Molecular Endocrinology. First published ahead of print September 24, 2013 as doi:10.1210/me.2013-1185
ORIGINAL
RESEARCH
Forkhead Box O1 Is a Repressor of Basal and GnRHInduced Fshb Transcription in Gonadotropes
Danalea V. Skarra, David J. Arriola, Courtney A. Benson, and
Varykina G. Thackray
Department of Reproductive Medicine and the Center for Reproductive Science and Medicine, University
of California, San Diego, LA Jolla, CA 92093
Synthesis of the gonadotropin beta subunits is tightly controlled by a complex network of hormonal signaling pathways that may be modulated by metabolic cues. Recently, we reported that
insulin regulates FOXO1 phosphorylation and cellular localization in pituitary gonadotropes and
that FOXO1 overexpression inhibits Lhb transcription. In the current study, we investigated
whether FOXO1 modulates Fshb synthesis. Here, we demonstrate that FOXO1 represses basal and
GnRH-induced Fshb transcription in L␤T2 cells. Additionally, we show that PI3K inhibition, which
increases FOXO1 nuclear localization, results in decreased Fshb mRNA levels in murine primary
pituitary cells. FOXO1 also decreases transcription from the human FSHB promoter, suggesting
that FOXO1 regulation of FSHB transcription may be conserved between rodents and humans.
Although the FOXO1 DNA binding domain is necessary for suppression of Fshb, we do not observe
direct binding of FOXO1 to the Fshb promoter, suggesting that FOXO1 exerts its effect through
protein-protein interactions with transcription factors required for Fshb synthesis. FOXO1 suppression of basal Fshb transcription may involve PITX1 since PITX1 interacts with FOXO1, FOXO1
repression maps to the proximal Fshb promoter containing a PITX1 binding site, PITX1 induction
of Fshb or a PITX1 binding element in CV-1 cells is decreased by FOXO1, and FOXO1 suppresses
Pitx1 mRNA and protein levels. GnRH induction of an Fshb promoter containing a deletion at
-50/-41 or -30/-21 is not repressed by FOXO1, suggesting that these two regions may be involved
in FOXO1 suppression of GnRH-induced Fshb synthesis. In summary, our data demonstrate that
FOXO1 can negatively regulate Fshb transcription, and suggest that FOXO1 may relay metabolic
hormonal signals to modulate gonadotropin production.
SH is produced by gonadotrope cells in the anterior
pituitary and plays a key role in mammalian fertility.
In females, it is required for ovarian folliculogenesis,
while in males it promotes spermatogenesis in conjunction with testosterone (1, 2). Female Fshb knockout mice
exhibit an arrest in ovarian folliculogenesis prior to the
antral stage, while males are fertile but have impaired
reproductive function (3). In contrast, the human FSHB
gene appears to be critical for reproductive function in
both genders. Nonsynonymous mutations result in absent
or incomplete pubertal development and infertility in
women, as well as azoospermia and infertility in men (4).
F
FSH is a heterodimeric glycoprotein composed of a
common alpha subunit, shared with LH and TSH, as well
as a unique beta subunit that confers biological specificity. Transcription of the Fshb gene is dynamically regulated during the estrous cycle. Alterations in Fshb mRNA
levels are observed prior to changes in serum FSH levels,
indicating that transcription of Fshb is a rate-limiting step
for production of the mature hormone (5, 6). Proper regulation of FSH levels is important for fertility. Low FSH
levels are associated with defective follicular growth,
while high levels are associated with premature ovarian
failure (7).
ISSN Print 0888-8809 ISSN Online 1944-9917
Printed in U.S.A.
Copyright © 2013 by The Endocrine Society
Received June 19, 2013. Accepted September 18, 2013.
Abbreviations: Abbreviations: AP1 activator protein 1; AP1BE AP1 binding element; ␤-gal
␤-galactosidase; DBD DNA binding domain; DMEM Dulbecco’s Modification of Eagles
Medium; EGR1 early growth response protein 1; FBE forkhead binding element; FBS fetal
bovine serum; GFP green fluorescent protein; HD homeodomain; HDBE HD binding element; HSD Honestly Significant Difference; LHX LIM homeobox gene; luc luciferase; NFY
nuclear transcription factor Y; PBS phosphate buffered saline; PITX paired-like homeodomain transcription factor; PITXBE PITX binding element; SF1 steroidogenic factor 1
doi: 10.1210/me.2013-1185
Mol Endocrinol
Copyright (C) 2013 by The Endocrine Society
mend.endojournals.org
1
2
FOXO1 Suppresses Fshb Gene Expression
Basal Fshb transcription involves multiple transcription factors, including LIM homeobox gene (LHX), nuclear transcription factor Y (NFY) and paired-like homeodomain transcription factor (PITX) (8). LHX3 was
reported to bind the porcine Fshb promoter at several
binding sites, including one element which is highly conserved among mammals (9). Additionally, NFY was
shown to bind to a site at –76/-72 in the murine Fshb
promoter and mutation of this site decreased basal Fshb
synthesis by 30% (10). Furthermore, Lamba et al, showed
that PITX1/2 binds to a conserved element at –54/-49 of
the murine Fshb promoter and that mutation of this binding element reduced basal Fshb gene expression (11).
Hormonal regulation of Fshb gene expression has been
shown to occur via multiple signaling pathways (12).
GnRH increases Fshb transcription via PKC and MAPK
signaling pathways through the induction of the activator
protein 1 (AP1) transcription factors, c-FOS and JUNB,
which bind and induce the Fshb promoter, along with
c-JUN and FOSB (13–18). AP1 also interacts with factors
involved in basal expression of Fshb, such as NFY, in the
mouse and USF1, in the rat to integrate GnRH responsiveness (16, 19). Activin is also an inducer of the Fshb
gene (20). Activin signaling through SMAD and FOXL2
proteins also appears to be critical for transcriptional regulation of the Fshb gene (8, 21).
In addition to reproductive hormones, metabolic hormones may regulate FSH production at the level of the
gonadotrope. While insulin, IGF1 and leptin treatment of
rat primary pituitary cells have been reported to increase
FSH, as well as LH levels (22–25), it is not clear whether
this is due to an effect of these hormones on Fshb transcription vs production and/or secretion of the mature
hormone. One possibility is that metabolic hormones regulate Fshb transcription in gonadotropes through the activity of downstream effectors such as the FOXO subfamily of forkhead transcription factors. This family is
composed of FOXO1, 3, 4 and 6. The transcriptional
activity of FOXOs is controlled by posttranslational
modifications in multiple cell and tissue types (26 –28).
FOXO phosphorylation has been shown to be regulated
by insulin, IGF1 and leptin (29 –31). Insulin stimulation
induces PI3K/AKT activation, triggering AKT phosphorylation of FOXO1 on residues Thr24, Ser256, and Ser319
(32). This results in FOXO1 export from the nucleus to
the cytoplasm, where it is sequestered by 14 –3–3 proteins, preventing FOXO1 transcriptional activity. While
considerable progress has been made in understanding
the role of FOXOs in reproductive tissues such as the
ovary and uterus (33, 34), FOXO regulation of gonadotropin hormone production in pituitary gonadotrope cells
remains largely unexplored.
Mol Endocrinol
Recently, we reported that insulin signaling regulated
FOXO1 phosphorylation in a PI3K-dependent manner in
immortalized gonadotropes, similarly to what has been
observed in other cells (26, 35, 36). Since we also discovered that overexpression of FOXO1 suppressed basal and
GnRH-induced Lhb transcription, the purpose of this
study was to determine whether FOXO1 can regulate
Fshb synthesis. We show that overexpression of FOXO1
in L␤T2 cells results in decreased basal and GnRH-induced transcription from murine and human FSHB-luc
reporters as well as endogenous Fshb mRNA. In addition,
we show that inhibition of PI3K, which increases FOXO1
nuclear localization (35), results in decreased basal and
GnRH-induced Fshb mRNA in murine primary pituitary
cells. We also demonstrate that the FOXO1 suppression
maps to the proximal Fshb promoter. Moreover, our data
suggest that the FOXO1 suppression occurs through protein-protein interactions with factors necessary for Fshb
transcription such as PITX1, since the FOXO1 DNA
binding domain (DBD) is required for the suppression but
FOXO1 does not appear to bind directly to the proximal
Fshb promoter. This idea is further supported by the fact
that PITX1 induction of Fshb or a PITX1 binding element
in CV-1 cells is suppressed by FOXO1, that PITX1 interacts with FOXO1, and that two regions of the proximal
Fshb promoter (-50/-41 and –30/-21) appear to be necessary for FOXO1 suppression of GnRH-induced Fshb
transcription.
Materials and Methods
Murine Primary Pituitary Cell Culture
Seven-week old, male C57 Black 6 mice (Harlan Laboratories, Indianapolis, IN) were housed in the UCSD vivarium for
one week under standard conditions. All animal procedures
were conducted in accordance with the UCSD Institutional Animal Care and Use Committee requirements. Eight mice were
sacrificed and their pituitaries were collected in ice-cold Dulbecco’s A Phosphate-buffered saline (PBS). After a PBS rinse, the
pituitaries were minced on ice with fine scissors and then placed
in dissociation media containing phosphate buffered 0.25%
trypsin-EDTA (Gibco/Life Technologies, Grand Isle, NY) and
0.25% collagenase (Life Technologies). The pituitaries were
shaken for 30 minutes at 37°C in a water bath, then an equal
volume of Dulbecco’s Modification of Eagles Medium (DMEM)
(Mediatech Inc., Herndon, VA) containing 10% fetal bovine
serum (FBS) (Omega Scientific, Inc., Tarzana, CA) was added
along with DNaseI (Worthington Biochemical, Lakewood, NJ)
at a final concentration of 25 ␮g/mL and incubated for another
15 minutes at 37°C. After removal of tissue debris, the cells were
pelleted by centrifugation and plated at a density of 6 ⫻ 105/2
cm2 well in Primaria plates (BD Biosciences, San Jose, CA).
After 24 hours in 10% FBS DMEM, the cells were changed to
serum-free media 18 hours before treatment. Cells were pre-
doi: 10.1210/me.2013-1185
treated with DMSO or 50 ␮M LY294002 (EMD Biosciences,
San Diego, CA) for 1 hour, then treated with 0.1% BSA vehicle
or 30 nM GnRH (Sigma-Aldrich Co., St. Louis, MO) along with
DMSO or LY294002 for an additional 5 hours, after which the
cells were lysed to obtain total RNA.
Immortalized Cell Culture
Cell culture was performed using the L␤T2 cell line which
has many characteristics of a mature, differentiated gonadotrope (37, 38). CV-1 cells lacking PITX1 were also used (39, 40).
The cells were maintained in 10 cm plates in DMEM with 10%
FBS and penicillin/streptomycin antibiotics (Gibco/Invitrogen,
Grand Island, NY) at 37°C and 5% CO2.
Adenoviral Infection
Adenoviral vectors containing cDNA of green fluorescent
protein (Ad-GFP) and constitutively active FOXO1 (T24A/
S256A/S319A) (Ad-FOXO1-CA) were generously provided by
Dr. Domenico Accili. L␤T2 cells were seeded at 2 ⫻ 106 cells/
well on 6-well plates. The next morning, cells were transduced
with a multiplicity of infection of 200 of Ad-GFP or AdFOXO1-CA for 6 hours, then switched to serum-free DMEM.
24 hours after adenoviral infection, cells were treated with vehicle (0.1% BSA) or 10 nM GnRH for 1 or 6 hours as noted.
Quantitative RT-PCR
Total RNA was extracted from L␤T2 cells with TRIzol Reagent (Life Technologies, Carlsbad, CA) following the manufacturer’s protocol. Contaminating DNA was removed with
DNA-free reagent (Life Technologies). 2 ␮g of RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (Bio-Rad
Laboratories, Inc., Hercules, CA) according to the manufacturer’s protocol. Quantitative real-time PCR was performed in an
iQ5 iCycler using iQ SYBR Green Supermix (Bio-Rad Laboratories, Inc.) and the following primers: Fshb forward, GCCGTTTCTGCATAAGC; Fshb reverse, CAATCTTACGGTCTCGTATACC;
Pitx1
forward,
GTCCGACGCTGATCTGCCA; Pitx1 reverse, TTGCCGCCGCTGTTTCTTCTT; c-Fos forward, GGCAAAGTAGAGCAGCTATCTCCT; c-Fos reverse GGCAAAGTAGAGCAGCTATCTCCT;
c-Jun
forward,
GTCCCCTATCGACATGGAGTCT;
c-Jun
reverse,
GAGTTTTGCGCTTTCAAGGTTT; Gapdh forward, TGCACCACCAACTGCTTAG; Gapdh reverse, GGATGCAGGGATGATGTTC; under the following conditions: 95°C
for 5 minutes, followed by 40 cycles at 95°C for 45 seconds,
56°C for 45 seconds, and 72°C for 45 seconds except for an
annealing temperature of 61°C for Pitx1. Each sample was assayed in triplicate and the experiment was conducted at least
three times. Standard curves with dilutions of a plasmid containing Fshb, Pitx1, c-Fos, c-Jun, or Gapdh cDNA were generated with the samples in each run. In each experiment, the
amount of Fshb, Pitx1, c-Fos, or c-Jun was calculated by comparing the threshold cycle obtained for each sample with the
standard curve generated in the same run. Replicates were averaged and divided by the mean value of Gapdh in the same
sample. After each run, a melting curve analysis was performed
to confirm that a single amplicon was generated for each primer
pair.
mend.endojournals.org
3
Plasmid Constructs
The pcDNA3 Flag human FOXO1 and pcDNA3 Flag
FOXO1-CA expression vectors were previously described (32).
We obtained the pcDNA3 FOXO1-⌬DBD (⌬208 –220) from
Dr. William Sellers (Addgene plasmid 10694). The pcDNA3
murine PITX1 expression vector was described previously (41).
The construction of the –1000 murine Fshb luciferase (luc) reporter plasmid and 5⬘ truncations were described previously
(16, 42). The 10 bp deletions of the –398 Fshb promoter from
–70/-11 were generously provided by Dr. Djurdjica Coss. The
–1028/⫹7 human FSHB-luc reporter plasmid was provided by
Dr. Daniel Bernard. The 4xFBE-luc was constructed by inserting four repeats of a consensus forkhead binding element (FBE)
(CCGTAAACAACT) upstream of a minimal – 81 Herpes simplex virus thymidine kinase promoter in pGL3 using KpnI and
NheI restriction enzyme sites while the 4xHDBE-luc contains
four repeats of a consensus bicoid-related homeodomain binding element (HDBE) (ACTAATCCCT) (39). The elements are
underlined. Sequences were confirmed by dideoxyribonucleotide sequencing.
Mutagenesis
The QuikChange Site-Directed Mutagenesis Kit (Stratagene,
La Jolla, CA) was used to generate mutations in a plasmid containing the murine Fshb promoter. Mutagenesis was performed
with the following mutations in the –54/-49 PITX1 and –72/-69
AP1 binding elements, respectively:
5⬘-GTGGATCGAC-3⬘ and 5⬘-ATTGGTCCCG-3⬘ (mutated
bases are indicated in bold). The sequences of the promoters
were confirmed by dideoxyribonucleotide sequencing.
Transient Transfection
L␤T2 cells were seeded at 4.5 ⫻ 105 cells/well on 12-well
plates and transfected 18 hours later, using Polyjet (SignaGen
Laboratories, Rockville, MD) following the manufacturer’s instructions. CV-1 cells were seeded at 1.5 ⫻ 105 cells/well. For all
experiments, the cells were transfected with 400 ng of the indicated luc reporter plasmid and 200 ng of a ␤-galactosidase (␤gal) reporter plasmid driven by the Herpes Virus thymidine
kinase promoter to control for transfection efficiency. The cells
were switched to serum-free DMEM containing 0.1% BSA, 5
mg/L transferrin, and 50 mM sodium selenite 6 hours after
transfection. After overnight incubation in serum-free media,
the cells were treated with vehicle (0.1% BSA) or 10 nM GnRH
for 6 hours, as indicated.
Luciferase and ␤-galactosidase Assays
To harvest the cells, they were washed with 1xPBS and lysed
with 0.1 M K-phosphate buffer pH 7.8 containing 0.2% Triton
X-100. Lysed cells were assayed for luc activity using a buffer
containing 100 mM Tris-HCl pH 7.8, 15 mM MgSO4, 10 mM
ATP, and 65 ␮M luciferin. ␤-Gal activity was assayed using the
Tropix Galacto-light assay (Applied Biosystems, Foster City,
CA), according to the manufacturer’s protocol. Both assays
were measured using a Veritas Microplate Luminometer (Promega, Madison, WI).
Statistical Analyses
Quantitative RT-PCR and transient transfection experiments were performed in triplicate and each experiment was
4
FOXO1 Suppresses Fshb Gene Expression
repeated at least three times. For the transient transfections, the
data were normalized for transfection efficiency by expressing
luc activity relative to ␤-gal and relative to the empty reporter
plasmid to control for hormone effects on the vector DNA. The
data were analyzed by Student’s t test for independent samples
or one-way analysis of variance (ANOVA) followed by post hoc
comparisons with the Tukey-Kramer Honestly Significant Difference (HSD) test using the statistical package JMP 10.0 (SAS,
Cary, NC). Significant differences were designated as P ⬍ .05.
Immunofluorescence
L␤T2 cells were seeded onto poly L-lysine coverslips (BD
Biosciences, Franklin Lakes, NJ) at 4.5 ⫻ 105 cells/well in 12well plates and then transfected 18 hours later with pcDNA3
Flag human FOXO1 or pcDNA3 Flag FOXO1-CA expression
vectors. Six h after transection, the cells were switched to serumfree DMEM containing 0.1% BSA, 5 mg/L transferrin, and 50
mM sodium selenite for overnight incubation. The next day, the
cells were washed twice with PBS and fixed with 4% paraformaldehyde for 10 minutes. Cells were then washed in PBS twice
and permeabilized with Nonidet P-40 solution (PBS containing
0.2% Nonidet P-40, 20% goat serum, 1% BSA) for 1 hour at
room temperature. Cells were washed twice in PBS and then
incubated with mouse anti-Flag (Sigma, 1:100, F3165) primary
antibody in blocking buffer (PBS containing 20% goat serum,
1% BSA) for 24 hours at 4°C. Cells were washed 3 times with
PBS for 5 minutes and incubated with Alexa488-conjugated
goat antimouse secondary antibody (Invitrogen, 1:300,
A11001) in blocking buffer for 1 hour at room temperature.
Cells were washed 3 times with PBS for 5 minutes and incubated
with 300 nM DAPI (Invitrogen) for 4 minutes, then washed 3
times with PBS for 5 minutes each. Coverslips were mounted
using Prolong Gold (Invitrogen) and cells were viewed using a
Nikon Eclipse TE 2000-U inverted fluorescence microscope.
Digital images were collected using a CoolSNAP EZ cooled
CCD camera (Roper Scientific, Trenton, NJ) and analyzed with
the Version 2.3 NIS-elements image analysis system.
Electrophoretic Mobility Shift Assay (EMSA)
Flag-FOXO1-CA was transcribed and translated using a
TnT Coupled Reticulolysate System (Promega Corp., Madison,
WI). The oligonucleotides were end-labeled with T4 polynucleotide kinase and [␥-32P] ATP. 4 ␮L of TnT lysate was incubated
with 1 fmol of 32P-labeled oligo at 4°C for 30 minutes in a
DNA-binding buffer [10 mM Hepes pH 7.8, 50 mM KCl, 5 mM
MgCl2, 0.1% Nonidet P-40, 1 mM dithiothreitol, 2 ␮g poly(dIdC), and 10% glycerol]. After 30 minutes, the DNA binding
reactions were run on a 5% polyacrylamide gel (30:1 acrylamide: bisacrylamide) containing 2.5% glycerol in a 0.25x TBE
buffer. Murine anti-Flag M2 antibody was used to supershift
Flag-FOXO1-CA; murine IgG was used as a control for nonspecific binding; 100x cold oligo was used as a competitor. The
following oligonucleotides were used for EMSA: –95/-61 5⬘CAGCAGGCTTTATGTTGGTATTGGTCATGTTAACA-3⬘,
– 65/-31
5⬘-TAACACCCAGTAAATCCACAGGGTTTTAAGTTTGT-3⬘, –35/-1 5⬘-TTTGTATAAAAGATGAGGTGTAACTTGACTCAGTG-3⬘, the consensus FBE (43) 5⬘CTAGATGGTAAACAACTGTGACTAGTAGAACACGG-3⬘
and
the
mutated
consensus
FBE
5⬘-CTAGATG-
Mol Endocrinol
GTGGGCAACTGTGACTAGTAGAACACGG-3⬘ with the
mutations underlined.
GST Interaction Assay
GST-PITX1 was provided by Dr. Jacques Drouin and the
GFP expression vector by Dr. Douglass Forbes. 35S-labeled proteins were produced using the TnT Coupled Reticulolysate System. Bacteria transformed with GST plasmids were grown to
OD of 0.6 and induced with IPTG overnight at 30°C (44).
Bacterial pellets were sonicated in 0.1% Triton X-100, 5 mM
EDTA in 1x PBS, centrifuged and the supernatant was bound to
glutathione sepharose 4B resin (Amersham Pharmacia Biotech,
Piscataway, NJ). Beads were washed 4x in PBS and in HND
buffer (10 mg/ml BSA, 20 mM Hepes pH 7.8, 50 mM NaCl, 5
mM DTT, and 0.1% NP-40). For the interaction assay, 20 ␮l of
35
S-labeled in vitro transcribed and translated FOXO1,
FOXO1-⌬DBD or GFP was added to the beads with 400 ␮l of
HND buffer. Beads were incubated overnight at 4°C, washed 2x
with HND buffer and 2x with 0.1% NP-40 in PBS. Thirty ␮l of
2x Laemmli load buffer was added, the samples were boiled and
electrophoresed on a 10% SDS-polyacrylamide gel. One fourth
of the 35S-labeled in vitro transcribed-translated product was
loaded onto the gel as input.
Western Blot Analysis
Whole cell extracts from adenoviral-infected L␤T2 cells were
analyzed by western for PITX1, c-JUN, c-FOS and FOXO1.
Cells were washed twice with ice cold PBS, then harvested by
incubating in lysis buffer [10 mM Tris-HCl, pH 7.4, 150 mM
NaCl, 1% Nonidet P-40, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, complete protease inhibitor mixture pellet
(Roche Molecular Biochemical, Indianapolis, IN) and phosphatase inhibitor mixture pellet (Roche)] for 10 minutes at 4°C.
Lysates were centrifuged at 20,000 x g for 30 minutes. The
protein concentration was determined by Bradford assay. An
equal amount of protein per sample was loaded on a 10% SDSPAGE gel. Proteins were resolved by electrophoresis and transferred onto a polyvinylidene difluoride membrane (Millipore,
Billerica, MA). Membranes were blocked overnight in 5% nonfat milk, then incubated overnight at 4°C with goat antihuman
PITX1 (1:500, sc-18922), rabbit antihuman c-JUN (1:1000; sc1694), rabbit antihuman c-FOS (1:1000; sc-52), rabbit antihuman FOXO1 (1:1000; sc-11350), or rabbit antihuman ␤-Tubulin (1:3000, sc-9104) primary antibodies (Santa Cruz
Biotechnology). Blots were incubated with an antirabbit or antigoat horseradish peroxidase-linked secondary antibody (1:
10000; Santa Cruz Biotechnology) and bands were visualized
using the SuperSignal West Dura Substrate (Thermo Scientific,
Rockford, IL). Densitometric analysis of band intensity was performed with ImageJ software (National Institute of Health,
Bethesda, MD).
Results
Overexpression of Constitutively Active FOXO1
and PI3K Inhibition Decreases Basal and GnRHInduced Fshb mRNA Levels
To ascertain whether the FOXO1 transcription factor
can suppress Fshb gene expression, we transduced L␤T2
doi: 10.1210/me.2013-1185
mend.endojournals.org
cells with adenovirus (Ad) expressing GFP or constitutively active FOXO1 (FOXO1-CA) and measured Fshb
mRNA levels using quantitative RT-PCR. FOXO1-CA is
localized in the nucleus due to the inability of insulin/
growth factor signaling to phosphorylate the mutated residues (Figure 1A). As observed previously (45), GnRH
induced Fshb transcription by 3 fold (Figure 1B). We also
demonstrated that Fshb mRNA synthesis was significantly decreased in cells infected with Ad-FOXO1-CA vs
Ad-GFP (Figure 1B). Basal Fshb mRNA levels were reduced by 67% while GnRH-induced Fshb transcription
was decreased by 84%. These results indicate that
FOXO1 can suppress endogenous Fshb synthesis in the
context of the native chromatin.
5
We then determined whether repression of Fshb transcription could be observed in murine primary pituitary
cells. Since there is no pharmacological activator of
FOXO1, we used a PI3K inhibitor to mimic constitutively
active FOXO1 since inhibition of PI3K results in FOXO1
nuclear localization in gonadotropes (35). As shown in
Figure 1C, treatment of dispersed pituitary cells with 30
nM GnRH resulted in a significant 1.7-fold induction of
Fshb. Inhibition of PI3K with 50 ␮M LY294002 resulted
in a substantial decrease in basal and GnRH-induced
Fshb mRNA levels (79% and 95%, respectively). Although pharmacological inhibition of PI3K may affect
multiple PI3K/AKT targets (46), these results demonstrate, for the first time, that inhibition of PI3K results in
A
B
β
C
FIGURE 1. Constitutively Active FOXO1 and Inhibition of PI3K Reduces Basal Transcription and GnRH Induction of Fshb mRNA in Gonadotropes.
A. Diagram illustrating wild-type FOXO1 and constitutively active FOXO1-CA (T24A/S256A/S319A). DBD, DNA binding domain; NLS, nuclear
localization signal; NES, nuclear export signal. B. L␤T2 cells were transduced with Ad-GFP or Ad-FOXO1-CA for 6 hours, then switched to serumfree media. 24 hours after adenoviral infection, cells were treated with 0.1% BSA vehicle (Veh) or 10 nM GnRH for 6 hours, as indicated. The
results represent the mean ⫾ SEM of three experiments performed in triplicate and are presented as amount of Fshb mRNA relative to Gapdh. *
indicates that Fshb transcription is significantly repressed by FOXO1-CA compared to GFP using Student’s t test. C. After overnight incubation in
serum-free media, dispersed murine primary pituitary cells were pretreated with DMSO or 50 ␮M LY294002 for 1 hour, then treated with Veh or
30 nM GnRH along with DMSO or LY294002 for an additional 5 hours. The results represent the mean ⫾ SEM of four experiments performed in
triplicate and are presented as amount of Fshb mRNA relative to Gapdh. # indicates that GnRH significantly increased Fshb mRNA levels compared
to Veh using Student’s t test. * indicates that Fshb transcription is significantly repressed by LY294002 compared to DMSO using Student’s t test.
FOXO1 Suppresses Fshb Gene Expression
FOXO1 Suppresses Basal Transcription and GnRH
Induction of Murine Fshb-luc
Since FOXO1-CA suppressed endogenous Fshb
mRNA levels, FOXO1 or FOXO1-CA were overexpressed in L␤T2 cells to determine whether FOXO1 regulates the Fshb promoter. Initially, we determined the
cellular localization of pcDNA3 Flag human FOXO1 and
pcDNA3 Flag human FOXO1-CA transiently transfected
in L␤T2 cells and incubated in serum-free media. As
shown in Figure 2A, FOXO1 is predominantly localized
in the cytoplasm with some nuclear localization while
FOXO1-CA is localized in the nucleus. We then tested
whether FOXO1 transfected into L␤T2 cells could induce
transcription from a minimal promoter containing a characterized forkhead binding element (FBE). FOXO1 increased transcription of four copies of a consensus FBE
linked to a luc reporter (4xFBE-luc) (Figure 2B). In contrast, when 200 ng of FOXO1 or FOXO1-CA were transiently transfected with the –1000 murine Fshb promoter
linked to a luc reporter (mFshb-luc), we observed repression of Fshb synthesis (Figure 2C). More specifically,
basal Fshb transcription was decreased by 50% and 99%,
respectively (Figure 2D) while GnRH-induced Fshb was
reduced by 63% and 29%, respectively (Figure 2E).
FOXO1 Suppresses Transcription of Human
FSHB-luc
Given that the proximal murine and human FSHB promoters are highly conserved (8), we hypothesized that
FOXO1 would have a similar repressive effect on human
FSHB gene expression as on murine Fshb. When 200 ng
of FOXO1 was transiently transfected with the –1028/⫹7
human FSHB promoter linked to a luciferase reporter
(hFSHB-luc), we observed repression of basal and GnRHinduced FSHB synthesis (Figure 3A-C). Basal FSHB transcription was reduced 38% by FOXO1 while GnRHinduced FSHB gene expression was reduced by 52%.
FOXO1 Suppression Maps to the Proximal Fshb
Promoter
Since the proximal Fshb promoter contains PITX1,
NFY and AP-1 binding elements necessary for basal and
GnRH induction of Fshb (Figure 4A), we determined
which regions of the Fshb promoter were required for
FOXO1 suppression using 5⬘ truncation analysis of the
promoter. Basal transcription and GnRH induction were
measured using –1000, –500, –304, –95, and – 64 Fshbluc reporter plasmids (Figure 4B). FOXO1 suppression of
A
B
β
decreased basal and GnRH-induced Fshb transcription in
murine primary pituitary cells, potentially through increased nuclear localization of FOXO1.
Mol Endocrinol
C
β
6
D
E
FIGURE 2. FOXO1 Suppresses Basal Transcription and GnRH
Induction of the Murine Fshb-luc in L␤T2 Cells. A. The pcDNA3 Flag
human FOXO1 and the pcDNA3 Flag human FOXO1-CA expression
vectors were transfected into L␤T2 cells and then incubated overnight
in serum-free media. Immunofluorescence was performed with a
mouse anti-Flag primary antibody and an Alexa488-conjugated goat
antimouse secondary antibody. DAPI was used as a nuclear marker.
Representative images were obtained using a Nikon Eclipse TE2000-U
inverted fluorescence microscope at 60x magnification. B. The 4xFBEluc reporter was transiently transfected into L␤T2 cells along 200 ng of
pcDNA3 empty vector (EV) or FOXO1 expression vectors, as indicated.
After overnight incubation in serum-free media, cells were treated for
doi: 10.1210/me.2013-1185
mend.endojournals.org
basal Fshb gene expression and GnRH induction still occurred with the – 64 Fshb-luc (Figure 4C-D), suggesting
that elements present in the 64 base pairs upstream of the
transcription start site are sufficient for FOXO1 repression of basal and GnRH-induced Fshb transcription.
Legend to Figure 2 Continued. . .
6 hours with 0.1% BSA vehicle (Veh) or 10 nM GnRH. The results
represent the mean ⫾ SEM of three experiments performed in
triplicate and are presented as luc/␤-gal. * indicates that the induction
by FOXO1 is significantly different from the empty vector using
Student’s t test. B-D. The –1000 murine Fshb-luc reporter was
transfected into L␤T2 cells along with EV, FOXO1 or FOXO1-CA (CA),
as indicated. After overnight incubation in serum-free media, cells
were treated for 6 hours with Veh or 10 nM GnRH. The results
represent the mean ⫾ SEM of three experiments performed in
triplicate and are presented as luc/␤-gal (C), basal transcription relative
to EV (D) or fold GnRH induction relative to the vehicle control (E). The
different lowercase letters indicate that Fshb-luc transcription is
significantly repressed by FOXO1 or FOXO1-CA compared to EV using
one-way ANOVA followed by Tukey’s HSD post hoc test.
A
B
C
β
B
The DNA-Binding Domain of FOXO1 Is Required
for Suppression of Fshb Synthesis
To determine whether FOXO1 repression requires the
FOXO1 DBD, we tested whether a DNA-binding deficient FOXO1, termed FOXO1- ⌬DBD (⌬208 –220) (Figure 5A), could elicit a repressive response. As a control for
the level of protein expression, we showed that FOXO1
and FOXO1-⌬DBD are stably expressed when transfected into L␤T2 cells (Figure 5B). We then demonstrated
that while overexpression of FOXO1 reduced Fshb gene
expression, the FOXO1-⌬DBD did not alter basal Fshb
synthesis (Figure 5C) or suppress GnRH-induced Fshb
gene expression (Figure 5D). These results indicate that
β
A
7
C
D
FIGURE 3. FOXO1 Suppresses Basal Transcription and GnRH
Induction of Human FSHB-luc. A-C. The –1028/⫹7 human FSHB-luc
reporter was transfected into L␤T2 cells along with pcDNA3 empty
vector (EV) or FOXO1, as indicated. After overnight incubation in
serum-free media, cells were treated for 6 hours with 0.1% BSA
vehicle (Veh) or 10 nM GnRH. The results represent the mean ⫾ SEM
of three experiments performed in triplicate and are presented as luc/
␤-gal (A), basal transcription relative to empty vector (B) or fold GnRH
induction relative to the vehicle control (C). * indicates that FSHB-luc
transcription is significantly repressed by FOXO1 compared to EV using
Student’s t test.
FIGURE 4. FOXO1 Suppression Maps to the Proximal Fshb Promoter.
A. Diagram illustrating the location of binding elements for NFY, AP1
and PITX1 transcription factors on the murine Fshb Promoter. B-D. The
–1000, –500, –304, –95, and – 64 murine Fshb-luc reporters were
transiently transfected into L␤T2 cells along with pcDNA3 empty vector
(EV) or FOXO1, as indicated. After overnight incubation in serum-free
media, cells were treated for 6 hours with 0.1% BSA vehicle (Veh) or
10 nM GnRH. The results represent the mean ⫾ SEM of three
experiments performed in triplicate and are presented as luc/␤-gal (B),
basal transcription relative to empty vector (C) or fold GnRH induction
relative to the vehicle control (D). * indicates that Fshb-luc transcription
is significantly repressed by FOXO1 compared to EV using one-way
ANOVA followed by Tukey’s HSD post hoc test.
8
FOXO1 Suppresses Fshb Gene Expression
the DBD of FOXO1 is necessary for FOXO1 repression
of Fshb basal transcription and GnRH induction on the
Fshb promoter and suggest that FOXO1 exerts an effect
by either binding to the Fshb promoter or indirectly
through FOXO1 DBD interaction with other factors.
A
B
∆
∆
∆
β
C
∆
D
Mol Endocrinol
FOXO1 Does Not Bind to the Proximal Fshb
Promoter via a High Affinity Binding Site
Since the FOXO1 repression mapped to the proximal
Fshb promoter and required the FOXO1 DBD, we performed EMSA to determine whether FOXO1 could bind
to the proximal promoter in vitro. Three 35-mer oligonucleotide probes were designed to span the –95/-1 region
relative to the transcription start site. Flag-FOXO1-CA,
synthesized with TnT rabbit reticulocyte lysate, bound to
an oligonucleotide probe containing a consensus FBE
(Figure 6A, lane 1) but not to probes encompassing the
–95/-1 region of the Fshb promoter (Figure 6A, lanes 4, 7,
and 10). TnT Flag-FOXO1 also bound to a consensus
FBE (data not shown). To identify which complex contained the Flag-FOXO1-CA bound to the FBE, we supershifted the complex with an anti-Flag antibody (Figure
6A, lane 3) but not with control IgG (Figure 6A, lane 2).
This complex was not present when rabbit reticulocyte
lysate containing the pcDNA3 empty vector was used
(data not shown). This complex also showed evidence of
self-competition (Figure 6B, lane 14) but did not compete
with a mutated consensus FBE (Figure 6B, lane 15). Incubation with oligos encompassing the –95/-1 region of the
Fshb promoter did not result in competition (Figure 6B,
lanes 16 –18). These results suggest that, in contrast to the
consensus FBE, FOXO1 does not bind to the proximal
Fshb promoter via a high affinity binding site.
A
B
∆
FIGURE 5. DNA Binding Domain of FOXO1 Is Required to Suppress
Basal and GnRH-induced Fshb Gene Expression. A. Diagram illustrating
FOXO1-⌬DBD (⌬208 –220). B. L␤T2 cells were transfected with
pcDNA3 empty vector (EV), pcDNA3-FOXO1 (WT) or pcDNA3-FOXO1⌬DBD for 6 hours, then switched to serum-free media. 24 hours after
transfection, the cells were harvested. Western blot analysis was
performed on whole cell extracts using FOXO1 and ␤-Tubulin primary
antibodies and a horseradish peroxidase-linked secondary antibody. A
representative image is shown. C-D. The –1000 murine Fshb-luc
reporter was transfected into L␤T2 cells along with EV, FOXO1 or
FOXO1-⌬DBD, as indicated. After overnight incubation in serum-free
media, cells were treated for 6 hours with 0.1% BSA or 10 nM GnRH.
The results represent the mean ⫾ SEM of three experiments performed
in triplicate and are presented as basal transcription relative to empty
vector (C) or fold GnRH induction relative to the vehicle control (D). *
indicates that Fshb-luc transcription is significantly repressed by FOXO1
compared to EV or FOXO1-⌬DBD using one-way ANOVA followed by
Tukey’s HSD post hoc test.
FIGURE 6. FOXO1 Does Not Bind Directly to the Proximal Fshb
Promoter. TnT Flag-FOXO1-CA was incubated with a consensus FBE,
–95/-61, – 65/31, or –35/-1 Fshb probes and tested for complex
formation in EMSA. A. FOXO1-CA-DNA complex on the FBE is shown
in lane 1, while anti-Flag supershift is shown in lane 3 and IgG control
in lane 2. The FOXO1-CA-DNA complex (arrow), antibody supershift
(ss) and nonspecific binding of proteins (ns) are indicated on the left of
the gel. B. Self-competition with excess cold FBE is shown in lane 14,
lack of competition with mutant FBE, –95/-61, – 65/31, or –35/-1 Fshb
oligos in lanes 15–18.
doi: 10.1210/me.2013-1185
mend.endojournals.org
FOXO1 Suppression of Basal Fshb Transcription
May Involve PITX1
Since the – 64 Fshb-luc containing the PITX1 binding
site was sufficient to elicit FOXO1 suppression, we tested
whether Fshb transcription due to PITX1 overexpression
was reduced by FOXO1. We performed these experi-
B
C
D
β
A
E
∆
β
9
ments in CV-1 cells lacking PITX1 because L␤T2 cells
contain PITX1 (39, 40). We first tested whether a multimer of a bicoid-related homeodomain binding element
(HDBE) was sufficient to elicit the FOXO1 suppressive
effect. As shown in Figure 7A, PITX1 induction of the
4xHDBE was significantly decreased by FOXO1. We
then showed that overexpression of
PITX1 resulted in a 14-fold induction of Fshb gene expression which
was reduced 73% by FOXO1 (Figure 7C). In addition, we tested
whether the PITX1 binding element
in the proximal Fshb promoter
shown in Figure 7B was necessary
for the PITX1 induction. Our results
demonstrated that the PITX1 binding element was absolutely required
for PITX1 induction of Fshb gene
expression in CV-1 cells (Figure 7C).
We also tested whether the PITX1
binding element was required in
L␤T2 cells. As previously reported
(11), mutation of the PITX1 binding
element reduced basal Fshb transcription (Figure 7D) but had no effect on GnRH induction (data not
shown). Interestingly, overexpression of FOXO1 reduced transcription of Fshb from the mutated promoter by 49% compared to 64% for
the wild-type promoter (Figure 7D),
suggesting that the PITX1 binding
element is not necessary for basal
FOXO1 suppression of Fshb. In addition, mutation of the PITX1 binding element did not prevent FOXO1
suppression of GnRH-induced Fshb
transcription (data not shown).
FIGURE 7. FOXO1 Suppression of Basal Fshb Transcription May Involve PITX1. A. The 4xHDBEluc reporter was transiently transfected into CV-1 cells along with pcDNA3 empty vector (EV),
FOXO1 and PITX1, as indicated. The results represent the mean ⫾ SEM of three experiments
performed in triplicate and are presented as fold PITX1 induction relative to pcDNA3 empty
vector. * indicates that transcription is significantly repressed by FOXO1 compared to EV using
Student’s t test. B. Diagram illustrating the mutations in the PITX1 binding element (PITXBE) in
the murine Fshb promoter. C-D. The –1000 Fshb-luc reporter and the Fshb PITX1 mutant (mut)
were transiently transfected into CV-1 (C) or L␤T2 (D) cells along with EV, FOXO1 and PITX1, as
indicated. The results represent the mean ⫾ SEM of three experiments performed in triplicate
and are presented as fold PITX1 induction relative to pcDNA empty vector (C) or luc/␤-gal (D). *
indicates that Fshb-luc transcription is significantly repressed by FOXO1 compared to EV using
Student’s t test while # indicates that the PITX1 mut was significantly repressed compared to the
wild-type Fshb promoter. E. GST interaction assays were performed using bacterially expressed
GST-fusion proteins (indicated above each lane) and 35S-labeled in vitro transcribed and
translated FOXO1, FOXO1-⌬DBD and GFP (indicated on the left of the panels). GFP was used as
a negative control. The GST-fusion proteins included GST alone and GST-PITX1. One quarter of
the protein used in the interaction assay was loaded in the lane marked input. The experiment
was repeated several times with the same results and a representative experiment is shown.
FOXO1 Interacts with PITX1
Since FOXO1 can suppress
PITX1 induction of Fshb and the
4xHDBE in CV-1 cells, we investigated whether FOXO1 can physically interact with PITX1. We tested
whether FOXO1 or DNA-binding
deficient FOXO1 interacts with
PITX1 by incubating a GST-PITX1
fusion protein with in vitro-transcribed and translated 35S-labeled
FOXO1 or FOXO1-⌬DBD in pulldown experiments. As shown in Fig-
FOXO1 Suppresses Fshb Gene Expression
ure 7E, there was minimal interaction between the GSTPITX1 fusion protein and the negative control (35S-GFP)
or with GST alone incubated with FOXO1 or FOXO1⌬DBD. In addition, FOXO1 bound to PITX1 while there
was no detectable interaction between FOXO1-⌬DBD
and PITX1, indicating that the interaction between
FOXO1 and PITX1 requires the FOXO1 DBD.
FOXO1 Reduces Pitx1 mRNA and Protein Levels
Since the FOXO1 DBD is required for suppression of
Fshb but FOXO1 does not appear to bind to the proximal
Fshb promoter, we hypothesized that FOXO1 may modulate Fshb transcription indirectly by regulating the
amount of PITX1 in the cells. In these experiments, L␤T2
cells were transduced with Ad-GFP or Ad-FOXO1-CA
and Pitx1 mRNA levels were measured using quantitative
RT-PCR (Figure 8A). FOXO1-CA significantly decreased
Pitx1 mRNA levels by 57%. We also tested whether the
decrease in Pitx1 mRNA levels translated into lower
PITX1 protein levels. As shown in Figure 8B-C,
FOXO1-CA transduction of L␤T2 cells resulted in a 40%
reduction in PITX1 protein levels. These results suggest
that FOXO1 may suppress Fshb transcription indirectly
through regulation of Pitx1 mRNA and protein levels.
FOXO1 Does Not Regulate c-Fos or c-Jun mRNA
and Protein Levels
Since GnRH induction of the murine Fshb promoter
involves the intermediate early genes, c-FOS and c-JUN
that comprise the transcriptional AP1 complex, we determined whether FOXO1-CA overexpression alters production of these two genes. L␤T2 cells were transduced
with Ad-GFP or Ad-FOXO1-CA and c-fos and c-jun
mRNA levels were measured using quantitative RT-PCR
(Figure 9A and C). Similar to previous reports (47, 48), 1
hour of GnRH treatment substantially increased c-fos
and c-jun mRNA levels (Figure 9B and D). However,
FOXO1-CA overexpression had little or no effect on c-fos
and c-jun mRNA. We also demonstrated that there was
no effect of FOXO1-CA overexpression on c-FOS and
c-JUN protein levels (Figure 9E).
FOXO1 Suppression of GnRH-Induced Fshb
Transcription Involves Two Regions of the
Proximal Fshb Promoter at –50/-41 and –30/-21
Since GnRH induction involves an AP1 binding element in the proximal Fshb promoter, we tested whether
this site was necessary for FOXO1 suppression of Fshb
transcription. Mutation of the AP1 binding element
shown in Figure 10A reduced GnRH induced Fshb transcription (Figure 10B), as previously reported (16). However, overexpression of FOXO1 reduced transcription of
Mol Endocrinol
A
B
β
C
β
10
FIGURE 8. FOXO1 Suppression of Basal Fshb Transcription May
Involve FOXO1 Regulation of Pitx1 mRNA and Protein Levels. L␤T2 cells
were transduced with Ad-GFP or Ad-FOXO1-CA for 6 hours, then
switched to serum-free media. 24 hours after adenoviral infection, cells
were harvested for total mRNA (A) or protein (B-C). A. The results
represent the mean ⫾ SEM of seven experiments performed in
triplicate and are presented as amount of Pitx1 mRNA relative to
Gapdh. * indicates that Pitx1 transcription is significantly repressed by
FOXO1-CA compared to GFP using Student’s t test. B-C. Western blot
analysis was performed on whole cell extracts using PITX1, FOXO1 and
␤-Tubulin primary antibodies and a horseradish peroxidase-linked
secondary antibody. A representative image is shown (B) or graph
representing the mean ⫾ SEM of four experiments presented as the
amount of PITX1 protein relative to ␤-Tubulin (C). * indicates that
PITX1 protein levels are significantly decreased by FOXO1-CA
compared to GFP using Student’s t test.
doi: 10.1210/me.2013-1185
mend.endojournals.org
Fshb from the mutated promoter by 50% compared to
59% for the wild-type promoter (Figure 10B), indicating
that the AP1 binding element is not required for FOXO1
suppression. Since FOXO1 suppression of GnRH-induced Fshb transcription occurred within the – 64 Fshb
promoter lacking the AP1 binding element, we sought to
map which regions of the proximal promoter were required for the suppression. Ten bp deletions of the Fshb
A
B
C
D
11
promoter ranging from –70/-61 to –20/-11 within the
–398 Fshb-luc were compared to wild-type –398 Fshbluc. Basal transcription of Fshb from either wild-type or
mutated promoters was suppressed by FOXO1 (data not
shown), suggesting that none of the 10 bp regions individually were required for FOXO1 suppression of basal
Fshb synthesis. Interestingly, GnRH induction of Fshb
was reduced with the mutated promoters compared to the
wild-type promoter (Figure 10C),
indicating that GnRH induction involves other regions of the Fshb promoter in addition to the AP1 binding
element. Moreover, FOXO1 was
unable to repress GnRH induction
of Fshb from promoters containing
deletions at –50/-41 or –30/-21 (Figure 10C), indicating that these regions may play a role in FOXO1
suppression of Fshb gene expression
induced by GnRH.
Discussion
E
FIGURE 9. FOXO1 Suppression of GnRH-Induced Fshb Transcription Does Not Involve
Regulation of c-Fos or c-Jun mRNA or Protein Levels. L␤T2 cells were transduced with Ad-GFP or
Ad-FOXO1-CA for 6 hours, then switched to serum-free media. 24 hours after adenoviral
infection, cells were treated with 0.1% BSA vehicle (Veh) or 10 nM GnRH for 1 hour, as
indicated. Cells were harvested for total mRNA (A-D) or protein (E). A-D. The results represent
the mean ⫾ SEM of three experiments performed in triplicate and are presented as amount of
c-Fos mRNA relative to Gapdh (A), fold GnRH induction of c-Fos relative to Veh (B), c-Jun mRNA
relative to Gapdh (C), fold GnRH induction of c-Jun relative to Veh (D). * indicates that
transcription is significantly repressed by FOXO1-CA compared to GFP using Student’s t test. E.
Western blot analysis was performed on whole cell extracts using c-FOS, c-JUN and FOXO1
primary antibodies and a horseradish peroxidase-linked secondary antibody. A representative
image is shown.
Our studies suggest that the FOXO1
transcription factor may regulate
fertility through modulation of gonadotropin beta subunit gene expression in pituitary gonadotrope
cells. Overexpression of wild-type
or constitutively active FOXO1
greatly diminished basal and
GnRH-induced Fshb mRNA levels
and Fshb-luc expression in L␤T2
cells (Figures 1 and 2), similarly to
the repressive effect of FOXO1 on
Lhb gene expression (35). Although
wild-type FOXO1 is predominantly
localized in the cytoplasm under serum-free media conditions, the level
of nuclear FOXO1 appears to be
sufficient to suppress Fshb transcription (Figure 2) (35). Our results
demonstrating that inhibition of
PI3K results in increased nuclear localization of FOXO1 (35) and decreased basal and GnRH induction
of Fshb mRNA in primary pituitary
cells (Figure 1) provides support for
the idea that FOXO1 is a repressor
of Fshb transcription in a more
physiological context. The suppres-
12
FOXO1 Suppresses Fshb Gene Expression
sion of Fshb and Lhb transcription by FOXO1 is not due
to a global repressive mechanism since reporter plasmids
containing the insulin response element from the IGFBP1
gene (35) or a consensus FBE (Figure 2) are induced by
FOXO1 in L␤T2 cells while endogenous c-fos and c-jun
mRNA levels are not altered by adenoviral transduction
of L␤T2 cells with FOXO1-CA (Figure 9). In addition,
FOXO1 repression of transcription is not an artifact of
the reporter plasmids since substantial repression of endogenous Fshb and Lhb mRNA was observed in L␤T2
cells transduced with constitutively active FOXO1 (Figure 1) (35).
At this time, it remains to be determined whether
FOXO1 regulates transcription of the gonadotropin beta
subunits in human gonadotropes. There is one report that
FOXO1 colocalized with Lhb-staining gonadotropes in a
human male pituitary section (49). Our results also suggest that FOXO1 regulation of gonadotropin levels may
Mol Endocrinol
occur in humans since FOXO1 suppressed transcription
of a reporter plasmid containing either the human FSHB
or LHB promoter in L␤T2 cells (Figure 3) (35).
So, how does FOXO1 regulate gonadotropin gene expression via transcriptional repression? Although there
are several similarities between FOXO1 repressive effects
on the Fshb and Lhb promoters, there are promoter-specific mechanisms that are also required for FOXO1 suppression of the individual promoters. First, the DBD of
FOXO1 is required for the repression of both genes (Figure 5) (35), although the specific residues involved have
not yet been mapped and it is unknown whether residues
required for the repression differ from those necessary for
binding to DNA. Second, there is no evidence that
FOXO1 binds directly to either the Fshb or Lhb proximal
promoters (Figure 6) (35). It is possible that FOXO1
binds to these promoters with such low affinity that it
cannot be detected in a gel-shift assay, although FOXO1
binding to a consensus FBE is not
altered by 100-fold excess of cold
A
B
oligonucleotides from the proximal
Fshb or Lhb promoters. Thus, our
data support the idea that FOXO1
elicits a repressive effect on the gonadotropin beta subunit promoters
through indirect mechanisms involving the FOXO1 DBD. This idea
is not altogether unexpected since
C
FOXO1 has been shown to interact
with other proteins such as SMADS
through its DBD (50).
Given that FOXO1 has been reported to physically interact with
other proteins to regulate transcription of specific target genes (51), it is
plausible that FOXO1 represses
basal transcription and GnRH induction of the Fshb and Lhb promoters through specific protein-pro∆
∆
∆
∆
∆
∆
tein interactions with transcription
FIGURE 10. FOXO1 Suppression of GnRH-Induced Fshb Transcription Involves Two Elements in
factor(s) or cofactors necessary for
the Proximal Fshb Promoter. A. Diagram illustrating the mutations in the AP1 binding element
gonadotropin synthesis. Although
(AP1BE) in the murine Fshb promoter. B. The –398 Fshb-luc reporter and the Fshb AP1 mutation
(mut) were transiently transfected into L␤T2 cells along with pcDNA3 empty vector (EV) or
basal transcription of Fshb involves
FOXO1, as indicated. After overnight incubation in serum-free media, cells were treated for 6
several factors, including LHX3 and
hours with 0.1% BSA vehicle or 10 nM GnRH. The results represent the mean ⫾ SEM of three
NFY, FOXO1 suppression of basal
experiments performed in triplicate and are presented as fold GnRH induction relative to the
vehicle control. * indicates that Fshb-luc transcription is significantly repressed by FOXO1
Fshb gene expression mapped to the
compared to EV using Student’s t test while # indicates that the AP1 mut was significantly
– 64/-1 region of the Fshb promoter
repressed compared to the wild-type Fshb promoter. C. The –398 Fshb-luc reporter and 10 bp
(Figure 4), suggesting that FOXO1
deletions ranging from –70/-61 to –20/-11 were transiently transfected into L␤T2 cells along with
EV or FOXO1, as indicated. After overnight incubation in serum-free media, cells were treated for
interaction with factors binding to
6 hours with 0.1% BSA or 10 nM GnRH. The results represent the mean ⫾ SEM of three
this region eg, PITX1 may play a
experiments performed in triplicate and are presented as fold GnRH induction relative to the
role in the repression of transcripvehicle control. * indicates that Fshb-luc transcription is significantly repressed by FOXO1
tion. In comparison, FOXO1 supcompared to EV using one-way ANOVA followed by Tukey’s HSD post hoc test.
doi: 10.1210/me.2013-1185
pression of basal Lhb transcription mapped to the
–150/-87 region of the Lhb promoter, which contains
PITX1 and SF1 binding sites (35). Since the PITX1 binding site in the proximal FSHB promoter is conserved
among mammals and mutation of this site in the murine
and human promoters reduced FSHB transcription (11),
it is interesting to speculate that FOXO1 suppression of
basal FSHB transcription via PITX1 may also be
conserved.
The hypothesis that PITX1 plays a role in FOXO1
suppression of the Fshb promoter is supported by our
results demonstrating that PITX1 induction of the Fshb
promoter in CV-1 cells is repressed by FOXO1, that
PITX1 induction of a consensus HDBE is also decreased
by FOXO1 and that PITX1 physically interacts with
FOXO1 (Figure 7). The fact that the FOXO1 DBD is
required for the interaction between FOXO1 and PITX1
is also in agreement with our data showing that the
FOXO1 DBD is necessary for FOXO1 repression of Fshb.
Although this is the first report of a physical interaction
between PITX1 and FOXO1, PITX2 interacts with another member of the forkhead transcription factor family,
FOXC1 via the C-terminal activation domain of FOXC1
and the homeodomain of PITX2 (52). Interestingly, the
PITX1 binding element in the proximal Fshb promoter
was not required for FOXO1 suppression in L␤T2 cells,
suggesting that the repression can occur without PITX1
binding to DNA. It is noteworthy that PITX1 was reported to activate the rat or human Fshb promoter even
when the PITX1 binding element was mutated, suggesting that PITX1 activation can occur through protein-protein interactions with factors such as SF1, in addition to
direct DNA binding (11, 53–55). Altogether, our studies
imply that FOXO1 interaction with PITX1 may be important for suppression of basal Fshb and possibly Lhb
transcription.
In addition to the protein-protein interaction between
FOXO1 and PITX1 which may regulate Fshb transcription, it is possible that FOXO1 modulates Fshb mRNA
levels through regulation of Pitx1 mRNA and protein
levels. Both PITX1/2 are expressed in Rathke’s pouch at
embryonic day 10.5 and in the developing anterior lobe at
e11.5 (56, 57). PITX1/2 are also highly expressed in adult
gonadotrope cells and have been reported to regulate
transcription of the alpha subunit, Fshb, Lhb and the
GnRH receptor (39, 57). Although knockout of PITX1
had little effect on pituitary gland development, lack of
PITX1/2 resulted in a more severe defect in pituitary
growth and differentiation than the PITX2 knockout
alone (58). These studies indicate that PITX1/2 may have
distinct and overlapping functions in pituitary development and gonadotropin hormone production in the adult.
mend.endojournals.org
13
Interestingly, little is known about the factors that regulate PITX1/2 expression during pituitary development
and in the adult (59). Since overexpression of FOXO1 in
L␤T2 cells resulted in a significant reduction of Pitx1
mRNA and PITX1 protein levels (Figure 8), it is possible
that FOXO1 may repress Pitx1 synthesis through regulation of the Pitx1 promoter.
GnRH responsiveness of the Fshb and Lhb promoters
occurs due to the induction and binding of gene-specific
transcription factors such as AP1 to the Fshb promoter
and early growth response protein 1 (EGR1) to the Lhb
promoter. Our results suggest that FOXO1 suppression
of GnRH-induced Fshb gene expression does not occur
through regulation of AP1. Transduction of L␤T2 cells
with FOXO1-CA did not alter c-Fos and c-Jun mRNA or
protein levels (Figure 9). In addition, FOXO1 suppression
of the GnRH induction of Fshb still occurred on the – 64
Fshb promoter lacking the characterized AP1 binding element (Figure 4). We also demonstrated that the AP1
binding element was not necessary for FOXO1 to elicit a
repressive effect on Fshb transcription (Figure 10). These
results are not that surprising, given that GnRH responsiveness on the murine Fshb promoter appears to involve
additional regions outside the AP1 binding element (16).
This is also illustrated by the fact that the – 64 Fshb promoter was still responsive to GnRH, that mutation of the
AP1 element reduced, but did not abolish, the GnRH
induction, and that 10 bp deletions of the proximal Fshb
promoter from –70/-61 to –30/-21 all resulted in reduction of GnRH responsiveness. Although other factors involved in the GnRH induction of murine Fshb have not
yet been identified, our studies highlight two regions between –50/-41 and –30/-21 which are required for
FOXO1 suppression (Figure 10) and suggest that factors
other than AP1 are targeted by FOXO1. It should be
noted that the –50/-41 region partially overlaps the
PITX1 binding element while the –30/-21 region overlaps
the TATA box.
In contrast to the Fshb promoter, FOXO1 suppression
of GnRH responsiveness on the Lhb promoter mapped to
the – 87/-1 region which contains an EGR1 binding element (35). Our previous studies also demonstrated that
FOXO1 suppressed Lhb transcription induced by EGR1
overexpression in L␤T2 cells. Overexpression of FOXO1
with PITX1 or SF1 also suppressed EGR1 induction of
Lhb in CV-1 cells. These results provide support for the
idea that an interaction between FOXO1 and EGR1 may
be responsible for FOXO1 suppression of GnRH-induced
Lhb transcription while FOXO1 interactions with as yet
unknown factors are responsible for FOXO1 suppression
of GnRH-induced Fshb gene expression.
In summary, we demonstrate that FOXO1 suppresses
14
FOXO1 Suppresses Fshb Gene Expression
basal transcription and GnRH induction of the Fshb gene,
potentially through protein-protein interactions between
FOXO1 and transcription factors recruited to the proximal Fshb promoter such as PITX1 as well as FOXO1
regulation of Pitx1 mRNA and protein levels. If FOXO1
is regulated by metabolic hormone signaling in gonadotropes and represses Fshb and Lhb transcription, as our
studies suggest, then it may prove to be an important
factor in the regulation of gonadotropin production in
situations of caloric insufficiency or excess. Further studies are necessary to comprehend how interactions among
FOXO1, PITX1, EGR1, and other factors contribute to
the regulation of Fshb and Lhb transcription in pituitary
gonadotropes. Investigation of the regulation of PITX1
synthesis may also provide insight into the mechanisms of
FOXO1 repression. Additional studies will also help elucidate how FOXO1 integrates input from multiple hormonal signaling pathways to regulate reproduction under
favorable or adverse environmental conditions.
Acknowledgments
The authors thank Djurdjica Coss, Pamela Mellon, Kellie Breen,
and Scott Kelley for helpful discussions and critical reading of
the manuscript.
Received June 19, 2013. Accepted September 18, 2013.
Address all correspondence and requests for reprints to:
Varykina G. Thackray, Ph.D., Department of Reproductive
Medicine, University of California, San Diego, 9500 Gilman
Drive, MC 0674, LA Jolla, CA 92093, USA, Tel.: (858) 822–
7693; Email:vthackray@ucsd.edu
The authors have nothing to disclose.
The Endocrine Society NIH statement: “This is an uncopyedited author manuscript copyrighted by The Endocrine Society. This may not be duplicated or reproduced, other than for
personal use or within the rule of “Fair Use of Copyrighted
Materials” (section 107, Title 17, U.S. Code) without permission of the copyright owner, The Endocrine Society. From the
time of acceptance following peer review, the full text of this
manuscript is made freely available by The Endocrine Society at
http://www.endojournals.org/. The final copy edited article can
be found at http://www.endojournals.org/. The Endocrine Society disclaims any responsibility or liability for errors or omissions in this version of the manuscript or in any version derived
from it by the National Institutes of Health or other parties. The
citation of this article must include the following information:
author(s), article title, journal title, year of publication and
DOI.”
This work was supported by This work was supported by
NIH grants K01 DK080467 and R01 HD067448 to V.G.T. as
well as T32 HD007203 and F32 HD074414 to D.V.S. This
work was also supported by a pilot and feasibility grant from the
UCSD/UCLA Diabetes Research Center (P30 DK063491), by
NICHD/NIH through a cooperative agreement (U54
HD012303) as part of the Specialized Cooperative Centers Pro-
Mol Endocrinol
gram in Reproduction and Infertility Research and by a UCSD
Academic Senate Health Sciences Research Grant.
References
1. Apter D. Development of the hypothalamic-pituitary-ovarian axis.
Ann N Y Acad Sci. 1997;816:9 –21.
2. Plant TM, Marshall GR. The functional significance of FSH in
spermatogenesis and the control of its secretion in male primates.
Endocr Rev. 2001;22(6):764 –786.
3. Kumar TR, Wang Y, Lu N, Matzuk MM. Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet. 1997;15(2):201–204.
4. Lamminen T, Jokinen P, Jiang M, Pakarinen P, Simonsen H, Huhtaniemi I. Human FSH beta subunit gene is highly conserved. Mol
Hum Reprod. 2005;11(8):601– 605.
5. Ortolano GA, Haisenleder DJ, Dalkin AC, Iliff-Sizemore SA, Landefeld TD, Maurer RA, Marshall JC. Follicle-stimulating hormone
beta subunit messenger ribonucleic acid concentrations during the
rat estrous cycle. Endocrinology. 1988;123(6):2946 –2948.
6. Halvorson LM, Weiss J, Bauer-Dantoin AC, Jameson JL. Dynamic
regulation of pituitary follistatin messenger ribonucleic acids during
the rat estrous cycle. Endocrinology. 1994;134(3):1247–1253.
7. Chand AL, Harrison CA, Shelling AN. Inhibin and premature ovarian failure. Hum Reprod Update. 2010;16(1):39 –50.
8. Bernard DJ, Fortin J, Wang Y, Lamba P. Mechanisms of FSH synthesis: what we know, what we don’t, and why you should care.
Fertil Steril. 2010;93(8):2465–2485.
9. West BE, Parker GE, Savage JJ, Kiratipranon P, Toomey KS, Beach
LR, Colvin SC, Sloop KW, Rhodes SJ. Regulation of the folliclestimulating hormone beta gene by the LHX3 LIM-homeodomain
transcription factor. Endocrinology. 2004;145(11):4866 – 4879.
10. Jacobs SB, Coss D, McGillivray SM, Mellon PL. Nuclear factor Y
and steroidogenic factor 1 physically and functionally interact to
contribute to cell-specific expression of the mouse Follicle-stimulating hormone-beta gene. Mol Endocrinol. 2003;17(8):1470 –
1483.
11. Lamba P, Khivansara V, D’Alessio AC, Santos MM, Bernard DJ.
Paired-like homeodomain transcription factors 1 and 2 regulate
follicle-stimulating hormone beta-subunit transcription through a
conserved cis-element. Endocrinology. 2008;149(6):3095–3108.
12. Thackray VG, Mellon PL, Coss D. Hormones in synergy: Regulation of the pituitary gonadotropin genes. Molecular and Cellular
Endocrinology. 2010;314(2):192–203.
13. Dalkin AC, Burger LL, Aylor KW, Haisenleder DJ, Workman LJ,
Cho S, Marshall JC. Regulation of gonadotropin subunit gene transcription by gonadotropin- releasing hormone: measurement of primary transcript ribonucleic acids by quantitative reverse transcription-polymerase chain reaction assays. Endocrinology. 2001;
142(1):139 –146.
14. Vasilyev VV, Pernasetti F, Rosenberg SB, Barsoum MJ, Austin DA,
Webster NJ, Mellon PL. Transcriptional activation of the ovine
follicle-stimulating hormone-beta gene by gonadotropin-releasing
hormone involves multiple signal transduction pathways. Endocrinology. 2002;143(5):1651–1659.
15. Liu F, Austin DA, Mellon PL, Olefsky JM, Webster NJ. GnRH
activates ERK1/2 leading to the induction of c-fos and LHbeta
protein expression in LbetaT2 cells. Mol Endocrinol. 2002;16(3):
419 – 434.
16. Coss D, Jacobs SB, Bender CE, Mellon PL. A novel AP-1 site is
critical for maximal induction of the follicle-stimulating hormone
beta gene by gonadotropin-releasing hormone. The Journal of Biological Chemistry. 2004;279:152–162.
17. Liu F, Ruiz MS, Austin DA, Webster NJ. Constitutively active Gq
impairs gonadotropin-releasing hormone-induced intracellular sig-
doi: 10.1210/me.2013-1185
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
naling and luteinizing hormone secretion in LbetaT2 cells. Mol
Endocrinol. 2005;19(8):2074 –2085.
Wang Y, Fortin J, Lamba P, Bonomi M, Persani L, Roberson MS,
Bernard DJ. Activator protein-1 and smad proteins synergistically
regulate human follicle-stimulating hormone beta-promoter activity. Endocrinology. 2008;149(11):5577–5591.
Ciccone NA, Lacza CT, Hou MY, Gregory SJ, Kam KY, Xu S,
Kaiser UB. A composite element that binds basic helix loop helix
and basic leucine zipper transcription factors is important for gonadotropin-releasing hormone regulation of the follicle-stimulating
hormone beta gene. Mol Endocrinol. 2008;22(8):1908 –1923.
Weiss J, Guendner MJ, Halvorson LM, Jameson JL. Transcriptional activation of the follicle-stimulating hormone beta-subunit
gene by activin. Endocrinology. 1995;136(5):1885–1891.
Coss D, Mellon PL, Thackray VG. A FoxL in the Smad house:
activin regulation of FSH. Trends in Endocrinology and Metabolism: TEM. 2010;21:562–568.
Adashi EY, Hsueh AJ, Yen SS. Insulin enhancement of luteinizing
hormone and follicle-stimulating hormone release by cultured pituitary cells. Endocrinology. 1981;108(4):1441–1449.
Kanematsu T, Irahara M, Miyake T, Shitsukawa K, Aono T. Effect
of insulin-like growth factor I on gonadotropin release from the
hypothalamus-pituitary axis in vitro. Acta Endocrinol. 1991;
125(2):227–233.
Ogura K, Irahara M, Kiyokawa M, Tezuka M, Matsuzaki T, Yasui
T, Kamada M, Aono T. Effects of leptin on secretion of LH and
FSH from primary cultured female rat pituitary cells. Eur J Endocrinol. 2001;144(6):653– 658.
Tezuka M, Irahara M, Ogura K, Kiyokawa M, Tamura T, Matsuzaki T, Yasui T, Aono T. Effects of leptin on gonadotropin secretion in juvenile female rat pituitary cells. Eur J Endocrinol. 2002;
146(2):261–266.
Van Der Heide LP, Hoekman MF, Smidt MP. The ins and outs of
FoxO shuttling: mechanisms of FoxO translocation and transcriptional regulation. Biochem J. . 2004;380(Pt 2):297–309.
Jacobs FM, van der Heide LP, Wijchers PJ, Burbach JP, Hoekman
MF, Smidt MP. FoxO6, a novel member of the FoxO class of
transcription factors with distinct shuttling dynamics. The Journal
of Biological Chemistry. 2003;278(38):35959 –35967.
Anderson MJ, Viars CS, Czekay S, Cavenee WK, Arden KC. Cloning and characterization of three human forkhead genes that comprise an FKHR-like gene subfamily. Genomics. 1998;47(2):187–
199.
Kenyon CJ. The genetics of ageing. Nature. 2010;464(7288):504 –
512.
Salih DA, Brunet A. FoxO transcription factors in the maintenance
of cellular homeostasis during aging. Curr Opin Cell Biol. 2008;
20(2):126 –136.
Varela L, Horvath TL. Leptin and insulin pathways in POMC and
AgRP neurons that modulate energy balance and glucose homeostasis. EMBO Rep. 2012;13(12):1079 –1086.
Tang ED, Nunez G, Barr FG, Guan KL. Negative regulation of the
forkhead transcription factor FKHR by Akt. The Journal of Biological Chemistry. 1999;274(24):16741–16746.
Richards JS, Pangas SA. The ovary: basic biology and clinical implications. J Clin Invest. 2010;120(4):963–972.
Brosens JJ, Wilson MS, Lam EW. FOXO transcription factors:
from cell fate decisions to regulation of human female reproduction. Adv Exp Med Biol. 2009;665:227–241.
Arriola DJ, Mayo SL, Skarra DV, Benson CA, Thackray VG.
FOXO1 transcription factor inhibits luteinizing hormone beta gene
expression in pituitary gonadotrope cells. The Journal of Biological
Chemistry. 2012;287(40):33424 –33435.
Calnan DR, Brunet A. The FoxO code. Oncogene. 2008;27(16):
2276 –2288.
Graham KE, Nusser KD, Low MJ. LbT2 gonadotroph cells secrete
mend.endojournals.org
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
15
follicle stimulating hormone (FSH) in response to activin A. J Endocrinol. 1999;162:R1–R5.
Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang H-J,
Miller WL, Mellon PL. Cell-specific transcriptional regulation of
FSH␤ by activin and GnRH in the L␤T2 pituitary gonadotrope cell
model. Endocrinology. 2001;142(6):2284 –2295.
Tremblay JJ, Lanctôt C, Drouin J. The pan-pituitary activator of
transcription, Ptx1 (pituitary homeobox 1), acts in synergy with
SF-1 and Pit1 and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3. Mol Endocrinol. 1998;12(3):428 – 441.
Jiang Q, Jeong KH, Horton CD, Halvorson LM. Pituitary homeobox 1 (Pitx1) stimulates rat LHbeta gene expression via two functional DNA-regulatory regions. Journal of Molecular Endocrinology. 2005;35(1):145–158.
Rosenberg SB, Mellon PL. An Otx-related homeodomain protein
binds an LHb promoter element important for activation during
gonadotrope maturation. Mol Endocrinol. 2002;16:1280 –1298.
Thackray VG, McGillivray SM, Mellon PL. Androgens, progestins
and glucocorticoids induce follicle-stimulating hormone ␤-subunit
gene expression at the level of the gonadotrope. Mol Endocrinol.
2006;20(9):2062–2079.
Zhang X, Gan L, Pan H, Guo S, He X, Olson ST, Mesecar A, Adam
S, Unterman TG. Phosphorylation of serine 256 suppresses transactivation by FKHR (FOXO1) by multiple mechanisms. Direct and
indirect effects on nuclear/cytoplasmic shuttling and DNA binding.
The Journal of Biological Chemistry. 2002;277(47):45276 –
45284.
Zappavigna V, Sartori D, Mavilio F. Specificity of HOX protein
function depends on DNA-protein and protein- protein interactions, both mediated by the homeo domain. Genes Dev. 1994;8(6):
732–744.
Coss D, Hand CM, Yaphockun KK, Ely HA, Mellon PL. p38 mitogen-activated protein kinase is critical for synergistic induction of
the FSH(beta) gene by gonadotropin-releasing hormone and activin
through augmentation of c-Fos induction and Smad phosphorylation. Mol Endocrinol. 2007;21(12):3071–3086.
Hemmings BA, Restuccia DF. PI3K-PKB/Akt pathway. Cold
Spring Harbor Perspectives in Biology. 2012;4(9):a011189.
Ely HA, Mellon PL, Coss D. GnRH Induces the c-Fos gene via
phosphorylation of SRF by the calcium/calmodulin kinase II pathway. Mol Endocrinol. 2011;25(4):669 – 680.
Lindaman LL, Yeh DM, Xie C, Breen KM, Coss D. Phosphorylation of ATF2 and interaction with NFY induces c-Jun in the gonadotrope. Mol Cell Endocrinol. 2013;365(2):316 –326.
Stavrou E. Regulation of FOXO Transcription Factors by Gonadotropin-Releasing Hormone. University of Edinburgh; 2011.
Seoane J, Le HV, Shen L, Anderson SA, Massague J. Integration of
Smad and forkhead pathways in the control of neuroepithelial and
glioblastoma cell proliferation. Cell. 2004;117(2):211–223.
Monsalve M, Olmos Y. The complex biology of FOXO. Current
Drug Targets. 2011;12(9):1322–1350.
Berry FB, Lines MA, Oas JM, Footz T, Underhill DA, Gage PJ,
Walter MA. Functional interactions between FOXC1 and PITX2
underlie the sensitivity to FOXC1 gene dose in Axenfeld-Rieger
syndrome and anterior segment dysgenesis. Human Molecular Genetics. 2006;15(6):905–919.
Suszko MI, Antenos M, Balkin DM, Woodruff TK. Smad3 and
Pitx2 cooperate in stimulation of FSHbeta gene transcription. Molecular and Cellular Endocrinology. 2008;281(1–2):27–36.
Tremblay JJ, Marcil A, Gauthier Y, Drouin J. Ptx1 regulates SF-1
activity by an interaction that mimics the role of the ligand-binding
domain. EMBO J. 1999;18(12):3431–3441.
Zakaria MM, Jeong KH, Lacza C, Kaiser UB. Pituitary homeobox
1 activates the rat FSHbeta (rFSHbeta) gene through both direct
and indirect interactions with the rFSHbeta gene promoter. Mol
Endocrinol. 2002;16(8):1840 –1852.
Lanctôt C, Gauthier Y, Drouin J. Pituitary homeobox 1 (Ptx1) is
16
FOXO1 Suppresses Fshb Gene Expression
differentially expressed during pituitary development. Endocrinology. 1999;140(3):1416 –1422.
57. Charles MA, Suh H, Hjalt TA, Drouin J, Camper SA, Gage PJ.
PITX genes are required for cell survival and Lhx3 activation. Mol
Endocrinol. 2005;19(7):1893–1903.
58. Suh H, Gage PJ, Drouin J, Camper SA. Pitx2 is required at multiple
Mol Endocrinol
stages of pituitary organogenesis: pituitary primordium formation
and cell specification. Development. 2002;129(2):329 –337.
59. Goodyer CG, Tremblay JJ, Paradis FW, Marcil A, Lanctot C, Gauthier Y, Drouin J. Pitx1 in vivo promoter activity and mechanisms
of positive autoregulation. Neuroendocrinology. 2003;78(3):129 –
137.