RNA polymerase. Sequence-specific transcription factors have a
major, well-studied role in the regulation of cell type-specific gene expression patterns (Fuda et
al., 2009; Lee and Young, 2013; Liu et al., 2013; Zaret and Carroll, 2011). Evidence over the last
decade has also established a fundamental role for chromatin in regulating transcriptional
programs. This section will focus on several mechanisms by which chromatin regulates
transcription, with an emphasis on the impact of chromatin on the ESC state.
‘Chromatin’ first coined by Flemming in the 1880’s, was identified based on its unique
histological staining pattern within the nucleus. Though identification of acid-extractable
histones soon followed (Kossel, 1884), it was unclear how they contributed to chromatin and for
many decades much about the structure and function of chromatin remained unknown. Early 20th
century studies proposed that differentially stained regions of chromatin, coined
‘heterochromatin’ and ‘euchromatin’ have differential genic activity (Heitz, 1928; 1929).
However, it took nearly half a century for the fundamental building block of chromatin, the
nucleosome, to be described (Kornberg, 1974; Olins and Olins, 1974; Oudet et al., 1975). The
nucleosome is composed of ~147 base pairs of DNA wrapped 1.7 turns around a core histone
octamer (Jorcano and Ruiz-Carrillo, 1979; Luger et al., 1997). Canonically, the histone octamer
is composed of an H3-H4 tetramer bound on either side by an H2A-H2B dimer. The core
histones interact with each other through a highly conserved three-helix histone-fold domain
(Arents and Moudrianakis, 1995; Arents et al., 1991; Luger et al., 1997). Once assembled into
nucleosomes, the amino- and carboxy-terminal tails of core histones form flexible projections,
which are subject to a myriad of post-translational modifications (Campos and Reinberg, 2009;
Zhou et al., 2011). Further higher-order compaction of these nucleosomes through interactions
with each other and other structural entities enables the packaging of DNA into the nucleus.
14 Chapter 1 | Introduction Once thought to be purely structural, chromatin has emerged as a key mechanism to delineate
functional units of the genome and to modulate gene expression.
Early studies suggested that chromatin may contribute to differences in cell types by activation
or silencing of subsets of genes (Allfrey et al., 1964; Huang and Bonner, 1962; Weintraub and
Groudine, 1976), but the diverse mechanisms that regulation chromatin structure would have
likely surprised even these prescient researchers. Because nucleosomes are a major barrier to the
transcriptional machinery, the distribution of nucleosomes along the DNA has important
consequences on gene expression. For example, regions of the genome with tightly compacted
nucleosomes- Heitz’s more densely stained ‘heterochromatin’- are less transcriptionally active
than less compacted ‘euchromatin’ (Trojer and Reinberg, 2007). Regulation of nucleosomal
distribution and DNA accessibility is facilitated by chromatin remodeling enzymes (Cairns,
2009; Ho and Crabtree, 2010). Functional demarcation of chromatin can also by achieved by
post-translational modification of histones, incorporation of histone variants, and chemical
modification of the DNA itself (Campos and Reinberg, 2009; Koh and Rao, 2013; Li et al., 2007;
Rando and Chang, 2009). Coordinated regulation of these various epigenetic mechanisms is
critical for the establishment and maintenance of cell identity, and their faulty regulation can
have dramatic consequences on development.
As discussed above, ESCs represent a pluripotent state of development, and as such these cells
maintain an open, accessible chromatin environment (Gaspar-Maia et al., 2011; Mattout and
Meshorer, 2010). This dynamic, plastic state enables rapid activation of lineage specific gene
expression programs. Determining how the chromatin environment of ESCs sets the foundation
for all developmental decisions is a fundamental question in biology. While the following
sections will examine the role of a variety of chromatin regulations in controlling gene
expression with a focus on ESCs, many of the principles discussed were first elucidated in
simple eukaryotes such as Saccharomyces cerevisiae.
Nucleosomal accessibility and chromatin remodeling
Nucleosomes are generally refractory to transcription, and a nucleosome positioned over a
promoter can occlude the binding of RNA Polymerase II (RNAPII). In order for the
15 Chapter 1 | Introduction transcriptional machinery to access appropriate sites of the genome, the structure of chromatin
must be amenable. Many functional regions of the genome, such as enhancers and promoters, are
depleted of nucleosomes (Struhl and Segal, 2013), and assembly of basal transcription factors
and recruitment of RNA polymerase requires a region depleted of nucleosomes (Workman and
Kingston, 1998). Nucleosomal positioning is both DNA sequence dependent and dependent on
the action of ATP-dependent chromatin remodelers. Therefore, the differential association of
transcriptional machinery at particular gene promoters depends, in part, on the activity of
chromatin remodelers.
ATP-dependent chromatin remodeling enzymes utilize the energy of ATP hydrolysis to alter the
contacts between histone and DNA. These enzymes catalyze the ‘sliding’ of nucleosomes along
the DNA, disrupt higher-order compaction, and promote the exchange, incorporation and
eviction of histones in and out of chromatin (Narlikar et al., 2013; Peterson and Almouzni, 2013).
These functions serve to rapidly establish and rearrange chromatin environments, making the
genome more or less accessible for DNA-mediated processes, including transcription, DNA
damage repair, transposon silencing, and DNA replication.
Transcription is a multi-step and highly regulated process that involves the recruitment of
transcription factors to regulatory sequences at promoters and enhancers and ultimately to
RNAPII occupancy. Transcription factors can recruit chromatin regulators, which often lack
sequence-specific binding properties, including histone-modifiers and chromatin remodeling
complexes, to catalyze changes in chromatin structure. An open chromatin structure promotes
the binding of Mediator and general transcription factors, and subsequent recruitment of RNAPII
(Fuda et al., 2009; Li et al., 2007). The transcription start site is often encompassed by highlypositioned nucleosomes (Gkikopoulos et al., 2011; Yen et al., 2013). Once RNAPII is engaged
and transcription is initiated, promoter nucleosomes must be disrupted to allow for subsequent
elongation, which can be accomplished by the ATP-dependent activity of the RSC complex
(Carey et al., 2006), and the removal of H2A-H2B dimers from nucleosomes by the histone
chaperone FACT (Belotserkovskaya et al., 2003; Orphanides et al., 1998). Thus, efficient
transcription from a chromatinized template is dependent on the combined action of multiple
factors.
16 Chapter 1 | Introduction As ESCs are primed to respond to differentiation cues, the activity of chromatin remodeling
enzymes is thought to both help maintain the open, dynamic chromatin state of ESCs, and
restructure it upon differentiation. Indeed, mutations in chromatin remodeling components result
in a variety of phenotypes, including early embryonic lethality in mice, emphasizing their roles
in mediating cell fate transitions. For example, the ATPase CHD1, a member of the Swi/Snf
family, associates with the core pluripotency network of Oct4/Sox2/Nanog, and works to prevent
the aberrant accumulation of heterochromatin (Gaspar-Maia et al., 2009). In contrast, loss of the
NuRD chromatin remodeling complex component, Mbd3, results in upregulation of pluripotency
markers and robust ESC self-renewal independent of the pluripotency-promoting growth factor
LIF (Kaji et al., 2006; Reynolds et al., 2012). These results and others(Gaspar-Maia et al., 2011)
suggest that the dynamic equilibrium between gene activation and repression in ESCs must be
maintained by the activity of chromatin remodelers. The subsequent commitment to a particular
lineage requires the silencing of alternate lineages, through the formation of a more inaccessible
chromatin state termed facultative heterochromatin(Hargreaves and Crabtree, 2011; Ho and
Crabtree, 2010; Mattout and Meshorer, 2010; Meshorer and Misteli, 2006). Understanding the
mechanisms that translate developmental signaling cues into chromatin remodeling activity will
lend critical insights into how the cell makes specific developmental decisions.
Post-translational modifications of histones
The post-translational modification of histones is a key mechanism used to demarcate chromatin
domains. The most widely studied modifications occur on histone tails, unstructured regions that
are rich in basic residues. Histone post-translational modifications can cause structural changes
to the intrinsic properties of the nucleosome including DNA-histone binding and mobility or
altering inter-nucleosomal contacts and higher-order structure. Modifications can also act as
binding platforms, serving to assist or block the recruitment of effector proteins to the chromatin.
Whether the combination of post-translational modifications constitutes an instruction manuallike ‘histone code’ remains under debate (Henikoff and Shilatifard, 2011; Jenuwein and Allis,
2001; Kouzarides, 2007; Strahl and Allis, 2000); however, it is clear that the histone
modification landscape can reflect cell state.
17 Chapter 1 | Introduction Early studies demonstrated that although nucleosomes are inhibitory to transcription,
nucleosome acetylation correlated with gene activity (ALLFREY et al., 1964; Luger et al., 1997).
Subsequently, it was determined that modification of particular lysines was required for both the
repression and activation of gene expression in vivo (Durrin et al., 1991; Han and Grunstein,
1988; Han et al., 1988; Kayne et al., 1988). The landmark discovery that the homolog of the
yeast transcriptional activator, Gcn5, was a histone acetyltransferase (HAT), demonstrated the
importance of chromatin-modifying enzymes in regulating transcriptional activity (Brownell et
al., 1996). Characterization and description of many more histone-modifying complexes and
their associated modifications followed, with over 100 (and increasing) distinct histone
modifications now cataloged including acetylation, methylation, ubiquitylation, phosphorylation,
ADP-ribosylation, and SUMOlyation, among others (Tan et al., 2011).
Recent advances in genome wide methods have allowed for genome wide profiling of the
chromatin landscape in diverse cell types by using chromatin immunoprecipitation coupled with
high-throughput sequencing (ChIP-Seq). This work has revealed correlations between histone
modification patterns and gene activity (Ernst et al., 2011; Shen et al., 2012; Wamstad et al.,
2012). These studies provided insights into the chromatin state associated with distinct
regulatory elements of the genome. For example, transcriptionally active promoters display
H3K4me31 enriched nucleosomes catalyzed by the MLL/Trithrorax complex (Bernstein et al.,
2005), whereas transcriptionally repressed promoters additionally harbor H3K27me3, a
modification catalyzed by Polycomb Repressive Complex 2 (PRC2) (Bernstein et al., 2006;
Boyer et al., 2006). Notably, active enhancers, non-coding DNA regulatory elements, often
display H3K27Ac enrichment in conjunction with H3K4me1 (Creyghton et al., 2010; RadaIglesias et al., 2011; Wamstad et al., 2012). Studies that profiled the enrichment patterns of seven
histone modifications in 29 cell types, including pluripotent cells, showed that the chromatin
landscape is highly representative of cell identity and becomes more restrictive as cells
differentiate (Zhu et al., 2013). Together, these studies demonstrate that combinations of histone
modifications can be used to classify distinct regulatory regions, and that these modules are often
1
Histone post-translation nomenclature generally follows the pattern of: 1. Histone modified, in this instance: H3,
2.Amino acid and position, so lysine in the 4th position: K4, 3. Modification and how many of them on the same
amino acids, 3 methyl groups in one lysine: me3
18 Chapter 1 | Introduction conserved among cell types and organisms. Thus, the following section examines several key
histone modifications, particularly focusing on their roles in differentiation.
Histone acetylation is often associated with accessible chromatin and active transcription, while
regions of heterochromatin are depleted of acetylation. Histone acetylation is thought to affect
both histone-DNA and histone-histone interactions which can affect local chromatin structure
(Hong et al., 1993; Shogren-Knaak et al., 2006). Histone acetylation can also mediate
recruitment of other chromatin-binding factors. For example, bromodomain-containing proteins
specifically recognize acetylated lysines (needs reference). Consistent with a function in open
chromatin, histone acetylation is highly enriched in ESCs compared to differentiated cells
(Efroni et al., 2008; Meshorer et al., 2006), and inhibition of histone deacetylation promotes
maintenance of hyper-dynamic chromatin and an undifferentiated state (Melcer et al., 2012;
Ware et al., 2009). These studies further demonstrate that chromatin structure has functional
consequences on cell state.
Histone methylation can occur as mono-, di-, or tri-methylation on lysines and mono- or
symmetric/asymmetric di-methylation on arginines, and is associated with both transcriptional
activation and silencing. As such, histone methylation patterns can be quite diverse and can have
distinct impacts on gene expression and cell state. For example, actively transcribed genes are
generally characterized by H3K4me3 enrichment at promoter regions and by increasing
H3K36me3 over their gene bodies. Notably, promoters of silent genes in ESCs are enriched for
Polycomb complex-mediated H3K27me3 as well as H3K4me3, which are termed bivalent
domains (discussed below). Additionally, regions of silenced heterochromatin can be enriched
with H3K9me2/3 and H4K20me3, and upon ESC differentiation these regions become more
densely methylated (Hawkins et al., 2010; Wen et al., 2009). Loss of H3K9 demethylases leads
to differentiation of ESCs (Loh et al., 2007), suggesting that preventing heterochromatin
formation functionally contributes to maintenance of pluripotency. These studies demonstrate the
complexity of histone modification patterns and the need for further investigations to understand
how these modifications coordinate with other regulatory pathways to promote lineage
commitment and to maintain cell fate.
19 Chapter 1 | Introduction Bivalent domains and Polycomb-mediated repression
ESCs have the capacity to differentiate into all cell types of the adult and thus are thought to
have tremendous plasticity. While actively transcribed genes in ESCs are marked by H3K4me3,
silent promoters have a chromatin structure enriched with both activating and repressive
chromatin modifications (Figure 1.2A). These so-called ‘bivalent domains’ are characterized by
peaks of H3K4me3 enrichment, overlapping with broader domains of the PRC2-mediated
H3K27me3 modification (Azuara et al., 2006; Bernstein et al., 2006; Mikkelsen et al., 2007; Pan
et al., 2007; Zhao et al., 2007). Bivalent genes comprise a large cohort of developmental and
signaling regulators in ESCs, such as the Hox clusters, as well as members of the Dlx, Fox, Irx,
Lhx, Pou, Pax, Sox, Tbx, and Wnt gene families (Boyer et al., 2006; Ku et al., 2008; Lee et al.,
2006). These genes represent key drivers of lineage commitment programs that need to be
rapidly turned on upon the cue to differentiate. Studies of the ICM of mouse pre-implantation
embryos and early zebrafish embryos have also found co-enrichment of H3K4me3 and
H3K27me3, suggesting that establishment of bivalent domains is critical for early development
in a number of species and not an artifact of cell culture (Dahl et al., 2010; Vastenhouw et al.,
2010). Furthermore, recent mass-spectrometry based studies have demonstrated that bivalency is
not a consequence of a mixed population of cells, but that bivalent, H3K27me3+ nucleosomes
make up ~15% of H3K4me3+ nucleosomes in ESCs, with opposing modifications present on
opposite H3 tails of the same nucleosome(Voigt et al., 2012). Determining how these bivalent
genes are repressed, but poised for activation will be key to understanding control of
developmental gene expression programs.
Polycomb-mediated repression is catalyzed by two functionally distinct Polycomb Repressive
Complexes (PRCs), namely PRC1 and PCR2. The composition of these complexes can vary in
different cell types and among organisms; however, their core components are conserved
between Drosophila and mammals (Gao et al., 2012; Kerppola, 2009; Levine et al., 2004;
Schuettengruber et al., 2007; Tavares et al., 2012). While Polycomb complexes are functionally
distinct, both PRC1 and PRC2 modify chromatin structure by covalent modification of histone
proteins (Müller and Verrijzer, 2009; Schuettengruber and Cavalli, 2009; Simon and Kingston,
2009). PRC2 (comprising core proteins Ezh2, Eed, and Suz12) catalyzes di- and tri- methylation
of lysine 27 on histone H3 (H3K27me2/3), a modification associated with transcriptional
20 Chapter 1 | Introduction repression(Cao and Zhang, 2004; Cao et al., 2002; Czermin et al., 2002; Kuzmichev et al., 2002;
2004), while PRC1 (comprised of core protein families Bmi1, Ring1, Cbx, Phc) monoubiquitylates histone H2A on lysine 119 (H2AK119Ub) (de Napoles et al., 2004; Wang et al.,
2004). Biochemical and genetic studies also support the idea that PcG-mediated repression
requires both catalytic and non-catalytic activities (Endoh et al., 2012; Eskeland et al., 2010).
Loss of PRC2 activity results in embryonic lethality in mice (Faust et al., 1998; 1995; O'Carroll
et al., 2001; Pasini et al., 2004), and the PRC1 component Ring1b, an E3 ubiquitin ligase, is
essential for gastrulation during mouse development and ESC differentiation (de Napoles et al.,
2004; Leeb and Wutz, 2007; Van Der Stoop et al., 2008; Voncken et al., 2003). Notably, ESCs
are able to self-renew and maintain the expression of key pluripotency genes in the absence of
PcG proteins (Chamberlain et al., 2008; Pasini et al., 2007; Shen et al., 2008; Van Der Stoop et
al., 2008). Rather, PRC2-deficient ESCs, as well as those lacking Ring1b or Fbxl10 (a PRC1
component), fail to properly maintain the repression of lineage-specific genes (Boyer et al.,
2006; Chamberlain et al., 2008; He et al., 2013; Leeb and Wutz, 2007; Leeb et al., 2010; Pasini
et al., 2007; Wu et al., 2013) and loss of components of both PRC1 and PRC2 leads to
inappropriate ESC differentiation(Leeb et al., 2010). Thus, repression by Polycomb group
proteins is necessary for precise regulation of developmental programs.
During differentiation, bivalent domains are generally resolved into either H3K27me3 or
H3K4me3 regions, depending on the expression state of the associated gene in that cell (Figure
1.2B). The binding of PcG proteins in ESCs – and thus catalysis of H3K27me3 and H2Aub –
may facilitate the subsequent repression of a particular set of genes during differentiation
through recruitment of a more stable silencing mechanism, such as DNA methylation
(Schuettengruber et al., 2007; Simon and Kingston, 2009). Indeed, promoters associated with
H3K27me3 in ESCs are more likely to become DNA methylated during differentiation
(Meissner et al., 2008; Mohn et al., 2008). This transition to a more permanently repressed state
is likely facilitated by a class of histone demethylases that selectively remove H3K4me3(Cloos
et al., 2008; Lan et al., 2008). Conversely, H3K27me2/me3 demethylases such as Jmjd3 and Utx
are necessary for proper differentiation and are targeted to bivalent developmental regulators
upon ESC differentiation (Agger et al., 2007; Chen et al., 2012; Hong et al., 2007; Jiang et al.,
2013; Kim et al., 2011; Lan et al., 2007; Lee et al., 2007; Ohtani et al., 2013; Swigut and
21 Chapter 1 | Introduction Wysocka, 2007; Xiang et al., 2007), suggesting they counteract Polycomb-mediated gene
silencing during activation of lineage specific genes.
Given the role of PRC1 in catalyzing H2Aub, specific histone deubiquitylases (DUBs) may also
have roles in PcG-mediated gene regulation during differentiation. In support of this idea, a
distinct Drosophila Polycomb repressive complex, PR-DUB, comprising the deubiquitinase
Bap1/Calypso and the co-factor Additional sex combs (Asx), possesses histone H2A deubiquitylase activity and regulates Hox gene expression(Scheuermann et al., 2010). Asx
homologs exist in mammals (Fisher et al., 2006), and several of these factors are required for
gene activation in various settings, including USP22 in response to androgen signaling (Zhao et
22 Chapter 1 | Introduction al., 2008), and hematopoiesis (Nijnik et al., 2011). The identification of H2A DUBs with specific
roles in counteracting PcG-mediated silencing during ESC differentiation is expected to reveal
another layer of regulation important for maintaining the balance between self-renewal and
lineage commitment. Ultimately, identifying the downstream effectors of both PRC2-mediated
H3K27me3 and PRC1-mediated H2AK119Ub, as well as elucidating how these modifications
crosstalk in ESCs, will be necessary to fully understand how PcG proteins function in stem cell
differentiation.
The role of bivalent chromatin structure in safe-guarding pluripotency remains under
investigation, though several hypotheses exist. In ESCs, bivalent promoters harbor paused
RNAPII, though GRO-Seq (a method that maps transcripts generated from transcriptionally
engaged polymerase in nuclear run-on assays) based studies suggest the RNAPII levels are much
reduced compared to active genes (Min et al., 2011). Paused, bivalent genes experience
transcription initiation, and yet show little evidence of elongation (Guenther et al., 2007),
consistent with the earlier finding that PcG proteins do not prevent the binding of RNAPII to
promoters in Drosophila (Dellino et al., 2004). Prior work suggested Ring1b-mediated H2A
ubiquitylation prevents productive elongation by RNA Polymerase II at bivalent promoters
(Brookes et al., 2012; Stock et al., 2007). However, it should be noted that loss of Ring1b also
alters PRC1 integrity, so it is possible that this observation is not a direct consequence of loss of
H2AK119Ub in ESCs. Furthermore, in vitro experiments suggest that PRC1 and H2Aub inhibits
MLL-mediated methylation of H3K4, and RNAPII initiation (Nakagawa et al., 2008). Studies in
ESCs also demonstrate that Ring1b/a ubiquitin ligase activity is required to suppress H3K4
methylation and pre-initiation complex formation (Endoh et al., 2012; Lehmann et al., 2012; Min
et al., 2011). Intriguingly, recent work has shown that the H3K27me3 demethylase activity
associated with Jmjd3 promotes transcriptional elongation (Chen et al., 2012; Estarás et al.,
2013). Altogether, these studies establish the importance of balancing repression and activation
for the transcriptional fine-tuning of developmental regulators in ESCs.
Histone variants
Though histone modifications have received much of the attention, the incorporation of histone
variants adds a fundamental layer of complexity onto the chromatin landscape. Replacement of
23 Chapter 1 | Introduction core histones with histone variants allows additional functionality to be encoded into the
chromatin, as they can impact nucleosomal structure, stability, and interactions.
Core histones (H2A, H2B, H3 and H4) are essential in all eukaryotes. In metazoans, histones
lack introns and are encoded by multiple genes often found clustered in the genome. Their
synthesis and deposition into the genome occurs during DNA synthesis in a highly regulated
manner (Marzluff et al., 2008). In metazoans, instead of a poly(A) tail, canonical histones harbor
a highly conserved stem-loop in their 3’UTR that is subject to a cascade of regulation, resulting
in the S-phase enrichment of histone mRNAs. Histone variants, in contrast, are usually (though
not always) encoded by a single gene, found outside core histone clusters, contain introns, and
their transcripts harbor a poly(A) tail. Histone variants are consequently produced throughout the
cell cycle and incorporated into specific places in the genome. Because histone variants exert
differential effects on the chromatin landscape, their deposition and removal is generally highly
specific. Indeed, many variants have dedicated deposition complexes and chaperones controlling
this process, distinct from those responsible for canonical histone incorporation (Filipescu et al.,
2013; Morrison and Shen, 2009; Watanabe and Peterson, 2010). While core histones provide
structure and compaction of the genome, histone variants have specialized functions involving a
number of DNA mediated processes.
While H2A and H3 have several specialized variants, fewer variants of H2B and H4 exist. When
examining the structure of the nucleosome, this constraint may make sense, as contacts between
H4 and H2B mediate interactions between the H3-H4 tetramer with H2A-H2B dimers(Luger et
al., 1997), which is required for core nucleosomal assembly. The H2A family has the largest
number of variants. This may be due to its long C-terminal tail which could specify functionality,
or because H2A-H2B dimers can be evicted during RNAPII transcription (Baer and Rhodes,
1983). Thus, dimers may be subject to additional regulation to allow control of transcriptional
output (Pusarla and Bhargava, 2005). Thus, incorporation of histone variants likely have a
significant impact on chromatin structure and function.
Histone variants can impact chromatin structure in a number of ways. Though several cladespecific histone variants exist, including macroH2A, a vertebrate innovation enriched at the
24 Chapter 1 | Introduction inactive X, and many testes-specific variants (Moosmann et al., 2011); a handful of histone
variants are found nearly universally, suggesting they are vital to eukaryotic cell function (Malik
and Henikoff, 2003). For example, the H3 variant CenH3 is critical for the assembly of
centromeres. Incorporation of CenH3 regulates the site of centromere formation, as mis-targeting
of CenH3 into euchromatin can recruit centromeric components. However, CenH3 alone is not
sufficient for full kinetochore assembly (Van Hooser et al., 2001), indicating the requirement for
additional regulation. More recent findings have demonstrated that centromeric targeting of
CenH3 is due to the activity of specific chaperone proteins (Dunleavy et al., 2009; Foltz et al.,
2009), and activity of the HJURP CenH3 chaperone is sufficient for de novo kinetochore
formation(Barnhart et al., 2011). Furthermore, CenH3 is essential in all organisms tested
(Stellfox et al., 2013), demonstrating the vital importance of understanding this histone variant.
Another histone H3 variant, termed H3.3, is highly conserved and found universally in
eukaryotes at specific regulatory regions, and its incorporation is often associated with active
transcription. Though H3.3 differs from canonical, replication-dependent H3.1 and H3.2 by only
four to five amino acids, it is associated with distinct cellular processes and is required for proper
development (Couldrey et al., 1999). Canonical histone assembly into nucleosomes occurs
primarily during replication, yet upon transcription, nucleosomes can be displaced. To replace
these evicted histones, H3.3-containing tetramers can be incorporated and are found associated
with regions of active transcription (Ahmad and Henikoff, 2002; Schwartz and Ahmad, 2005).
Converting the divergent residues of H3.3 back into those of H3.1/2 disrupts this localization,
demonstrating that distribution of H3.3 is a consequence of replication-independent synthesis,
and that a small sequence change greatly impacts function. Furthermore, H3.3 is subject to posttranslational modifications associated with transcriptional activation, such as H3K4me3,
H3K36me2, and H3K79me2, and depleted of modifications associated with repression, like
H3K27me3 and H3K9me2/3 (Hake et al., 2006; Jung et al., 2010; McKittrick et al., 2004).
Surprisingly, however, H3.3 is not only localized at transcriptionally active regions, where it is
deposited by the histone chaperone Hira, but also at heterochromatic regions, including
telomeres and pericentric heterochromatin, deposited by the chaperones ATRX and Daxx (Drané
et al., 2010; Goldberg et al., 2010; Lewis et al., 2010; Santenard et al., 2010; Szenker et al.,
2011). Furthermore, in ESCs, H3.3 is also enriched at poised, bivalent promoters (Banaszynski et
25 Chapter 1 | Introduction al., 2013; Goldberg et al., 2010), and upon differentiation, as these bivalent domains are resolved,
H3.3 is lost from Polycomb-repressed promoters. The highly regulated deposition of H3.3
suggests incorporation of this histone variant has important functional consequences.
What is the functional role of H3.3 at sites of incorporation? Recent work has shown that
mutation of H3.3K27 leads to defects in heterochromatin silencing and chromosome segregation,
and a disruption of mouse embryonic development, suggesting that specific residues may
mediate particular functions (Santenard et al., 2010). In ESCs, Hira-dependent H3.3 deposition is
required for PRC2 recruitment and repression of bivalent genes, with loss leading to skewed
differentiation (Banaszynski et al., 2013). Furthermore, PRC2 recruitment is dependent on the
dynamic chromatin environment associated with H3.3. Indeed, H3.3-containing nucleosomes
were previously shown to have increased dynamics and instability compared to canonical
nucleosomes (Jin and Felsenfeld, 2007; Jin et al., 2009), making them ideal regulators of the
open chromatin environment in pluripotent cells, including the bivalent, poised state of early
developmental regulators.
The following section focuses further attention on the essential histone H2A variant H2A.Z, and
we discuss its role in various cellular processes with a particular emphasis on its roles in
regulating transcription and lineage commitment.
1.4 The role of the histone variant H2A.Z in lineage commitment.
Although H2A.Z has been widely studied across many organisms, its function is largely
unknown. First discovered by West and Bonner in 1980 based on its differential migration on a
protein gel (West and Bonner, 1980), H2A.Z has been implicated in diverse cellular processes.
H2A.Z is thought to have originated at the root of the eukaryotic tree, and is found in all
eukaryotes examined. This variant is highly conserved and displays ~90% amino acid identity
between yeast and human (Zlatanova and Thakar, 2008). H2A.Z is an orphan histone gene
encoded by a single copy (yeast) or up to three (Arabidopsis thaliana) or four distinct genes
(Simonet et al., 2013). A recent vertebrate innovation has led to the emergence of two copies of
this gene, H2A.Z.1 (or H2afz) and H2A.Z.2 (H2afv) differing by only three amino acids that are
26 Chapter 1 | Introduction highly conserved within chordates (Dryhurst et al., 2009; Eirín-López et al., 2009; Matsuda et al.,
2010). Notably, these variants appear to have different functions as knockout of H2A.Z.1 in mice
is lethal and cannot be compensated for by H2A.Z.2 (Faast et al., 2001). Consistent with this idea,
recent evidence indicates that the two isoforms can differentially interact with the transcriptional
activator, Brd2 (Draker et al., 2012). However, the failure of H2A.Z.2 to rescue H2A.Z.1
deficiency may be simply due to differential expression patterns, H2AZ.2 proteins levels are
~20-fold lower in ESCs compared to H2AZ.1 (Subramanian et al., 2013). Thus, it remains to be
determined whether overexpression of H2A.Z.2 can rescue the phenotype of H2A.Z.1 loss of
function mutants.
While deletion of H2A.Z in yeast does not affect viability, mutants display slower growth and
decreased responsiveness to external cues(Adam et al., 2001; Jackson and Gorovsky, 2000;
Santisteban et al., 2000). Remarkably, H2A.Z is otherwise essential for all other organisms
examined to date including parasitic protazoa (Anderson et al., 2013; Lowell et al., 2005),
Tetrahymena (Liu et al., 1996), D. melanogaster (Clarkson et al., 1999), Xenopus (Ridgway et al.,
2004), and mice (Faast et al., 2001), and mutants often display early developmental phenotypes.
To investigate the function of H2A.Z during mammalian development, several groups have taken
advantage of ESCs as a model system, and demonstrated that H2A.Z is essential for the switch
from a pluripotent to a lineage committed state (Creyghton et al., 2008; Hu et al., 2012; Li et al.,
2012; Subramanian et al., 2013). Depletion of H2A.Z in ESCs leads to upregulation of bivalent
developmental regulators and to an inability to differentiate. The requirement of H2A.Z at genes
that are induced in response to developmental and external cues across diverse organisms
suggests that it may function in a conserved manner.
To understand the function of H2A.Z, much attention has focused on the differences between
H2A.Z and the canonical histone H2A. Though H2A.Z shares only ~60% sequence identity with
H2A, the structure of H2A.Z-containing nucleosomes is largely similar (Suto et al., 2000).
H2A.Z, however, diverges at several regions, and its incorporation into the nucleosome has
distinct consequences on the nucleosome. The docking domain of H2A makes contacts with H2B
to form an acidic patch, and this acidic patch region is extended in H2A.Z by two amino acids.
Notably, mutations in the extended acidic patch region leads to developmental defects in
27 Chapter 1 | Introduction Drosophila (Clarkson et al., 1999)and mouse ESCs (Subramanian et al., 2013). Both in vitro and
in vivo, increased stability of H2A.Z nucleosomes is due to the acidic patch, as mutation of the
extended acidic patch residues in H2A.Z to those of H2A leads to increased dynamics in
chromatin and an inability to form higher order chromatin fibers (Fan et al., 2004). Conflicting
reports have demonstrated that H2A.Z-containing nucleosomes can be both more or less stable
than those with H2A (reviewed in (Billon and Côté, 2012; Hansen, 2002; Zlatanova and Thakar,
2008)). Though these findings seem contradictory, they may be explained by other factors
associated with the H2A.Z nucleosome. For example, H2A.Z/H2A heterotypic nucleosomes are
predicted to have steric clashes causing instability (Suto et al., 2000). Moreover, posttranslational modifications of H2A.Z as well as other nucleosomal histones can influence
nucleosome structure. Furthermore, incorporation of additional variants can also impact
nucleosome structure and function. Nucleosomes that contain both H3.3 and H2A.Z are less
stable than both canonical nucleosomes and nucleosomes with either variant alone (Jin and
Felsenfeld, 2007; Jin et al., 2009). These results suggest that H2A.Z has context-dependent
functions that can have a diverse impact on local chromatin states.
H2A.Z deposition and removal is highly regulated, and this task is accomplished by distinct
chromatin chaperones and remodeling complexes. The SWR-C complex in yeast was the first
ATP-dependent chromatin remodeling complex found to replace H2A-H2B dimers with H2A.ZH2B (Kobor et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004), and is thought to be the
main complex responsible for H2A.Z dimer exchange. This activity is stimulated both by the
presence of free H2A.Z-H2B dimers, and H2A-containing nucleosomes (Luk et al., 2010).
Studies in metazoans have revealed two complexes with homology to SWR-C: Tip60/p400 and
SRCAP (Cuadrado et al., 2010; Gévry et al., 2007; Kusch et al., 2004; Ruhl et al., 2006; Wong et
al., 2007), which also function in H2A.Z deposition. Interestingly, several components of
Tip60/p400 were identified in an RNAi screen as regulators of ESC identity (Fazzio et al., 2008),
and Tip60 knockout mice fail to undergo gastrulation (Hu et al., 2009), phenotypes with similar
features to that of H2A.Z loss of function mutants (Creyghton et al., 2008; Faast et al., 2001).
While effects of SRCAP depletion on early developmental has not been described, SRCAP is
required for terminal muscle cell differentiation (Cuadrado et al., 2010), and mutations in
SRCAP have been reported in Floating-Harbor syndrome, a disease characterized by
28 Chapter 1 | Introduction developmental defects (Hood et al., 2012). Furthermore, components of both complexes are
required for transcriptional induction in response to a variety of stimuli (Dalvai et al., 2013;
Gévry et al., 2009; Gnatovskiy et al., 2013; van Beekum et al., 2008).
In addition to specific incorporation, specific removal of H2A.Z by the ATP-dependent
chromatin remodeler INO80 (Papamichos-Chronakis et al., 2011) is also an active, regulated
process. In yeast, INO80 is recruited to sites of transcriptional activation (Yen et al., 2013),
double-strand breaks (Papamichos-Chronakis et al., 2006), replication forks (PapamichosChronakis and Peterson, 2008; Shimada et al., 2008), and peri-centromeric regions (Chambers et
al., 2012), where it can facilitate the removal of unacetylated H2A.Z dimers. In metazoans, loss
of INO80 leads to defects in replication and genomic instability (Gospodinov et al., 2011; Hur et
al., 2010). Therefore, proper localization of H2A.Z is critical for the regulation of DNAmediated processes.
Mapping the genomic localization of H2A.Z may help to explain its association with such a
seemingly diverse set of cellular processes, including transcriptional activation and repression,
DNA damage repair, chromosome segregation, and heterochromatic silencing (Billon and Côté,
2012; Draker and Cheung, 2009; Zlatanova and Thakar, 2008). Though H2A.Z makes up only
~5-10% of all H2A-type histones, global analyses reveal an enrichment of this variant at discrete
genomic sites. For example, H2A.Z is enriched at regions of considerable regulation across
diverse organisms including promoters, insulators, enhancers, sites of DNA damage,
heterochromatic boundaries, among others (Albert et al., 2007; Barski et al., 2007; Bruce et al.,
2005; Creyghton et al., 2008; Hardy et al., 2009; Jin et al., 2009; Kalocsay et al., 2009; Ku et al.,
2012; Luk et al., 2010; Mavrich et al., 2008; Meneghini et al., 2003; Nekrasov et al., 2012;
Raisner et al., 2005). Thus, investigating the context dependent functions of H2A.Z will be
required to understand its diverse roles. For example, in both yeast and mammalian cell culture
lines, depletion of H2A.Z leads to defects in chromosome segregation (Carr et al., 1994; Fujii et
al., 2010; Hou et al., 2010; Rangasamy et al., 2004). A recent study in fission yeast demonstrated
that lack of H2A.Z at centromeres allows for kinetochore assembly and suggests that the
presence of H2A.Z prevented maturation of ectopic centromeres by inhibiting the association of
Scm3, a CENP-A chaperone (Ogiyama et al., 2013).
29 Chapter 1 | Introduction The role of H2A.Z in other heterochromatic regions has been less clear. In yeast, it was first
described as flanking heterochromatic regions to prevent their spreading-induced silencing
(Meneghini et al., 2003), potentially through recruiting activating acetyltransferases (Babiarz et
al., 2006). The difficulty of mapping ChIP-Seq reads to the repetitive regions often found within
heterochromatin presents challenges to determining heterochromatic enrichment. Nonetheless,
several studies have demonstrated, using a variety of techniques, that H2A.Z does localize within
both pericentromeric and facultative heterochromatin (Greaves et al., 2007; Hardy et al., 2009;
Rangasamy et al., 2003; Swaminathan et al., 2005). Furthermore, in mouse trophoblast cells,
H2A.Z undergoes a metaphase-induced redistribution from promoters towards heterochromatic
regions (Nekrasov et al., 2012). How H2A.Z functions at these regions remains poorly
understood. Current models suggest that H2A.Z recruits silencing factors, and increases
chromatin stability during mitosis.
H2A.Z has crucial roles in transcriptional regulation. Promoters of actively transcribed genes are
characterized by a nucleosome-free region (NFR) that surrounds the transcription start site (TSS).
Many studies have shown that H2A.Z is enriched at the nucleosome downstream of the NFR,
called the +1 nucleosome (and to some extent at the -1) (Albert et al., 2007; Barski et al., 2007;
Bruce et al., 2005; Creyghton et al., 2008; Hardy et al., 2009; Jin et al., 2009; Kalocsay et al.,
2009; Ku et al., 2012; Luk et al., 2010; Mavrich et al., 2008; Meneghini et al., 2003; Nekrasov et
al., 2012; Raisner et al., 2005; Weber et al., 2010). Substantial evidence indicates that H2A.Z has
functional, often contrasting roles in transcription. In yeast, H2A.Z is found at both active and
repressed/poised promoters (Albert et al., 2007; Raisner et al., 2005; Zhang et al., 2005) and
H2A.Z depletion can lead to transcriptional upregulation, supporting a role for H2A.Z in gene
repression. In contrast, in multi-cellular organisms, levels of H2A.Z enrichment generally
correlate with transcriptional activity (Barski et al., 2007; Hardy et al., 2009; Weber et al., 2010).
Indeed, the transcriptional role of H2A.Z was first described in Tetrahymena, where it was found
exclusively in the transcriptionally active macronucleus, absent from the silenced micronucleus
(Allis et al., 1986). Furthermore, H2A.Z incorporation can promote recruitment of RNAPII and
the transcriptional machinery (Adam et al., 2001; Hardy et al., 2009). Many of these seemingly
contradictory functions may be explained by the presence of H2A.Z in different subtypes of
30 Chapter 1 | Introduction nucleosomes that harbor different combinations of post-translational modifications, and other
variants and regulatory factors (see above). In fact, H2A.Z co-localizes with H3.3 at active
promoters (Jin et al., 2009), and the instability of these double-variant histones is proposed to
contribute to the open, accessible chromatin state required for active transcription. Acetylation of
H2A.Z, even in yeast, correlates with transcriptional activity, and mutation of acetylated lysines
disrupts transcriptional activation (Ku et al., 2012; Millar et al., 2006; Ren and Gorovsky, 2001;
Tanabe et al., 2008). Histone acetylation plays a functional role in modulating recruitment of the
transcriptional machinery and decreasing nucleosomal stability (Ishibashi et al., 2009),
suggesting that post-translational modification of H2A.Z may be a key mechanism for regulating
its context dependent functions. Thus, it will be important to fully characterize the posttranslational modifications associated with H2A.Z and to dissect how these modifications
influence transcriptional output.
Despite studies in a range of organisms, we still do not know how H2AZ contributes to the
regulation of early development. In ESCs, H2A.Z is found at both active and poised ‘bivalent’
genes (Figure 1.2) as described above (Creyghton et al., 2008; Hu et al., 2012; Subramanian et
al., 2013). Loss of H2A.Z leads to de-repression of bivalent genes, and a failure to properly
execute developmental gene expression programs (Creyghton et al., 2008; Hu et al., 2012).
Notably, H2A.Z depletion in ESCs leads to loss of Polycomb complexes at these genes
suggesting that these two regulatory pathways coordinate to regulate the poised state. In this
thesis, we dissect the role of H2A.Z in ESCs to understand how it regulates early developmental
programs. Our work shows that PRC1-mediated mono-ubiquitylation of H2AZ is critical for
maintaining the bivalent state and the ability of ESCs to regulate Wnt signaling and multi-lineage
differentiation. Thus, dissecting the key features of how H2A.Z governs the active and silent
state at target promoters in
ESCs will reveal critical new insights into how this essential variant mediates specific
transcriptional responses during development.
31 Chapter 1 | Introduction 1.5 References
Adam, M., Robert, F., Larochelle, M., and Gaudreau, L. (2001). H2A.Z is required for global
chromatin integrity and for recruitment of RNA polymerase II under specific conditions.
Molecular and Cellular Biology 21, 6270–6279.
Agger, K., Cloos, P.A.C., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I., Canaani,
E., Salcini, A.E., and Helin, K. (2007). UTX and JMJD3 are histone H3K27 demethylases
involved in HOX gene regulation and development. Nature 449, 731–734.
Ahmad, K., and Henikoff, S. (2002). The histone variant H3.3 marks active chromatin by
replication-independent nucleosome assembly. Mol Cell 9, 1191–1200.
Ahmed, K., Dehghani, H., Rugg-Gunn, P., Fussner, E., Rossant, J., and Bazett-Jones, D.P.
(2010). Global chromatin architecture reflects pluripotency and lineage commitment in the early
mouse embryo. PLoS ONE 5, e10531.
Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh, B.F.
(2007). Translational and rotational settings of H2A.Z nucleosomes across the Saccharomyces
cerevisiae genome. Nature 446, 572–576.
Allfrey, V.G., Faulkner, V.G., and Mirsky, A.E. (1964). Acetylation and methylation of histones
and their possible role in the regulation of RNA synthesis. Proc Natl Acad Sci USA 51, 786–794.
Allis, C.D., Richman, R., Gorovsky, M.A., Ziegler, Y.S., Touchstone, B., Bradley, W.A., and
Cook, R.G. (1986). hv1 is an evolutionarily conserved H2A variant that is preferentially
associated with active genes. J Biol Chem 261, 1941–1948.
Anderson, B.A., Wong, I.L.K., Baugh, L., Ramasamy, G., Myler, P.J., and Beverley, S.M.
(2013). Kinetoplastid-specific histone variant functions are conserved in Leishmania major.
Molecular and Biochemical Parasitology.
Arents, G., and Moudrianakis, E.N. (1995). The histone fold: a ubiquitous architectural motif
utilized in DNA compaction and protein dimerization. Proc Natl Acad Sci USA 92, 11170–
11174.
Arents, G., Burlingame, R.W., Wang, B.C., Love, W.E., and Moudrianakis, E.N. (1991). The
nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a lefthanded superhelix. Proc Natl Acad Sci USA 88, 10148–10152.
Arnold, S.J., and Robertson, E.J. (2009). Making a commitment: cell lineage allocation and axis
patterning in the early mouse embryo. Nat Rev Mol Cell Biol 10, 91–103.
Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jørgensen, H.F., John, R.M., Gouti, M., Casanova,
M., Warnes, G., Merkenschlager, M., et al. (2006). Chromatin signatures of pluripotent cell lines.
Nat Cell Biol 8, 532–538.
Babiarz, J.E., Halley, J.E., and Rine, J. (2006). Telomeric heterochromatin boundaries require
NuA4-dependent acetylation of histone variant H2A.Z in Saccharomyces cerevisiae. Genes &
32 Chapter 1 | Introduction Development 20, 700–710.
Baer, B.W., and Rhodes, D. (1983). Eukaryotic RNA polymerase II binds to nucleosome cores
from transcribed genes. Nature 301, 482–488.
Banaszynski, L.A., Wen, D., Dewell, S., Whitcomb, S.J., Lin, M., Diaz, N., Elsässer, S.J.,
Chapgier, A., Goldberg, A.D., Canaani, E., et al. (2013). Hira-Dependent Histone H3.3
Deposition Facilitates PRC2 Recruitment at Developmental Loci in ES Cells. Cell 155, 107–120.
Barnhart, M.C., Kuich, P.H.J.L., Stellfox, M.E., Ward, J.A., Bassett, E.A., Black, B.E., and Foltz,
D.R. (2011). HJURP is a CENP-A chromatin assembly factor sufficient to form a functional de
novo kinetochore. J Cell Biol 194, 229–243.
Barski, A., Cuddapah, S., Cui, K., Roh, T.-Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I.,
and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome.
Cell 129, 823–837.
Belotserkovskaya, R., Oh, S., Bondarenko, V.A., Orphanides, G., Studitsky, V.M., and Reinberg,
D. (2003). FACT facilitates transcription-dependent nucleosome alteration. Science 301, 1090–
1093.
Berge, ten, D., Koole, W., Fuerer, C., Fish, M., Eroglu, E., and Nusse, R. (2008). Wnt signaling
mediates self- n and axis formation in embryoid bodies. Cell Stem Cell 3, 508–518.
Berge, ten, D., Kurek, D., Blauwkamp, T., Koole, W., Maas, A., Eroglu, E., Siu, R.K., and Nusse,
R. (2011). Embryonic stem cells require Wnt proteins to prevent differentiation to epiblast stem
cells. Nat Cell Biol 13, 1070–1075.
Bernstein, B.E., Kamal, M., Lindblad-Toh, K., Bekiranov, S., Bailey, D.K., Huebert, D.J.,
McMahon, S., Karlsson, E.K., Kulbokas, E.J., Gingeras, T.R., et al. (2005). Genomic maps and
comparative analysis of histone modifications in human and mouse. Cell 120, 169–181.
Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner,
A., Wernig, M., Plath, K., et al. (2006). A bivalent chromatin structure marks key developmental
genes in embryonic stem cells. Cell 125, 315–326.
Billon, P., and Côté, J. (2012). Precise deposition of histone H2A.Z in chromatin for genome
expression and maintenance. Biochim Biophys Acta 1819, 290–302.
Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G.,
Kumar, R.M., Murray, H.L., Jenner, R.G., et al. (2005). Core transcriptional regulatory circuitry
in human embryonic stem cells. Cell 122, 947–956.
Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S.,
Wernig, M., Tajonar, A., Ray, M.K., et al. (2006). Polycomb complexes repress developmental
regulators in murine embryonic stem cells. Nature 441, 349–353.
Brookes, E., de Santiago, I., Hebenstreit, D., Morris, K.J., Carroll, T., Xie, S.Q., Stock, J.K.,
33 Chapter 1 | Introduction Heidemann, M., Eick, D., Nozaki, N., et al. (2012). Polycomb Associates Genome-wide with a
Specific RNA Polymerase II Variant, and Regulates Metabolic Genes in ESCs. Cell Stem Cell
10, 157–170.
Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., and Allis,
C.D. (1996). Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone
acetylation to gene activation. Cell 84, 843–851.
Bruce, K., Myers, F.A., Mantouvalou, E., Lefevre, P., Greaves, I., Bonifer, C., Tremethick, D.J.,
Thorne, A.W., and Crane-Robinson, C. (2005). The replacement histone H2A.Z in a
hyperacetylated form is a feature of active genes in the chicken. Nucleic Acids Research 33,
5633–5639.
Cairns, B.R. (2009). The logic of chromatin architecture and remodelling at promoters. Nature
461, 193–198.
Campos, E.I., and Reinberg, D. (2009). Histones: Annotating Chromatin. Annu Rev Genet 43,
559–599.
Cao, R., and Zhang, Y. (2004). SUZ12 is required for both the histone methyltransferase activity
and the silencing function of the EED-EZH2 complex. Mol Cell 15, 57–67.
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R.S., and
Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing.
Science 298, 1039–1043.
Carey, M., Li, B., and Workman, J.L. (2006). RSC exploits histone acetylation to abrogate the
nucleosomal block to RNA polymerase II elongation. Mol Cell 24, 481–487.
Carr, A.M., Dorrington, S.M., Hindley, J., Phear, G.A., Aves, S.J., and Nurse, P. (1994).
Analysis of a histone H2A variant from fission yeast: evidence for a role in chromosome stability.
Mol. Gen. Genet. 245, 628–635.
Chamberlain, S.J., Yee, D., and Magnuson, T. (2008). Polycomb repressive complex 2 is
dispensable for maintenance of embryonic stem cell pluripotency. Stem Cells 26, 1496–1505.
Chambers, A.L., Ormerod, G., Durley, S.C., Sing, T.L., Brown, G.W., Kent, N.A., and Downs,
J.A. (2012). The INO80 chromatin remodeling complex prevents polyploidy and maintains
normal chromatin structure at centromeres. Genes & Development 26, 2590–2603.
Chen, S., Ma, J., Wu, F., Xiong, L.-J., Ma, H., Xu, W., Lv, R., Li, X., Villén, J., Gygi, S.P., et al.
(2012). The histone H3 Lys 27 demethylase JMJD3 regulates gene expression by impacting
transcriptional elongation. Genes & Development 26, 1364–1375.
Chen, X., Xu, H., Yuan, P., Fang, F., Huss, M., Vega, V.B., Wong, E., Orlov, Y.L., Zhang, W.,
Jiang, J., et al. (2008). Integration of external signaling pathways with the core transcriptional
network in embryonic stem cells. Cell 133, 1106–1117.
34 Chapter 1 | Introduction Clarkson, M.J., Wells, J.R., Gibson, F., Saint, R., and Tremethick, D.J. (1999). Regions of
variant histone His2AvD required for Drosophila development. Nature 399, 694–697.
Cloos, P.A.C., Christensen, J., Agger, K., and Helin, K. (2008). Erasing the methyl mark: histone
demethylases at the center of cellular differentiation and disease. Genes & Development 22,
1115–1140.
Cole, M.F., Johnstone, S.E., Newman, J.J., Kagey, M.H., and Young, R.A. (2008). Tcf3 is an
integral component of the core regulatory circuitry of embryonic stem cells. Genes &
Development 22, 746–755.
Couldrey, C., Carlton, M.B., Nolan, P.M., Colledge, W.H., and Evans, M.J. (1999). A retroviral
gene trap insertion into the histone 3.3A gene causes partial neonatal lethality, stunted growth,
neuromuscular deficits and male sub-fertility in transgenic mice. Human Molecular Genetics 8,
2489–2495.
Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna,
J., Lodato, M.A., Frampton, G.M., Sharp, P.A., et al. (2010). Histone H3K27ac separates active
from poised enhancers and predicts developmental state. Proc Natl Acad Sci USA 107, 21931–
21936.
Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young, R.A.,
Jaenisch, R., and Boyer, L.A. (2008). H2AZ is enriched at polycomb complex target genes in ES
cells and is necessary for lineage commitment. Cell 135, 649–661.
Cuadrado, A., Corrado, N., Perdiguero, E., Lafarga, V., Muñoz-Canoves, P., and Nebreda, A.R.
(2010). Essential role of p18(Hamlet)/SRCAP-mediated histone H2A.Z chromatin incorporation
in muscle differentiation. Embo J.
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. (2002). Drosophila
enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks
chromosomal Polycomb sites. Cell 111, 185–196.
Dahl, J.A., Reiner, A.H., Klungland, A., Wakayama, T., and Collas, P. (2010). Histone H3 lysine
27 methylation asymmetry on developmentally-regulated promoters distinguish the first two
lineages in mouse preimplantation embryos. PLoS ONE 5, e9150.
Dalvai, M., Fleury, L., Bellucci, L., Kocanova, S., and Bystricky, K. (2013). TIP48/Reptin and
H2A.Z requirement for initiating chromatin remodeling in estrogen-activated transcription. PLoS
Genet 9, e1003387.
de Napoles, M., Mermoud, J.E., Wakao, R., Tang, Y.A., Endoh, M., Appanah, R., Nesterova,
T.B., Silva, J., Otte, A.P., Vidal, M., et al. (2004). Polycomb group proteins Ring1A/B link
ubiquitylation of histone H2A to heritable gene silencing and X inactivation. Developmental Cell
7, 663–676.
de Wit, E., Bouwman, B.A.M., Zhu, Y., Klous, P., Splinter, E., Verstegen, M.J.A.M., Krijger,
P.H.L., Festuccia, N., Nora, E.P., Welling, M., et al. (2013). The pluripotent genome in three
35 Chapter 1 | Introduction dimensions is shaped around pluripotency factors. Nature.
Dellino, G.I., Schwartz, Y.B., Farkas, G., McCabe, D., Elgin, S.C.R., and Pirrotta, V. (2004).
Polycomb silencing blocks transcription initiation. Mol Cell 13, 887–893.
Draker, R., and Cheung, P. (2009). Transcriptional and epigenetic functions of histone variant
H2A.Z. Biochem Cell Biol 87, 19–25.
Draker, R., Ng, M.K., Sarcinella, E., Ignatchenko, V., Kislinger, T., and Cheung, P. (2012). A
Combination of H2A.Z and H4 Acetylation Recruits Brd2 to Chromatin during Transcriptional
Activation. PLoS Genet 8, e1003047.
Drané, P., Ouararhni, K., Depaux, A., Shuaib, M., and Hamiche, A. (2010). The death-associated
protein DAXX is a novel histone chaperone involved in the replication-independent deposition
of H3.3. Genes & Development 24, 1253–1265.
Dryhurst, D., Ishibashi, T., Rose, K.L., Eirín-López, J.M., McDonald, D., Silva-Moreno, B.,
Veldhoen, N., Helbing, C.C., Hendzel, M.J., Shabanowitz, J., et al. (2009). Characterization of
the histone H2A.Z-1 and H2A.Z-2 isoforms in vertebrates. BMC Biol 7, 86.
Dunleavy, E.M., Roche, D., Tagami, H., Lacoste, N., Ray-Gallet, D., Nakamura, Y., Daigo, Y.,
Nakatani, Y., and Almouzni-Pettinotti, G. (2009). HJURP is a cell-cycle-dependent maintenance
and deposition factor of CENP-A at centromeres. Cell 137, 485–497.
Durrin, L.K., Mann, R.K., Kayne, P.S., and Grunstein, M. (1991). Yeast histone H4 N-terminal
sequence is required for promoter activation in vivo. Cell 65, 1023–1031.
Efroni, S., Duttagupta, R., Cheng, J., Dehghani, H., Hoeppner, D.J., Dash, C., Bazett-Jones, D.P.,
Le Grice, S., McKay, R.D.G., Buetow, K.H., et al. (2008). Global transcription in pluripotent
embryonic stem cells. Cell Stem Cell 2, 437–447.
Eirín-López, J.M., González-Romero, R., Dryhurst, D., Ishibashi, T., and Ausió, J. (2009). The
evolutionary differentiation of two histone H2A.Z variants in chordates (H2A.Z-1 and H2A.Z-2)
is mediated by a stepwise mutation process that affects three amino acid residues. BMC
Evolutionary Biology 9, 31.
Endoh, M., Endo, T.A., Endoh, T., Isono, K.-I., Sharif, J., Ohara, O., Toyoda, T., Ito, T.,
Eskeland, R., Bickmore, W.A., et al. (2012). Histone H2A Mono-Ubiquitination Is a Crucial
Step to Mediate PRC1-Dependent Repression of Developmental Genes to Maintain ES Cell
Identity. PLoS Genet 8, e1002774.
Ernst, J., Kheradpour, P., Mikkelsen, T.S., Shoresh, N., Ward, L.D., Epstein, C.B., Zhang, X.,
Wang, L., Issner, R., Coyne, M., et al. (2011). Mapping and analysis of chromatin state dynamics
in nine human cell types. Nature 473, 43–49.
Eskeland, R., Leeb, M., Grimes, G.R., Kress, C., Boyle, S., Sproul, D., Gilbert, N., Fan, Y.,
Skoultchi, A.I., Wutz, A., et al. (2010). Ring1B compacts chromatin structure and represses gene
expression independent of histone ubiquitination. Mol Cell 38, 452–464.
36 Chapter 1 | Introduction Estarás, C., Fueyo, R., Akizu, N., Beltrán, S., and Martínez-Balbás, M.A. (2013). RNA
polymerase II progression through H3K27me3-enriched gene bodies requires JMJD3 histone
demethylase. Mol Biol Cell 24, 351–360.
Faast, R., Thonglairoam, V., Schulz, T.C., Beall, J., Wells, J.R., Taylor, H., Matthaei, K.,
Rathjen, P.D., Tremethick, D.J., and Lyons, I. (2001). Histone variant H2A.Z is required for
early mammalian development. Curr Biol 11, 1183–1187.
Fan, J.Y., Rangasamy, D., Luger, K., and Tremethick, D.J. (2004). H2A.Z alters the nucleosome
surface to promote HP1alpha-mediated chromatin fiber folding. Mol Cell 16, 655–661.
Faust, C., Lawson, K.A., Schork, N.J., Thiel, B., and Magnuson, T. (1998). The Polycomb-group
gene eed is required for normal morphogenetic movements during gastrulation in the mouse
embryo. Development 125, 4495–4506.
Faust, C., Schumacher, A., Holdener, B., and Magnuson, T. (1995). The eed mutation disrupts
anterior mesoderm production in mice. Development 121, 273–285.
Fazzio, T.G., Huff, J.T., and Panning, B. (2008). An RNAi screen of chromatin proteins
identifies Tip60-p400 as a regulator of embryonic stem cell identity. Cell 134, 162–174.
Filipescu, D., Szenker, E., and Almouzni, G. (2013). Developmental roles of histone H3 variants
and their chaperones. Trends Genet 29, 630–640.
Fisher, C.L., Randazzo, F., Humphries, R.K., and Brock, H.W. (2006). Characterization of Asxl1,
a murine homolog of Additional sex combs, and analysis of the Asx-like gene family. Gene 369,
109–118.
Foltz, D.R., Jansen, L.E.T., Bailey, A.O., Yates, J.R., Bassett, E.A., Wood, S., Black, B.E., and
Cleveland, D.W. (2009). Centromere-specific assembly of CENP-a nucleosomes is mediated by
HJURP. Cell 137, 472–484.
Fuda, N.J., Ardehali, M.B., and Lis, J.T. (2009). Defining mechanisms that regulate RNA
polymerase II transcription in vivo. Nature 461, 186–192.
Fujii, T., Ueda, T., Nagata, S., and Fukunaga, R. (2010). Essential role of p400/mDomino
chromatin-remodeling ATPase in bone marrow hematopoiesis and cell-cycle progression.
Journal of Biological Chemistry 285, 30214–30223.
Gao, Z., Zhang, J., Bonasio, R., Strino, F., Sawai, A., Parisi, F., Kluger, Y., and Reinberg, D.
(2012). PCGF homologs, CBX proteins, and RYBP define functionally distinct PRC1 family
complexes. Mol Cell 45, 344–356.
Gaspar-Maia, A., Alajem, A., Meshorer, E., and Ramalho-Santos, M. (2011). Open chromatin in
pluripotency and reprogramming. Nat Rev Mol Cell Biol 12, 36–47.
Gaspar-Maia, A., Alajem, A., Polesso, F., Sridharan, R., Mason, M.J., Heidersbach, A.,
Ramalho-Santos, J., McManus, M.T., Plath, K., Meshorer, E., et al. (2009). Chd1 regulates open
37 Chapter 1 | Introduction chromatin and pluripotency of embryonic stem cells. Nature 460, 863–868.
Gévry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L. (2007). p21
transcription is regulated by differential localization of histone H2A.Z. Genes & Development 21,
1869–1881.
Gévry, N., Hardy, S., Jacques, P.-E., Laflamme, L., Svotelis, A., Robert, F., and Gaudreau, L.
(2009). Histone H2A.Z is essential for estrogen receptor signaling. Genes & Development 23,
1522–1533.
Gifford, C.A., Ziller, M.J., Gu, H., Trapnell, C., Donaghey, J., Tsankov, A., Shalek, A.K., Kelley,
D.R., Shishkin, A.A., Issner, R., et al. (2013). Transcriptional and Epigenetic Dynamics during
Specification of Human Embryonic Stem Cells. Cell 153, 1149–1163.
Gkikopoulos, T., Schofield, P., Singh, V., Pinskaya, M., Mellor, J., Smolle, M., Workman, J.L.,
Barton, G.J., and Owen-Hughes, T. (2011). A role for Snf2-related nucleosome-spacing enzymes
in genome-wide nucleosome organization. Science 333, 1758–1760.
Gnatovskiy, L., Mita, P., and Levy, D.E. (2013). The human RVB complex is required for
efficient transcription of type I interferon-stimulated genes. Molecular and Cellular Biology 33,
3817–3825.
Goldberg, A.D., Banaszynski, L.A., Noh, K.-M., Lewis, P.W., Elsaesser, S.J., Stadler, S., Dewell,
S., Law, M., Guo, X., Li, X., et al. (2010). Distinct factors control histone variant H3.3
localization at specific genomic regions. Cell 140, 678–691.
Gospodinov, A., Vaissiere, T., Krastev, D.B., Legube, G., Anachkova, B., and Herceg, Z. (2011).
Mammalian Ino80 mediates double-strand break repair through its role in DNA end strand
resection. Molecular and Cellular Biology 31, 4735–4745.
Greaves, I.K., Rangasamy, D., Ridgway, P., and Tremethick, D.J. (2007). H2A.Z contributes to
the unique 3D structure of the centromere. Proc Natl Acad Sci USA 104, 525–530.
Guenther, M.G., Levine, S.S., Boyer, L.A., Jaenisch, R., and Young, R.A. (2007). A chromatin
landmark and transcription initiation at most promoters in human cells. Cell 130, 77–88.
Hake, S.B., Garcia, B.A., Duncan, E.M., Kauer, M., Dellaire, G., Shabanowitz, J., Bazett-Jones,
D.P., Allis, C.D., and Hunt, D.F. (2006). Expression patterns and post-translational modifications
associated with mammalian histone H3 variants. J Biol Chem 281, 559–568.
Han, M., and Grunstein, M. (1988). Nucleosome loss activates yeast downstream promoters in
vivo. Cell 55, 1137–1145.
Han, M., Kim, U.J., Kayne, P., and Grunstein, M. (1988). Depletion of histone H4 and
nucleosomes activates the PHO5 gene in Saccharomyces cerevisiae. Embo J 7, 2221–2228.
Hansen, J.C. (2002). Conformational dynamics of the chromatin fiber in solution: determinants,
mechanisms, and functions. Annu Rev Biophys Biomol Struct 31, 361–392.
38 Chapter 1 | Introduction Hardy, S., Jacques, P.-E., Gévry, N., Forest, A., Fortin, M.-E., Laflamme, L., Gaudreau, L., and
Robert, F. (2009). The euchromatic and heterochromatic landscapes are shaped by antagonizing
effects of transcription on H2A.Z deposition. PLoS Genet 5, e1000687.
Hargreaves, D.C., and Crabtree, G.R. (2011). ATP-dependent chromatin remodeling: genetics,
genomics and mechanisms. Cell Res 21, 396–420.
Hawkins, R.D., Hon, G.C., Lee, L.K., Ngo, Q., Lister, R., Pelizzola, M., Edsall, L.E., Kuan, S.,
Luu, Y., Klugman, S., et al. (2010). Distinct epigenomic landscapes of pluripotent and lineagecommitted human cells. Cell Stem Cell 6, 479–491.
He, J., Shen, L., Wan, M., Taranova, O., Wu, H., and Zhang, Y. (2013). Kdm2b maintains
murine embryonic stem cell status by recruiting PRC1 complex to CpG islands of developmental
genes. Nat Cell Biol 15, 373–384.
Henikoff, S., and Shilatifard, A. (2011). Histone modification: cause or cog? Trends Genet 27,
389–396.
Ho, L., and Crabtree, G.R. (2010). Chromatin remodelling during development. Nature 463,
474–484.
Hong, L., Schroth, G.P., Matthews, H.R., Yau, P., and Bradbury, E.M. (1993). Studies of the
DNA binding properties of histone H4 amino terminus. Thermal denaturation studies reveal that
acetylation markedly reduces the binding constant of the H4 “tail” to DNA. J Biol Chem 268,
305–314.
Hong, S., Cho, Y.-W., Yu, L.-R., Yu, H., Veenstra, T.D., and Ge, K. (2007). Identification of
JmjC domain-containing UTX and JMJD3 as histone H3 lysine 27 demethylases. Proc Natl Acad
Sci USA 104, 18439–18444.
Hood, R.L., Lines, M.A., Nikkel, S.M., Schwartzentruber, J., Beaulieu, C., Nowaczyk, M.J.M.,
Allanson, J., Kim, C.A., Wieczorek, D., Moilanen, J.S., et al. (2012). Mutations in SRCAP,
encoding SNF2-related CREBBP activator protein, cause Floating-Harbor syndrome. Am. J.
Hum. Genet. 90, 308–313.
Hou, H., Wang, Y., Kallgren, S.P., Thompson, J., Yates, J.R., and Jia, S. (2010). Histone variant
H2A.Z regulates centromere silencing and chromosome segregation in fission yeast. Journal of
Biological Chemistry 285, 1909–1918.
Hu, G., Cui, K., Northrup, D., Liu, C., Wang, C., Tang, Q., Ge, K., Levens, D., Crane-Robinson,
C., and Zhao, K. (2012). H2A.Z Facilitates Access of Active and Repressive Complexes to
Chromatin in Embryonic Stem Cell Self-Renewal and Differentiation. Cell Stem Cell.
Hu, Y., Fisher, J.B., Koprowski, S., McAllister, D., Kim, M.-S., and Lough, J. (2009).
Homozygous disruption of the Tip60 gene causes early embryonic lethality. Dev Dyn 238,
2912–2921.
Huang, R.C. and Bonner, J. (1962). Histone, a suppressor of chromosomal RNA synthesis. Proc
39 Chapter 1 | Introduction Natl Acad Sci USA 48, 1216–1222.
Hur, S.-K., Park, E.-J., Han, J.-E., Kim, Y.-A., Kim, J.-D., Kang, D., and Kwon, J. (2010). Roles
of human INO80 chromatin remodeling enzyme in DNA replication and chromosome
segregation suppress genome instability. Cell. Mol. Life Sci. 67, 2283–2296.
Ishibashi, T., Dryhurst, D., Rose, K.L., Shabanowitz, J., Hunt, D.F., and Ausió, J. (2009).
Acetylation of vertebrate H2A.Z and its effect on the structure of the nucleosome. Biochemistry
48, 5007–5017.
Jackson, J.D., and Gorovsky, M.A. (2000). Histone H2A.Z has a conserved function that is
distinct from that of the major H2A sequence variants. Nucleic Acids Research 28, 3811–3816.
Jenuwein, T., and Allis, C.D. (2001). Translating the histone code. Science 293, 1074–1080.
Jiang, W., Wang, J., and Zhang, Y. (2013). Histone H3K27me3 demethylases KDM6A and
KDM6B modulate definitive endoderm differentiation from human ESCs by regulating WNT
signaling pathway. Cell Res 23, 122–130.
Jin, C., and Felsenfeld, G. (2007). Nucleosome stability mediated by histone variants H3.3 and
H2A.Z. Genes & Development 21, 1519–1529.
Jin, C., Zang, C., Wei, G., Cui, K., Peng, W., Zhao, K., and Felsenfeld, G. (2009). H3.3/H2A.Z
double variant-containing nucleosomes mark “nucleosome-free regions” of active promoters and
other regulatory regions. Nat Genet 41, 941–945.
Jorcano, J.L., and Ruiz-Carrillo, A. (1979). H3.H4 tetramer directs DNA and core histone
octamer assembly in the nucleosome core particle. Biochemistry 18, 768–774.
Jung, H.R., Pasini, D., Helin, K., and Jensen, O.N. (2010). Quantitative mass spectrometry of
histones H3.2 and H3.3 in Suz12-deficient mouse embryonic stem cells reveals distinct, dynamic
post-translational modifications at Lys-27 and Lys-36. Molecular & Cellular Proteomics : MCP
9, 838–850.
Kaji, K., Caballero, I.M., MacLeod, R., Nichols, J., Wilson, V.A., and Hendrich, B. (2006). The
NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nat Cell Biol 8,
285–292.
Kalocsay, M., Hiller, N.J., and Jentsch, S. (2009). Chromosome-wide Rad51 spreading and
SUMO-H2A.Z-dependent chromosome fixation in response to a persistent DNA double-strand
break. Mol Cell 33, 335–343.
Kayne, P.S., Kim, U.J., Han, M., Mullen, J.R., Yoshizaki, F., and Grunstein, M. (1988).
Extremely conserved histone H4 N terminus is dispensable for growth but essential for
repressing the silent mating loci in yeast. Cell 55, 27–39.
Kerppola, T.K. (2009). Polycomb group complexes--many combinations, many functions.
Trends Cell Biol 19, 692–704.
40 Chapter 1 | Introduction Kim, S.W., Yoon, S.-J., Chuong, E., Oyolu, C., Wills, A.E., Gupta, R., and Baker, J. (2011).
Chromatin and transcriptional signatures for Nodal signaling during endoderm formation in
hESCs. Dev Biol 357, 492–504.
Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L., Link, A.J.,
Madhani, H.D., and Rine, J. (2004). A protein complex containing the conserved Swi2/Snf2related ATPase Swr1p deposits histone variant H2A.Z into euchromatin. Plos Biol 2, E131.
Koh, K.P., and Rao, A. (2013). DNA methylation and methylcytosine oxidation in cell fate
decisions. Current Opinion in Cell Biology 25, 152–161.
Kornberg, R.D. (1974). Chromatin structure: a repeating unit of histones and DNA. Science 184,
868–871.
Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693–705.
Krogan, N.J., Keogh, M.-C., Datta, N., Sawa, C., Ryan, O.W., Ding, H., Haw, R.A., Pootoolal, J.,
Tong, A., Canadien, V., et al. (2003). A Snf2 family ATPase complex required for recruitment of
the histone H2A variant Htz1. Mol Cell 12, 1565–1576.
Ku, M., Jaffe, J.D., Koche, R.P., Rheinbay, E., Endoh, M., Koseki, H., Carr, S.A., and Bernstein,
B.E. (2012). H2A.Z landscapes and dual modifications in pluripotent and multipotent stem cells
underlie complex genome regulatory functions. Genome Biol 13, R85.
Ku, M., Koche, R.P., Rheinbay, E., Mendenhall, E.M., Endoh, M., Mikkelsen, T.S., Presser, A.,
Nusbaum, C., Xie, X., Chi, A.S., et al. (2008). Genomewide analysis of PRC1 and PRC2
occupancy identifies two classes of bivalent domains. PLoS Genet 4, e1000242.
Kusch, T., Florens, L., Macdonald, W.H., Swanson, S.K., Glaser, R.L., Yates, J.R., Abmayr,
S.M., Washburn, M.P., and Workman, J.L. (2004). Acetylation by Tip60 is required for selective
histone variant exchange at DNA lesions. Science 306, 2084–2087.
Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P., and Reinberg, D. (2002).
Histone methyltransferase activity associated with a human multiprotein complex containing the
Enhancer of Zeste protein. Genes & Development 16, 2893–2905.
Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S., Alpatov, R.,
Issaeva, I., Canaani, E., et al. (2007). A histone H3 lysine 27 demethylase regulates animal
posterior development. Nature 449, 689–694.
Lan, F., Nottke, A.C., and Shi, Y. (2008). Mechanisms involved in the regulation of histone
lysine demethylases. Current Opinion in Cell Biology 20, 316–325.
Lee, M.G., Villa, R., Trojer, P., Norman, J., Yan, K.-P., Reinberg, D., Di Croce, L., and
Shiekhattar, R. (2007). Demethylation of H3K27 regulates polycomb recruitment and H2A
ubiquitination. Science 318, 447–450.
Lee, T.I., and Young, R.A. (2013). Transcriptional regulation and its misregulation in disease.
41 Chapter 1 | Introduction Cell 152, 1237–1251.
Lee, T.I., Jenner, R.G., Boyer, L.A., Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B.,
Johnstone, S.E., Cole, M.F., Isono, K.-I., et al. (2006). Control of developmental regulators by
Polycomb in human embryonic stem cells. Cell 125, 301–313.
Leeb, M., and Wutz, A. (2007). Ring1B is crucial for the regulation of developmental control
genes and PRC1 proteins but not X inactivation in embryonic cells. J Cell Biol 178, 219–229.
Leeb, M., Pasini, D., Novatchkova, M., Jaritz, M., Helin, K., and Wutz, A. (2010). Polycomb
complexes act redundantly to repress genomic repeats and genes. Genes & Development 24,
265–276.
Lehmann, L., Ferrari, R., Vashisht, A.A., Wohlschlegel, J.A., Kurdistani, S.K., and Carey, M.
(2012). Polycomb Repressive Complex 1 (PRC1) Disassembles RNA Polymerase II Preinitiation
Complexes. Journal of Biological Chemistry.
Levine, S.S., King, I.F.G., and Kingston, R.E. (2004). Division of labor in polycomb group
repression. Trends in Biochemical Sciences 29, 478–485.
Lewis, P.W., Elsaesser, S.J., Noh, K.-M., Stadler, S.C., and Allis, C.D. (2010). Daxx is an H3.3specific histone chaperone and cooperates with ATRX in replication-independent chromatin
assembly at telomeres. Proc Natl Acad Sci USA 107, 14075–14080.
Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription. Cell
128, 707–719.
Li, W., Jiang, K., Wei, W., Shi, Y., and Ding, S. (2013). Chemical approaches to studying stem
cell biology. Cell Res 23, 81–91.
Li, Z., Gadue, P., Chen, K., Jiao, Y., Tuteja, G., Schug, J., Li, W., and Kaestner, K.H. (2012).
Foxa2 and H2A.Z Mediate Nucleosome Depletion during Embryonic Stem Cell Differentiation.
Cell 151, 1608–1616.
Liu, X., Bowen, J., and Gorovsky, M.A. (1996). Either of the major H2A genes but not an
evolutionarily conserved H2A.F/Z variant of Tetrahymena thermophila can function as the sole
H2A gene in the yeast Saccharomyces cerevisiae. Molecular and Cellular Biology 16, 2878–
2887.
Liu, X., Bushnell, D.A., and Kornberg, R.D. (2013). RNA polymerase II transcription: structure
and mechanism. Biochim Biophys Acta 1829, 2–8.
Loh, Y.-H., Wu, Q., Chew, J.-L., Vega, V.B., Zhang, W., Chen, X., Bourque, G., George, J.,
Leong, B., Liu, J., et al. (2006). The Oct4 and Nanog transcription network regulates
pluripotency in mouse embryonic stem cells. Nat Genet 38, 431–440.
Loh, Y.-H., Zhang, W., Chen, X., George, J., and Ng, H.-H. (2007). Jmjd1a and Jmjd2c histone
H3 Lys 9 demethylases regulate self-renewal in embryonic stem cells. Genes & Development 21,
42 Chapter 1 | Introduction 2545–2557.
Lowell, J.E., Kaiser, F., Janzen, C.J., and Cross, G.A.M. (2005). Histone H2AZ dimerizes with a
novel variant H2B and is enriched at repetitive DNA in Trypanosoma brucei. J Cell Sci 118,
5721–5730.
Luger, K., Mäder, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). Crystal
structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251–260.
Luk, E., Ranjan, A., Fitzgerald, P.C., Mizuguchi, G., Huang, Y., Wei, D., and Wu, C. (2010).
Stepwise Histone Replacement by SWR1 Requires Dual Activation with Histone H2A.Z and
Canonical Nucleosome. Cell 143, 725–736.
Malik, H.S., and Henikoff, S. (2003). Phylogenomics of the nucleosome. Nat Struct Biol 10,
882–891.
Martin, G.R. (1980). Teratocarcinomas and mammalian embryogenesis. Science 209, 768–776.
Marzluff, W.F., Wagner, E.J., and Duronio, R.J. (2008). Metabolism and regulation of canonical
histone mRNAs: life without a poly(A) tail. Nat Rev Genet 9, 843–854.
Matsuda, R., Hori, T., Kitamura, H., Takeuchi, K., Fukagawa, T., and Harata, M. (2010).
Identification and characterization of the two isoforms of the vertebrate H2A.Z histone variant.
Nucleic Acids Research 38, 4263–4273.
Mattout, A., and Meshorer, E. (2010). Chromatin plasticity and genome organization in
pluripotent embryonic stem cells. Current Opinion in Cell Biology 22, 334–341.
Mavrich, T.N., Jiang, C., Ioshikhes, I.P., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P., Qi, J.,
Glaser, R.L., Schuster, S.C., et al. (2008). Nucleosome organization in the Drosophila genome.
Nature 453, 358–362.
McKittrick, E., Gafken, P.R., Ahmad, K., and Henikoff, S. (2004). Histone H3.3 is enriched in
covalent modifications associated with active chromatin. Proc Natl Acad Sci USA 101, 1525–
1530.
Meissner, A., Mikkelsen, T.S., Gu, H., Wernig, M., Hanna, J., Sivachenko, A., Zhang, X.,
Bernstein, B.E., Nusbaum, C., Jaffe, D.B., et al. (2008). Genome-scale DNA methylation maps
of pluripotent and differentiated cells. Nature 454, 766–770.
Melcer, S., Hezroni, H., Rand, E., Nissim-Rafinia, M., Skoultchi, A., Stewart, C.L., Bustin, M.,
and Meshorer, E. (2012). Histone modifications and lamin A regulate chromatin protein
dynamics in early embryonic stem cell differentiation. Nat Commun 3, 910.
Meneghini, M.D., Wu, M., and Madhani, H.D. (2003). Conserved histone variant H2A.Z
protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112, 725–736.
Merrill, B.J. (2012). Wnt pathway regulation of embryonic stem cell self-renewal. Cold Spring
43 Chapter 1 | Introduction Harb Perspect Biol 4, a007971.
Meshorer, E., and Misteli, T. (2006). Chromatin in pluripotent embryonic stem cells and
differentiation. Nature Publishing Group 7, 540–546.
Meshorer, E., Yellajoshula, D., George, E., Scambler, P.J., Brown, D.T., and Misteli, T. (2006).
Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells.
Developmental Cell 10, 105–116.
Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P.,
Brockman, W., Kim, T.-K., Koche, R.P., et al. (2007). Genome-wide maps of chromatin state in
pluripotent and lineage-committed cells. Nature 448, 553–560.
Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. (2006). Acetylation of H2AZ Lys 14 is
associated with genome-wide gene activity in yeast. Genes & Development 20, 711–722.
Min, I.M., Waterfall, J.J., Core, L.J., Munroe, R.J., Schimenti, J., and Lis, J.T. (2011).
Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells.
Genes & Development 25, 742–754.
Mizuguchi, G., Shen, X., Landry, J., Wu, W.-H., Sen, S., and Wu, C. (2004). ATP-driven
exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science
303, 343–348.
Mohn, F., Weber, M., Rebhan, M., Roloff, T.C., Richter, J., Stadler, M.B., Bibel, M., and
Schübeler, D. (2008). Lineage-specific polycomb targets and de novo DNA methylation define
restriction and potential of neuronal progenitors. Mol Cell 30, 755–766.
Moosmann, A., Campsteijn, C., Jansen, P.W., Nasrallah, C., Raasholm, M., Stunnenberg, H.G.,
and Thompson, E.M. (2011). Histone variant innovation in a rapidly evolving chordate lineage.
BMC Evolutionary Biology 11, 208.
Morrison, A.J., and Shen, X. (2009). Chromatin remodelling beyond transcription: the INO80
and SWR1 complexes. Nat Rev Mol Cell Biol 10, 373–384.
Murry, C.E., and Keller, G. (2008). Differentiation of embryonic stem cells to clinically relevant
populations: lessons from embryonic development. Cell 132, 661–680.
Müller, J., and Verrijzer, P. (2009). Biochemical mechanisms of gene regulation by polycomb
group protein complexes. Curr Opin Genet Dev 19, 150–158.
Nakagawa, T., Kajitani, T., Togo, S., Masuko, N., Ohdan, H., Hishikawa, Y., Koji, T.,
Matsuyama, T., Ikura, T., Muramatsu, M., et al. (2008). Deubiquitylation of histone H2A
activates transcriptional initiation via trans-histone cross-talk with H3K4 di- and trimethylation.
Genes & Development 22, 37–49.
Narlikar, G.J., Sundaramoorthy, R., and Owen-Hughes, T. (2013). Mechanisms and Functions of
ATP-Dependent Chromatin-Remodeling Enzymes. Cell 154, 490–503.
44 Chapter 1 | Introduction Nekrasov, M., Amrichova, J., Parker, B.J., Soboleva, T.A., Jack, C., Williams, R., Huttley, G.A.,
and Tremethick, D.J. (2012). Histone H2A.Z inheritance during the cell cycle and its impact on
promoter organization and dynamics. Nat Struct Mol Biol 19, 1076–1083.
Nijnik, A., Clare, S., Hale, C., Raisen, C., McIntyre, R.E., Yusa, K., Everitt, A.R., Mottram, L.,
Podrini, C., Lucas, M., et al. (2011). The critical role of histone H2A-deubiquitinase Mysm1 in
hematopoiesis and lymphocyte differentiation. Blood.
O'Carroll, D., Erhardt, S., Pagani, M., Barton, S.C., Surani, M.A., and Jenuwein, T. (2001). The
polycomb-group gene Ezh2 is required for early mouse development. Molecular and Cellular
Biology 21, 4330–4336.
Ogiyama, Y., Ohno, Y., Kubota, Y., and Ishii, K. (2013). Epigenetically induced paucity of
histone H2A.Z stabilizes fission-yeast ectopic centromeres. Nat Struct Mol Biol.
Ohtani, K., Zhao, C., Dobreva, G., Manavski, Y., Kluge, B., Braun, T., Rieger, M.A., Zeiher,
A.M., and Dimmeler, S. (2013). Jmjd3 controls mesodermal and cardiovascular differentiation of
embryonic stem cells. Circ Res 113, 856–862.
Olins, A.L., and Olins, D.E. (1974). Spheroid chromatin units (v bodies). Science 183, 330–332.
Orphanides, G., LeRoy, G., Chang, C.H., Luse, D.S., and Reinberg, D. (1998). FACT, a factor
that facilitates transcript elongation through nucleosomes. Cell 92, 105–116.
Oudet, P., Gross-Bellard, M., and Chambon, P. (1975). Electron microscopic and biochemical
evidence that chromatin structure is a repeating unit. Cell 4, 281–300.
Pan, G., Tian, S., Nie, J., Yang, C., Ruotti, V., Wei, H., Jonsdottir, G.A., Stewart, R., and
Thomson, J.A. (2007). Whole-genome analysis of histone H3 lysine 4 and lysine 27 methylation
in human embryonic stem cells. Cell Stem Cell 1, 299–312.
Papamichos-Chronakis, M., and Peterson, C.L. (2008). The Ino80 chromatin-remodeling enzyme
regulates replisome function and stability. Nat Struct Mol Biol 15, 338–345.
Papamichos-Chronakis, M., Krebs, J.E., and Peterson, C.L. (2006). Interplay between Ino80 and
Swr1 chromatin remodeling enzymes regulates cell cycle checkpoint adaptation in response to
DNA damage. Genes & Development 20, 2437–2449.
Papamichos-Chronakis, M., Watanabe, S., Rando, O.J., and Peterson, C.L. (2011). Global
regulation of H2A.Z localization by the INO80 chromatin-remodeling enzyme is essential for
genome integrity. Cell 144, 200–213.
Pasini, D., Bracken, A.P., Hansen, J.B., Capillo, M., and Helin, K. (2007). The polycomb group
protein Suz12 is required for embryonic stem cell differentiation. Molecular and Cellular
Biology 27, 3769–3779.
Pasini, D., Bracken, A.P., Jensen, M.R., Lazzerini Denchi, E., and Helin, K. (2004). Suz12 is
essential for mouse development and for EZH2 histone methyltransferase activity. Embo J 23,
45 Chapter 1 | Introduction 4061–4071.
Pera, M.F., and Tam, P.P.L. (2010). Extrinsic regulation of pluripotent stem cells. Nature 465,
713–720.
Peterson, C.L., and Almouzni, G. (2013). Nucleosome dynamics as modular systems that
integrate DNA damage and repair. Cold Spring Harb Perspect Biol 5.
Pusarla, R.-H., and Bhargava, P. (2005). Histones in functional diversification. Core histone
variants. Febs J. 272, 5149–5168.
Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S.A., Flynn, R.A., and Wysocka, J. (2011).
A unique chromatin signature uncovers early developmental enhancers in humans. Nature 470,
279–283.
Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L., Rando,
O.J., and Madhani, H.D. (2005). Histone variant H2A.Z marks the 5' ends of both active and
inactive genes in euchromatin. Cell 123, 233–248.
Rando, O.J., and Chang, H.Y. (2009). Genome-wide views of chromatin structure. Annu Rev
Biochem 78, 245–271.
Rangasamy, D., Berven, L., Ridgway, P., and Tremethick, D.J. (2003). Pericentric
heterochromatin becomes enriched with H2A.Z during early mammalian development. Embo J
22, 1599–1607.
Rangasamy, D., Greaves, I., and Tremethick, D.J. (2004). RNA interference demonstrates a
novel role for H2A.Z in chromosome segregation. Nat Struct Mol Biol 11, 650–655.
Ren, Q., and Gorovsky, M.A. (2001). Histone H2A.Z acetylation modulates an essential charge
patch. Mol Cell 7, 1329–1335.
Reynolds, N., Latos, P., Hynes-Allen, A., Loos, R., Leaford, D., O'Shaughnessy, A., Mosaku, O.,
Signolet, J., Brennecke, P., Kalkan, T., et al. (2012). NuRD suppresses pluripotency gene
expression to promote transcriptional heterogeneity and lineage commitment. Cell Stem Cell 10,
583–594.
Ridgway, P., Brown, K.D., Rangasamy, D., Svensson, U., and Tremethick, D.J. (2004). Unique
residues on the H2A.Z containing nucleosome surface are important for Xenopus laevis
development. J Biol Chem 279, 43815–43820.
Ruhl, D.D., Jin, J., Cai, Y., Swanson, S., Florens, L., Washburn, M.P., Conaway, R.C., Conaway,
J.W., and Chrivia, J.C. (2006). Purification of a human SRCAP complex that remodels
chromatin by incorporating the histone variant H2A.Z into nucleosomes. Biochemistry 45, 5671–
5677.
Saiz, N., and Plusa, B. (2013). Early cell fate decisions in the mouse embryo. Reproduction 145,
R65–R80.
46 Chapter 1 | Introduction Santenard, A., Ziegler-Birling, C., Koch, M., Tora, L., Bannister, A.J., and Torres-Padilla, M.-E.
(2010). Heterochromatin formation in the mouse embryo requires critical residues of the histone
variant H3.3. Nat Cell Biol 12, 853–862.
Santisteban, M.S., Kalashnikova, T., and Smith, M.M. (2000). Histone H2A.Z regulats
transcription and is partially redundant with nucleosome remodeling complexes. Cell 103, 411–
422.
Scheuermann, J.C., de Ayala Alonso, A.G., Oktaba, K., Ly-Hartig, N., Mcginty, R.K., Fraterman,
S., Wilm, M., Muir, T.W., and Müller, J. (2010). Histone H2A deubiquitinase activity of the
Polycomb repressive complex PR-DUB. Nature 465, 243–247.
Schuettengruber, B., and Cavalli, G. (2009). Recruitment of polycomb group complexes and
their role in the dynamic regulation of cell fate choice. Development 136, 3531–3542.
Schuettengruber, B., Chourrout, D., Vervoort, M., Leblanc, B., and Cavalli, G. (2007). Genome
regulation by polycomb and trithorax proteins. Cell 128, 735–745.
Schwartz, B.E., and Ahmad, K. (2005). Transcriptional activation triggers deposition and
removal of the histone variant H3.3. Genes & Development 19, 804–814.
Shen, X., Liu, Y., Hsu, Y.-J., Fujiwara, Y., Kim, J., Mao, X., Yuan, G.-C., and Orkin, S.H.
(2008). EZH1 mediates methylation on histone H3 lysine 27 and complements EZH2 in
maintaining stem cell identity and executing pluripotency. Mol Cell 32, 491–502.
Shen, Y., Yue, F., McCleary, D.F., Ye, Z., Edsall, L., Kuan, S., Wagner, U., Dixon, J., Lee, L.,
Lobanenkov, V.V., et al. (2012). A map of the cis-regulatory sequences in the mouse genome.
Nature 488, 116–120.
Shimada, K., Oma, Y., Schleker, T., Kugou, K., Ohta, K., Harata, M., and Gasser, S.M. (2008).
Ino80 chromatin remodeling complex promotes recovery of stalled replication forks. Curr Biol
18, 566–575.
Shogren-Knaak, M., Ishii, H., Sun, J.-M., Pazin, M.J., Davie, J.R., and Peterson, C.L. (2006).
Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science 311,
844–847.
Simon, J.A., and Kingston, R.E. (2009). Mechanisms of polycomb gene silencing: knowns and
unknowns. Nat Rev Mol Cell Biol 10, 697–708.
Simonet, N.G., Reyes, M., Nardocci, G., Molina, A., and Alvarez, M. (2013). Epigenetic
regulation of the ribosomal cistron seasonally modulates enrichment of H2A.Z and H2A.Zub in
response to different environmental inputs in carp (Cyprinus carpio). Epigenetics & Chromatin 6,
22.
Smith, Z.D., Chan, M.M., Mikkelsen, T.S., Gu, H., Gnirke, A., Regev, A., and Meissner, A.
(2012). A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature.
47 Chapter 1 | Introduction Solnica-Krezel, L., and Sepich, D.S. (2012). Gastrulation: making and shaping germ layers.
Annu Rev Cell Dev Biol 28, 687–717.
Stellfox, M.E., Bailey, A.O., and Foltz, D.R. (2013). Putting CENP-A in its place. Cell. Mol.
Life Sci. 70, 387–406.
Stock, J.K., Giadrossi, S., Casanova, M., Brookes, E., Vidal, M., Koseki, H., Brockdorff, N.,
Fisher, A.G., and Pombo, A. (2007). Ring1-mediated ubiquitination of H2A restrains poised
RNA polymerase II at bivalent genes in mouse ES cells. Nat Cell Biol 9, 1428–1435.
Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature 403,
41–45.
Struhl, K., and Segal, E. (2013). Determinants of nucleosome positioning. Nat Struct Mol Biol
20, 267–273.
Subramanian, V., Mazumder, A., Surface, L.E., Butty, V.L., Fields, P.A., Alwan, A., Torrey, L.,
Thai, K.K., Levine, S.S., Bathe, M., et al. (2013). H2A.Z Acidic Patch Couples Chromatin
Dynamics to Regulation of Gene Expression Programs during ESC Differentiation. PLoS Genet
9, e1003725.
Suto, R.K., Clarkson, M.J., Tremethick, D.J., and Luger, K. (2000). Crystal structure of a
nucleosome core particle containing the variant histone H2A.Z. Nat Struct Biol 7, 1121–1124.
Swaminathan, J., Baxter, E.M., and Corces, V.G. (2005). The role of histone H2Av variant
replacement and histone H4 acetylation in the establishment of Drosophila heterochromatin.
Genes & Development 19, 65–76.
Swigut, T., and Wysocka, J. (2007). H3K27 demethylases, at long last. Cell 131, 29–32.
Szenker, E., Ray-Gallet, D., and Almouzni, G. (2011). The double face of the histone variant
H3.3. Cell Res 21, 421–434.
Tam, P.P.L., and Loebel, D.A.F. (2007). Gene function in mouse embryogenesis: get set for
gastrulation. Nat Rev Genet 8, 368–381.
Tam, W.-L., Lim, C.Y., Han, J., Zhang, J., Ang, Y.-S., Ng, H.-H., Yang, H., and Lim, B. (2008).
T-cell factor 3 regulates embryonic stem cell pluripotency and self-renewal by the transcriptional
control of multiple lineage pathways. Stem Cells 26, 2019–2031.
Tan, M., Luo, H., Lee, S., Jin, F., Yang, J.S., Montellier, E., Buchou, T., Cheng, Z., Rousseaux,
S., Rajagopal, N., et al. (2011). Identification of 67 histone marks and histone lysine
crotonylation as a new type of histone modification. Cell 146, 1016–1028.
Tanabe, M., Kouzmenko, A.P., Ito, S., Sawatsubashi, S., Suzuki, E., Fujiyama, S., Yamagata, K.,
Zhao, Y., Kimura, S., Ueda, T., et al. (2008). Activation of facultatively silenced Drosophila loci
associates with increased acetylation of histone H2AvD. Genes Cells 13, 1279–1288.
48 Chapter 1 | Introduction Tavares, L., Dimitrova, E., Oxley, D., Webster, J., Poot, R., Demmers, J., Bezstarosti, K., Taylor,
S., Ura, H., Koide, H., et al. (2012). RYBP-PRC1 Complexes Mediate H2A Ubiquitylation at
Polycomb Target Sites Independently of PRC2 and H3K27me3. Cell 1–15.
Thomson, M., Liu, S.J., Zou, L.-N., Smith, Z., Meissner, A., and Ramanathan, S. (2011).
Pluripotency factors in embryonic stem cells regulate differentiation into germ layers. Cell 145,
875–889.
Trojer, P., and Reinberg, D. (2007). Facultative heterochromatin: is there a distinctive molecular
signature? Mol Cell 28, 1–13.
van Beekum, O., Brenkman, A.B., Grontved, L., Hamers, N., van den Broek, N.J.F., Berger, R.,
Mandrup, S., and Kalkhoven, E. (2008). The adipogenic acetyltransferase Tip60 targets
activation function 1 of peroxisome proliferator-activated receptor gamma. Endocrinology 149,
1840–1849.
Van Der Stoop, P., Boutsma, E.A., Hulsman, D., Noback, S., Heimerikx, M., Kerkhoven, R.M.,
Voncken, J.W., Wessels, L.F.A., and Van Lohuizen, M. (2008). Ubiquitin E3 ligase
Ring1b/Rnf2 of polycomb repressive complex 1 contributes to stable maintenance of mouse
embryonic stem cells. PLoS ONE 3, e2235.
Van Hooser, A.A., Ouspenski, I.I., Gregson, H.C., Starr, D.A., Yen, T.J., Goldberg, M.L.,
Yokomori, K., Earnshaw, W.C., Sullivan, K.F., and Brinkley, B.R. (2001). Specification of
kinetochore-forming chromatin by the histone H3 variant CENP-A. J Cell Sci 114, 3529–3542.
Vastenhouw, N.L., Zhang, Y., Woods, I.G., Imam, F., Regev, A., Liu, X.S., Rinn, J., and Schier,
A.F. (2010). Chromatin signature of embryonic pluripotency is established during genome
activation. Nature 464, 922–926.
Voigt, P., Leroy, G., Drury, W.J., Zee, B.M., Son, J., Beck, D.B., Young, N.L., Garcia, B.A., and
Reinberg, D. (2012). Asymmetrically modified nucleosomes. Cell 151, 181–193.
Voncken, J.W., Roelen, B.A.J., Roefs, M., de Vries, S., Verhoeven, E., Marino, S., Deschamps,
J., and Van Lohuizen, M. (2003). Rnf2 (Ring1b) deficiency causes gastrulation arrest and cell
cycle inhibition. Proc Natl Acad Sci USA 100, 2468–2473.
Wamstad, J.A., Alexander, J.M., Truty, R.M., Shrikumar, A., Li, F., Eilertson, K.E., Ding, H.,
Wylie, J.N., Pico, A.R., Capra, J.A., et al. (2012). Dynamic and coordinated epigenetic
regulation of developmental transitions in the cardiac lineage. Cell 151, 206–220.
Wang, H., Wang, L., Erdjument-Bromage, H., Vidal, M., Tempst, P., Jones, R.S., and Zhang, Y.
(2004). Role of histone H2A ubiquitination in Polycomb silencing. Nature 431, 873–878.
Ware, C.B., Wang, L., Mecham, B.H., Shen, L., Nelson, A.M., Bar, M., Lamba, D.A., Dauphin,
D.S., Buckingham, B., Askari, B., et al. (2009). Histone deacetylase inhibition elicits an
evolutionarily conserved self-renewal program in embryonic stem cells. Cell Stem Cell 4, 359–
369.
49 Chapter 1 | Introduction Watanabe, S., and Peterson, C.L. (2010). The INO80 family of chromatin-remodeling enzymes:
regulators of histone variant dynamics. Cold Spring Harb Symp Quant Biol 75, 35–42.
Weber, C.M., Henikoff, J.G., and Henikoff, S. (2010). H2A.Z nucleosomes enriched over active
genes are homotypic. Nat Struct Mol Biol 17, 1500–1507.
Weintraub, H., and Groudine, M. (1976). Chromosomal subunits in active genes have an altered
conformation. Science 193, 848–856.
Wen, B., Wu, H., Shinkai, Y., Irizarry, R.A., and Feinberg, A.P. (2009). Large histone H3 lysine
9 dimethylated chromatin blocks distinguish differentiated from embryonic stem cells. Nat Genet
41, 246–250.
West, M.H., and Bonner, W.M. (1980). Histone 2A, a heteromorphous family of eight protein
species. Biochemistry 19, 3238–3245.
Wong, M.M., Cox, L.K., and Chrivia, J.C. (2007). The chromatin remodeling protein, SRCAP, is
critical for deposition of the histone variant H2A.Z at promoters. J Biol Chem 282, 26132–26139.
Workman, J.L., and Kingston, R.E. (1998). Alteration of nucleosome structure as a mechanism
of transcriptional regulation. Annu Rev Biochem 67, 545–579.
Wray, J., and Hartmann, C. (2012). WNTing embryonic stem cells. Trends Cell Biol 22, 159–
168.
Wu, X., Johansen, J.V., and Helin, K. (2013). Fbxl10/Kdm2b Recruits Polycomb Repressive
Complex 1 to CpG Islands and Regulates H2A Ubiquitylation. Mol Cell.
Xiang, Y., Zhu, Z., Han, G., Lin, H., Xu, L., and Chen, C.D. (2007). JMJD3 is a histone H3K27
demethylase. Cell Res 17, 850–857.
Yen, K., Vinayachandran, V., and Pugh, B.F. (2013). SWR-C and INO80 Chromatin Remodelers
Recognize Nucleosome-free Regions Near +1 Nucleosomes. Cell 154, 1246–1256.
Ying, Q.-L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and
Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature 453, 519–523.
Zaret, K.S., and Carroll, J.S. (2011). Pioneer transcription factors: establishing competence for
gene expression. Genes & Development 25, 2227–2241.
Zhang, H., Roberts, D.N., and Cairns, B.R. (2005). Genome-wide dynamics of Htz1, a histone
H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 123,
219–231.
Zhao, X., Han, X., Chew, J., Liu, J., Chiu, K., Choo, A., Orlov, Y., Sung, W., Shahab, A., and
Kuznetsov, V. (2007). Whole-genome mapping of histone H3 Lys4 and 27 trimethylations
reveals distinct genomic compartments in human embryonic stem cells. Cell Stem Cell 1, 286–
298.
50 Chapter 1 | Introduction Zhao, Y., Lang, G., Ito, S., Bonnet, J., Metzger, E., Sawatsubashi, S., Suzuki, E., Le Guezennec,
X., Stunnenberg, H.G., Krasnov, A., et al. (2008). A TFTC/STAGA module mediates histone
H2A and H2B deubiquitination, coactivates nuclear receptors, and counteracts heterochromatin
silencing. Mol Cell 29, 92–101.
Zhou, V.W., Goren, A., and Bernstein, B.E. (2011). Charting histone modifications and the
functional organization of mammalian genomes. Nat Rev Genet 12, 7–18.
Zhu, J., Adli, M., Zou, J.Y., Verstappen, G., Coyne, M., Zhang, X., Durham, T., Miri, M.,
Deshpande, V., De Jager, P.L., et al. (2013). Genome-wide Chromatin State Transitions
Associated with Developmental and Environmental Cues. Cell 1–22.
Zlatanova, J., and Thakar, A. (2008). H2A.Z: view from the top. Structure 16, 166–179.
(2004). Silencing of human polycomb target genes is associated with methylation of histone H3
Lys 27. 18, 1592–1605.
51 Chapter 1 | Introduction 52 Chapter 2
H2A.Z mono-ubiquitylation is necessary for
proper regulation of lineage determination in
ESCs
Lauren E. Surface1, Vidya Subramanian1, Jake Jaffe2, Laurie A. Boyer1
1
Department of Biology, Massachusetts Institute of Technology, 77 Massachusetts Avenue
Cambridge, MA 02139 USA; 2Broad Institute, 7 Cambridge Center, Cambridge, MA 02142
USA
53
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Abstract
Pluripotent cells must translate signaling cues into rapid transcriptional responses during
development to specify the hundreds of cell types in the adult. The essential histone variant
H2A.Z is a critical regulator of developmental gene expression programs during embryonic stem
cell (ESC) differentiation. While H2A.Z is enriched at the promoters of both active and silent
genes in ESCs, how it contributes to these contrasting transcriptional outcomes is not known. We
show here that Polycomb Repressive Complex (PRC) 1-mediated H2A.Z ubiquitylation
(H2A.Zub) is necessary for regulation of silent, developmental genes in ESCs and for proper
multi-lineage differentiation. By generating ESCs that harbor site-specific mutations in the three
PRC1-target lysines of H2A.Z, we directly show that H2A.Zub is necessary for proper regulation
of bivalent genes including developmental signaling pathways, such as canonical WNT
signaling. Loss of H2A.Zub led to a failure to differentiate into neural lineages, consistent with
hyper-activation of WNT pathway. We further demonstrate that addition of a small molecule
WNT inhibitor restored gene expression patterns and rescued the differentiation phenotype
associated with mutant cells. Our work uncovers a previously unknown role for PCR1-mediated
H2A.Zub in mediating appropriate transcriptional responses during lineage commitment.
54
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
2.1 Introduction
Chromatin structure is critical for regulating both the activation and silencing of subsets of genes
during development and for maintenance of gene expression programs in somatic tissues. The
replication-independent incorporation of histone variants in place of core histones has emerged
as a key mechanism for regulating DNA-mediated processes and for the rapid reprogramming of
chromatin states. The histone H2A variant H2A.Z is of particular interest because it has an
essential, but poorly understood role in early metazoan development (Faast et al., 2001; Liu et
al., 1996; Ridgway et al., 2004; van Daal and Elgin, 1992). Moreover, H2A.Z incorporation is
necessary for the proper induction of lineage programs during mouse embryonic stem cell (ESC)
differentiation (Creyghton et al., 2008; Hu et al., 2013). However, we lack detailed mechanistic
insights into how this variant mediates specialized functions compared to core H2A. ESCs are an
ideal system for studying lineage commitment in mammals because these cells resemble the
uncommitted cells of the pre-implantation embryo and maintain the capacity to differentiate into
all cell types in the adult (Murry and Keller, 2008; Young, 2011). Thus, dissecting the function
of H2A.Z in ESCs will further our understanding of its roles in transcriptional regulation during
mammalian development.
H2A.Z incorporation is associated with genomic regions subject to considerable regulation,
including the promoters of a large number of genes in ESCs as well as transcriptional enhancers.
Notably, H2A.Z is enriched at the TSSs of both active and silent, poised genes in a number of
organisms including C. elegans (Whittle et al., 2008), Drosophila (Mavrich et al., 2008; Weber
et al., 2010), mouse (Creyghton et al., 2008; Hu et al., 2013; Ku et al., 2012) and humans (Hardy
et al., 2009). How H2A.Z regulates these different transcriptional outcomes at target genes is
poorly understand. In ESCs, H2A.Z is enriched at genes marked with H3K4me3 nucleosomes
including active genes as well as silent genes. Bivalent genes, which encode a majority of
developmental regulators including lineage specific transcription factors and signaling
components harbor both H3K4me3 and H3K27me3, marks of transcriptional initiation and
silencing that are catalyzed by Trithorax (MLL) and Polycomb complexes, respectively
(Bernstein et al., 2006; Mikkelsen et al., 2007). A bivalent chromatin state is thought to poise
genes for transcriptional activation in response to developmental cues (Surface et al., 2010;
Vastenhouw and Schier, 2012). Thus, H2A.Z incorporation at bivalent genes may be an
55
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
important mechanism for coordinating the proper induction of developmental gene expression
programs in response to signaling cues.
Prior work suggested an important functional relationship between H2A.Z and Polycomb group
(PcG) proteins in establishing chromatin states that set the stage for subsequent lineage
commitment. H2A.Z depletion in ESCs leads to a decrease in Polycomb Repressive Complex 2
(PRC2) and PRC1 at target sites, and to de-repression of bivalent genes that subsequently fail to
properly activate during differentiation (Creyghton et al., 2008; Hu et al., 2013). However, we
know little about how these pathways are coordinated at the molecular level. Post-translational
modification of histones is important for regulation of gene expression states, and can distinguish
functional regions of chromatin. Notably, H2A.Z is subject to a similar repertoire of
modifications as canonical histones, including acetylation and ubiquitylation. For example,
amino-terminal acetylation of H2A.Z correlates with gene activation (Bellucci et al., 2013; Bruce
et al., 2005; Hu et al., 2013; Ku et al., 2012; Millar et al., 2006). Conversely, three H2A.Z
carboxy-terminal lysine residues (K120, K121, and K125) can be mono-ubiquitylated by the
Polycomb Repressive Complex 1 (PRC1) at inactive genes (Draker et al., 2011; Ku et al., 2012;
Sarcinella et al., 2007), however, the role of this modification in regulating H2A.Z function is
not known.
Prior work suggests that PRC1-dependent C-terminal ubiquitylation of H2A is important for
silencing bivalent genes in ESCs (de Napoles et al., 2004; Endoh et al., 2012), possibly through
pausing of RNA Polymerase II (RNAPII) at promoters (Stock et al., 2007). However, these
studies are based on disruption of the PRC1-associated E3 ligase Ring1b, which is known to
modify other proteins including H2A.Z. Moreover, due to the number of genes that code for
H2A in the mammalian genome, it is not possible to dissect the specific functions of these PRC1
targeted lysines. Furthermore, H2A cannot compensate for loss of H2A.Z in vivo or in vitro
(Creyghton et al., 2008; Faast et al., 2001; Hu et al., 2013), suggesting that this variant plays
distinct roles compared to H2A in regulating developmental programs. Thus, dissecting the
function of H2A.Z ubiquitylation (H2A.Zub) is critical for understanding how chromatin
structure regulates lineage specification during embryonic development.
56
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
We show here that PRC1-mediated H2A.Z ubiquitylation is necessary for regulation of bivalent
genes and for proper lineage commitment during ESC differentiation. We directly investigated
the function of the three C-terminal PRC1 targeted lysine residues by site-specific mutagenesis
(K120R, K121R, K125R; denoted H2A.ZK3R3). While loss of H2A.Zub did not affect selfrenewal, H2A.ZK3R3 ESCs were unable to undergo multi-lineage differentiation. We found that
H2A.Zub is necessary to maintain a bivalent chromatin state. Specifically, H2A.ZK3R3 ESCs
were unable to commit to neuroectoderm as demonstrated by the failure of genes such as Sox1
and Pax6 to activate, whereas markers of mesendoderm (e.g Mesp1, Foxa2) maintained the
capacity for induction upon ESC differentiation. We further demonstrate that H2A.ZK3R3 ESCs
display WNT hyper-activation and that the addition of WNT antagonists partially rescued the
mutant phenotype suggesting that loss of H2A.Zub renders the cells particularly sensitive to
misregulation of signaling networks. Thus, these data show that PRC1-mediated H2A.Zub is
directly responsible for regulating gene silencing at bivalent genes in ESCs and in mediating
gene induction in response to developmental cues. Furthermore, our work also suggests that
specific post-translation modifications can modulate the function of H2A.Z in a context-specific
manner.
2.2 Results
PRC1-mediated H2A.Z ubiquitylation is required for proper lineage commitment
Ubiquitylated H2A.Z (H2A.Zub) is enriched in H3K27me3 nucleosomes in ESCs (Ku et al.,
2012) and at the inactive X chromosome in human cell lines (Sarcinella et al., 2007), however,
the role of this modification in regulating H2A.Z function is not known. We hypothesized that
H2A.Zub is an important regulatory component of bivalent genes. Using tandem mass
spectrometry (MS/MS), we observed PRC1-dependent mono-ubiquitylation of H2A.Z at K120,
K121, and K125 on independent C-termini in mouse ESCs (Figure 2.S1A-F) similar to prior
studies (Ku et al., 2012; Sarcinella et al., 2007). Though bivalent chromatin is a feature of many
promoters in ESCs, these genes often transition to either an active or more permanently silenced
state upon differentiation (Bernstein et al., 2006; Mikkelsen et al., 2007). Consistent with this
observation, we found that H2A.Zub levels decreased in retinoic acid-treated ESCs and in more
differentiated neural precursor cells (NPCs) compared to ESCs (~75% and ~35% of ESC levels,
respectively) as quantified in SILAC (Stable Isotope Labeling by Amino Acids in Cell Culture)
57
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
(Figure 2.S1G) labeled histone extracts. Collectively, these results suggest that H2A.Zub has an
important role in regulating bivalent genes in pluripotent cells.
58
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Our proteomic analysis showed that each of the three C-terminal lysines in H2A.Z was similarly
likely to be ubiquitylated in ESCs. Thus, to investigate the specific function of the lysine
residues, ESC lines that harbor a doxycycline-inducible H2A.Z transgene engineered with a Cterminal YFP fusion (denoted H2A.ZWT) were generated in addition to similar cell lines that
contain an H2A.Z-YFP transgene with all three carboxy-terminal lysines mutated to arginines
(K120R, K121R, K125R; denoted H2A.ZK3R3) (Figure 2.1A). Upon induction by doxycycline,
we sorted for YFP expression and collected cells that displayed transgene expression comparable
to endogenous H2A.Z levels for further analysis. Mutation of the three lysines resulted in loss of
H2A.Zub as determined by Western blot (Figure 2.1B, Figure 2.S2A). Cells were then infected
with lentiviruses harboring a short hairpin directed against the 3’UTR of endogenous H2A.Z
(Figure 2.1B, Figure 2.S2B). The hairpin used in this study leads to specific depletion of
endogenous H2A.Z and to failure to activate developmental programs (Subramanian et al.,
2013). Induction of H2A.ZK3R3 in ESCs depleted of endogenous H2A.Z did not affect ESC
morphology, expression of pluripotency markers, or cell cycle dynamics compared to expression
of H2A.ZWT (Figure 2.1C, Figure 2.S2C-S2E). Similar results were obtained with an
independent hairpin (data not shown). These data indicate that H2A.Zub is not necessary for
maintenance of the ESC state.
We next tested the function of H2A.ZK3R3 during ESC differentiation by allowing these cells to
aggregate into embryoid bodies (EBs), which undergo multi-lineage differentiation in the
absence of the pluripotency growth factor LIF. While H2A.Z depletion results in EBs lacking
distinct differentiated structures (Creyghton et al., 2008), expression of a H2A.ZWT transgene
rescues the knock-down phenotype as measured by the restoration of multi-lineage gene
59
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
expression patterns in these cell lines as shown in a prior study (Subramanian et al., 2013). In
contrast, expression of H2A.ZK3R3 failed to rescue normal EB differentiation. Conversely, H2AYFP did not compensate for loss of H2A.Z (data not shown). While the overall size of
H2A.ZK3R3 EBs was similar to that of H2A.ZWT, H&E stained sections revealed clear differences
in tissue representation (Figure 2.1D). H2A.ZK3R3 EBs lacked neuroepithelial structures
compared to H2A.ZWT EBs and failed to activate the neural marker Tuj1 in the mutant cells as
shown by immunohistochemistry (Figure 2.1E). Upon further analysis, we found that while early
markers of neuroectoderm (e.g. Fgf5, Otx2) were initially activated similar to H2A.ZWT,
expression of genes involved in later neural differentiation (e.g. Sox3, Sox1, Pax6) were not
properly induced in the H2A.ZK3R3 EBs as assayed by qRT-PCR (Figure 2.1F, upper panels). In
contrast, markers of mesoderm (e.g. Brachyury, Mesp1, Eomes, Bmp4) and endoderm (e.g.
Foxa2, Sox17, Sox7, Gata4) showed higher expression in H2A.ZK3R3 EBs compared to H2A.ZWT
cells (Figure 2.1F, middle and lower panels). Notably, the specific failure of neural induction is
distinct from the general differentiation defects that result from H2A.Z depletion (Creyghton et
al., 2008; Hu et al., 2013; Subramanian et al., 2013). Together, these data suggest that H2A.Zub
in ESCs is necessary for proper multi-lineage differentiation.
H2A.Zub is necessary for maintenance of the bivalent chromatin state
Point mutations as well as truncations in the H2A.Z carboxy-terminus can destabilize
nucleosomes or prevent H2A.Z incorporation in yeast (Wang et al., 2011; Wratting et al., 2012).
Moreover, mutations in the H2A.Z C-terminal acidic patch leads to decreased incorporation and
to global differentiation defects in ESCs (Subramanian et al., 2013). Thus, we tested whether Cterminal ubiquitylation is necessary for H2A.Z incorporation. We have previously demonstrated
that ChIP-Seq using a GFP-specific antibody (recognizes the YFP tag) in H2A.ZWT cell lines
replicates the patterns observed with H2A.Z antibodies indicating the YFP tag does not affect
incorporation (Subramanian et al., 2013). Thus, we analyzed the distribution of H2A.ZK3R3 by
ChIP-Seq using GFP antibodies and found it to be highly similar across the genome compared to
H2A.ZWT, with distinct enrichment at H3K4me3 marked transcriptional start sites (Figure 2.2A).
Our analysis identified 97,146 and 110,434 enriched regions in H2A.ZWT and H2A.ZK3R3 ESCs,
respectively (GEO accession GSE53208), of which 80,626 (83% of H2A.ZWT regions)
overlapped using a strict peak-calling threshold (Figure 2.2B). This overlap is similar to
60
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
61
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
comparisons of H2A.ZWT ChIP-Seq replicates. Moreover, we observed a high concordance of
H2A.ZWT and H2A.ZK3R3 enrichment across transcription start sites (TSSs) (Spearman 0.972)
(Figure 2.2A,C) where 13,684 and 13,000 genes showed enrichment within 2kb of the TSS for
H2A.ZWT and H2A.ZK3R3, respectively. For example, H2A.ZK3R3 was highly concordant with
H2A.ZWT enrichment across target genes, including the HoxA locus, as well as the promoters of
individual genes such as Nestin and Brachyury (Figures 2.2D, 2.S3A-C). H2A.Z is also enriched
at a subset of distal enhancers in the genome (Hu et al., 2013), and loss of ubiquitylation does not
affect H2A.Z incorporation at these regions (Figure 2.S3D,E). We further show that conditional
ablation of the PRC1-associated E3 ligase Ring1b did not impact H2A.Z enrichment (Figure
S3F) (Illingworth et al., 2012). In addition, we utilized Fluorescence Recovery after
Photobleaching (FRAP) to monitor differential histone dynamics (Bhattacharya et al., 2009;
Meshorer et al., 2006) to determine whether ubiquitylation may also have an impact on the
dynamic association of H2A.Z with chromatin. We found that H2A.ZK3R3 histones display
similar dynamics to H2A.ZWT in ESCs (Figure 2.S3G). Thus, our analysis indicates that PRC1dependent H2A.Zub is not necessary for proper incorporation or dynamics at target genes,
suggesting the phenotypic consequences of H2A.ZK3R3 ESCs are likely due to a specific loss of
this modification.
Polycomb-occupied promoters in ESCs include a large cohort of developmental genes, and their
regulation is key for the proper execution of lineage commitment (Surface et al., 2010). Recent
studies using MNase-IP showed that H2A.Zub is enriched in H3K27me3 nucleosomes (Ku et al.,
2012), however, the localization of H2A.Zub at specific genomic sites is not known. We
performed sequential ChIP and found that H2A.Zub is enriched at the promoters of bivalent
genes representing all three germ layers, including Otx2, Sox1, Pax6, Nestin (neuroectoderm)
and Brachyury, Foxa2, Sox17 (mesendoderm) (Figure 2.2E). In contrast, we did not observe
H2A.Zub at active genes such as Thra, Kcnn2, and Tex10. Because PRC1 activity is necessary
for bivalent gene repression by modifying chromatin structure (Endoh et al., 2012), we next
tested whether H2A.Zub also contributes to the chromatin structure at bivalent genes in ESCs.
By ChIP-qPCR we observed decreased enrichment of Ring1b and the PRC2 component Suz12,
as well as its corresponding mark H3K27me3 at bivalent promoters in H2A.ZK3R3 ESCs (Figure
2.3A-C). These changes in chromatin marks were similar on promoters of neuroectoderm
62
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
markers (e.g. Otx2, Zfp521, Sox1, Sox3, Pax6) as those of mesendoderm (e.g. Brachyury, Mesp1,
Foxa2, Sox17). Conversely, loss of H2A.Zub did not appear to alter H3K4me3 levels or other
modifications such as H3K27Ac compared to H2A.ZWT ESCs (Figure 2.3D, E). Thus, our data
suggest that H2A.Zub may function to maintain the repressed state of bivalent genes in part by
stabilizing the recruitment of Polycomb complexes to their target loci.
H2A.Zub regulates expression of developmental programs
We find that H2A.Zub is enriched at bivalent target genes and is necessary for maintenance of
the bivalent chromatin state. To determine the role of H2A.Zub in regulating gene expression,
we next performed transcriptome profiling in ESCs. We found that bivalent genes showed
63
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
overall higher expression levels in H2A.ZK3R3 ESCs compared to H2A.ZWT ESCs (p<2.2x10-16,
Kolmogorov-Smirnov test, two-sided), while active genes were largely unaffected (Figure 2.4A).
Specifically, we determined that 265 and 37 genes were up- and down-regulated, respectively, in
H2A.ZK3R3 ESCs compared to H2A.ZWT controls using a stringent two-fold change cutoff and a
p-value<0.05 (Figure 2.4B). Notably, bivalent genes significantly overlapped the set of upregulated genes (p<2.65x10-87, hypergeometric test). Using PANTHER as an annotation tool
(Huang et al., 2009a; 2009b), we found genes up-regulated in H2A.ZK3R3 ESCs are enriched for
functional processes related to cell communication and signaling cascades (Figure 2.4C),
whereas down-regulated genes did not yield significant results. To compare the effects of global
depletion of H2A.Z with the specific loss of H2A.Zub, we also profiled the transcriptome of
H2A.ZKD ESCs. We found that while H2A.Z depletion resulted in global up-regulation of
bivalent genes, the effect was less pronounced than that observed in H2A.ZK3R3 ESCs (Figure
2.S4A). These data suggest that while depletion of H2A.Z at bivalent genes leads to loss of
repression, the maintenance of H2A.ZK3R3 at these genes allows for their downstream activation
suggesting that H2A.Z incorporation is a critical component for regulating activation of bivalent
genes.
Prior studies indicated that the E3 ligase activity of Ring1b may be important for the regulation
of RNA Polymerase II (RNAPII) pausing at bivalent promoters through H2Aub (Stock et al.,
2007). Thus, we next investigated whether the differential expression in H2A.Zub mutant cells is
associated with a disruption of RNAPII pausing at these promoters. Using previously published
ChIP-Seq data of total RNAPII (Rahl et al., 2010), we found markedly lower levels of RNAPII
at the promoters of bivalent genes compared to active genes (Figure 2.4D and Figure 2.S4B).
Furthermore, the expression of highly paused genes that largely comprise a cohort of active
genes as determined by a high RNAPII traveling ratio (Rahl et al., 2010), were not significantly
affected in H2A.ZK3R3 ESCs compared to bivalent genes (Figure 2.4E). Therefore, H2A.Zub
does not appear to regulate bivalent genes through control of RNAPII pausing. Rather, our data
are consistent with a model whereby H2A.Zub may limit stable RNAPII recruitment to bivalent
genes in ESCs.
64
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
65
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
H2A.Zub regulates canonical WNT signaling in ESCs
The balance between ESC self-renewal and pluripotency is regulated by the signaling
environment (Merrill, 2012; Pera and Tam, 2010). Many bivalent genes code for key signaling
factors, and modulation of signaling molecules during ESC differentiation can lead to changes in
developmental potential (Berge et al., 2008; Yang et al., 2012). Using IPA analysis (Ingenuity
Systems, www.ingenuity.com), we found enrichment for a number of signaling factors including
leukocyte inhibitory factor (LIF) which is critical for mouse ESC self-renewal as well as
canonical WNT signaling factors such as Wnt1 and Wnt3A that may function upstream of a
significant number of the up-regulated genes (Figure 2.S4B). To further investigate the effects of
H2A.ZK3R3 on signaling pathways, we first analyzed expression of markers of the WNT (Wnt3A,
Axin2), Activin/Nodal (Nodal, LEFTY1) and BMP (Bmp4, Bmpr1a) pathways during EB
differentiation in H2A.ZK3R3 ESCs compared to H2A.ZWT controls (Figure 2.5A). We found that
WNT signaling genes showed significant changes in expression compared to the other pathways.
In particular, while Wnt3a and Axin2 levels were higher in H2A.ZK3R3 ESCs, these genes failed
to properly activate in EBs compared to H2A.ZWT controls. Thus, we focused further analysis on
the role of H2A.Zub in the regulation of WNT signaling during ESC differentiation.
Hyper-activation of WNT signaling during EB formation promotes mesendoderm formation and
inhibits neuroectodermal differentiation similar to loss of H2A.Zub (Berge et al., 2008).
Canonical Wnt signaling affects downstream gene expression patterns by modulating β-catenin
levels and localization (Merrill, 2012) . As shown in Figure 2.5B, in a low WNT signaling
environment, GSK3β-containing APC/Axin destruction complexes promote β-catenin
degradation. Upon WNT activation, β-catenin can translocate into the nucleus, which is thought
to reduce binding of TCF3 to relieve target gene repression (Wray et al., 2011; Yi et al., 2011).
Consistent with the inappropriate activation of WNT signaling in H2A.ZK3R3 ESCs, nuclear βcatenin levels increased significantly in mutant ESCs (Figure 2.5C). Notably, binding of TCF3 at
WNT target genes, such as Axin2 and Tcfcp2l1, is reduced in H2A.ZK3R3 ESCs (Figure 2.5D),
consistent with their increased expression in these cells. This difference is not due to decreased
66
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
67
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
expression of Tcf3 in H2A.ZK3R3 ESCs (Figure 2.S4D). Moreover, using the TOPFlash assay, we
show increased activity of a WNT signaling reporter in H2A.ZK3R3 ESCs compared to H2A.ZWT
controls (Figure 2.5E). Collectively, our results indicate that H2A.Zub is necessary for the ability
of ESCs to appropriately respond to developmental cues.
While previous reports have shown that WNT pathway activation promotes mesoderm formation
during differentiation, it is also associated with the pluripotent ground state when mouse ESCs
are grown in chemically defined 2i+LIF media, which contains GSK3β and MEK inhibitors
(Berge et al., 2011; Ying et al., 2008). In contrast, standard serum-containing ESC media is
thought to promote a more ‘primed’ state. As cells in this study were grown in serum-containing
media, we compared the gene expression profile of H2A.ZK3R3 ESCs with those transcripts
associated with ‘2i’ or ‘serum’ grown cells (Marks et al., 2012), and found higher expression of
primed/serum-associated transcripts in H2A.ZK3R3 ESCs compared to 2i-associated transcripts
(Figure 2.S4E). Consistent with a more differentiated cell state and up-regulation of
developmental signaling pathways, signaling through the ERK/MAPK pathway is also increased
in H2A.ZK3R3 cells, as indicated by the slight increase in pErk levels (Figure 2.S4E). Thus, our
data suggest that inappropriate WNT signaling and de-repression of developmental genes
induced by loss of H2A.Zub destabilizes the pluripotent ESC state.
WNT inhibition partially rescues loss of H2AZub
While bivalent genes display global de-repression in H2A.ZK3R3 ESCs, we hypothesized that the
mutant cells may be particularly sensitive to misregulation of WNT pathway signaling as
disruption of this pathway can dramatically alter multi-lineage specification (Berge et al., 2008;
Caronna et al., 2013). To test this idea, we first examined the consequence of WNT hyperactivation on differentiation capacity. H2A.ZWT ESCs were treated with the GSK3β inhibitor,
CHIR99021, which leads to increased canonical WNT signaling and de-repression of
downstream target genes (Kelly et al., 2011; Yi et al., 2011). We found that treatment of
H2A.ZWT ESCs with CHIR99021 led to increased levels of Wnt3A (Figure 2.6A, left panel), and
68
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
69
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
to a subsequent decrease of neuroectoderm markers and a relative increase in mesendoderm
markers during EB formation compared to untreated H2A.ZWT (Figure 2.6A, right panel). Given
that activation of WNT alone appeared to recapitulate much of the H2A.ZK3R3 phenotype, we
tested whether inhibition of this pathway could rescue the differentiation defect. To this end, we
treated H2A.ZK3R3 ESCs with the WNT antagonist KY02111 (Minami et al., 2012) or DMSO as
a control for 48 hours prior EB differentiation. After 48 hours of KY02111 treatment (d0),
Wnt3A was restored to near wild-type levels in H2A.ZK3R3 ESCs as measured by qRT-PCR
(Figure 2.6B). ESCs were then allowed to differentiate as EBs for 12 days, maintaining the levels
of the inhibitor over the time course. Notably, KY0211 treatment partially rescued the
differentiation defect of the mutant cells as shown by activation of the neuroectodermal genes
Sox3 and Pax6, similar to H2A.ZWT ESCs treated with DMSO, whereas H2A.ZK3R3 ESCs treated
with DMSO failed to activate these genes. Additionally, WNT inhibition reduced the expression
of mesodermal markers (e.g. Mesp1, FoxA2, Sox17) in H2A.ZK3R3 EBs (Figure 2.6B). Similar
results were observed using a different WNT signaling inhibitor (IWP2) (data not shown).
Together, our study reveals a previously unknown role for H2A.Zub in regulating signaling
pathways in ESCs and suggests that PRC1-mediated H2A.Zub is crucial for coordinating
specific transcriptional outputs that lead to proper differentiation in response to developmental
cues.
2.3 Discussion
H2A.Z has critical roles in transcriptional regulation in a wide range of organisms. While H2A.Z
is incorporated at most promoters in ESCs, it appears to regulate contrasting gene expression
states. For example, H2A.Z is enriched both at active H3K4me3 promoters as well as silent,
poised genes that harbor a bivalent chromatin structure. Bivalent genes comprise a large cohort
of developmental transcription factors and signaling molecules, and their precise regulation is
crucial for the proper execution of lineage programs. While H2A.Z acetylation has been widely
associated with gene activation from yeast to mammals (Bellucci et al., 2013; Bruce et al., 2005;
Hu et al., 2013; Ku et al., 2012; Millar et al., 2006; Valdés-Mora et al., 2012), how this variant
contributes to the poised state is poorly understood. Our findings suggest that PRC1-mediated
mono-ubiquitylation of H2A.Z in ESCs is necessary for both the maintenance of the silent state
and for proper induction of developmental programs. Notably, H2A.ZK3R3 ESCs maintained the
70
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
ability to activate mesendoderm differentiation, which is phenotypically distinct from the
complete lack of differentiation observed in H2A.Z-depleted ESCs. These data are consistent
with context specific roles of H2A.Z that depend on its incorporation and post-translational
modifications at promoters.
PcG proteins regulate developmental genes including various signaling pathways in multicellular organisms (Sawarkar and Paro, 2010), however, the molecular mechanisms that underpin
this regulation are not clear. While it has been suggested that mono-ubiquitylation of core H2A
by PRC1-associated Ring1a/b is an important component of regulating developmental gene
expression programs in ESCs, H2A cannot compensate for the loss of H2A.Z. Moreover, H2Aub
has been suggested to potentially function through polymerase pausing (Brookes et al., 2012; de
Napoles et al., 2004; Endoh et al., 2012; Stock et al., 2007), however, most bivalent genes harbor
low levels of RNAPII (Min et al., 2011; Rahl et al., 2010), and the function of H2Aub has not
been directly tested due to the existence of multiple copies in the mammalian genome.
Furthermore, PRC1 can modify both H2A and H2A.Z (and possibly non-histone proteins)
leaving open the possibility that H2A.Z may be a major functional target of Polycomb activity in
ESCs. In our system, we dissected the direct effects of loss of H2A.Z mono-ubiquitylation by
mutating the three target lysine residues. Our data suggest that H2A.Z is a key downstream
effector of PRC1. We also demonstrate that regulation of developmental gene expression
programs is not likely mediated through RNAPII pausing in ESCs as genes that showed a high
traveling ratio did not exhibit significant changes in expression, whereas bivalent genes showed
the most significant changes. Collectively, this work suggests that post-translational modification
of H2A.Z can functionally distinguish specific subsets of H2A.Z during development.
We propose that PRC1-mediated ubiquitylation of H2A.Z is crucial for cells to respond to
environmental and developmental stimuli. For example, while bivalent genes were largely derepressed in the mutant, H2A.ZK3R3 ESCs were particularly sensitive to activation of WNT
pathway components and its downstream effector genes. ESCs are highly sensitive to their
signaling environment and the temporal regulation of WNT signaling is critical for both selfrenewal and differentiation. Thus, H2A.Zub may play a role in suppressing key signaling factors
in ESCs while allowing for proper induction of WNT pathway genes when signaled to do so. It
71
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
will therefore be crucial to determine whether ubiquitylation is also necessary for the response to
environmental cues in other contexts and systems where H2A.Z has been shown to have
functional roles, such as the thermo-sensory response in plants (Coleman-Derr and Zilberman,
2012; Kumar and Wigge, 2010) and in estrogen and androgen responsiveness in human cells
(Dalvai et al., 2012; Gévry et al., 2009). Consistent with the latter roles, H2A.Z has recently been
implicated in breast and prostrate cancer progression (Dryhurst et al., 2012; Hua et al., 2008).
Furthermore, aberrant WNT activation as well as disruption of normal Polycomb activity has
been reported in many types of cancers (Chang and Hung, 2012; Lento et al., 2013). Together,
our findings implicate H2A.Zub as an important component of the regulatory module that
governs development and suggests how its faulty regulation can lead to diseases such as cancer.
Determining how ubiquitylation potentiates the role of H2A.Z will be a crucial next step in
understanding its specific role in lineage commitment. H2A.Zub may have consequences on
nucleosomal structure or may nucleate downstream interactions with other effectors. For
example, H2A.Zub may provide a novel scaffold for the recruitment of additional regulatory
factors. Consistent with this idea, H2A.Z appears to interact with a distinct set of binding
partners compared to H2A (Draker et al., 2012; Fujimoto et al., 2012). Therefore, elucidating the
downstream pathways that are regulated by H2A.Zub will likely reveal additional insights into
the function of this modification. Moreover, active deubiquitylation by USP10 is required for full
transcriptional activation in androgen receptor signaling (Draker et al., 2011), however, little is
known about the role of H2A.Z deubiquitylation during development. Thus, determining the role
of histone deubiquitylation during the transition from a poised to an active state will also be an
important area for future investigation.
2.4 Experimental Procedures
Growth of mouse embryonic stem cells (mESCs)
V6.5 (129SvJae and C57BL/6; male) ESCs were plated with irradiated murine embryonic
fibroblasts (MEFs) and grown under typical ES cell conditions on gelatinized tissue culture
plates. Briefly, cells were grown in Knockout DMEM (Invitrogen) supplemented with 10% fetal
bovine serum (Hyclone), leukemia inhibitory factor (LIF), non-essential amino acids
(Invitrogen), L-glutamine (Invitrogen), and penicillin/streptomycin (Invitrogen) as previously
72
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
described (Boyer et al., 2006; Subramanian et al., 2013; Surface et al., 2010). To harvest cells for
experiments, ESCs were either trypsinized and plated without irradiated MEFs for the final
passage or pre-plated without MEFs on non-gelatinized plates for 30’ to remove MEFs. To
examine how loss of Ring1b affected H2A.Z ubiquitylation Ring1bfl/-; CreERT2 ESCs (Ku et al.,
2012; van der Stoop et al., 2008) were treated with 200nM 4-hydroxytamoxifen (4-OHT) for the
indicated number of days. To examine effects of WNT signaling hyper-activation and inhibition,
cells were treated with CHIR99021 (15µM) and KY02111 (10µM), respectively. Control cells
were treated with DMSO. For EB differentiation experiments, ESCs were treated for 48 hours
with the small molecule inhibitor and then allowed to form EBs in the continuous presence of the
inhibitor or DMSO.
Qualitative and Quantitative (SILAC) Proteomics analyses
ES cells were cultured in 13C6/15N2-lysine(+8) 13C6/15N4-arginine(+10) (“SILAC heavy”) or
naturally occurring lysine and arginine (“SILAC light”) medium according to (Bendall et al.,
2008). One SILAC label state was propagated as ES cells while the other state was differentiated
with retinoic acid (1µM). The experiment was repeated with flipping the label conditions to
ensure that SILAC medium did not introduce artifacts into the data. Histones were purified from
ESCs and differentiated cells as described (Thomas et al., 2006), except that a Zorbax C8 HPLC
column was employed (Agilent). Each 1 min fraction collected from the HPLC separation of the
histones was subjected to SDS-PAGE. Subsequent LC-MS/MS experiments were performed on
an LTQ Velos-Orbitrap mass spectrometer (ThermoFisher Scientific) fed by an Agilent 1200
nano-HPLC system (Agilent) following procedures analogous to those described elsewhere
(Kinter and Sherman, 2005). First, the Coomassie-stained visible bands on PAGE separations of
the HPLC fractions were interrogated by tryptic and chymotryptic digestion. Peptides unique to
H2A.Z (and not derived from other H2A variants) were detected in bands of ~14 kDa and ~20
kDa. The ~14 kDa variant of H2A.Z co-HPLC-separated with Histone H4 (~12 kDa) while the
~20 kDa variant co-HPLC-separated with Histone H2B (~14 kDa). Next, these bands (from a
parallel preparation) were subject to in-gel propionylation using propionic anhydride according
to (Garcia et al., 2007). To study the carboxy-terminal ubiquitination of H2A.Z, chymotryptic
peptides were analyzed. M/z values corresponding to the various ubiquitin-residual peptides
(proteases will cleave ubiquitin as well as H2A.Z, leaving a branched peptide residual) were
73
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
calculated. Selective-ion monitoring (SIM) windows were designed around these m/zs as
appropriate and data-independent MS/MS scans were acquired at these m/zs as dictated by each
experiment. The sample was introduced to the mass spectrometer via liquid chromatography
with conditions identical to those described (Jaffe et al., 2008). Carboxy-terminal ubiquityl
positional isomers were assigned from collisional MS/MS spectra. The percentage of each
positional isomer was determined using integrated chromatographic peak area of extracted ion
chromatograms (XICs).
Transgenic mESC lines
H2A.ZWT, and H2A.ZK3R3-YFP cell lines were generated as described in (Subramanian et al.,
2013). H2A.ZWT, and H2A.ZK3R3-YFP constructs were generated from H2A.ZWT- and
H2A.ZK3R3-GFP containing vectors from (Sarcinella et al., 2007) by replacement by YFP (since
it provides minimum background for imaging purposes). This construct was then placed into a
lentiviral vector containing a tetOn CMV-promoter driven by an rtTA drug inducible system.
The lentiviral constructs were transfected into 293 cells using the protocol outlined by the RNAi
consortium (TRC, Broad Institute). The viral supernatant generated 48hrs after transfection was
used to infect KH2 ES cells (Beard et al., 2006) to generate wild-type and mutant H2A.Z
transgenic ES cell lines. Infection was aided by the presence of 8ug/ml polybrene. ESCs were
split onto MEFs after 24 hours. The YFP transgenic ES cells were induced with 1µg/ml of
doxycycline and sorted using flow cytometry for high YFP expression. An shRNA directed
against the 3’UTR of endogenous H2A.Z (shH2A.Z: AACAGCTGTCCAGTGTTGGTG) was
cloned into pLKO.1 containing a blasticidin resistance cassette instead of the puromycin
resistance gene. Lentiviral particles were generated and H2A.Z/K3R3-YFP cells were infected as
described above. ESCs were split onto MEFs after 24 hours and selected with 5ug/ml blasticidin.
Embryoid body differentiation
mESCs were allowed to form embryoid bodies (EBs) by plating them in Corning Ultra-Low
Attachment Tissue Culture Plates at a density of 100,000 cells/ml in mESC media lacking LIF.
Media was gently changed every other day, and EBs were grown for the indicated number of
days.
74
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Histone Extraction & Cellular Fractionation
Histone extracts were prepared as described (Subramanian et al., 2013). For cellular
fractionation, 2 x 107 cells were fractionated according to (Wysocka et al., 2001), collecting the
cytoplasmic fraction and splitting the nuclear fraction into a total nuclear fraction and a further
purified chromatin fraction. Prior to boiling, the cytoplasmic and total nuclear fraction were
mixed 1:1 with sample buffer and then boiled for 10 minutes.
Immunoblot
For immunoblot analysis, samples were resolved on SDS-PAGE gels. Proteins were transferred
to a PVDF membrane, blocked with 5% milk in PBST (0.1% Tween-20 in phosphate-buffered
saline, pH 7.4), blotted overnight with primary antibody in PBST, and binding was detected by
HRP-conjugated secondary antibody. Western blotting was performed with the following
antibodies: Rabbit anti-GFP antibody (Abcam, ab290, 1:1000); Rabbit anti-H2A.Z (Abcam,
ab4174, 1:1000); Mouse anti-Ub (Santa Cruz, sc-8017, 1:500); Mouse anti-H3 (Abcam,
ab10799, 1:1000); Rabbit anti-β-catenin (Santa Cruz, sc-7199, 1:100), Rabbit anti-Erk1/2 (CST
9102, 1:800), Rabbit anti-phosphoErk1/2 (CST, 9101, 1:800). Western blot for H2Aub was done
with anti-H2Aub (Millipore, 05-678, 1:300) followed by anti-mouse IgMµ (Millipore, 12-488,
1:200).
Immunostaining and Histology
Cells were fixed with 4% paraformaldehyde for 20 minutes at room temperature, washed 3X
with PBS, permeabilized in PBS with 0.2% TritonX, 0.1% Tween-20 for 30 minutes at room
temperature, washed 2x with PBS and blocked with PBS with 0.1% Tween-20, 2% CCS
(Cosmic Calf Serum, Invitrogen) for 1 hour at room temperature. The cells were then stained
with anti-Oct4 antibody (Santa Cruz, sc-5279, 1:100) for 1 hour at room temperature, then
washed twice with block and stained with anti-mouse secondary (Alexafluor 594). Cells were
imaged using a Zeiss LSM 710 confocal microscope. For histology, d12 embryoid bodies were
fixed for 20 minutes in 10% formalin, washed twice with PBS, subject to a series of 20 minute
dehydration washes, 1x 70% Ethanol, 1x 80% Ethanol, 2x 95% Ethanol, 3x 100% Ethanol, 3x
Xylene and embedded in paraffin overnight at 60°C. Embedded EBs were then sectioned at
0.4uM and placed on slides for staining. The sections were deparaffinized with xylene,
75
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
rehydrated and stained with Harris Hematoxylin (Surgipath, 01560) and Eosin (Polyscientific,
s176). Additional sections were stained with an anti-β-tubulin (TUJ1) antibody (Covance, MMS435P).
Flow Cytometry Analysis of Cell Cycle and Apoptosis
To analyze cell cycle status, 5x106 cells were fixed in cold 100% ethanol overnight at 4o C, then
washed twice with PBS + 1% BSA, and resuspended in 800ul of PBS + 1% BSA. 100ul of 10x
PI solution (500ug/ml propidium iodine in 38mM sodium citrate, pH 7.0) and 100ul of boiled
RNaseA were added and cells incubated at 37o C for 30 minutes and then analyzed by flow
cytometry. For apoptosis assays, ESCs were treated with the topoisomerase inhibitor Etoposide
(100ng/ml and 1ug/ml) for 18 hrs. Apoptosis was analyzed using an AnnexinV-Cy5 apoptosis
detection kit (Biovision, K103-25) following manufacturer’s instructions. Stained cells were
quantified by flow cytometry.
MNase Immunoprecipitation
MNase immunoprecipitations were performed on H2A.ZWT and H2A.ZK3R3 cell pellets as
described (Sarcinella et al., 2007). Immunoprecipitations were carried out with Protein-G
magnetic beads (Invitrogen) preincubated for 4 hours with 5ug anti-GFP antibody (Abcam,
ab290).
Chromatin Immunoprecipitation
ChIPs were performed on 10-25 million cells as previously described (Wamstad et al., 2012),
with minor modifications. Samples were sonicated in a Diagenode Biorupter in polystyrene tubes
at 4°C while immersed in ice cold water for 30 cycles of 30 sec on, 30 sec off. ChIPs were
washed 2x with Low Salt Buffer (150mM NaCl, 2 mM EDTA, 20mM Tris pH 8.0, 1% Triton X100, 0.1% SDS), 1x with High Salt Buffer (500mM NaCl, 2 mM EDTA, 20mM Tris pH 8.0, 1%
Triton X-100, 0.1% SDS), 2x with LiCl Buffer (250mM LiCl, 1mM EDTA, 10mM Tris pH8.0,
1% NP-40, 1% Na-Deoxycholate), 1x with TE+NaCl (10mM Tris pH 8.0, 1mM EDTA, 50mM
NaCl) and eluted, reverse crosslinked, RNase and Proteinase K treated. Antibodies: GFP
(Abcam, ab290), H2Aub (Millipore, 05-678), H3 (Abcam, ab1791), H3K27me3 (Cell Signaling,
CST #9733S), H3K4me3 (Millipore, 07-473), H3K27Ac (Abcam, ab4729), Ring1b (Atsuta et
76
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
al., 2001), Suz12 (Bethyl A302-407A), Tcf3 (Santa Cruz Biotechnology, sc-8635).
Sequential ChIP: Initial ChIP was performed as above using the GFP antibody with 120 million
cells. Initial ChIP material was eluted from beads twice (5’ at 65oC, 15’ at RT) with 60ul Elution
Buffer (10mM EDTA, 50mM Tris pH8.0, 1% SDS) each elution. Eluates were pooled and
diluted 10x in ChIP Dilution Buffer (167 mM NaCl, 1.2 mM EDTA, 16.7 mM Tris pH8.0, 1.1%
Triton X-100, 0.01% SDS), and divided into aliquots for subsequent ChIP with GFP and H2Aub,
following the above protocol. Because we demonstrated that the H2Aub antibody recognizes the
H2A.Zub (and also H2A.Z-YFPub) and that this recognition is abolished for H2A.ZK3R3 (Figure
S2A), we were able to use H2A.ZK3R3 as a negative control for the sequential ChIP to
demonstrate specificity of H2A.Zub enrichment at bivalent loci.
Site-specific PCR analysis of ChIP
To analyze enrichment at specific loci, quantitative PCR reactions using SYBR Green (KAPA
Biosystems) and gene-specific primers (listed below) were performed on ChIP and whole cell
extract (WCE) DNA. Reactions were performed in triplicate on the Roche LightCycler 480. %
Input was calculated with the following formula: % Input = 2(Cp(WCE)-Cp(IP)) *(%WCE is of total
ChIP input).
ChIP coupled with high-throughput sequencing
Sample Preparation: ~200 ng of DNA was submitted to SPRI-works Fragment Library System I
(Beckman Coulter) for each library prepared. Briefly, the DNA is subjected to size selection
(200-400bp) with magnetic beads, end repaired, then a single adenine nucleotide is added to
allow for directional ligation of adaptors. For this study, a 1:100 dilution of Single End read
adapters (Illumina) was used in the ligation reaction. Each sample was then amplified for 19
cycles, according to the Illumina protocol. The samples were then purified on a Qiagen MinElute
column, and libraries were quantified by Quant-it DNA Assay (Invitrogen, Q-33120), and
examined for proper size and structure by Bioanalyzer (Agilent) and qPCR. Samples were
sequenced on the Illumina GAII.
77
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
ChIP-Seq Data Analysis: ChIP-Seq reads were aligned to the mm9 genome assembly using
Bowtie 0.12.3, allowing for two mismatches. Mapped reads were extended to 200bp, and
allocated in 25-bp bins to determine genomic regions enriched for H2A.Z. As described
previously (Marson et al., 2008), a Poissonian model was used to determine statistically enriched
bins with a P-value threshold of 1x10-12.
RNA isolation, quantitative real-time PCR, and analysis
RNA was extracted using TRIzol (Invitrogen, 15596-018). Purified RNA was reverse transcribed
using SuperScript III (Invitrogen, 18080-044) or M-MLV reverse transcriptase (Invitrogen,
28025-013) and random hexamers according to manufacturer protocols. qPCR reactions were
performed with SYBR Green (KAPA Biosystems) and primers listed in Table S1. Relative
mRNA levels were determined in triplicate for each transcript using the manufacturer’s software
(Advanced Relative Quantification with Roche Lightcycler 480 Software Version 1.5) with
relative Tubb5 levels used for normalization.
RNA-Seq
Library Preparation: RNA was isolated using Trizol as described above. Libraries were prepared
as described previously (Subramanian et al., 2013). Briefly, the purified RNA was the subjected
to oligo (dT) selection, fragmentation, first and double strand synthesis with the Illumina TruSeq kit (RS-930-20 01) according to the manufacturer’s instructions. SPRI-TE beads (Beckmann
Coulter, Agencourt, A63880) were used to purify cDNA fragments larger than 30bp. The
purified cDNA was end-repaired, single A bases were added and adaptor ligated. 200bp
fragments of adaptor-ligated DNA were subjected to purification using SPRI-TE beads. These
fragments were enriched and barcoded by PCR for multiplexing. A final SPRI-TE purification
was performed to clean up the barcoded RNA-Seq libraries. Libraries were barcoded and run on
the Illumina HiSeq with paired-end sequencing.
Analysis: The reads were mapped to mm9 genome using OLego (Wu et al., 2013) (1.1.2).
Known junctions extracted from igenome (Illumina) were provided to OLego to maximize the
sensitivity. Default options were used for OLego. Afterwards, HTSeq-count (0.5.4p1) was used
to summarize the read counts mapped to each transcript (http://www-
78
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
huber.embl.de/users/anders/HTSeq/doc/overview.html). The RPKM values were computed by
normalizing the raw read counts with the transcript lengths and total numbers of reads for each
sample. Raw read counts were used to detect differentially expressed genes using DEseq
(1.10.1) with default parameters (Anders and Huber, 2010). For data analysis and figures
generated in Figure 4/S4, the cutoffs to include a gene in the analysis were as follows: at least 5
reads across the gene in all samples, and at least an RPKM of 1 in any of the samples. The
background for gene ontology was the total list of genes that passed this threshold. Box plots
were generated using BoxPlotR (Spitzer et al., 2014).
TOPFlash Assay
ESCs were plated in duplicate at 10,000 cells/well of a 24-well and were co-transfected 6 hours
later with 25ng pRL-TK (constitutive expression of Renilla Luciferase) and a 1.5ug of a
construct harboring either B-catenin/TCF binding sites upstream of Firefly luciferase (Super8X
TOPFlash, Addgene plasmid 12456) or a mutant version with the B-catenin/TCF binding sites
scrambled (Super 8x FOPFlash, Addgene plasmid 12457) (Veeman et al., 2003). After 48 hours,
cells were lysed in Passive Lysis Buffer and analyzed using the Dual-Luciferase Reporter
System (Promega).
Accession Numbers
All sequencing data reported in this article have been deposited under the GEO accession ID
GSE53208.
Acknowledgements
H2A.ZWT- and H2A.ZK3R3-GFP vectors were a kind gift from Peter Cheung, Ontario Cancer
Institute. Ring1bfl/-; CreERT2 cells were a kind gift from Maarten van Lohuizen. We thank Paul
Fields of the Boyer lab and members of the MIT BioMicro Center, in particular Fugen Li,
Vincent Butty, Jie Wu, and Stuart Levine for assistance with data analysis. We are also grateful
to members of the Boyer lab for helpful and stimulating discussions. This work was supported in
part by the NHLBI Bench to Bassinet Program (U01HL098179) and from the Massachusetts
Life Sciences Center to L.A.B.
79
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
2.5 Supplementary Figures
Figure S1. H2A.Z is a target of Polycomb-mediated monoubiquitylation in mESCs, and
decreases upon differentiation.
A. H2A/H2A.Z containing fractions of RP-HPLC fractionated, acid-extracted histones from
mESCs were subjected to SDS-PAGE. The boxed band was excised, propionylated, cleaved with
chymotrypsin and analyzed by LC-MS. 3 LC-resolved features had the proper accurate mass
MS1 indicating ubiqutylation near the carboxy-terminus. B-D. MS2 spectra confirm the presence
of ubiquityl on K120 (B), K121 (C) and K125 (D) on H2A.Z in mESC. Key fragment ions
localizing the position of the ubiquityl adduct are indicated (* = b-ions; # = y-ions). E. MS2
analysis identified the presence of three independent H2A.Z carboxy-termini with a monoubiquityl group on either K120, K121 or K125. F. Ring1bfl/- conditional knockout cells were
treated with 4-hydroxytamoxifen (4-OHT) for 0, 1.5 and 4 days. Quantification of the relative
amount of H2A.Zub as in A-D shows that loss of Ring1b leads to a dramatic reduction in
H2A.Zub. Ratios were normalized to the amount of H4 in a lower band of the same lane in the
SDS-PAGE gel. G. SILAC (Stable Isotope Labeling by Amino acids in Cell culture) was used to
quantify differences in H2A.Zub levels in mESCs vs. mESCs + 5 days retinoic acid and between
mESCs and NPCs (neural precursor cells), finding that H2A.Zub decreases upon differentiation.
Error bars represent standard deviation, and values were normalized using relative H4 levels.
80
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Figure 2.S2
B
IP: GFP WB: H2Aub
H2A.ZWT
H2A.ZK3R3
+D
+D
-D
-D
Relative levels H2AZ/H3
A
H2A.Z-YFPub
Endogenous H2A.Z
1.2
1
0.8
0.6
0.4
0.2
0
H2A.ZWT H2A.ZK3R3 H2A.ZWT H2A.ZK3R3
-
Endogenous
H2A/.Zub
D
1.4
70
1
0.8
0.6
0.4
0.2
Nanog
Oct4
+
+
E
80
1.2
0
+
90
% of Cells
Relative expression
1.6
+
-
100
H2A.ZWT
H2A.ZK3R3
1.8
-
S
60
G2
50
G1
40
30
20
10
0
% of Cells Annexin-V+, PI-
C
+
-
+
ESCs +Lif
:Dox
:3’UTR shRNA
35
30
H2A.ZWT
H2A.ZK3R3
25
20
15
10
5
0
H2A.ZWT H2A.ZK3R3 H2A.ZWT H2A.ZK3R3
+
+
1 ug/ml
No Stress 100 ng/ml
Etoposide Etoposide
ESCs-Lif 5 days
Figure 2.S2. Loss of H2A.Z ubiquitylation does not affect cell cycle or apoptosis.
A. Mutation of H2A.Z carboxy-terminal lysine residues results in loss of ubiquitylation. Histone
extracts from H2A.ZWT and H2A.ZK3R3 ESCs (+/- doxycycline) were subject to
immunoprecipitation with GFP antibody and blotted for H2Aub (which recognizes H2A.Zub). B.
Quantification of Western blots in Figure 1B. Levels of endogenous H2A.Z in the various cell
lines were normalized against H2AZWT (no Dox, no shRNA), using levels of H3 as a
normalization control. C. Expression of Nanog and Oct4 as detected by qRT-PCR in H2A.ZWT
and H2A.ZK3R3 ESCs. Values were normalized to H2A.ZWT ESCs using Tubb5. Error bars
represent the standard deviation of triplicate reactions. D. H2A.ZWT and H2A.ZK3R3 ESCs and
ESCs grown in –LIF conditions for 5 days, were subjected to cell cycle and proliferation analysis
using propidium iodine and FACS. E. H2A.ZK3R3 ESCs do not have increased levels of
apoptosis, as measured by FACS using Annexin-V and propidium iodine. Addition of the
topoisomerase inhibitor Etoposide (100ng/ml and 1ug/ml) does not lead to increased levels of in
H2A.ZK3R3 ESCs compared to H2A.ZWT ESCs.
81
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
82
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Figure 2.S3. H2A.Z ubiquitylation does not affect H2A.Z incorporation.
A. The binding pattern of H2A.ZWT replicates and H2A.ZK3R3 are largely similar across the HoxA
locus, as well as Nestin and Brachyury. Gene tracks are shown in reads per million (RPM).
Replicate tracks of H3K4me3 and H3K27me3 ChIP-Seq data (Wamstad et al., 2012) are
included for comparison. B. Average read density plots of H2A.ZWT (two replicates) and
H2A.ZK3R3 across all transcriptional start sites. C. qPCR analysis of independent H2A.ZWT and
H2A.ZK3R3 ChIPs using primers targeted to promoters of genes indicated. D. Venn diagram of
H3K27Ac+ enhancers (Wamstad et al., 2012) that overlap H2A.ZWT and H2A.ZK3R3 by at least
one base pair. E. Average read density plots of H2A.ZWT and H2A.ZK3R3 at the 2,715 H3K27Ac+
ESC enhancers that overlap H2A.ZWT and H2A.ZK3R3, plotted +/- 2kb relative to center of
enhancer. F. ChIP-qPCR for endogenous H2A.Z in Ring1bfl/- and Ring1b-/- ESCs demonstrates
that lack of Ring1b does not affect H2A.Z localization at several target genes. % Input is
calculated using 2(Cp(WCE)-Cp(IP))*(%WCE is of total ChIP input). Error bars represent the standard
deviation of triplicate qPCR reactions. G. H2A.ZWT and H2A.ZK3R3 histones have similar
dynamics in ESCs as demonstrated in mean recovery curves of FRAP (Fluorescence Recovery
After Photobleaching) analyses. Each point represents the mean fluorescence intensity measured
every 30secs, of a region that undergoes photobleaching. Mean recovery curves are an average of
individual curves from n=11 cells of H2A.ZWT and n=12 cells for H2A.ZK3R3.
83
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Figure S4. H2A.Zub functions to regulate developmental signaling pathways
A. Box plots represent the log2 fold change in expression of either H2A.ZK3R3 ESCs or H2A.ZKD
ESCs relative to H2A.ZWT at all (13857 genes), active (11010), bivalent (1611) or K4me3- (61)
genes. An expression threshold of 5 reads per sample was used. Classifications are from
(Subramanian et al., 2013). Center lines show the medians; box limits indicate the 25th and 75th
percentiles; whiskers extend 1.5 times the interquartile range from the 25th and 75th percentiles,
outliers are represented by dots. B. Heatmap representation of ChIP-Seq data of total RNAPII
(Rahl et al., 2010), H3K4me3 and H3K27me3 (Wamstad et al., 2012), and H2A.ZWT. Heatmaps
are centered on transcriptional start sites (TSSs) of all genes ordered from most H2K27me3
enriched promoters to least and extend +/- 2kb. C. The 265 up-regulated genes were submitted
to Ingenuity Pathway Analysis and enriched upstream cytokines are displayed. D. Expression of
Tcf3 and β-catenin in H2A.ZK3R3 ESCs is similar to that of H2A.ZWT ESCs as detected by qRT84
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
PCR. Values were normalized to H2A.ZWT ESCs using Tubb5. Error bars represent the standard
deviation of triplicate reactions. E. Cumulative density plots of the log2 fold change in
expression in H2A.ZK3R3 ESCs. Black line represents all genes (with expression above our
detection threshold of an RPKM of at least 1 in any sample and 5 unique reads in each samples).
Using this same expression threshold, those genes previously reported as up-regulated 2-fold or
more in ESCs grown in either Serum (1208 of 1947 genes passed threshold) or 2i (850 of 1489
genes passed expression threshold) media conditions (Marks et al., 2012) were plotted
independently, which demonstrates that serum-specific (and not 2i-specific) transcripts are more
upregulated in H2A.ZK3R3 ESCs. F. Western blots for phospho-Erk, Erk demonstrate that Erk
signaling is largely similar between H2A.ZK3R3 and H2A.ZK3R3 ESCs. Right bar graph represents
quantification of Western, where value is the ratio of pErk/Erk in H2A.ZK3R3 ESCs normalized to
the ratio in H2A.ZWT ESCs. Error bars represent the standard deviation of several quantification
methods.
2.6 References
Anders, S., and Huber, W. (2010). Differential expression analysis for sequence count data.
Genome Biology 11, R106.
Atsuta, T., Fujimura, S., Moriya, H., Vidal, M., Akasaka, T., and Koseki, H. (2001). Production
of monoclonal antibodies against mammalian Ring1B proteins. Hybridoma 20, 43–46.
Beard, C., Hochedlinger, K., Plath, K., Wutz, A., and Jaenisch, R. (2006). Efficient method to
generate single-copy transgenic mice by site-specific integration in embryonic stem cells.
Genesis 44, 23–28.
Bellucci, L., Dalvai, M., Kocanova, S., Moutahir, F., and Bystricky, K. (2013). Activation of p21
by HDAC inhibitors requires acetylation of H2A.Z. PLoS ONE 8, e54102.
Bendall, S.C., Hughes, C., Stewart, M.H., Doble, B., Bhatia, M., and Lajoie, G.A. (2008).
Prevention of amino acid conversion in SILAC experiments with embryonic stem cells.
Molecular & Cellular Proteomics 7, 1587–1597.
Berge, ten, D., Koole, W., Fuerer, C., Fish, M., Eroglu, E., and Nusse, R. (2008). Wnt signaling
mediates self-organization and axis formation in embryoid bodies. Cell Stem Cell 3, 508–518.
Berge, ten, D., Kurek, D., Blauwkamp, T., Koole, W., Maas, A., Eroglu, E., Siu, R.K., and
Nusse, R. (2011). Embryonic stem cells require Wnt proteins to prevent differentiation to
epiblast stem cells. Nature Cell Biology 13, 1070–1075.
Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner,
A., Wernig, M., Plath, K., et al. (2006). A bivalent chromatin structure marks key developmental
genes in embryonic stem cells. Cell 125, 315–326.
Bhattacharya, D., Talwar, S., Mazumder, A., and Shivashankar, G.V. (2009). Spatio-temporal
85
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
plasticity in chromatin organization in mouse cell differentiation and during Drosophila
embryogenesis. Biophys. J. 96, 3832–3839.
Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S.,
Wernig, M., Tajonar, A., Ray, M.K., et al. (2006). Polycomb complexes repress developmental
regulators in murine embryonic stem cells. Nature 441, 349–353.
Brookes, E., de Santiago, I., Hebenstreit, D., Morris, K.J., Carroll, T., Xie, S.Q., Stock, J.K.,
Heidemann, M., Eick, D., Nozaki, N., et al. (2012). Polycomb associates genome-wide with a
specific RNA polymerase II variant, and regulates metabolic genes in ESCs. Cell Stem Cell 10,
157–170.
Bruce, K., Myers, F.A., Mantouvalou, E., Lefevre, P., Greaves, I., Bonifer, C., Tremethick, D.J.,
Thorne, A.W., and Crane-Robinson, C. (2005). The replacement histone H2A.Z in a
hyperacetylated form is a feature of active genes in the chicken. Nucleic Acids Research 33,
5633–5639.
Caronna, E.A., Patterson, E.S., Hummert, P.M., and Kroll, K.L. (2013). Geminin Restrains
Mesendodermal Fate Acquisition of Embryonic Stem Cells and is Associated with Antagonism
of Wnt Signaling and Enhanced Polycomb-Mediated Repression. Stem Cells 31, 1477–1487.
Chang, C.-J., and Hung, M.-C. (2012). The role of EZH2 in tumour progression. Br. J. Cancer
106, 243–247.
Coleman-Derr, D., and Zilberman, D. (2012). Deposition of histone variant H2A.Z within gene
bodies regulates responsive genes. PLoS Genet 8, e1002988.
Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young, R.A.,
Jaenisch, R., and Boyer, L.A. (2008). H2AZ is enriched at polycomb complex target genes in ES
cells and is necessary for lineage commitment. Cell 135, 649–661.
Dalvai, M., Bellucci, L., Fleury, L., Lavigne, A.-C., Moutahir, F., and Bystricky, K. (2012).
H2A.Z-dependent crosstalk between enhancer and promoter regulates Cyclin D1 expression. 1–
9.
de Napoles, M., Mermoud, J.E., Wakao, R., Tang, Y.A., Endoh, M., Appanah, R., Nesterova,
T.B., Silva, J., Otte, A.P., Vidal, M., et al. (2004). Polycomb group proteins Ring1A/B link
ubiquitylation of histone H2A to heritable gene silencing and X inactivation. Developmental Cell
7, 663–676.
Draker, R., Ng, M.K., Sarcinella, E., Ignatchenko, V., Kislinger, T., and Cheung, P. (2012). A
combination of H2A.Z and H4 acetylation recruits Brd2 to chromatin during transcriptional
activation. PLoS Genet 8, e1003047.
Draker, R., Sarcinella, E., and Cheung, P. (2011). USP10 deubiquitylates the histone variant
H2A.Z and both are required for androgen receptor-mediated gene activation. Nucleic Acids
Research 39, 3529–3542.
86
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Dryhurst, D., McMullen, B., Fazli, L., Rennie, P.S., and Ausió, J. (2012). Histone H2A.Z
prepares the prostate specific antigen (PSA) gene for androgen receptor-mediated transcription
and is upregulated in a model of prostate cancer progression. Cancer Letters 315, 38–47.
Endoh, M., Endo, T.A., Endoh, T., Isono, K.-I., Sharif, J., Ohara, O., Toyoda, T., Ito, T.,
Eskeland, R., Bickmore, W.A., et al. (2012). Histone H2A mono-ubiquitination is a crucial step
to mediate PRC1-dependent repression of developmental genes to maintain ES cell identity.
PLoS Genet 8, e1002774.
Faast, R., Thonglairoam, V., Schulz, T.C., Beall, J., Wells, J.R., Taylor, H., Matthaei, K.,
Rathjen, P.D., Tremethick, D.J., and Lyons, I. (2001). Histone variant H2A.Z is required for
early mammalian development. Curr. Biol. 11, 1183–1187.
Fujimoto, S., Seebart, C., Guastafierro, T., Prenni, J., Caiafa, P., and Zlatanova, J. (2012).
Proteome analysis of protein partners to nucleosomes containing canonical H2A or the variant
histones H2A.Z or H2A.X. Biological Chemistry 393, 47–61.
Garcia, B.A., Mollah, S., Ueberheide, B.M., Busby, S.A., Muratore, T.L., Shabanowitz, J., and
Hunt, D.F. (2007). Chemical derivatization of histones for facilitated analysis by mass
spectrometry. Nature Protocols 2, 933–938.
Gévry, N., Hardy, S., Jacques, P.-É., Laflamme, L., Svotelis, A., Robert, F., and Gaudreau, L.
(2009). Histone H2A.Z is essential for estrogen receptor signaling. Genes & Development 23,
1522–1533.
Hardy, S., Jacques, P.-É., Gévry, N., Forest, A., Fortin, M.-È., Laflamme, L., Gaudreau, L., and
Robert, F. (2009). The euchromatic and heterochromatic landscapes are shaped by antagonizing
effects of transcription on H2A.Z deposition. PLoS Genet 5, e1000687.
Hu, G., Cui, K., Northrup, D., Liu, C., Wang, C., Tang, Q., Ge, K., Levens, D., Crane-Robinson,
C., and Zhao, K. (2013). H2A.Z facilitates access of active and repressive complexes to
chromatin in embryonic stem cell self-renewal and differentiation. Cell Stem Cell 12, 180–192.
Hua, S., Kallen, C.B., Dhar, R., Baquero, M.T., Mason, C.E., Russell, B.A., Shah, P.K., Liu, J.,
Khramtsov, A., Tretiakova, M.S., et al. (2008). Genomic analysis of estrogen cascade reveals
histone variant H2A.Z associated with breast cancer progression. Mol Syst Biol 4, 188.
Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2009a). Bioinformatics enrichment tools:
paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research
37, 1–13.
Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2009b). Systematic and integrative analysis
of large gene lists using DAVID bioinformatics resources. Nature Protocols 4, 44–57.
Illingworth, R.S., Botting, C.H., Grimes, G.R., Bickmore, W.A., and Eskeland, R. (2012). PRC1
and PRC2 are not required for targeting of H2A.Z to developmental genes in embryonic stem
cells. PLoS ONE 7, e34848.
87
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Jaffe, J.D., Keshishian, H., Chang, B., Addona, T.A., Gillette, M.A., and Carr, S.A. (2008).
Accurate inclusion mass screening: a bridge from unbiased discovery to targeted assay
development for biomarker verification. Molecular & Cellular Proteomics 7, 1952–1962.
Kelly, K.F., Ng, D.Y., Jayakumaran, G., Wood, G.A., Koide, H., and Doble, B.W. (2011). βcatenin enhances Oct-4 activity and reinforces pluripotency through a TCF-independent
mechanism. Cell Stem Cell 8, 214–227.
Ku, M., Jaffe, J.D., Koche, R.P., Rheinbay, E., Endoh, M., Koseki, H., Carr, S.A., and Bernstein,
B.E. (2012). H2A.Z landscapes and dual modifications in pluripotent and multipotent stem cells
underlie complex genome regulatory functions. Genome Biology 13, R85.
Kumar, S.V., and Wigge, P.A. (2010). H2A.Z-containing nucleosomes mediate the
thermosensory response in Arabidopsis. Cell 140, 136–147.
Lento, W., Congdon, K., Voermans, C., Kritzik, M., and Reya, T. (2013). Wnt signaling in
normal and malignant hematopoiesis. Cold Spring Harbor Perspectives in Biology 5.
Liu, X., Bowen, J., and Gorovsky, M.A. (1996). Either of the major H2A genes but not an
evolutionarily conserved H2A.F/Z variant of Tetrahymena thermophila can function as the sole
H2A gene in the yeast Saccharomyces cerevisiae. Molecular and Cellular Biology 16, 2878–
2887.
Marks, H., Kalkan, T., Menafra, R., Denissov, S., Jones, K., Hofemeister, H., Nichols, J., Kranz,
A., Stewart, A.F., Smith, A., et al. (2012). The transcriptional and epigenomic foundations of
ground state pluripotency. Cell 149, 590–604.
Marson, A., Levine, S.S., Cole, M.F., Frampton, G.M., Brambrink, T., Johnstone, S., Guenther,
M.G., Johnston, W.K., Wernig, M., Newman, J., et al. (2008). Connecting microRNA genes to
the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134, 521–533.
Mavrich, T.N., Jiang, C., Ioshikhes, I.P., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P., Qi, J.,
Glaser, R.L., Schuster, S.C., et al. (2008). Nucleosome organization in the Drosophila genome.
Nature 453, 358–362.
Merrill, B.J. (2012). Wnt pathway regulation of embryonic stem cell self-renewal. Cold Spring
Harbor Perspectives in Biology 4, a007971.
Meshorer, E., Yellajoshula, D., George, E., Scambler, P.J., Brown, D.T., and Misteli, T. (2006).
Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells.
Developmental Cell 10, 105–116.
Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P.,
Brockman, W., Kim, T.-K., Koche, R.P., et al. (2007). Genome-wide maps of chromatin state in
pluripotent and lineage-committed cells. Nature 448, 553–560.
Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. (2006). Acetylation of H2AZ Lys 14 is
associated with genome-wide gene activity in yeast. Genes & Development 20, 711–722.
88
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
Min, I.M., Waterfall, J.J., Core, L.J., Munroe, R.J., Schimenti, J., and Lis, J.T. (2011).
Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells.
Genes & Development 25, 742–754.
Minami, I., Yamada, K., Otsuji, T.G., Yamamoto, T., Shen, Y., Otsuka, S., Kadota, S., Morone,
N., Barve, M., Asai, Y., et al. (2012). A small molecule that promotes cardiac differentiation of
human pluripotent stem cells under defined, cytokine- and xeno-free conditions. Cell Reports 2,
1448–1460.
Murry, C.E., and Keller, G. (2008). Differentiation of embryonic stem cells to clinically relevant
populations: lessons from embryonic development. Cell 132, 661–680.
Pera, M.F., and Tam, P.P.L. (2010). Extrinsic regulation of pluripotent stem cells. Nature 465,
713–720.
Rahl, P.B., Lin, C.Y., Seila, A.C., Flynn, R.A., McCuine, S., Burge, C.B., Sharp, P.A., and
Young, R.A. (2010). c-Myc regulates transcriptional pause release. Cell 141, 432–445.
Ridgway, P., Brown, K.D., Rangasamy, D., Svensson, U., and Tremethick, D.J. (2004). Unique
residues on the H2A.Z containing nucleosome surface are important for Xenopus laevis
development. J. Biol. Chem. 279, 43815–43820.
Sarcinella, E., Zuzarte, P.C., Lau, P.N.I., Draker, R., and Cheung, P. (2007). Monoubiquitylation
of H2A.Z distinguishes its association with euchromatin or facultative heterochromatin.
Molecular and Cellular Biology 27, 6457–6468.
Sawarkar, R., and Paro, R. (2010). Interpretation of developmental signaling at chromatin: the
Polycomb perspective. Developmental Cell 19, 651–661.
Spitzer, M., Wildenhain, J., Rappsilber, J., and Tyers, M. (2014). BoxPlotR: a web tool for
generation of box plots. Nat Meth 11, 121–122.
Stock, J.K., Giadrossi, S., Casanova, M., Brookes, E., Vidal, M., Koseki, H., Brockdorff, N.,
Fisher, A.G., and Pombo, A. (2007). Ring1-mediated ubiquitination of H2A restrains poised
RNA polymerase II at bivalent genes in mouse ES cells. Nature Cell Biology 9, 1428–1435.
Subramanian, V., Mazumder, A., Surface, L.E., Butty, V.L., Fields, P.A., Alwan, A., Torrey, L.,
Thai, K.K., Levine, S.S., Bathe, M., et al. (2013). H2A.Z Acidic Patch Couples Chromatin
Dynamics to Regulation of Gene Expression Programs during ESC Differentiation. PLoS Genet
9, e1003725.
Surface, L.E., Thornton, S.R., and Boyer, L.A. (2010). Polycomb group proteins set the stage for
early lineage commitment. Cell Stem Cell 7, 288–298.
Thomas, C.E., Kelleher, N.L., and Mizzen, C.A. (2006). Mass spectrometric characterization of
human histone H3: a bird's eye view. J. Proteome Res. 5, 240–247.
Valdés-Mora, F., Song, J.Z., Statham, A.L., Strbenac, D., Robinson, M.D., Nair, S.S., Patterson,
89
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
K.I., Tremethick, D.J., Stirzaker, C., and Clark, S.J. (2012). Acetylation of H2A.Z is a key
epigenetic modification associated with gene deregulation and epigenetic remodeling in cancer.
Genome Research 22, 307–321.
van Daal, A., and Elgin, S.C. (1992). A histone variant, H2AvD, is essential in Drosophila
melanogaster. Molecular Biology of the Cell 3, 593–602.
van der Stoop, P., Boutsma, E.A., Hulsman, D., Noback, S., Heimerikx, M., Kerkhoven, R.M.,
Voncken, J.W., Wessels, L.F.A., and van Lohuizen, M. (2008). Ubiquitin E3 ligase Ring1b/Rnf2
of polycomb repressive complex 1 contributes to stable maintenance of mouse embryonic stem
cells. PLoS ONE 3, e2235.
Vastenhouw, N.L., and Schier, A.F. (2012). Bivalent histone modifications in early
embryogenesis. Current Opinion in Cell Biology 24, 374–386.
Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H., and Moon, R.T. (2003). Zebrafish
prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr.
Biol. 13, 680–685.
Wamstad, J.A., Alexander, J.M., Truty, R.M., Shrikumar, A., Li, F., Eilertson, K.E., Ding, H.,
Wylie, J.N., Pico, A.R., Capra, J.A., et al. (2012). Dynamic and coordinated epigenetic
regulation of developmental transitions in the cardiac lineage. Cell 151, 206–220.
Wang, A.Y., Aristizabal, M.J., Ryan, C., Krogan, N.J., and Kobor, M.S. (2011). Key functional
regions in the histone variant H2A.Z C-terminal docking domain. Molecular and Cellular
Biology 31, 3871–3884.
Weber, C.M., Henikoff, J.G., and Henikoff, S. (2010). H2A.Z nucleosomes enriched over active
genes are homotypic. Nature Structural & Molecular Biology 17, 1500–1507.
Whittle, C.M., McClinic, K.N., Ercan, S., Zhang, X., Green, R.D., Kelly, W.G., and Lieb, J.D.
(2008). The genomic distribution and function of histone variant HTZ-1 during C. elegans
embryogenesis. PLoS Genet 4, e1000187.
Wratting, D., Thistlethwaite, A., Harris, M., Zeef, L.A.H., and Millar, C.B. (2012). A conserved
function for the H2A.Z C terminus. Journal of Biological Chemistry 287, 19148–19157.
Wray, J., Kalkan, T., Gomez-Lopez, S., Eckardt, D., Cook, A., Kemler, R., and Smith, A. (2011).
Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repression of the pluripotency network
and increases embryonic stem cell resistance to differentiation. Nature Cell Biology 13, 838–
845.
Wu, J., Anczuków, O., Krainer, A.R., Zhang, M.Q., and Zhang, C. (2013). OLego: fast and
sensitive mapping of spliced mRNA-Seq reads using small seeds. Nucleic Acids Research 41,
5149–5163.
Wysocka, J., Reilly, P.T., and Herr, W. (2001). Loss of HCF-1-chromatin association precedes
temperature-induced growth arrest of tsBN67 cells. Molecular and Cellular Biology 21, 3820–
90
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
3829.
Yang, S.-H., Kalkan, T., Morrisroe, C., Smith, A., and Sharrocks, A.D. (2012). A genome-wide
RNAi screen reveals MAP kinase phosphatases as key ERK pathway regulators during
embryonic stem cell differentiation. PLoS Genet 8, e1003112.
Yi, F., Pereira, L., Hoffman, J.A., Shy, B.R., Yuen, C.M., Liu, D.R., and Merrill, B.J. (2011).
Opposing effects of Tcf3 and Tcf1 control Wnt stimulation of embryonic stem cell self-renewal.
Nature Cell Biology 13, 762–770.
Ying, Q.-L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and
Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature 453, 519–523.
Young, R.A. (2011). Control of the embryonic stem cell state. Cell 144, 940–954.
91
Chapter 2 | H2A.Zub regulates lineage commitment in ESCs
92
Chapter 3
Ubiquitylation mediates the protein interaction
landscape of H2A.Z
Lauren E. Surface1, Paul A. Fields1, Jake Jaffe2, Laurie A. Boyer1
1
Department of Biology, Massachusetts Institute of Technology, 77 Massachusetts Avenue
Cambridge, MA 02139 USA; 2Broad Institute, 7 Cambridge Center, Cambridge, MA 02142
USA
Author contributions
P.A.F. performed the SILAC-MNase-IPs. J.J. executed the mass spectrometry and analysis.
L.E.S. performed all experimental validation and characterization of protein interactions.
93
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
Abstract
The histone variant H2A.Z has functions in diverse cellular processes including gene regulation.
While PRC1-mediated mono-ubiquitylation of H2A.Z is necessary for proper lineage
commitment and responsiveness to signaling cues, its role in this process is poorly understood.
Because ubiquitin moieties often mediate downstream interactions with important regulatory
factors, we analyzed changes in the H2A.Z protein-interaction landscape upon loss of H2A.Zub
using quantitative mass spec. We found that loss of H2A.Z ubiquitylation altered the protein
interaction landscape of H2A.Z chromatin. Specifically, H2A.Z ubiquitylation modulates
interactions with the DNA methyltransferase machinery, and is important for maintaining proper
levels of DNA methylation. In addition, loss of H2A.Z ubiquitylation leads to increased
interactions with repressive histone methyltransferases, resulting in an increase in repressive
histone modifications, particularly at imprinted loci. Furthermore, H2A.Z ubiquitylation may
play a crucial role in the DNA damage response by Together, these data suggest
94
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
3.1 Introduction
Chromatin organization can have dramatic consequences on cell state, and can influence all
DNA mediated processes. Site-specific incorporation of histone variants can impart additional
functional specialization on chromatin. The essential histone H2A variant H2A.Z has been
implicated in a wide variety of biological processes, including gene regulation, chromosomal
segregation, response to DNA damage (Billon and Côté, 2012; Millar, 2013). How this histone
variant controls these processes is poorly understood. Emerging evidence indicates that H2A.Z
functions in a context-dependent manner that depends on histone post-translational modifications
and chromatin-associated proteins (Bonisch and Hake, 2012). For example, H2A.Z is subject to a
similar repertoire of post-translational modifications as core histones. In particular, N-terminal
H2A.Z acetylation correlates with transcriptional activation (Bellucci et al., 2013; Ku et al.,
2012; Valdés-Mora et al., 2012). In contrast, H2A.Z mono-ubiquitylation has been linked with
heterochromatic regions, including the inactive X chromosome (Sarcinella et al., 2007). In the
previous chapter, we demonstrated a role in embryonic stem cells (ESCs) for Polycombmediated H2A.Z mono-ubiquitylation at poised bivalent genes. Our work suggests that H2A.Zub
is critical for regulating the response to developmental signaling cues. Determining how
H2A.Zub influences chromatin structure and gene expression programs will be critical for
understanding its essential functions during mammalian development.
H2A.Z incorporation may provide a novel scaffold for the recruitment of other regulatory
factors. Consistent with this idea, H2A.Z interacts with a distinct set of binding partners
compared to H2A (Draker et al., 2012; Fujimoto et al., 2012). These interactions are often
dependent on the surrounding chromatin environment. For example, the bromodomain protein
Brd2 specifically interacts with H2A.Z-containing nucleosomes, but this interaction is highly
dependent on the presence of acetylated H4, suggesting a combinatorial action of H2A.Z and
other chromatin modifications. Furthermore, histone post-translational modifications, including
mono-ubiquitylation, often serve as binding platforms for downstream effectors (Braun and
Madhani, 2012). Thus, determining the effect of loss of mono-ubiquitylation on the chromatin
environment of H2A.Z nucleosomes may lend insights into how H2A.Z regulates the poised
state as well as the responsiveness to developmental cues.
95
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
We hypothesized that loss of ubiquitylation may disrupt or promote interactions with H2A.Z
bound chromatin. To test this idea, we analyzed H2A.Z specific interactions by using
immunoprecipation and quantitative proteomics to determine differential protein interactions
between wildtype and a version of H2A.Z where the three C-terminal lysines were mutated to
arginine (K120, K121, and K125, denoted as H2A.ZK3R3). Notably, we found that loss of
H2A.Zub led to a depletion of interactions with DNA methyltransferases and proteins involved
in the DNA damage response, and enrichment of interactions with several repressive histone
methyltransferases. We confirmed several of these differential interactions, and explored their
functions on H2A.Z regulation. For example, we found a decrease in global DNA methylation
levels upon loss of H2A.Z mono-ubiquitylation, increased levels of silencing-associated histone
modifications at imprinted loci, and a disrupted response to DNA damage. Thus, our results
reveal potentially new regulatory pathways that coordinate with H2A.Z and demonstrate the
importance of post-translational modifications in defining the H2A.Z protein interaction
landscape.
3.2 Results and Discussion
Mono-ubiquitylation mediates specific H2A.Z protein interactions
To investigate the set of protein interactions mediated by H2A.Zub, we combined
immunoprecipitation with quantitative proteomics. H2A.ZWT and H2A.ZK3R3 ESCs (described in
Chapter 2) were cultured in “heavy” and “light” SILAC (Stable Isotope Labeling by Amino acids
in Cell culture) media (Ong and Mann, 2006; Ong et al., 2002) for 4 passages to allow for
incorporation of isotope labeled amino acids. H2A.Z-enriched chromatin was isolated from
MNase-treated extracts using a GFP antibody (as both H2A.ZWT and H2A.ZK3R3 molecules are
tagged with YFP, immunoprecipitates from each cell type (one labeled in “heavy” media, one
labeled in “light”) were pooled 1:1, subjected to SDS-PAGE and in-gel tryptic digestion, and
quantified by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) to
identify differentially interacting proteins (Figure 3.1A). From the relative numbers of the
“heavy” vs. “light” peptides for each protein, we quantified differences in H2A.ZWT and
H2A.ZK3R3 interactions. In order to account for differences in background, this experiment was
performed in duplicate with the labeled isotopes reversed.
96
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
We reasoned that under-represented peptides associated with the H2A.ZK3R3 chromatin fraction
represent a set of proteins that bind to H2A.Zub. Conversely, enriched peptides associated with
H2A.ZK3R3 may normally be inhibited by mono-ubiquitylation. Using SILAC-IP-MS/MS, we
detected a number of differential interactions. A table listing all proteins detected, with detection
ratios and moderated p-values are listed in Table 3.1. Given that H2A.Z functions in specific
process including chromatin and gene regulation, we expected that interacting proteins would
have similar functions. In order to test this idea, we utilized the program STRING (Franceschini
et al., 2013), which builds network connections between proteins based on a number of criteria
including direct binding, co-expression patterns, and co-mentions in PubMed abstracts, and can
97
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
add further proteins which may build the information content and connections within the
network. Figure 3.1B highlights one of the nodes of the network built from proteins depleted in
H2A.ZK3R3 interacting chromatin, and includes several chromatin modifiers, including DNA
methyltransferases (DNM3A/B), BAF chromatin remodeling components (SMARCD1/2), the
histone H3K9/K36 demethylase KDM4A (i.e. JMJD42A), among others. We then analyzed the
functions of the set of differentially enriched proteins (61 proteins over-enriched and 99 proteins
under-enriched) using gene ontology (GO) analysis by DAVID (Huang et al., 2009a; 2009b),
setting the background as all genes that code for proteins detected by MS/MS (1299) (Figure
3.1C-D). These data revealed an enrichment of chromatin-related functions, and unexpectedly,
terms associated with translational regulation. We focused further attention on those factors that
have known roles in chromatin and epigenetic regulation as we wanted to dissect the function of
chromatin-associated H2A.Z.
DNA methylation is dependent on H2A.Z ubiquitylation
Notably, we found that DNA-methylation associated proteins were depleted in H2A.ZK3R3
interactions compared to H2A.ZWT. Several reports have suggested that H2A.Z and DNA
methylation anti-correlate in the genomes of both plants and mammals (Coleman-Derr and
Zilberman, 2012; Conerly et al., 2010; Yang et al., 2012; Zemach et al., 2010; Zilberman et al.,
2008) and that DNA methylation excludes H2A.Z at both repetitive regions and in gene bodies,
though the mechanism of this relationship remains to be elucidated. DNA methylation plays a
key role in mammalian development (Smith and Meissner, 2013), and is dynamically regulated
during ESC differentiation(Gifford et al., 2013; Ziller et al., 2013). Similar to H2A.Z depletion,
the lack of DNA methylation does not impact ESC state (Tsumura et al., 2006), rather DNA
methylation-deficient cells are unable to undergo lineage commitment and fail to activate early
developmental regulators (Jackson et al., 2004). These data suggest an important functional
connection between H2A.Z and the DNA methylation machinery in ESCs.
Because we observed that loss of ubiquitylation led to decreased interactions with the de novo
DNA methyltransferases, DNMT3A and DNMT3B, we compared DNA methylation levels in
wild-type and mutant ESCs. First, we confirmed a decreased interaction in H2A.ZK3R3 via
MNase-IP followed by Western blotting for both DNMT3A and DNMT3B (Figure 3.2A).
98
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
Importantly, this decrease is not due to lower expression of DNA methyltransferases in mutant
cells (Figure 3.2B). We next profiled global methylation levels by hybridizing serial dilutions of
total genomic DNA onto a membrane followed by blotting with 5mC specific antibodies. This
analysis revealed globally decreased levels of 5-methylcytosine (5mC) in H2A.ZK3R3 ESCs
(Figure 3.2C). Additionally, we observed decreased 5-hydroxymethylcytosine (5hmC), a
modification generated by active Tet-mediated demethylation of 5mC, by slot blot with 5hmC
antibodies. These data indicate that loss of H2A.Zub does not promote the recruitment of Tet
enzymes, thereby generating increased levels of 5hmC, but instead it leads to decreased levels of
both 5mC and 5hmC. Notably, we also found that 5mC and 5hmC showed decreased enrichment
at reported target sites (from (Atlasi et al., 2013; Ficz et al., 2011; 2013)) in H2A.ZK3R3 genomic
DNA by Me-DIP using antibodies specific for each modification (Figure 3.2D,E). Thus,
H2A.Zub may regulate the recruitment of de novo methyltransferases and subsequent DNA
methylation at bivalent genes that become permanently silenced during lineage commitment.
Our data suggest that H2A.Zub functions to recruit DNA methyltransferases to specific sites in
the genome. We previously demonstrated Polycomb-mediated H2A.Zub is enriched at bivalent,
poised promoters of ESCs. A subset of both active and bivalent promoters is characterized by
high CpG content, and these regions are largely unmethylated in ESCs (Meissner et al., 2008;
Mikkelsen et al., 2007). Upon differentiation, the CpG islands of genes that resolve from the
bivalent state into a silent state become hypermethylated, a mechanism that promotes stable
silencing (Meissner et al., 2008; Mohn et al., 2008). Thus, H2A.Zub may recruit DNA
methyltransferases at a low level to help keep bivalent genes silent. This recruitment may be
critical for rapid silencing of these developmental regulators in lineage-committed cells where
the expression of these genes is not required.
Alternatively, the decreased association of DNA methyltransferases and decreased DNA
methylation may be a more direct consequence of the decreased Polycomb complex binding
observed in H2A.ZK3R3 ESCs (see Chapter 2). Previous studies have reported a direct interaction
between the PRC2 component EZH2 and DNMT3A (Rush et al., 2009; Viré et al., 2006).
Conversely, the decrease in Polycomb and H3K27me3 enrichment in H2A.ZK3R3 ESCs may be
99
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
100
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
due to DNA hypomethylation, which has been observed in mouse fibroblasts and ESCs
(Brinkman et al., 2012; Reddington et al., 2013). However, evidence for the recruitment of
Polycomb by DNA methylation is conflicting, as other studies suggest an antagonist relationship
between Polycomb and DNA methylation (Hagarman et al., 2013; Wu et al., 2010). In vitro and
in vivo studies investigating the mechanistic relationship between DNA methylation, H2A.Z and
Polycomb complexes will be vital to understanding how these different epigenetic regulatory
pathways function together to regulate lineage commitment.
H2A.Z ubiquitylation influences heterochromatin-associated histone modifications
We then examined the ten most significantly (using a moderated p-value) differentially bound
proteins in our data (Figure 3.3). Consistent with enriched GO terms associated with chromatin
modification, we observed histone methyltransferases that catalyze modifications associated with
silencing, SUV39H2 (catalyzes H3K9 tri-methylation) and SUV420H2 (catalyzes H4K20
methylation), enriched in H2A.ZK3R3 nucleosomes compared to H2A.ZWT. Interestingly, we also
found a decrease in the levels of JMJD2A, an H3K9 histone demethylase, in H2A.ZK3R3
chromatin fractions. These data suggest that H2A.Z ubiquitylation prevents binding of chromatin
modifiers associated with heterochromatin formation.
The histone modifications associated with these proteins, H3K9me3 and H4K20me3, often have
similar localization patterns (Hattori et al., 2013; Mikkelsen et al., 2007), and are enriched at
pericentromeric heterochromatin, satellite repeats and LTRs (Barski et al., 2007; Mikkelsen et al.,
2008; Rosenfeld et al., 2009). Additionally, these marks have been detected at the silent allele of
imprinted genes (Delaval et al., 2007; Regha et al., 2007), including in ESCs (Mikkelsen et al.,
2007). To determine if loss of H2A.Z had downstream consequences for enrichment of these
marks, we performed chromatin immunoprecipitations followed by qPCR. We found that both
H3K9me3 (Figure 3.3B) and H4K20me3 (Figure 3.3C) were enriched at silent and imprinted
loci, but not at bivalent and active genes, as previously reported. However in H2A.ZK3R3 ESCs,
we observed an increase in levels of these modifications at imprinted genes, suggesting that
regulation of these complexes may be disrupted in ESCs lacking H2A.Z ubiquitylation.
101
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
102
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
Indeed, many imprinted genes are targets of Polycomb, and our data suggest that H2A.Zub plays
a role at imprinted genes, maintaining a balance of activation and repression. In particular, at
imprinted loci, one allele harbors the active mark, H3K4me3 and the other contains the silencing
marks H3K9me3 and H4K20me3. H2A.Z is enriched at imprinted loci (Chapter 2), and
H2A.Zub may help prevent the binding of repressive histone methyltransferases to the active
allele. However, we did not find enrichment for either H2A.Z-GFP or H2A.Zub at the same sites
that gain these modifications by sequential ChIP, first for GFP, followed by GFP (as a control) or
H2Aub (which also recognizes H2A.Zub) (Figure 3.3D). These results may reflect technical
difficulties rather than a biological outcome for reasons that include a lack of data for known
H2A.Z target region at imprinted loci. Therefore, whether increased binding of SUV39H2 and
SUV420H2 with H2A.ZK3R3 nucleosomes is directly leading to increased H3K9me3 and
H4K20me3 histone modifications remains to be determined.
H2A.Zub and DNA damage response
Further examination of the top differentially bound proteins also revealed a set of proteins
involved in the DNA damage response, most prominently, 53BP1, whose binding decreases
upon loss of H2A.Z ubiquitylation. 53BP1 is a critical factor for DNA double strand break repair
by non-homologous end joining (Bunting et al., 2010; Nakamura et al., 2006; Zimmermann et al.,
2013). The recruitment of 53BP1 to double strand breaks upon DNA damage is dependent on its
recognition of methylated H4K20(Botuyan et al., 2006; Pei et al., 2011) and the ubiquitylation
activity of RNF8/RNF168 E3 ligases. Furthermore, JMJD2A (which as noted above, also has
decreased association with H2A.ZK3R3 nucleosomes) also binds H4K20me2, but upon DNA
damage, this factor is ubiquitylated by RNF/RN128 and then subject to degradation, allowing the
binding of 53BP1, which has lower affinity than JMJD2A for this modification (Mallette et al.,
2012). Overexpression of JMJD2A prevents binding of 53BP1 upon DNA damage, and results in
an abrogated DNA repair response (Mallette et al., 2012), suggesting the dynamic balance
between these histone modification-binding proteins must be tightly regulated.
The preliminary association with DNA damage response factors was intriguing given that H2A.Z
has previously been implicated in the response to DNA damage (Peterson and Almouzni, 2013).
Yeast H2A.Z mutants are sensitive to DNA damage, and H2A.Z is deposited at sites of DNA
103
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
damage by the SWR-C complex (Kalocsay et al., 2009; Papamichos-Chronakis et al., 2006).
However, it is present only temporarily, and is soon removed by the chromatin remodeling
complex INO80 (Papamichos-Chronakis et al., 2006). Interestingly, in yeast, mutation of H2A.Z
C-terminal lysines to arginines disrupts DNA double strand break repair (Kalocsay et al., 2009).
While the authors suggest this is due to loss of SUMOlyation (a modification related to
ubiquitylation), the requirement for ubiquitylation vs. SUMOlyation was not tested. In human
cells, H2A.Z deposition is also required for proper DNA DSB repair complex assembly (Xu et
al., 2012); however, the role of specific H2A.Z modifications is not known. Figure 3.4A depicts
a model of the role of these proteins upon DNA damage.
We next investigated the function of H2A.Zub in the DNA damage response, and specifically the
localization of JMJD2A and 53BP1 before and after DNA damage in H2A.ZWT and H2A.ZK3R3
ESCs. In untreated H2A.ZWT ESCs, JMJD2A levels were low, but clearly visible by
immunofluorescence, whereas its levels were barely detectable in H2A.ZK3R3 ESCs (Figure
3.4B). After treatment with the DNA damaging agent bleomycin, JMJD2A levels were ablated in
H2A.ZWT, as would be expected by RNF8/168-mediated poly-ubiquitylation and subsequent
proteolysis (Figure 3.4C). However, in H2A.ZK3R3 ESCs, the opposite was observed; JMJD2A
levels dramatically increased, suggesting that it was no longer a target for degradation. Whether
increased JMJD2A is due to recruitment via an increase in H4K20me3, or some other additional
mechanism, remains to be determined. Because JMJD2A antagonizes 53BP1 binding, we also
examined 53BP1 distribution and found that 53BP1 is globally distributed in untreated H2A.ZWT
ESCs, yet largely absent from H2A.ZK3R3 ESCs (Figure 3.4D). Upon bleomycin exposure,
53BP1 relocalizes to punctate foci at high levels in H2A.ZWT ESCs, while the numbers and
intensity of these foci are decreased in ESCs lacking H2A.Z ubiquitylation (Figure 3.4E).
We propose a model by which H2A.Zub functions to properly localize JMJD2A and 53BP1,
both in the basal state, and upon DNA damage. Consistent with this model, recent work has
demonstrated that Polycomb proteins facilitate recruitment of 53BP1 upon DNA damage (Ismail
et al., 2010; 2013). Further investigations into the roles of these various factors should lend
insights into role of H2A.Z in DNA damage repair.
104
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
105
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
3.3 Concluding Remarks
While the importance of post-translation modifications of core histones in regulating chromatin
structure and function has been appreciated since the 1980s, the impact of these modifications on
histone variants has been less clear. In this chapter, we demonstrate that ubiquitylation may
provide a binding module for downstream interactions. Our data suggest that H2A.Zub affects
that diversity of interactions between H2A.Z and chromatin-associated proteins. For example,
while this model needs further validation, H2A.Zub may prevent DNA methylation at bivalent
genes in ESCs in order to allow these genes to remain in a poised state. This study provides a
critical foundation for future mechanistic studies on the role of H2A.Z post-translational
modifications in regulating chromatin structure and transcriptional output as target genes as well
as its roles in other processes such as DNA damage.
3.4 Experimental Procedures
SILAC-IP
ES cells were cultured for four passages in 13C6/15N2-lysine(+8) 13C6/15N4-arginine(+10)
(“SILAC heavy”) or naturally occurring lysine and arginine (“SILAC light”) medium according
to (Bendall, Mol Cel Proteomics 2008). The experiment was repeated with flipping the label
conditions to ensure that SILAC medium did not introduce artifacts into the data. YFP
transgenes were induced 48hrs prior to collection by addition of doxycycline (1ug/ml). 75
million cells were collected for each condition. Cells were washed with PBS 2x prior to cell
lysis. Nuclei were washed twice followed by a nuclear lysis. Nuclei were subjected to an
MNase treatment for 5 minutes. MNase was stopped by the addition of EDTA and EGTA.
Previously cross-linked beads (AffiPrep Protein A beads with GFP antibody, kindly provided by
Iain Cheeseman, crosslinked with DMP) were added to the cell lysate and rotated at 4 degrees
for 2 hr. Beads were washed 2x with wash buffer containing 75mM KCl. During the second
wash, beads from corresponding samples (H2A.ZWT Light and H2A.ZK3R3) were combined into
one reaction. Proteins were eluted with 50ul of 1x NuPage sample buffer with 20mM DTT.
Samples were separated on a 4-12% gel and subject to LC-MS/MS.
MNase Immunoprecipitation
106
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
MNase immunoprecipitations were carried out on H2A.ZWT and H2A.ZK3R3 cell pellets as
described in (Sarcinella et al., 2007). Immunoprecipitations were carried out with Protein-G
magnetic beads (Invitrogen) previously pre-incubated for 4 hours with 5ug anti-GFP antibody
(Abcam, ab290).
Immunoblot
For immunoblot analysis, samples were boiled and then resolved on SDS-PAGE gels. Proteins
were transferred to a PVDF membrane, which was blocked with 5% milk in PBST (0.1%
Tween-20 in phosphate-buffered saline, pH 7.4). Western blotting was performed with the
following antibodies: anti-GFP antibody (Abcam, ab290, 1:1000, Rabbit); anti-DNMT3A
(Abcam, ab13888, 2ug/ml, Mouse); anti-DNMT3B (Abcam, ab13604, 3ug/ml, Mouse) anti-H3
(Abcam, ab10799, 1:1000, Mouse). HRP-conjugated secondary antibodies were then used to
detect binding.
DNA Slot Blotting
Genomic DNA was extracted from H2A.ZWT and H2A.ZK3R3 ESCs using Qiagen’s DNeasy kit.
DNA was prepared in 2 fold dilutions and denatured for 10’ at 95degrees C in 0.8M NaOH,
20mM EDTA, cooled on ice, and neutralized with equal volume of 2 M ammonium acetate.
DNA was applied to a positively-charged membrane using the BioRad Slot Blot apparatus,
following manufacture’s instructions. The membrane was UV autocrosslinked using a
Stratalinker. It was then blocked with a 5% Milk in PBST solution before incubation with
primary antibody for overnight. Antibodies used: anti-5mC (Eurogentec, #BI-MECY-1000), and
anti-5hmC (Active Motif, #39769). HRP-conjugated secondary antibodies were then used to
detect binding. Total genomic DNA was quantified using SYBR-Gold.
Methyl-DNA Immunoprecipitation
Genomic DNA was extracted using Qiagen’s DNeasy Kit, and subject to Me-DIP according to
(Weber et al., 2005) and associated online protocol
(http://www.epigenesys.eu/images/stories/protocols/pdf/20111026125309_p33.pdf), with minor
modifications. Briefly, genomic DNA was sonicated using a Diagenode Biorupter for 12 minutes
with 30sec on, 30sec off on Low power, then precipitated, and resuspended in TE. 4ug of DNA
107
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
were immunoprecipitated with 40ul beads (Dynabeads M-280 Sheep anti-mouse IgG)
preconjugated with 5ug of antibody (preconjugated for 4 hours). Antibodies used: anti-5mC
(Eurogentec, #BI-MECY-1000), and anti-5hmC (Active Motif, #39769). Me-DIPs was analyzed
by quantitative PCR. qPCR reactions using SYBR Green (KAPA Biosystems) and gene-specific
primers were performed on Me-DIP and total genomic (WCE) DNA. Reactions were performed
in triplicate on the Roche LightCycler 480. % Input was calculated with the following formula:
% Input = 2(Cp(WCE)-Cp(IP)) *(%WCE is of total Me-DIP input).
RNA isolation, quantitative real-time PCR, and analysis
RNA was extracted using TRIzol (Invitrogen, 15596-018). Purified RNA was reverse transcribed
using SuperScript III (Invitrogen, 18080-044) or M-MLV reverse transcriptase (Invitrogen,
28025-013) and random hexamers according to manufacturer protocols. Quantitative PCR
reactions were performed with SYBR Green (KAPA Biosystems) on a Roche LightCycler 480.
Relative mRNA levels were determined in triplicate for each transcript using the manufacturer’s
software (Advanced Relative Quantification with Roche Lightcycler 480 Software Version 1.5)
with relative Tubb5 levels used for normalization. Error bars represent standard deviations.
Chromatin Immunoprecipitation
ChIPs were performed on 10-25 million cells as previously described (Wamstad et al., 2012),
with minor modifications. Samples were sonicated in a Diagenode Biorupter in polystyrene tubes
at 4°C while immersed in ice cold water for 30 cycles of 30 sec on, 30 sec off. ChIPs were
washed 2x with Low Salt Buffer (150mM NaCl, 2 mM EDTA, 20mM Tris pH 8.0, 1% Triton X100, 0.1% SDS), 1x with High Salt Buffer (500mM NaCl, 2 mM EDTA, 20mM Tris pH 8.0, 1%
Triton X-100, 0.1% SDS), 2x with LiCl Buffer (250mM LiCl, 1mM EDTA, 10mM Tris pH8.0,
1% NP-40, 1% Na-Deoxycholate), 1x with TE+NaCl (10mM Tris pH 8.0, 1mM EDTA, 50mM
NaCl) and eluted, reverse crosslinked, RNase and Proteinase K treated as previously described
(Wamstad et al., 2012). Antibodies: GFP (Abcam, ab290), H3K9me3 (Abcam, ab8898),
H4K20me3 (Abcam, ab9053).
Site-specific PCR analysis of ChIP
To analyze the amount of enrichment at specific loci, quantitative PCR was conducted with
108
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
analysis as described in (Milne et al., 2009). qPCR reactions using SYBR Green (KAPA
Biosystems) and gene-specific primers (listed below) were performed on ChIP and whole cell
extract (WCE) DNA. Reactions were performed in triplicate on the Roche LightCycler 480. %
Input was calculated with the following formula: % Input = 2(Cp(WCE)-Cp(IP)) *(%WCE is of total
ChIP input).
Immunofluorescence
Cells were prepared by being fixed with 4% paraformaldehyde for 20 minutes at room
temperature, washed 3X with PBS, permeabilized in PBS with 0.2% TritonX, 0.1% Tween-20
for 30 minutes at room temperature, washed 2x with PBS and blocked with PBS with 0.1%
Tween-20, 2% CCS (Cosmic Calf Serum, Invitrogen) for 1 hour at room temperature. The cells
were then stained with primary antibody overnight at 4o C, then washed twice more with block
and stained with anti-mouse secondary (Alexafluor 594) for 1 hour at room temperature. After
3x washes with block, DAPI was added, and the coverslips were mounted. Cells were imaged
using a Zeiss LSM 710 microscope. Primary antibodies used: anti-JMJD2A (Abcam, ab2545,
1:100), anti-53BP1 (Novus Biologicals, 1:100)
3.5 References
Atlasi, Y., Noori, R., Gaspar, C., Franken, P., Sacchetti, A., Rafati, H., Mahmoudi, T., Decraene,
C., Calin, G.A., Merrill, B.J., et al. (2013). Wnt Signaling Regulates the Lineage Differentiation
Potential of Mouse Embryonic Stem Cells through Tcf3 Down-Regulation. PLoS Genet 9,
e1003424.
Barski, A., Cuddapah, S., Cui, K., Roh, T.-Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I.,
and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome.
Cell 129, 823–837.
Bellucci, L., Dalvai, M., Kocanova, S., Moutahir, F., and Bystricky, K. (2013). Activation of p21
by HDAC Inhibitors Requires Acetylation of H2A.Z. PLoS ONE 8, e54102.
Billon, P., and Côté, J. (2012). Precise deposition of histone H2A.Z in chromatin for genome
expression and maintenance. Biochim Biophys Acta 1819, 290–302.
Bonisch, C., and Hake, S.B. (2012). Histone H2A variants in nucleosomes and chromatin: more
or less stable? Nucleic Acids Research.
109
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
Botuyan, M.V., Lee, J., Ward, I.M., Kim, J.-E., Thompson, J.R., Chen, J., and Mer, G. (2006).
Structural basis for the methylation state-specific recognition of histone H4-K20 by 53BP1 and
Crb2 in DNA repair. Cell 127, 1361–1373.
Braun, S., and Madhani, H.D. (2012). Shaping the landscape: mechanistic consequences of
ubiquitin modification of chromatin. EMBO Rep 13, 619–630.
Brinkman, A.B., Gu, H., Bartels, S.J.J., Zhang, Y., Matarese, F., Simmer, F., Marks, H., Bock,
C., Gnirke, A., Meissner, A., et al. (2012). Sequential ChIP-bisulfite sequencing enables direct
genome-scale investigation of chromatin and DNA methylation cross-talk. Genome Res 22,
1128–1138.
Bunting, S.F., Callen, E., Wong, N., Chen, H.-T., Polato, F., Gunn, A., Bothmer, A., Feldhahn,
N., Fernandez-Capetillo, O., Cao, L., et al. (2010). 53BP1 inhibits homologous recombination in
Brca1-deficient cells by blocking resection of DNA breaks. Cell 141, 243–254.
Coleman-Derr, D., and Zilberman, D. (2012). Deposition of Histone Variant H2A.Z within Gene
Bodies Regulates Responsive Genes. PLoS Genet 8, e1002988.
Conerly, M.L., Teves, S.S., Diolaiti, D., Ulrich, M., Eisenman, R.N., and Henikoff, S. (2010).
Changes in H2A.Z occupancy and DNA methylation during B-cell lymphomagenesis. Genome
Res 20, 1383–1390.
Delaval, K., Govin, J., Cerqueira, F., Rousseaux, S., Khochbin, S., and Feil, R. (2007).
Differential histone modifications mark mouse imprinting control regions during
spermatogenesis. Embo J 26, 720–729.
Draker, R., Ng, M.K., Sarcinella, E., Ignatchenko, V., Kislinger, T., and Cheung, P. (2012). A
Combination of H2A.Z and H4 Acetylation Recruits Brd2 to Chromatin during Transcriptional
Activation. PLoS Genet 8, e1003047.
Ficz, G., Branco, M.R., Seisenberger, S., Santos, F., Krueger, F., Hore, T.A., Marques, C.J.,
Andrews, S., and Reik, W. (2011). Dynamic regulation of 5-hydroxymethylcytosine in mouse ES
cells and during differentiation. Nature 473, 398–402.
Ficz, G., Hore, T.A., Santos, F., Lee, H.J., Dean, W., Arand, J., Krueger, F., Oxley, D., Paul, Y.L., Walter, J., et al. (2013). FGF Signaling Inhibition in ESCs Drives Rapid Genome-wide
Demethylation to the Epigenetic Ground State of Pluripotency. Cell Stem Cell.
Franceschini, A., Szklarczyk, D., Frankild, S., Kuhn, M., Simonovic, M., Roth, A., Lin, J.,
Minguez, P., Bork, P., Mering, von, C., et al. (2013). STRING v9.1: protein-protein interaction
networks, with increased coverage and integration. Nucleic Acids Research 41, D808–D815.
Fujimoto, S., Seebart, C., Guastafierro, T., Prenni, J., Caiafa, P., and Zlatanova, J. (2012).
Proteome analysis of protein partners to nucleosomes containing canonical H2A or the variant
histones H2A.Z or H2A.X. Biological Chemistry 393, 47–61.
Gifford, C.A., Ziller, M.J., Gu, H., Trapnell, C., Donaghey, J., Tsankov, A., Shalek, A.K., Kelley,
110
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
D.R., Shishkin, A.A., Issner, R., et al. (2013). Transcriptional and Epigenetic Dynamics during
Specification of Human Embryonic Stem Cells. Cell 153, 1149–1163.
Hagarman, J.A., Motley, M.P., Kristjansdottir, K., and Soloway, P.D. (2013). Coordinate
regulation of DNA methylation and H3K27me3 in mouse embryonic stem cells. PLoS ONE 8,
e53880.
Hattori, N., Niwa, T., Kimura, K., Helin, K., and Ushijima, T. (2013). Visualization of
multivalent histone modification in a single cell reveals highly concerted epigenetic changes on
differentiation of embryonic stem cells. Nucleic Acids Research 41, 7231–7239.
Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2009a). Bioinformatics enrichment tools:
paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research
37, 1–13.
Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2009b). Systematic and integrative analysis
of large gene lists using DAVID bioinformatics resources. Nature Protocols 4, 44–57.
Ismail, I.H., Andrin, C., McDonald, D., and Hendzel, M.J. (2010). BMI1-mediated histone
ubiquitylation promotes DNA double-strand break repair. J Cell Biol 191, 45–60.
Ismail, I.H., McDonald, D., Strickfaden, H., Xu, Z., and Hendzel, M.J. (2013). A small molecule
inhibitor of Polycomb repressive complex 1 inhibits ubiquitin signaling at DNA double-strand
breaks. Journal of Biological Chemistry.
Jackson, M., Krassowska, A., Gilbert, N., Chevassut, T., Forrester, L., Ansell, J., and Ramsahoye,
B. (2004). Severe global DNA hypomethylation blocks differentiation and induces histone
hyperacetylation in embryonic stem cells. Molecular and Cellular Biology 24, 8862–8871.
Kalocsay, M., Hiller, N.J., and Jentsch, S. (2009). Chromosome-wide Rad51 spreading and
SUMO-H2A.Z-dependent chromosome fixation in response to a persistent DNA double-strand
break. Mol Cell 33, 335–343.
Ku, M., Jaffe, J.D., Koche, R.P., Rheinbay, E., Endoh, M., Koseki, H., Carr, S.A., and Bernstein,
B.E. (2012). H2A.Z landscapes and dual modifications in pluripotent and multipotent stem cells
underlie complex genome regulatory functions. Genome Biol 13, R85.
Luger, K., Dechassa, M.L., and Tremethick, D.J. (2012). New insights into nucleosome and
chromatin structure: an ordered state or a disordered affair? Nat Rev Mol Cell Biol 13, 436–447.
Mallette, F.A., Mattiroli, F., Cui, G., Young, L.C., Hendzel, M.J., Mer, G., Sixma, T.K., and
Richard, S. (2012). RNF8- and RNF168-dependent degradation of KDM4A/JMJD2A triggers
53BP1 recruitment to DNA damage sites. Embo J 31, 1865–1878.
Meissner, A., Mikkelsen, T.S., Gu, H., Wernig, M., Hanna, J., Sivachenko, A., Zhang, X.,
Bernstein, B.E., Nusbaum, C., Jaffe, D.B., et al. (2008). Genome-scale DNA methylation maps
of pluripotent and differentiated cells. Nature 454, 766–770.
111
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
Mikkelsen, T.S., Hanna, J., Zhang, X., Ku, M., Wernig, M., Schorderet, P., Bernstein, B.E.,
Jaenisch, R., Lander, E.S., and Meissner, A. (2008). Dissecting direct reprogramming through
integrative genomic analysis. Nature 454, 49–55.
Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P.,
Brockman, W., Kim, T.-K., Koche, R.P., et al. (2007). Genome-wide maps of chromatin state in
pluripotent and lineage-committed cells. Nature 448, 553–560.
Millar, C.B. (2013). Organizing the genome with H2A histone variants. Biochem J 449, 567–579.
Milne, T.A., Zhao, K., and Hess, J.L. (2009). Chromatin immunoprecipitation (ChIP) for
analysis of histone modifications and chromatin-associated proteins. Methods Mol Biol 538,
409–423.
Mohn, F., Weber, M., Rebhan, M., Roloff, T.C., Richter, J., Stadler, M.B., Bibel, M., and
Schübeler, D. (2008). Lineage-specific polycomb targets and de novo DNA methylation define
restriction and potential of neuronal progenitors. Mol Cell 30, 755–766.
Nakamura, K., Sakai, W., Kawamoto, T., Bree, R.T., Lowndes, N.F., Takeda, S., and Taniguchi,
Y. (2006). Genetic dissection of vertebrate 53BP1: a major role in non-homologous end joining
of DNA double strand breaks. DNA Repair 5, 741–749.
Ong, S.-E., and Mann, M. (2006). A practical recipe for stable isotope labeling by amino acids in
cell culture (SILAC). Nature Protocols 1, 2650–2660.
Ong, S.-E., Blagoev, B., Kratchmarova, I., Kristensen, D.B., Steen, H., Pandey, A., and Mann, M.
(2002). Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate
approach to expression proteomics. Molecular & Cellular Proteomics : MCP 1, 376–386.
Papamichos-Chronakis, M., Krebs, J.E., and Peterson, C.L. (2006). Interplay between Ino80 and
Swr1 chromatin remodeling enzymes regulates cell cycle checkpoint adaptation in response to
DNA damage. Genes & Development 20, 2437–2449.
Pei, H., Zhang, L., Luo, K., Qin, Y., Chesi, M., Fei, F., Bergsagel, P.L., Wang, L., You, Z., and
Lou, Z. (2011). MMSET regulates histone H4K20 methylation and 53BP1 accumulation at DNA
damage sites. Nature 470, 124–128.
Peterson, C.L., and Almouzni, G. (2013). Nucleosome dynamics as modular systems that
integrate DNA damage and repair. Cold Spring Harb Perspect Biol 5.
Reddington, J.P., Perricone, S.M., Nestor, C.E., Reichmann, J., Youngson, N.A., Suzuki, M.,
Reinhardt, D., Dunican, D.S., Prendergast, J.G., Mjoseng, H., et al. (2013). Redistribution of
H3K27me3 upon DNA hypomethylation results in de-repression of Polycomb target genes.
Genome Biol 14, R25.
Regha, K., Sloane, M.A., Huang, R., Pauler, F.M., Warczok, K.E., Melikant, B., Radolf, M.,
Martens, J.H.A., Schotta, G., Jenuwein, T., et al. (2007). Active and repressive chromatin are
interspersed without spreading in an imprinted gene cluster in the mammalian genome. Mol Cell
112
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
27, 353–366.
Rosenfeld, J.A., Wang, Z., Schones, D.E., Zhao, K., DeSalle, R., and Zhang, M.Q. (2009).
Determination of enriched histone modifications in non-genic portions of the human genome.
BMC Genomics 10, 143.
Rush, M., Appanah, R., Lee, S., Lam, L.L., Goyal, P., and Lorincz, M.C. (2009). Targeting of
EZH2 to a defined genomic site is sufficient for recruitment of Dnmt3a but not de novo DNA
methylation. Epigenetics : Official Journal of the DNA Methylation Society 4, 404–414.
Sarcinella, E., Zuzarte, P.C., Lau, P.N.I., Draker, R., and Cheung, P. (2007). Monoubiquitylation
of H2A.Z distinguishes its association with euchromatin or facultative heterochromatin.
Molecular and Cellular Biology 27, 6457–6468.
Smith, Z.D., and Meissner, A. (2013). DNA methylation: roles in mammalian development. Nat
Rev Genet 14, 204–220.
Tsumura, A., Hayakawa, T., Kumaki, Y., Takebayashi, S.-I., Sakaue, M., Matsuoka, C.,
Shimotohno, K., Ishikawa, F., Li, E., Ueda, H.R., et al. (2006). Maintenance of self-renewal
ability of mouse embryonic stem cells in the absence of DNA methyltransferases Dnmt1,
Dnmt3a and Dnmt3b. Genes Cells 11, 805–814.
Valdés-Mora, F., Song, J.Z., Statham, A.L., Strbenac, D., Robinson, M.D., Nair, S.S., Patterson,
K.I., Tremethick, D.J., Stirzaker, C., and Clark, S.J. (2012). Acetylation of H2A.Z is a key
epigenetic modification associated with gene deregulation and epigenetic remodeling in cancer.
Genome Res 22, 307–321.
Viré, E., Brenner, C., Deplus, R., Blanchon, L., Fraga, M., Didelot, C., Morey, L., Van Eynde,
A., Bernard, D., Vanderwinden, J.-M., et al. (2006). The Polycomb group protein EZH2 directly
controls DNA methylation. Nature 439, 871–874.
Wamstad, J.A., Alexander, J.M., Truty, R.M., Shrikumar, A., Li, F., Eilertson, K.E., Ding, H.,
Wylie, J.N., Pico, A.R., Capra, J.A., et al. (2012). Dynamic and coordinated epigenetic
regulation of developmental transitions in the cardiac lineage. Cell 151, 206–220.
Weber, M., Davies, J.J., Wittig, D., Oakeley, E.J., Haase, M., Lam, W.L., and Schübeler, D.
(2005). Chromosome-wide and promoter-specific analyses identify sites of differential DNA
methylation in normal and transformed human cells. Nat Genet 37, 853–862.
Wu, H., Coskun, V., Tao, J., Xie, W., Ge, W., Yoshikawa, K., Li, E., Zhang, Y., and Sun, Y.E.
(2010). Dnmt3a-dependent nonpromoter DNA methylation facilitates transcription of neurogenic
genes. Science 329, 444–448.
Xu, Y., Ayrapetov, M.K., Xu, C., Gursoy-Yuzugullu, O., Hu, Y., and Price, B.D. (2012). Histone
H2A.Z Controls a Critical Chromatin Remodeling Step Required for DNA Double-Strand Break
Repair. Mol Cell.
Yang, X., Noushmehr, H., Han, H., Andreu-Vieyra, C., Liang, G., and Jones, P.A. (2012). Gene
113
Chapter 3 | Ubiquitylation mediates the protein interaction landscape of H2A.Z
Reactivation by 5-Aza-2'-Deoxycytidine-Induced Demethylation Requires SRCAP-Mediated
H2A.Z Insertion to Establish Nucleosome Depleted Regions. PLoS Genet 8, e1002604.
Zemach, A., McDaniel, I.E., Silva, P., and Zilberman, D. (2010). Genome-wide evolutionary
analysis of eukaryotic DNA methylation. Science 328, 916–919.
Zilberman, D., Coleman-Derr, D., Ballinger, T., and Henikoff, S. (2008). Histone H2A.Z and
DNA methylation are mutually antagonistic chromatin marks. Nature 456, 125–129.
Ziller, M.J., Gu, H., Müller, F., Donaghey, J., Tsai, L.T.Y., Kohlbacher, O., De Jager, P.L.,
Rosen, E.D., Bennett, D.A., Bernstein, B.E., et al. (2013). Charting a dynamic DNA methylation
landscape of the human genome. Nature.
Zimmermann, M., Lottersberger, F., Buonomo, S.B., Sfeir, A., and de Lange, T. (2013). 53BP1
Regulates DSB Repair Using Rif1 to Control 5' End Resection. Science.
114
Chapter 4
Conclusions and Future Directions
4.1 Summary and Significance
The work presented in this thesis focuses on dissecting the roles of H2A.Z mono-ubiquitylation.
The activity of H2A.Z depends on both the surrounding chromatin environment and on posttranslational modifications. Specifically, we found that Polycomb-mediated H2A.Z monoubiquitylation (H2A.Zub) impacts the differentiation potential of ESCs. Loss of H2A.Zub by
mutating three key C-terminal lysines to arginines alters the chromatin state of poised, ‘bivalent’
genes in ESCs and leads to transcriptional derepression of developmental gene expression
programs. We also show that H2A.Zub is critical for regulating canonical Wnt pathway
activation, a major intercellular signaling pathway controlling early embryogenesis. Consistent
with hyperactivation of Wnt, H2A.ZK3R3 ESCs fail to differentiate into neural lineages. Thus, we
have uncovered a previously unrecognized role for H2A.Zub in regulating early cell fate
decisions.
We further investigated the mechanisms by which H2A.Zub functions to regulate developmental
programs by quantitative mass spec. We identified a set of proteins that showed differential
interactions between wild-type and mutant containing chromatin. We then explored the
functional consequences of some of these differential interactions and found that H2A.Zub is
necessary for maintenance of global DNA methylation levels as well as for levels of several
repressive histone modifications at imprinted genes. Our data also reveal a potential connection
115 Chapter 4 | Conclusions
between H2A.Zub and DNA damage. Collectively, this work sets the stage for understanding
how post-translation modifications can contribute to further specialization of H2A.Z in a
context-dependent manner.
4.2 Future Directions
The work presented here opens many avenues for future exploration of the role of H2A.Z posttranslational modifications, in particular, mono-ubiquitylation in mediating the different
functionalities of H2A.Z. This section will explore some of these directions, and discuss various
experimental avenues to address these questions.
Regulation of H2A.Z deubiquitylation
Over 25 years ago, it was shown that ubiquitylation of both H2A and H2A.Z becomes
undetectable during mitosis and reappears following cell division (Mueller et al., 1985}
suggesting that removal of this moiety may be a regulated process. This situation is similar to
that histone methylation, where there was a lag between the identification of the deposition
enzymes and the removal enzymes (Culhane and Cole, 2007; Mueller et al., 1985). Thus, it is
possible that H2A.Z is actively deubiquitylated; however, the enzymes that catalyze its removal,
and its function during lineage commitment are not known.
Studies to understand how H2Aub and H2A.Zub levels dramatically decrease during mitosis
discovered Ubp-M/USP16, a de-ubiquitinating enzyme that associates with condensed mitotic
chromatin and has specific catalytic activity towards nucleosomal H2Aub (Cai et al., 1999; Joo
et al., 2007; Richly et al., 2010). Furthermore, depletion of this enzyme leads to repression of
Hox gene expression (Draker et al., 2011; Joo et al., 2007), the opposite outcome to that of
Polycomb-mediated ubiquitylation, whose depletion results in Hox gene upregulation (Draker et
al., 2011; Soshnikova and Duboule, 2009). In addition, H2A deubiquitination activity has been
demonstrated for additional enzymes in mammalian cells, and Drosophila, including PR-DUB
(Zhu et al., 2007), USP21 (Nakagawa et al., 2008), and BAP1 (Scheuermann et al., 2010) all of
which act during transcriptional activation. Furthermore, in human NT2 cells, H2Aub was found
to recruit the ubiquitin-binding protein ZRF1 (Richly et al., 2010). This protein acted upon
differentiation cues through a two-step process to first antagonize PRC1 binding and
116 Chapter 4 | Conclusions
subsequently to recruit the histone deubiquitylase USP21, facilitating transcriptional activation
upon differentiation. These finding suggest that deubiquitylating enzymes (or DUBs) function
antagonistically to the transcriptional inhibitory function of Polycomb-mediated ubiquitylation of
H2A.Z.
Our work demonstrated the importance of H2A.Zub in the repression of Polycomb-bound
bivalent genes, but it is unclear if these genes need to be actively deubiquitylated in order to
become transcriptionally activated during differentiation. A recent study suggested this might be
the case. The authors showed that a histone deubiquitinase, USP10, catalyzes removal of
ubiquitin from both H2A.Zub and H2Aub both in vitro and in vivo (Draker et al., 2011).
Furthermore, both H2A.Z and USP10 were required for transcriptional activation in response to
androgen signaling (Draker et al., 2011). It will therefore be of interest to determine if USP10 or
another H2A.Zub DUB is required for transcriptional activation in early differentiation, and if an
intermediary ubiquitin binding protein like ZRF1 facilitates this activity. USP10 is a relatively
understudied protein and while it is lowly expressed in ESCs (data from (Wamstad et al., 2012)),
determining its function in early development may prove interesting. Conversely, determining
the consequences of overexpression of ZRF1 and USP10 or other potential H2A.Z DUBs on
ESC differentiation will provide additional evidence for the importance of regulating this process.
DUB overexpression would likely result in a similar phenotype as that of H2A.Zub loss- Wnt
hyperactivation and failure to specify neuronal lineages. These future investigations will lend
additional insights into the role of H2A.Z in mediating the balance between transcriptional
activation and repression.
Connection between Polycomb-ubiquitylation and RNA Polymerase activity
In ESCs, bivalent genes represent a class of genes that need to remain silent, but poised for rapid
activation upon receipt of cues; however, we know little about how this balance is accomplished.
Insights may derived from examination of the canonical heat shock response which requires a
paused polymerase for rapid transcriptional activation of response genes (O'Brien and Lis, 1991;
Rougvie and Lis, 1988). A paused polymerase is transcriptionally engaged, but requires the
action of a series of transcriptional elongation factors to undergo productive transcription (Fuda
et al., 2009). Though the presence of a paused RNAPII near the transcriptional start site of
117 Chapter 4 | Conclusions
bivalent genes has been controversial with studies reporting opposite conclusions (Brookes et al.,
2012; Guenther et al., 2007; Min et al., 2011), the majority of evidence supports the presence of
RNAPII near and just downstream of the TSS of bivalent genes. For example, a recent study
profiling the chromatin of ESCs cultured in serum+LIF media (standard ESC growth media) or
in chemically defined 2i+LIF media, thought to promote a more “naïve” pluripotent state, found
that while bivalent genes showed almost no expression in the naïve state, levels of promoterassociated RNAPII were largely increased (Marks et al., 2012), suggesting that transcriptional
regulation occurs at the step of elongation, and not recruitment.
We have shown that loss of H2A.Zub results in transcriptional derepression of bivalent genes;
however, the effect of H2A.Zub on RNAPII activity at bivalent promoters remains an
outstanding question. Conflicting models exist for the role of Polycomb-mediated ubiquitylation
in transcriptional repression. While some studies suggest it prevents productive elongation
(Stock et al., 2007), others indicate it inhibits MLL complex-mediated H3K4 methylation and
transcriptional initiation by RNAPII, but not elongation (Endoh et al., 2012; Nakagawa et al.,
2008). We found H3K4me3 levels at the promoters of bivalent, developmental regulators were
slightly increased in H2A.ZK3R3 ESCs compared to H2A.ZWT, suggesting a potential, though not
exclusive role for H2A.Zub in preventing tri-methylation of H3K4. However, this does not
preclude increased levels of H3K4me3 due to an indirect effect. While our preliminary results
show that levels of the initiating form of RNAPII (Ser5 phosphorylated) at H2A.ZK3R3 bivalent
promoters are decreased (data not shown), it remains to be determined whether this decrease in
promoter association is due to a loss of H2A.Zub-mediated RNAPII recruitment or to an increase
in RNAPII elongation. Further experiments examining the elongating form of RNAPII (Ser2
phosphorylated) will be insightful in this regard. If H2A.Zub indeed functions to prevent
productive elongation, we expect to observe an increase in RNAPII-S2P in the bodies of bivalent
genes in H2A.ZK3R3 ESCs compared to H2A.ZWT. Future experiments utilizing in vitro
transcription assays on chromatinized templates will allow us to more directly dissect the
differential effects of H2Aub vs. H2A.Zub on both transcriptional initiation and elongation.
Collectively, these experiments will contribute new insights into how H2A.Z ubiquitylation
regulates transcription, including the presence of a promoter-bound RNAPII.
118 Chapter 4 | Conclusions
H2A.Z ubiquitylation in yeast vs. other organisms
Much of the seminal work describing the varying functions of H2A.Z has utilized the yeast
Saccharomyces cerevisiae. However, this organism lacks the Polycomb repressive complexes
observed in a variety of other eukaryotes, including plants, insects and vertebrates. In this thesis
we determined that H2A.Z ubiquitylation in ESCs is catalyzed by the Polycomb repressive
complex 1 (PRC1)-associated E3 ligase Ring1b (de Napoles et al., 2004; Endoh et al., 2008;
Stock et al., 2007). Furthermore, though generally highly conserved, there is considerable
divergence between the H2A.Z yeast and mammalian C-terminal sequence (Zlatanova and
Thakar, 2008). Thus, it is important to whether H2A.Zub exists in yeast or why Polycombmediated ubiquitylation of H2A.Z may have evolved in more complex organisms.
Though little has been reported on H2A.Z mono-ubiquitylation in yeast, a recent study
demonstrated that H2A.Z is also subject to this modification. However, unlike the pattern of a
SUMO-lyated form of H2A.Z, H2A.Zub levels did not decrease in the absence of SWR1 (Boden
et al., 2013; Kalocsay et al., 2009; Kumar and Wigge, 2010). Because SWR1 is responsible for
the incorporation of H2A.Z (Dalvai et al., 2012; Kobor et al., 2004; Krogan et al., 2003;
Mizuguchi et al., 2004), the authors suggest that SUMO, but not ubiquitin moieties are primarily
associated with nucleosomal H2A.Z. In addition, mutation of yeast C-terminal lysines did not
affect levels of ubiquitylation (Kalocsay et al., 2009; Pantazis and Bonner, 1981). These results
suggest that in yeast there is very little C-terminal ubiquitylation, and that H2A.Zub is not
primarily associated with chromatin. While these findings do not exclude the possibility of a
function in yeast for C-terminal ubiquitylation of H2A.Z, they suggest this modification may
have evolved other functions in multi-cellular organisms.
Indeed, a large proportion of both H2A and H2A.Z histones are ubiquitylated in mammalian
cells, with ubiquitylated species comprising ~5-15% of the total histone in each case (Sarcinella
et al., 2007; Vissers et al., 2008) and data not shown. H2A.Z has been implicated in the ‘poising’
of developmental regulators in embryonic tissues of a number of species (Creyghton et al., 2008;
Hu et al., 2012; Mavrich et al., 2008; Whittle et al., 2008). Furthermore, transcriptional response
to both developmental and environmental cues appears to require H2A.Z, including the response
to temperature and chemical stimuli in plants (Boden et al., 2013; Kumar and Wigge, 2010), as
119 Chapter 4 | Conclusions
well as estrogen and p21 induction in mammalian cells (Bellucci et al., 2013; Dalvai et al., 2012;
Gévry et al., 2007; 2009; Hardy and Robert, 2010). Thus, we propose that PRC1-mediated
H2A.Z ubiquitylation is critical to maintain inducible genes in a repressed, but poised state,
allowing for rapid activation upon receipt of cues. As the yeast genome is thought to be generally
open chromatin structure, perhaps the requirement for this poising capacity is not necessary.
Function of other H2A.Z post-translation modifications
While the work presented here has focused on the role of H2A.Z ubiquitylation, this histone
variant is subject to additional histone modifications. For example, H2A.Z acetylation, first
reported by Bonner and colleagues (Pantazis and Bonner, 1981), has roles in transcriptional
activation and in yeast, prevention of heterochromatic spreading (Allis et al., 1986; Babiarz et al.,
2006; Bruce et al., 2005; Halley et al., 2010; Ishibashi et al., 2009; Millar et al., 2006; Ren and
Gorovsky, 2001; Santisteban et al., 2000; Valdés-Mora et al., 2012). Recent studies have shown
that H2A.Z acetylation is required for transcriptional activation in response to p21 induction
(Bellucci et al., 2013), and correlates with transcriptional derepression in cancer cells (ValdésMora et al., 2012). The mechanism by which acetylation facilitates transcriptional activation may
be similar to how acetylation is thought to function on canonical histones- to destabilize intraand inter-nucleosomal interactions. Indeed, in vitro analysis demonstrated destabilization of
H2A.Z nucleosomes when H2A.Z N-terminal lysines were mutated to acetyl-mimicking
glutamines (Ishibashi et al., 2009). However, it remains to be determined whether H2A.Z
acetylation functions in the recruitment of chromatin associated proteins required for
transcriptional activation. Utilizing the SILAC-IP-MS approach described in Chapter 3, analysis
of differentially interacting proteins in the context of H2A.Z N-terminal lysines mutated to either
acetylation defective or acetylation mimic amino acids may provide clues to its function in
transcriptional activation.
In addition, H2A.Z is subject to C-terminal SUMOlyation. As described previously,
H2A.ZSUMO is associated with DNA damage in yeast, but little function had been ascribed for
this modification in metazoans. In data not shown in this manuscript, we also observed a
SUMOlyated version of H2A.Z in ESC histone extracts. Interestingly, this SUMOlyated band
disappeared in the H2A.ZK3R3 ESCs, suggesting at least in mouse ESCs, that SUMO and
120 Chapter 4 | Conclusions
ubiquitin moieties are added to the same C-terminal lysines. While we have suggested that the
phenotype we observed in H2A.ZK3R3 ESCs is due to lack of ubiquitylation, we have not
formally demonstrated that these phenotypic consequences are not due to loss of SUMOlyation.
In particular, the observed defective DNA damage response seems like a candidate for
H2A.ZSUMO functionality, given its reported role in yeast. To address these questions, it is
imperative to dissect the distinct (or convergent) functions of H2A.Zub and H2A.ZSUMO. Our
initial efforts will be directed towards attempting to rescue the various defects in differentiation
and DNA damage response with expression of a constitutively ubiquitylated or SUMOlyated
H2A.Z. This will allow us to determine the function of these modifications in different cellular
processes. Furthermore, analysis of the downstream effectors of these modifications will also
lend insights into how these modifications affect the context-dependent functions of H2A.Z.
4.3 Concluding Remarks
Recent developments in the field of epigenetics have provided fundamental insights into the
regulatory mechanisms that control cell state. Findings from ‘basic’ research are providing the
foundation for appreciating how chromatin structure contributes to human health and disease.
For example, the regulated DNA demethylation by Tet enzymes was only recently demonstrated
(Ito et al., 2010; Williams et al., 2011), and has now been connected to synaptic plasticity and
memory extinction (Rudenko et al., 2013), with potential clinical implications for human mental
health. Moreover, epigenetic factors are key targets of a whole new class of pharmaceutical
compounds that provide treatment for a range of disease and improve overall health outcomes.
Dissecting how these many epigenetic pathways converge to regulate cellular responses will be
key to understanding the targets of these compounds in a broader context.
4.4 References
Allis, C.D., Richman, R., Gorovsky, M.A., Ziegler, Y.S., Touchstone, B., Bradley, W.A., and
Cook, R.G. (1986). hv1 is an evolutionarily conserved H2A variant that is preferentially
associated with active genes. J Biol Chem 261, 1941–1948.
Babiarz, J.E., Halley, J.E., and Rine, J. (2006). Telomeric heterochromatin boundaries require
NuA4-dependent acetylation of histone variant H2A.Z in Saccharomyces cerevisiae. Genes &
Development 20, 700–710.
121 Chapter 4 | Conclusions
Bellucci, L., Dalvai, M., Kocanova, S., Moutahir, F., and Bystricky, K. (2013). Activation of p21
by HDAC Inhibitors Requires Acetylation of H2A.Z. PLoS ONE 8, e54102.
Boden, S.A., Kavanová, M., Finnegan, E.J., and Wigge, P.A. (2013). Thermal stress effects on
grain yield in Brachypodium distachyon occur via H2A.Z-nucleosomes. Genome Biol 14, R65.
Brookes, E., de Santiago, I., Hebenstreit, D., Morris, K.J., Carroll, T., Xie, S.Q., Stock, J.K.,
Heidemann, M., Eick, D., Nozaki, N., et al. (2012). Polycomb Associates Genome-wide with a
Specific RNA Polymerase II Variant, and Regulates Metabolic Genes in ESCs. Cell Stem Cell
10, 157–170.
Bruce, K., Myers, F.A., Mantouvalou, E., Lefevre, P., Greaves, I., Bonifer, C., Tremethick, D.J.,
Thorne, A.W., and Crane-Robinson, C. (2005). The replacement histone H2A.Z in a
hyperacetylated form is a feature of active genes in the chicken. Nucleic Acids Research 33,
5633–5639.
Cai, S.Y., Babbitt, R.W., and Marchesi, V.T. (1999). A mutant deubiquitinating enzyme (UbpM) associates with mitotic chromosomes and blocks cell division. Proc Natl Acad Sci USA 96,
2828–2833.
Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young, R.A.,
Jaenisch, R., and Boyer, L.A. (2008). H2AZ is enriched at polycomb complex target genes in ES
cells and is necessary for lineage commitment. Cell 135, 649–661.
Culhane, J.C., and Cole, P.A. (2007). LSD1 and the chemistry of histone demethylation. Curr
Opin Chem Biol 11, 561–568.
Dalvai, M., Bellucci, L., Fleury, L., Lavigne, A.-C., Moutahir, F., and Bystricky, K. (2012).
H2A.Z-dependent crosstalk between enhancer and promoter regulates Cyclin D1 expression.
Oncogene.
de Napoles, M., Mermoud, J.E., Wakao, R., Tang, Y.A., Endoh, M., Appanah, R., Nesterova,
T.B., Silva, J., Otte, A.P., Vidal, M., et al. (2004). Polycomb group proteins Ring1A/B link
ubiquitylation of histone H2A to heritable gene silencing and X inactivation. Developmental Cell
7, 663–676.
Draker, R., Sarcinella, E., and Cheung, P. (2011). USP10 deubiquitylates the histone variant
H2A.Z and both are required for androgen receptor-mediated gene activation. Nucleic Acids
Research 39, 3529–3542.
Endoh, M., Endo, T.A., Endoh, T., Fujimura, Y.-I., Ohara, O., Toyoda, T., Otte, A.P., Okano, M.,
Brockdorff, N., Vidal, M., et al. (2008). Polycomb group proteins Ring1A/B are functionally
linked to the core transcriptional regulatory circuitry to maintain ES cell identity. Development
135, 1513–1524.
Endoh, M., Endo, T.A., Endoh, T., Isono, K.-I., Sharif, J., Ohara, O., Toyoda, T., Ito, T.,
Eskeland, R., Bickmore, W.A., et al. (2012). Histone H2A Mono-Ubiquitination Is a Crucial
Step to Mediate PRC1-Dependent Repression of Developmental Genes to Maintain ES Cell
122 Chapter 4 | Conclusions
Identity. PLoS Genet 8, e1002774.
Fuda, N.J., Ardehali, M.B., and Lis, J.T. (2009). Defining mechanisms that regulate RNA
polymerase II transcription in vivo. Nature 461, 186–192.
Gévry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L. (2007). p21
transcription is regulated by differential localization of histone H2A.Z. Genes & Development 21,
1869–1881.
Gévry, N., Hardy, S., Jacques, P.-E., Laflamme, L., Svotelis, A., Robert, F., and Gaudreau, L.
(2009). Histone H2A.Z is essential for estrogen receptor signaling. Genes & Development 23,
1522–1533.
Guenther, M.G., Levine, S.S., Boyer, L.A., Jaenisch, R., and Young, R.A. (2007). A chromatin
landmark and transcription initiation at most promoters in human cells. Cell 130, 77–88.
Halley, J.E., Kaplan, T., Wang, A.Y., Kobor, M.S., and Rine, J. (2010). Roles for H2A.Z and its
acetylation in GAL1 transcription and gene induction, but not GAL1-transcriptional memory.
Plos Biol 8, e1000401.
Hardy, S., and Robert, F. (2010). Random deposition of histone variants: A cellular mistake or a
novel regulatory mechanism? Epigenetics : Official Journal of the DNA Methylation Society 5,
368–372.
Hu, G., Cui, K., Northrup, D., Liu, C., Wang, C., Tang, Q., Ge, K., Levens, D., Crane-Robinson,
C., and Zhao, K. (2012). H2A.Z Facilitates Access of Active and Repressive Complexes to
Chromatin in Embryonic Stem Cell Self-Renewal and Differentiation. Cell Stem Cell.
Ishibashi, T., Dryhurst, D., Rose, K.L., Shabanowitz, J., Hunt, D.F., and Ausió, J. (2009).
Acetylation of vertebrate H2A.Z and its effect on the structure of the nucleosome. Biochemistry
48, 5007–5017.
Ito, S., D’alessio, A.C., Taranova, O.V., Hong, K., Sowers, L.C., and Zhang, Y. (2010). Role of
Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification.
Nature 466, 1129–1133.
Joo, H.-Y., Zhai, L., Yang, C., Nie, S., Erdjument-Bromage, H., Tempst, P., Chang, C., and
Wang, H. (2007). Regulation of cell cycle progression and gene expression by H2A
deubiquitination. Nature 449, 1068–1072.
Kalocsay, M., Hiller, N.J., and Jentsch, S. (2009). Chromosome-wide Rad51 spreading and
SUMO-H2A.Z-dependent chromosome fixation in response to a persistent DNA double-strand
break. Mol Cell 33, 335–343.
Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L., Link, A.J.,
Madhani, H.D., and Rine, J. (2004). A protein complex containing the conserved Swi2/Snf2related ATPase Swr1p deposits histone variant H2A.Z into euchromatin. Plos Biol 2, E131.
123 Chapter 4 | Conclusions
Krogan, N.J., Keogh, M.-C., Datta, N., Sawa, C., Ryan, O.W., Ding, H., Haw, R.A., Pootoolal, J.,
Tong, A., Canadien, V., et al. (2003). A Snf2 family ATPase complex required for recruitment of
the histone H2A variant Htz1. Mol Cell 12, 1565–1576.
Kumar, S.V., and Wigge, P.A. (2010). H2A.Z-containing nucleosomes mediate the
thermosensory response in Arabidopsis. Cell 140, 136–147.
Marks, H., Kalkan, T., Menafra, R., Denissov, S., Jones, K., Hofemeister, H., Nichols, J., Kranz,
A., Francis Stewart, A., Smith, A., et al. (2012). The transcriptional and epigenomic foundations
of ground state pluripotency. Cell 149, 590–604.
Mavrich, T.N., Jiang, C., Ioshikhes, I.P., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P., Qi, J.,
Glaser, R.L., Schuster, S.C., et al. (2008). Nucleosome organization in the Drosophila genome.
Nature 453, 358–362.
Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. (2006). Acetylation of H2AZ Lys 14 is
associated with genome-wide gene activity in yeast. Genes & Development 20, 711–722.
Min, I.M., Waterfall, J.J., Core, L.J., Munroe, R.J., Schimenti, J., and Lis, J.T. (2011).
Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells.
Genes & Development 25, 742–754.
Mizuguchi, G., Shen, X., Landry, J., Wu, W.-H., Sen, S., and Wu, C. (2004). ATP-driven
exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science
303, 343–348.
Mueller, R.D., Yasuda, H., Hatch, C.L., Bonner, W.M., and Bradbury, E.M. (1985).
Identification of ubiquitinated histones 2A and 2B in Physarum polycephalum. Disappearance of
these proteins at metaphase and reappearance at anaphase. J Biol Chem 260, 5147–5153.
Nakagawa, T., Kajitani, T., Togo, S., Masuko, N., Ohdan, H., Hishikawa, Y., Koji, T.,
Matsuyama, T., Ikura, T., Muramatsu, M., et al. (2008). Deubiquitylation of histone H2A
activates transcriptional initiation via trans-histone cross-talk with H3K4 di- and trimethylation.
Genes & Development 22, 37–49.
O'Brien, T., and Lis, J.T. (1991). RNA polymerase II pauses at the 5' end of the transcriptionally
induced Drosophila hsp70 gene. Molecular and Cellular Biology 11, 5285–5290.
Pantazis, P., and Bonner, W.M. (1981). Quantitative determination of histone modification. H2A
acetylation and phosphorylation. J Biol Chem 256, 4669–4675.
Ren, Q., and Gorovsky, M.A. (2001). Histone H2A.Z acetylation modulates an essential charge
patch. Mol Cell 7, 1329–1335.
Richly, H., Rocha-Viegas, L., Ribeiro, J.D., Demajo, S., Gundem, G., Lopez-Bigas, N.,
Nakagawa, T., Rospert, S., Ito, T., and Di Croce, L. (2010). Transcriptional activation of
polycomb-repressed genes by ZRF1. Nature 468, 1124–1128.
124 Chapter 4 | Conclusions
Rougvie, A.E., and Lis, J.T. (1988). The RNA polymerase II molecule at the 5' end of the
uninduced hsp70 gene of D. melanogaster is transcriptionally engaged. Cell 54, 795–804.
Rudenko, A., Dawlaty, M.M., Seo, J., Cheng, A.W., Meng, J., Le, T., Faull, K.F., Jaenisch, R.,
and Tsai, L.-H. (2013). Tet1 is critical for neuronal activity-regulated gene expression and
memory extinction. Neuron 79, 1109–1122.
Santisteban, M.S., Kalashnikova, T., and Smith, M.M. (2000). Histone H2A.Z regulats
transcription and is partially redundant with nucleosome remodeling complexes. Cell 103, 411–
422.
Scheuermann, J.C., de Ayala Alonso, A.G., Oktaba, K., Ly-Hartig, N., Mcginty, R.K., Fraterman,
S., Wilm, M., Muir, T.W., and Müller, J. (2010). Histone H2A deubiquitinase activity of the
Polycomb repressive complex PR-DUB. Nature 465, 243–247.
Soshnikova, N., and Duboule, D. (2009). Epigenetic regulation of vertebrate Hox genes: a
dynamic equilibrium. Epigenetics : Official Journal of the DNA Methylation Society 4, 537–540.
Stock, J.K., Giadrossi, S., Casanova, M., Brookes, E., Vidal, M., Koseki, H., Brockdorff, N.,
Fisher, A.G., and Pombo, A. (2007). Ring1-mediated ubiquitination of H2A restrains poised
RNA polymerase II at bivalent genes in mouse ES cells. Nat Cell Biol 9, 1428–1435.
Valdés-Mora, F., Song, J.Z., Statham, A.L., Strbenac, D., Robinson, M.D., Nair, S.S., Patterson,
K.I., Tremethick, D.J., Stirzaker, C., and Clark, S.J. (2012). Acetylation of H2A.Z is a key
epigenetic modification associated with gene deregulation and epigenetic remodeling in cancer.
Genome Res 22, 307–321.
Vissers, J.H., Nicassio, F., Van Lohuizen, M., Di Fiore, P.P., and Citterio, E. (2008). The many
faces of ubiquitinated histone H2A: insights from the DUBs. Cell Div 3, 8.
Wamstad, J.A., Alexander, J.M., Truty, R.M., Shrikumar, A., Li, F., Eilertson, K.E., Ding, H.,
Wylie, J.N., Pico, A.R., Capra, J.A., et al. (2012). Dynamic and coordinated epigenetic
regulation of developmental transitions in the cardiac lineage. Cell 151, 206–220.
Whittle, C.M., McClinic, K.N., Ercan, S., Zhang, X., Green, R.D., Kelly, W.G., and Lieb, J.D.
(2008). The genomic distribution and function of histone variant HTZ-1 during C. elegans
embryogenesis. PLoS Genet 4, e1000187.
Williams, K., Christensen, J., Pedersen, M.T., Johansen, J.V., Cloos, P.A.C., Rappsilber, J., and
Helin, K. (2011). TET1 and hydroxymethylcytosine in transcription and DNA methylation
fidelity. Nature 473, 343–348.
Zhu, P., Zhou, W., Wang, J., Puc, J., Ohgi, K.A., Erdjument-Bromage, H., Tempst, P., Glass,
C.K., and Rosenfeld, M.G. (2007). A histone H2A deubiquitinase complex coordinating histone
acetylation and H1 dissociation in transcriptional regulation. Mol Cell 27, 609–621.
Zlatanova, J., and Thakar, A. (2008). H2A.Z: view from the top. Structure 16, 166–179.
125 Chapter 4 | Conclusions
126