Molecular and Cellular Endocrinology 382 (2014) 346–357
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology
journal homepage: www.elsevier.com/locate/mce
Polyribosome and ribonucleoprotein complex redistribution of mRNA
induced by GnRH involves both EIF2AK3 and MAPK signaling
Minh-Ha T. Do a,1, Taeshin Kim a,1, Feng He b, Hiral Dave a, Rachel E. Intriago a, Uriah A. Astorga a,
Sonia Jain b, Mark A. Lawson a,⇑
a
b
Department of Reproductive Medicine, University of California, San Diego, La Jolla, CA 92093, United States
Department of Family and Preventive Medicine, University of California, San Diego, La Jolla, CA 92093, United States
a r t i c l e
i n f o
Article history:
Received 19 July 2013
Received in revised form 2 October 2013
Accepted 6 October 2013
Available online 23 October 2013
Keywords:
Gonadotropins
Luteinizing hormone
Dusp1
Pituitary
Translation
Unfolded protein response
a b s t r a c t
The neuropeptide gonadotropin-releasing hormone stimulates synthesis and secretion of the glycoprotein gonadotropic hormones and activates the unfolded protein response, which causes a transient reduction of endoplasmic reticulum-associated mRNA translation. Hormone-treated cell extracts were
fractionated to resolve mRNA in active polyribosomes from mRNA in inactive complexes. Quantitative
real-time PCR and expression array analysis were used to determine hormone-induced redistribution
of mRNAs between fractions and individual mRNAs were found to be redistributed differentially. Among
the affected mRNAs relevant to gonadotropin synthesis, the luteinizing hormone subunit genes Lhb and
Cga were enriched in the ribonucleoprotein pool. The MAP kinase phosphatase Dusp1 was enriched in the
polyribosome pool. Enrichment of Dusp1 mRNA in the polyribosome pool was independent of the
unfolded protein response, sensitive to ERK inhibition, and dependent on the 30 untranslated region.
The results show that GnRH exerts translational control to modulate physiologically relevant gene
expression through two distinct signaling pathways.
Ó 2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
The reproductive endocrine axis is controlled by the timed
release of gonadotropin-releasing hormone I (GnRH) from hormone-producing neurons of the hypothalamus into the fenestrated
capillary bed providing arterial flow to the anterior pituitary. Timing and amplitude of GnRH pulses alters production and secretion
of the gonadotropins luteinizing hormone (LH) and follicle-stimulating hormone (FSH) by the gonadotropes. Production of LH is
favored by high frequency, high amplitude pulses of GnRH whereas
FSH is favored by lower pulse frequencies (Ferris and Shupnik,
2006; Tsaneva-Atanasova et al., 2012). The altered production
and timing of gonadotropin release in response to GnRH stimulation is essential for the onset of the preovulatory LH surge in
females. The gonadotropins are heterodimeric glycoprotein hormones comprised of a common alpha subunit encoded by the
Cga gene, and a unique beta subunit encoded by the Lhb and Fshb
genes for LH and FSH, respectively. The transcriptional control of
the gonadotropin genes has been extensively studied both
in vivo (Burger et al., 2004, 2011) and using in vitro cell models
such as LbT2 cells derived from LH-producing cells of the mouse
⇑ Corresponding author. Tel.: +1 (858) 822 4128; fax: +1 (858) 534 1438.
1
E-mail address: mlawson@ucsd.edu (M.A. Lawson).
These authors made equal contribution to the manuscript.
0303-7207/$ - see front matter Ó 2013 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.mce.2013.10.007
anterior pituitary (Alarid et al., 1996), or modified cell lines engineered to express the GnRH receptor (Armstrong et al., 2009).
Both basal and GnRH pulse-induced transcriptional regulation
of the gonadotropin genes have been well characterized. Regulation of gene expression by GnRH is largely, but not exclusively
modulated by signaling via the mitogen-activated protein kinase
(MAP kinase) cascades, particularly through activation of the extracellular receptor signal activated kinases MAPK 1 and 3, which target transcription through activation of immediate-early genes and
increase protein synthesis via cap-dependent translation initiation
(Lawson et al., 2007; Nguyen et al., 2004). The MAP kinase signaling cascade experiences rapid negative feedback which is partly
mediated by the dual specificity protein phosphatases including
DUSP1, and this is hypothesized to contribute to the overall ability
of the gonadotrope to interpret GnRH pulse frequency and amplitude (Lim et al., 2009). The expression of Dusp1 and related dual
specificity kinase family members is induced by pulsatile GnRH
(Lawson et al., 2007). DUSP1 protein synthesis is also induced by
GnRH, as is its rapid phosphorylation. Manipulation of DUSP1
levels alters MAPK 1/3 phosphorylation and the Egr1 and Lhb
transcriptional response to GnRH stimulation (Caunt et al., 2008;
Nguyen et al., 2010; Zhang and Roberson, 2006). Although the
MAP kinases and the DUSP’s comprise an ultra-short feedback loop
that provides rapid but transient propagation of GnRH –induced
signaling events to maintain sensitivity to subsequent GnRH
pulses, there are compelling findings in HeLa cells that suggest this
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
may not fully explain pulse sensitivity (Armstrong et al., 2010). The
contribution of rapid transcriptional activation by EGR1 and rapid
signaling feedback via DUSP1 represent two distinct points of control that can potentially facilitate rapid response and resolution to
GnRH receptor signaling events.
Another regulatory cascade initiated by GnRH treatment is the
unfolded protein response, or UPR (Do et al., 2009). This pathway
involves both transcriptional and protein synthesis regulatory
arms that serve to minimize endoplasmic reticulum (ER) stress.
In secretory cells, stress occurs after a secretion event due to loss
of calcium ion from the ER lumen and alteration of the oxidative
environment. The UPR is essential to preserve normal function of
pancreatic b-cells, hepatocytes, osteoblasts, and plasma cells, and
is generally regarded as an indispensable control mechanism in
cells experiencing high secretory demand (Scheuner and Kaufman,
2008; Zhang and Kaufman, 2006). Proper folding and export of proteins destined for secretion or targeted to extracellular or intracellular membranes through the ER requires a proper oxidative
environment. Disruption of the ER luminal environment leads to
accumulation of improperly folded protein that can lead to reduced
ER capacity and cell death (Fribley et al., 2009; Walter and Ron,
2011). Protection of ER balance and maintenance of protein quality
is controlled by the UPR, which blocks the import of protein into
the ER, degrades unfolded proteins, and induces an adaptive
response to increase ER capacity. Pathological conditions such as
hypoxia, inflammation, oxidative stress, or chemical insult can also
lead to induction of the UPR.
We have shown that GnRH induces the UPR in gonadotropes
and in the cultured gonadotrope cell line LbT2 (Do et al., 2009).
Induction of the UPR is transient in LbT2 cells, resolving within
60 min. A hallmark of translational pausing is activation of the
ER membrane-resident eukaryotic initiation factor 2 alpha kinase
3 (EIF2AK3). Activation of EIF2AK3 results in phosphorylation
and inactivation of cytosolic eukaryotic initiation factor 2 alpha
(EIF2A), an essential part of the translation initiation complex. This
results in inhibition of translation and subsequent protein export
into the ER lumen. Examination of LbT2 cell polyribosome profiles
by centrifugation on sucrose density gradients showed that after
GnRH treatment there is a transient redistribution of ribosomes
between active and inactive states as measured by RNA content
in active, polyribosome fractions versus inactive ribonucleoprotein
(RNP) complexes. Examination of Cga and Lhb mRNAs across polyribosome and RNP fractions showed that both were transiently displaced from the polyribosome to the RNP fractions by GnRH,
consistent with translational pausing.
It is not known if pausing is a generalized response to UPR induction, or if gonadotropin mRNAs represent a subpopulation of
mRNAs targeted for translational pausing. We examined the details
of polyribosome redistribution induced by GnRH treatment to assess the specificity of translational pausing induced by GnRH in
LbT2 cells. Using a microarray-based approach to evaluate mRNA
content in both polyribosome and RNP fractions and specific analysis of individual mRNA species, we find that mRNAs are differentially enriched or redistributed to both the polyribosome and RNP
fractions after GnRH treatment. Evaluation of the signaling components participating in translational control show that redistribution
to the polyribosome fractions is independent of EIF2AK3 activation
and may represent an independent mRNA regulatory process.
2. Materials and methods
2.1. Cell culture
The LbT2 mouse gonadotrope line (Alarid et al., 1996) was
maintained in high-glucose (4.5 g/l) 20 mM HEPES-buffered DMEM
347
supplemented with penicillin/streptomycin and 10% fetal bovine
serum. The cells were maintained at 37 °C in a humidified atmosphere of 5% CO2. Prior to GnRH treatment, cells were changed into
serum-free DMEM for 12–16 h. For transfection studies, cells were
transfected immediately after changing to serum-free medium and
allowed to incubate 12–16 h before GnRH treatments.
2.2. Plasmid construction and transfection
To analyze the effect of the 30 UTR of Dusp1 or Lhb, 30 UTR on reporter gene expression these regions were inserted into a multiple
cloning site placed downstream of the luciferase coding sequence
of the pGL3-TK80C-XPL plasmid. This reporter vector was constructed by inserting the 80 bp proximal sequence of the HSV thymidine kinase promoter upstream of the luciferase coding
sequence in pGL3-basic (Promega, Madison, WI) and inserting a
second multiple cloning site downstream of the luciferase coding
sequence prior to the SV40 termination and poly-adenylation site.
The 76-bp 30 UTR fragment of Lhb amplified by PCR from genomic
DNA of C57/Bl6 mice was inserted into the EcoR1- and XhoI-digested site of pGL3-TK80C. The 688-bp 30 UTR fragment of the
Dusp1 30 UTR was amplified by PCR from genomic DNA of C57/Bl6
mice and inserted into EcoR1-digested pGL3-TK80C. These new
plasmids, pTK-Luc-Lhb-30 UTR and pTK-Luc-Dusp1 30 UTR, were
then sequenced to confirm identify.
To analyze the effect of the ELAV1 binding site in the Dusp1 30
UTR on luciferase expression, two plasmids containing either just
the previously described ELAV1 binding site (Kuwano et al.,
2008) or the remainder of the 30 UTR without the site were constructed from the parent Dusp1 30 UTR plasmid. The resultant plasmids, pTK-Luc-ELAV+, and pTK-Luc-ELAV, were sequenced to
confirm identity.
For transfection, LbT2 cells were plated at a density of
2.75 105 cells/cm2 and incubated for 24 h before transfection.
Cells were then changed into serum-free medium for 12–16 h
and then transfected with Fugene 6 (Roche Applied Science, Indianapolis, IN) according to the manufacturer’s instructions using
above plasmids and the internal control pGL3-CMV-bGal (Nguyen
et al., 2004). After incubation for 16 h. the cells were treated with
10 nM GnRH (Sigma Aldrich, Inc.), or 100 nM phorbol-12-myristate-13-acetate (PMA; Calbiochem) for the indicated time. The
cells were then harvested with Reporter Lysis Buffer (Promega,
Madison, WI). Lysates were assayed using the Luciferase Assay
Kit (Promega, Madison, WI) and Galacto-Light Plus Kit (Applied
Biosystems, Foster City, CA), respectively. Luminescence was measured in a Veritas microplate luminometer (Turner BioSystem,
Sunnyvale, CA).
2.3. Quantitative real-time PCR
For quantitative PCR analysis of fractionated, ribosome-bound
poly-adenylated mRNA, cDNA was synthesized using Omniscript
Reverse Transcriptase (Qiagen, Valencia, CA) and 10 lM of random
hexamer primers (Applied Biosystems, Foster City, CA). For analysis of total RNA, cDNA was synthesized using QuantiTect Reverse
Transcription Kit (Qiagen, Valencia, CA). Quantitative real-time
PCR was carried out using the MyIQ Single-Color Real-Time Detection System (Bio-Rad Laboratories, Hercules, CA). The PCR products
were amplified in the presence of SYBR Green using the QuantiTect
SYBR Green PCR kit (Qiagen, Valencia, CA) supplemented with
300 nM of transcript specific primers and 1 lM fluorescein for
proper instrument calibration. The cycling conditions used were
those recommended by the PCR kit manufacturer. A melt curve
was performed after each PCR run to ensure that just a single product was amplified in each assay and the size of the products were
verified using agarose gel electrophoresis.
348
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
Primer sequences were designed against murine mRNA sequences as available through PubMed. Sequences of the primers
used were: Cga fwd, 50 -GGTTCCAAAGAATATTACCTCG-30 , Cga rev,
GTCATTCTGGTCATGCTGTCC, Lhb fwd, 50 -CTGTCAACGCAACTC
TGG-30 , Lhb rev, 50 -ACAGGAGGCAAAGCAGC-30 , Gapdh fwd, 50 -T
GCACCACCAACTGCTTAG-30 ; Gapdh rev, 50 -GATGCAGGGATGATG
TTC-30 ; Gnrhr fwd, 50 -GCCCCTTGCTGTACAAAGC-30 ; Gnrhr rev, 50 -C
CGTCTGCTAGGTAGATCATCC-30 ; c-Myc fwd, 50 -GCTGCATGAGGAGACACCG-30 ; c-Myc rev, 50 -CCTCGGGATGGAGATGAGC-30 ; Egr1
fwd, 50 -ATTTTTCCTGAGCCCCAAAGC-30 ; Egr1 rev, 50 -ATGGGAAC
CTGGAAACCACC-30 ; Dusp1 fwd, 50 -TGGTTCAACGAGGCTATTGAC30 ; Dusp1 rev, 50 -GGCAATGAACAAACACTCTCC-30 ;.
Primers were designed to generate an 80–150 bp amplicon that
crossed intron/exon boundaries where possible in order to avoid
amplification of any contaminating unspliced RNA or genomic
DNA. All PCR reactions were performed in triplicate, except for
those involving cDNA from primary pituitary cells, which were
performed in duplicate. A larger cDNA fragment of all the genes assayed was inserted into pCR2.1 (Invitrogen, Carlsbad, CA) and used
to generate a standard curve and assess PCR efficiency for each run.
The mass values for each transcript were extrapolated from the
standard curve. To calculate a fold-redistribution value for an
mRNA’s movement within the ribosome profile, the mass of each
transcript in each ribosome pool (polysome or RNP) was measured
and a ratio was calculated for the mass of that transcript in the RNP
pool compared to the polysome pool. A ratio was calculated for
both the treated and control (vehicle treated) conditions. A foldredistribution value was then generated by taking a ratio of the
ratios: the RNP/polysome ratio in treated compared to the RNP/
polysome ratio in control cells. Statistics were performed as indicated in each figure legend on these values. For ease of representation in the histograms only, the negative inverse was calculated
and reported for fold-redistribution values between 0 and 1, such
that movement of an mRNA into the polysome pool would report
a negative redistribution value and movement into RNP complexes
would report a positive value.
2.4. Western blotting
Protein was harvested using standard RIPA lysis buffer supplemented with phosphatase inhibitors. Standard SDS-PAGE and
semi-dry transfer method (Bio-Rad Laboratories, Hercules, CA)
was used to transfer the extracts onto PVDF membranes (Bio-Rad
Laboratories, Hercules, CA). Blocking and primary antibody
delivery was performed in 1 casein (Vector Laboratories, Burlingame, CA). Antibodies directed against phosphorylated MAPK1/3
(Santa Cruz Biotechnology, Santa Cruz, CA), total MAPK1/3 (Santa
Cruz Biotechnology, Santa Cruz, CA), phosphorylated EIF2AK3
(Rockland Immunochemicals, Gilbertsville, PA), total EIF2AK3
(Rockland Immunochemicals, Gilbertsville, PA), phosphorylated
eIF4E (Ser209; Cell Signaling, Beverly, MA), total eIF4E (Cell Signaling, Beverly, MA), phosphorylated 4EBP1 (Thr70; Cell Signaling,
Beverly, MA), and total 4EBP1 (Cell Signaling, Beverly, MA) were
incubated for 16 h. Blots were developed using 1:2000 dilution of
biotinylated secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) and Chemiglow chemiluminescence (Cell Biosciences,
San Leandro, CA). Chemiluminescence was visualized using the
GeneSnap (Syngene, Frederick, MD) or the Flourchem Q (Cell Biosciences, San Lendro, CA) Imaging Systems.
2.5. Ribosome fractionation and mRNA isolation
Two 10-cm plates were used for each experimental condition
with 2 107 LbT2 cells seeded per plate. Cells were incubated in
serum free-DMEM for 16 h. Cells were then incubated with Earle’s
Balanced Salt Solution (EBSS) 1 h, then treated with vehicle, 10 nM
GnRH (Sigma Aldrich, St. Louis, MO) 2 mM dithiothreitol (DTT; Sigma Aldrich, St. Louis, MO), or 100 nM phorbol-12-myristate-13acetate (PMA; EMD Chemicals, San Diego, CA), 30 lM PD98059
(EMD Chemicals, San Diego), and 10 nM Rapamycin (Rap, EMD
Chemicals, San Diego, CA) for 30 min. After treatment, 100 lg/ml
cycloheximide (Sigma–Aldrich, St. Louis, MO) was added to all
the plates (except for any pre-treated plates) and the cells were
incubated on ice for 5 min. The cells were then harvested in
500 ll of ice-cold polysome extraction buffer (PEB) containing
140 mM KCl, 5 mM MgCl2, 1 mg/ml heparin sodium salt, and
20 mM Tris–HCl pH 8, supplemented with fresh 0.5 mM DTT and
100 lg/ml cycloheximide on the day of the experiment. Cells from
two plates of the same experimental condition were collected and
pooled at this step. The cells were spun down at 1000g for 3 min
and then each pellet was resuspended in 200 ll PEB containing
1% Triton-X. The pellets were allowed to lyse on ice for 20 min with
gentle inversion by hand every few minutes. Finally, the cellular
debris was collected by centrifugation at 10,000g for 10 min. The
supernatants were layered onto 5 ml 10–50% sucrose gradients
made with PEB lacking Triton-X. The samples were centrifuged in
a SW-55 swing-bucket rotor for 1.5 h at 150,000g. A 21-guage needle was used to collect fractions from the bottom of the gradient.
Fractions were collected using a peristaltic pump while monitoring
real-time absorption at 254 nm through a UVM-II monitor (GE
Healthcare, Fairfield, CT). Fractions of 250 ll volume each were
collected using a FC 203B fraction collector (Gilson, Middleton,
WI). Monitoring of UV absorption and fraction collection was
controlled through a Labview virtual instrument (National Instruments, Austin, TX) and a KPCI 3108 DAQ card (Keithley Instruments, Cleveland, OH). Fractions were dripped directly into SDS
for a final SDS concentration of 1%. Each fraction was then treated
with 0.2 mg/ml proteinase K at 37 °C for 1.5 h. RNA was purified
from each fraction by phenol–chloroform extraction and ethanol
precipitation. An aliquot (1 ll) of RNA from each fraction was subjected to agarose electrophoresis in the presence of ethidium bromide to verify the presence of the large and small ribosomal
subunits through presence of the 28S and 18S rRNAs, respectively.
The rest of the RNA from the fractions was pooled into polysome
and RNP pools according to the gradient’s UV absorption profile.
Poly-A RNA was then isolated using Oligotex mRNA Mini Kit
oligo-dT columns (Qiagen, Valencia, CA) according to the manufacturer’s recommendations and eluted into a final volume of 40 ll for
each pool. A 10 ll aliquot of mRNA was used for reverse-transcription for quantitative PCR analysis.
2.6. Microarray analysis
The RNP (R) and polysome (P) fractionated mRNA collected
from three independent experiments of GnRH or vehicle-treated
LbT2 cells was used for Affymetrix GeneChip analysis (Affymetrix,
Santa Clara, CA). The integrity of the mRNA was checked by agarose
gel electrophoresis, 200 ng of mRNA was processed, and 15 lg of
cRNA was hybridized to Affymetrix mouse MOE430A array chips
according to the manufacturer’s recommended protocol.
Gene expression profiles were compared between the GnRHtreated R/P and untreated R/P groups. Three independent experiments were analyzed, resulting in a total of twelve microarray sets
(six R/P sets). Affymetrix chip image files were converted to probe
set data (.CEL files) using the Gene Chip Operating System (GCOS).
The MOE430A Affymetrix chip consists of 22,690 probes. 6556
probes had Absent Calls that were consistent across all twelve
chips and were removed, leaving 16,134 probes for analysis. Raw
expression values in the CEL files were pre-processed via the
Robust Multichip Average (RMA) method (Irizarry et al., 2003), as
implemented in Bioconductor (www.bioconductor.org), a suite
of programs for the R statistical programming language
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
(http://cran.r-project.org). RMA default values were employed to
pre-process the twelve chips simultaneously.
The log2 gene expression values obtained from RMA pre-processing were analyzed as follows. First, genes that were differentially expressed between the GnRH-treated R/P and untreated R/P
groups were identified via two different criteria: fold change and
t-statistics. Fold-change analysis highlights potentially biologically
interesting genes. The t-statistics were used to compute the magnitude of the variation among biological replicates as compared
to the variation between the treated and untreated groups. A large
absolute value in the t-statistic is indicative that there is larger statistical variation between treated and untreated groups than variation within a specific group. A composite measure of fold-change
and t-statistics, called bioweight (Rosenfeld et al., 2004), was used
to produce a list of the top 5% (800) of the most regulated mRNA
species amongst those that are found to be expressed in LbT2.
The bioweight measure is a product of the across-replicate fold
change and the negative log10 of p-values for the gene specific
t-tests. The advantage of bioweight analysis is that the impacts
of fold-change analysis and gene specific t-test analysis are studied
simultaneously.
Confirmatory differential gene expression analysis was conducted via the permutation method Significance Analysis of Microarrays (SAM) (Tusher et al., 2001). The SAM method detects mRNA
species with statistically significant differences in expression by
computing a score for each species relative to the species-specific
standard deviation (Tusher et al., 2001). Individual mRNAs with
scores greater than an adjustable threshold are declared significant. The percentage of mRNAs that are identified by chance is
the False Discovery Rate (FDR), which was set at 0.2. Since nonparametric, permutation-based techniques, such as SAM, are hindered by experiments with small sample sizes, it is reasonable to
compare the results from SAM to other methods such as bioweight.
The SAM technique was computed in Bioconductor via the siggenes library. The q-values generated by SAM are an FDR-adjusted
equivalent to the p-value (Storey, 2002).
Confirmatory analysis employed unsupervised clustering to
determine if the treatment groups could be recovered. Dendrograms of expression patterns and samples were computed via
hierarchical clustering using complete-linkage as the betweencluster distance criteria and Pearson’s correlation as the similarity
measure (Eisen et al., 1998). Heatmaps (false color images) of the
top 800 and bottom 800 bioweight mRNAs were generated such
that the rows (samples) and columns (genes) were clustered independently using hierarchical clustering via Pearson’s correlation
for within-cluster distance and complete linkage for between-cluster distance. Red indicates strong positive correlation and green
indicates strong negative correlation (Fig. S2).
The top regulated mRNAs were further characterized by the
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (http://www.kegg.org) via the Bioconductor package, annffy
(Gentleman et al., 2005). The annffy package is designed to interface between Affymetrix chip analysis results and web-based databases by gathering annotation data from diverse resources. Probes
that were not associated with a KEGG pathway (approximately
400) were not summarized in Fig. S1. mRNAs with multiple probes
or that were associated with multiple pathways were consolidated.
2.7. RNA-binding protein immunoprecipitation
RNA-binding protein immunoprecipitation (RIP) was performed
to analyze the interaction of DUSP1 mRNA with HuR as described
previously (Jain et al., 2011). In brief, LbT2 cells were treated with
vehicle or 10 nM GnRH for 30 min and then lysate with PEB containing 1% Triton-X. After centrifugation, the supernatants were
pre-cleared with 5 lg of normal mouse IgG (sc-2025, Santa Cruz
349
Biotechnology, Santa Cruz, CA) and 50 ll of protein G Dynabeads
(Invitrogen, Carlsbad, CA) for 40 min at 4 °C with constant mixing.
After remove the beads, 10 ll supernatant was used to as internal
controls of Input RNA. For coated magnetic bead with antibody,
50 ll of protein G Dynabeads (Invitrogen, Carlsbad, CA) were
washed with 1 ml of 0.1 M citrate-phosphate buffer (pH 5.0) and
mixed with 5 lg of mouse anti-HuR antibody (sc-5261, Santa Cruz
Biotechnology, Santa Cruz, CA), or 5 lg of mouse IgG (sc-2025,
Santa Cruz Biotechnology, Santa Cruz, CA) for 30 min at room temperature with constant mixing. The HuR- and mouse IgG antibodycoated beads were then resuspended in 400 ll of the NT2 buffer
(50 mM Tris (pH 7.4), 1 mM MgCl2, 150 mM NaCl, 0.05% Nonidet
P-40) supplemented with 100 U/ml RNase OUT, 1 mM DTT, and
20 mM EDTA, and then incubated for 3 h at 4 °C with 100 ll of
the cell lysate. After beads were washed 5 times using NT2 buffer,
and then incubated for 30 min at 55 °C in 150 ll of NT2 buffer supplemented with 1.2 mg/ml of proteinase K and 1% SDS. The immunoprecipitated RNA was extracted using phenol/chloroform and
analyzed with reverse transcription-PCR (RT-PCR) using above
DUSP1 primers.
2.8. Statistical analysis
The areas under the curves of the polyribosomal profiles were
integrated using SigmaPlot v9.01 (Systat Software, Richmond,
CA). To correct for the skewed distribution of ratio data, all ratio
data was transformed using log2 and a value of 10 was added to ensure positive values prior to analysis. All subsequent statistical
analysis was conducted using JMP (SAS Institute, Cary, NC) on
untransformed (other than log2 + 10 for ratio or fold-redistribution
values) or optimally Box–Cox transformed values. Redistribution
data is analyzed as fold-change ratio. Data obtained from transfection experiments was evaluated by multifactor ANOVA and post
hoc testing with Tukey’s multiple comparison test. Except for the
microarray data set, all the experiments were repeated at least four
independent times and reported values are represented by the
means ± SEM of those experiments.
3. Results
3.1. Differential sensitivity to translation inhibition
To understand translational regulation by GnRH stimulation,
we examined the global redistribution of mRNA between actively
translating polyribosome and non-translating RNP complexes in
LbT2 gonadotropes by subcellular fractionation on sucrose gradients after treatment with GnRH or vehicle for 30 min. Our previous
observations showed that mRNA displacement was transient with
a maximal effect at 30 min after a 5-min exposure to GnRH that resolved within 60 min. After isolating mRNA from pooled fractions
encompassing either the polyribosome or RNP pools (Fig. 1A), we
examined the relative change in abundance of individual mRNAs
in the polyribosome and RNP pools by microarray. Data were processed as described in Section 2 and the change of individual
mRNA species in each pool after GnRH treatment was expressed
as fold change relative to vehicle treatment.
We examined the effect of mRNA distribution between the
polyribosome and RNP pools using bioweight measurements of
individual species (Rosenfeld et al., 2004). In this method, individual mRNAs are ranked by relative change from control and by significance of the measured change to distinguish the mRNAs most
influenced by the treatment. At the global level, RNP accumulation
was evident after GnRH treatment, consistent with our previous
observation that GnRH causes a transient attenuation through
activation of the UPR. However, by examining mRNAs that are
350
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
Fig. 1. GnRH causes a targeted redistribution of mRNA in polyribosome and
ribonucleoprotein complexes in LbT2 gonadotrope cells. (A) a sample profile of
fractionated cell extracts from LbT2 cells treated with vehicle or GnRH at 10 nM for
30 min. Extracts were fractionated on 10–50% sucrose gradients and collected from
the bottom to the top (50–10%, left to right) while absorbance was monitored at
254 nM wavelength. Area under the curve containing polyribosomes and single
ribosome/RNP fractions are indicated by the vertical lines through the chart. These
areas were collected and purified mRNA derived from these fractions were
designated as polyribosome or RNP fractions for subsequent studies. (B) Bioweight
plot of changes in mRNA representation in polyribosome and RNP fractions of LbT2
cells. The method of analysis is described in Section 2. Briefly, mRNA isolated from
polyribosome and RNP fractions from three independent experiments was subject
to microarray quantitation and analysis. Change in mRNA representation between
pools is plotted by log2 fold change on the abscissa and log10 of the Student’s test
p-value on the ordinal axes to illustrate overall shifts in representation. Individual
mRNAs examined in this study are highlighted and designated in the plot. Gray dots
represented individual mRNA probes. Vertical bars represent 95% confidence
interval for the fold redistribution, Horizontal bar represents 95% cutoff for log10
p-value. Approximately 800 mRNAs fall outside these regions. The dashed line
indicates significant change from control at a = 0.05. 1362 probes showed significant change from vehicle treated control values. (C) Results of quantitative PCR
measuring fold redistribution of individual mRNAs after GnRH treatment identified
in the microarray analysis above. Bars above the line represent fold change to the
RNP fraction and bars below the line represent fold change to the polyribosome
(polysomes) fraction from three (Dusp1) or six (Lhb, Cga, Gapdh, Gnrhr, Myc, Egr1)
replicates. Asterisks indicate significant change from untreated control levels by
Student’s t-test.
redistributed, it is evident that invocation of the UPR by GnRH does
not result in a generalized loss of mRNA from the actively translating pool of polyribosomes. As indicated by the plot in Fig. 1B, all
mRNAs significantly changed by GnRH treatment are indicated
by those appearing above the dashed line in Fig. 1B. This represents
1362 distinct probes corresponding to unique mRNA species,
including variants of the same gene. Distinct populations of mRNAs
are enriched in either the polysome or RNP pools by GnRH treatment, as indicated by separation on the abscissa from zero, which
indicates no change. This is particularly evident in the clustering
analysis and heat map representation of the top 800 mRNAs
(representing 774 genes) affected by GnRH treatment displayed
in Fig. S1A. Increased representation in the RNP pool indicates a
relative decrease in association with ribosomes and reduced utilization by the translational machinery. Increased relative abundance in the polysome pool indicates an increase in association
with ribosomes, suggesting increased utilization by the translational machinery. This analysis confirmed our previous observations that Lhb mRNA is displaced to the RNP pool and this
analysis shows it is one of the most highly affected mRNAs (Table 1,
Supplemental Table S1). Previous analysis has shown that increased representation in the RNP pool of Lhb, Cga, and Gapdh
mRNA is not a result of increased mRNA content due to increased
transcription (Do et al., 2009), but this has not been generally confirmed for all affected mRNAs.
In contrast, many mRNAs are enriched in the polysome pool
after GnRH treatment, indicating increased association with ribosomes and translational utilization. Included in this population is
Dusp1 mRNA. DUSP1 participates in the dephosphorylation of
MAP kinases after GnRH stimulation and we have shown that protein levels increase after GnRH stimulation, consistent with this
redistribution (Nguyen et al., 2010). It is also noted that c-myc
was also increased in abundance in the polysome fraction. Unlike
Dusp1 mRNA, translation of C-myc mRNA occurs via a cap-independent translational mechanism involving internal ribosome entry
(Nanbru et al., 1997). The presence of mRNAs utilizing both capdependent and cap-independent translation initiation mechanisms
suggests that enrichment of mRNA in the polyribosome pool occurs through a mechanism that is not determined by the mode of
ribosomal assembly and translation initiation. The relative distribution of Egr1 mRNA between pools is not reliably determined
by microarray analysis. We and others have documented a rapid
increase in total mRNA abundance after GnRH treatment (Lawson
et al., 2007; Ruf and Sealfon, 2004), initial levels are low and affect
the reproducibility of the assessment. This is more closely evaluated below.
A more generalized view of the consequences of mRNA redistribution can be obtained by examination of the cellular pathways affected. Evaluation by KEGG pathways of the top 800 mRNAs
subject to redistribution is shown in Supplemental Fig. S1B. Of
the 800 top regulated mRNAs, only about half had KEGG pathway
information available. The enrichment of mRNAs in the RNP pool
identifies those that are potential targets of translational inhibition
by induction of the UPR and subsequent phosphorylation of EIF2A,
which blocks initiation of assembled translational complexes.
Examination of RNP-displaced genes revealed a number of important features. The abundance of genes associated with subcellular
structures or membranes is evident in the proportion that is displaced to the RNP fraction by GnRH. These include those encoding
proteins in the oxidative phosphorylation pathway, gap junction,
tight junction and adherens junction pathways as well as protein
export and ribosomal proteins themselves. The mRNAs subject to
accumulation in the RNP may also be a consequence of the distinct
subcellular ER and mitochondrial localization of EIF2AK3 after
351
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
Table 1
Top 10 genes by bioweight enriched in polyribosome or RNP fractions by GnRH.
Bioweight
Gene
Common name
Top 10 mRNAs enriched in the RNP fraction by GnRH
4.07
Ndufa3
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3
3.04
Ecel1
Endothelin converting enzyme-like 1
2.98
2900010M23Rik
RIKEN cDNA 2900010M23 gene
2.86
Mknk2
MAP kinase-interacting serine/threonine kinase 2
2.86
Mrps15
Mitochondrial ribosomal protein S15
2.84
Lhb
Luteinizing hormone beta
2.79
Aplp1
Amyloid beta (A4) precursor-like protein 1
2.70
Srf
Serum response factor
2.66
Atp5o
ATP synthase, H + transporting, mitochondrial F1 complex, O subunit
2.58
Ndufa3
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3
Top 10 mRNAs enriched in the polyribosome fraction by GnRH
2.58
Dusp1
Dual specificity phosphatase 1
2.54
9630042H07Rik
RIKEN cDNA 9630042H07 gene
2.36
Catnb
Catenin beta
2.32
N/A
0 day neonate cerebellum cDNA, RIKEN, clone:C230091D08
2.14
Scd2
Stearoyl-Coenzyme A desaturase 2
2.04
BC004701
cDNA sequence BC004701
1.99
2310032D16Rik
RIKEN cDNA 2310032D16 gene
1.98
Usp31
Ubiquitin specific protease 31
1.98
Il23a
Interleukin 23, alpha subunit p19
1.97
Bhlhb2
Basic helix-loop-helix domain containing, class B2
Accession
Probe
AV048277
NM_021306
NM_026063
NM_021462
BB314055
NM_008497
NM_007467
BI662291
AV066932
AV048277
1452790_x_at
1422586_at
1448685_at
1418300_a_at
1456109_a_at
1450795_at
1416134_at
1418255_s_at
1437164_x_at
1428464_at
NM_013642
BC027796
NM_007614
AI154956
BG060909
BC004701
AV291259
BG068704
NM_031252
NM_011498
1437354_at
1415823_at
1424766_at
1429144_at
1419277_at
1419529_at
1418025_at
1415996_at
1420922_at
1434392_at
Top 10 genes enriched in the ribonucleoprotein (RNP) and polyribosome cytosolic fraction of cells as determined by microarray analysis and bioweight method of fold change
from control. The bioweight index is determined by the product of absolute average fold change from control and negative logarithm of the t-statistic p-value. The top genes
listed below are abstracted from a full list of the top 800 genes (top 5% of those measured) presented as Table S1 in Supplementary data.
induction of the UPR (Kondratyev et al., 2007; Verfaillie et al.,
2012).
The analysis also revealed pathways known to be important for
GnRH signaling, including MAPK, and insulin. For MAPK, mRNAs
enriched in the RNP pool were immediate signal transducers
(Map4k4, Mapkapk2, Mknk2, Ras), indicating a pause in synthesis
of these factors, while feedback regulators (Dusp1, Pla2g2d) were
enriched in the polysome pool, indicating either a resistance to
UPR control mechanisms or specific enrichment via other regulatory processes. The opposite effect was observed for members of
the JAK-STAT signaling pathway. Viewed in the context of signal
induction and feedback control, individual components of signaling cascades may be regulated at the level of translation by either
attenuation through induction of the UPR or increased synthesis
through enrichment in the polyribosome pool.
3.2. Enrichment of specific mRNAs to the polyribosome and RNP pools
To validate these results we examined the redistribution of specific mRNA species central to the regulation of gonadotropes by
GnRH. We monitored Lhb, Cga, Gapdh, Gnrhr, Egr1, and Dusp1 representation in ribosome or RNP complexes after GnRH treatment
using quantitative real time PCR. Consistent with the microarray
analysis above and previous observations, the relative increase in
Lhb, Cga, and Gapdh in the RNP fractions was confirmed (Fig. 1C).
Evaluation of Gnrhr mRNA indicated no significant change from
GnRH treatment. A GnRH-induced increase in the relative abundance of Dusp1 and Egr1 mRNA in the polyribosome pool was also
confirmed. Additionally we examined C-myc mRNA, which is translated via internal ribosome entry rather than the 50 cap-dependent
mechanism. After GnRH treatment C-myc was also increased in the
polyribosome fraction. Because translation of C-myc is not capdependent, increased presence in the polyribosomal fraction suggests that enrichment occurs through a mechanism other than
cap-dependent translation initiation. Thus three populations of
mRNA are identified in this analysis; one showing increased relative representation in polyribosome complexes after stimulation
with GnRH indicating consistent or increased translational utilization, one largely unaffected, and a third showing a relative increase
in the RNP fractions, indicating decreased translational utilization.
3.3. Activation of the unfolded protein response does not explain Duspl
mRNA redistribution
GnRH receptor occupancy leads to stimulation of a number of
downstream signaling factors that participate in the initiation of
secretion, increased transcriptional activity, increased translation,
and modulation of ER function through the UPR. Translational
attenuation by the UPR occurs due to phosphorylation of EIF2A
by EIF2AK3. However, as demonstrated above, not all mRNAs
appear to be susceptible to inhibition. In particular Dusp1 mRNA
appears to be resistant to attenuation. To determine whether
Dusp1 enrichment in the polyribosome fraction was a result of
UPR activation, we compared the effect of GnRH on Dusp1 mRNA
to the direct chemical activation of the UPR by DTT, a known activator of the UPR. DTT treatment results in a near complete inhibition of translation. Comparison of GnRH and DTT effects on Lhb and
Dusp1 mRNA showed that under strong UPR activation by DTT, Lhb
and Dusp1 mRNA are both enriched in the RNP fraction (Fig. 2A).
However, GnRH treatment only affects Lhb mRNA. Examination
of EIF2AK3 phosphorylation in both DTT and GnRH treated LbT2
cells by Western blot shows that both treatments resulted in EIF2AK3 activation (Fig. 2B). In contrast GnRH caused a significant
increase in MAPK1/3 phosphorylation whereas DTT had no effect.
Phosphorylation of the translation initiation factor EIF4E was also
increased by both DTT and GnRH, indicating some independence
from MAPK 1/3 activation (Fig. 2B and C). Therefore the increased
abundance of Dusp1 mRNA in the polyribosome fraction cannot be
explained by activation of the UPR or of EIF4E and suggests that
other components of the GnRH signaling response are responsible.
3.4. Dusp1 mRNA redistribution is recapitulated by activation of PKC
Dusp1 enrichment in polyribosomes did not appear to be
dependent on UPR activation or phosphorylation of EIF4E, suggesting that signaling cascades other than those targeting translational
control by the UPR or cap-dependent translation initiation via
EIF4E activation may contribute to the behavior of Dusp1 mRNA.
GnRH, but not DTT treatment, strongly activates MAPK 1/3 and this
correlated with polyribosome enrichment of Dusp1 mRNA. This
suggests that activation of the PKC-MAPK signaling pathway by
352
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
GnRH may contribute to the observed behavior of Dusp1 mRNA.
Activation of protein kinase C isoforms by PMA strongly activates
MAP kinases including MAPK1/3, and this recapitulates PKC activation by GnRH and regulation of gonadotropin subunit genes
(Dobkin-Bekman et al., 2010; Vasilyev et al., 2002). Treatment of
LbT2 cells with PMA resulted in enrichment of Dusp1 mRNA in
the polyribosome fraction but did not significantly affect Lhb
mRNA distribution relative to vehicle-treated cells (Fig. 3A). We
examined the effect of PMA on EIF2AK3 activation by Western blot
and found that PMA had no measureable effect on phosphorylation
(Fig. 3B). However, PMA treatment did significantly increase both
MAPK1/3 and EIF4E phosphorylation (Fig. 3B and C). Because EIF4E
is also phosphorylated in response to UPR activation by DTT and
this does not lead to Dusp1 mRNA enrichment in polyribosomes,
these observations combined with those in Fig. 2 support the interpretation that translational control mechanisms involving MAPK1/
3 activation contribute to the polyribosomal enrichment of Dusp1
by GnRH.
3.5. Dusp1 mRNA redistribution is sensitive to MAPK1/3 inhibition
Both GnRH and PMA strongly activate MAPK1/3 and this corresponds with their ability to induce Dusp1 mRNA redistribution.
Therefore we tested the dependence of Dusp1 redistribution on
MAPK1/3 activation. We treated LbT2 cells with the MEKK inhibitor PD098059 to block GnRH activation of MAPK1/3 prior to GnRH
treatment and fractionation on sucrose gradients. Treatment with
PD098059 resulted in attenuation of Dusp1 mRNA enrichment in
the polyribosome fractions after GnRH treatment but has no effect
on Lhb mRNA enrichment in the RNP fraction, indicating that polyribosome enrichment occurs through a MAP kinase-dependent
mechanism that is independent of the mechanisms contributing
to enrichment of Lhb mRNA in the RNP fractions (Fig. 4A).
PD098059 does not impact EIF2AK3 or EIF4E activation by GnRH
(Fig. 4B). However, MAPK1/3 activation was significantly attenuated by pretreatment. This supports the role of MAP kinase signaling in polyribosome enrichment of Dusp1 mRNA.
3.6. Dusp1 mRNA redistribution is insensitive to rapamycin
Fig. 2. Activation of the UPR does not explain polyribosome enrichment of Dusp1
mRNA. (A) Summary of Lhb and Dusp1 enrichment in RNP and polyribosome
fractions of cytoplasmic extracts from vehicle or 10 nM GnRH-treated LbT2 cells
with or without pretreatment with 2 mM DTT. DTT causes enrichment of both Lhb
and Dusp1 mRNA to the RNP fraction, but GnRH causes RNP enrichment of Lhb mRNA
and polyribosomal enrichment of Dusp1 mRNA. Asterisks indicate significant fold
change from untreated samples in four independent experiments as determined by
Student’s t-test. (B) An example Western blot analysis of signaling proteins isolated
from Vehicle (Veh), GnRH and DTT treated LbT2 cells using antibodies directed
against EIF2AK3, phosphorylated MAPK1/3, total MAPK 1/3, phosphorylated EIF4E,
and total EIF4E. Proteins were visualized by chemiluminescent imaging and
resulting images used in quantification of individual proteins as below. Images are
presented in inverted grayscale. (C) Summary of Western blot quantification of
phosphor- and total MAPK1/3 from 4 replicate experiments showing increased
phospho-MAPK1/3 to total MAPK 1/3 ratio due to GnRH, but not DTT treatment of
LbT2 cells. Protein levels were determined by chemiluminescent imaging and
quantification. Phosphorylated to total ratios of protein were normalized to
untreated levels and plotted. GnRH, but not DTT, increases MAPK1/3 phosphorylation. (D) Summary of EIF4E phosphorylation in response to GnRH and DTT treatment
of LbT2 cells as above. Ratios of phospho- to total-EIF4E were determined and
normalized to untreated controls in five independent experiments. Both GnRH and
DTT increase EIF4E phosphorylation to a similar degree. In both (C and D) dashed
lines represent control ratio of phospho-MAPK1/3 to total MAPK 1/3 or phosphoEIF4E to total-EIF4E normalized to one. Asterisks indicate significant difference from
untreated control as determined by Student’s t test and groups with different letters
are significantly different from each other as determined by two-sample t test.
The above results indicate that Dusp1 mRNA enrichment in the
polyribosome fractions does not require activation of cap-dependent initiation. EIF4E phosphorylation depends on its release from
an inactive complex with 4E binding protein (4EBP1). Phosphorylation of 4EBP1 by the growth regulatory kinase mTOR releases
EIF4E, enabling interaction with mRNA cap structures and
phosphorylation by the translational initiation machinery. To
examine the dependence of Dusp1 enrichment in polyribosomes
on the cap-dependent translation initiation mechanism directly,
we examined the effect of the mTOR inhibitor rapamycin on
GnRH-induced mRNA redistribution. Inhibition of with mTOR with
rapamycin inhibits phosphorylation of 4EBP1 thus blocking
cap-dependent translation initiation. The presence of rapamycin
reduced the overall content of mRNA in the polyribosome pool
(Fig. 5A). However, GnRH treatment still caused an enrichment of
Dusp1 in that pool and rapamycin had no effect on Lhb enrichment
in the RNP pool. Although rapamycin inhibited phosphorylation of
4EBP1 by GnRH, there was no effect on GnRH induced phosphorylation of MAPK 1/3 (Fig. 5B and C). As we and others have reported,
rapamycin does not completely inhibit EIF4E phosphorylation in
response to a signaling stimulus (Beretta et al., 1996; Nguyen
et al., 2004). Overall this result confirms that activation of EIF4E
and cap-dependent translation does not contribute to increased
DUSP1 representation in the polyribosome pool.
353
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
A
GnRH
GnRH+PD
B
C
Fold Response
18
15
MAPK 1/3
A*
12
9
6
B
3
C
0
GNRH
D
EIF4E
Fold Response
6
5
4
PD PD+GnRH
A*
A*
3
2
B
1
0
GNRH
Fig. 3. Polyribosome enrichment of Dusp1 mRNA is recapitulated by treatment with
PMA. (A) Summary of redistribution of Lhb and Dusp1 mRNA to RNP and
polyribosome fractions in response to GnRH and PMA treatment. Both GnRH and
PMA induce polyribosomal redistribution of Dusp1 mRNA, but PMA has no effect of
Lhb distribution. Asterisks indicate significant change from control from three
independent experiments as determined by Student’s t test. (B) Example Western
blot images from LbT2 cells treated with Vehicle (Veh) GnRH, or PMA showing a
lack of EIF2AK3 phosphorylation but increased MAPK1/3 and EIF4E phosphorylation. Chemiluminescent images are displayed in inverted grayscale. (C) Summary of
three independent Western blot analyses of MAPK 1/3 phosphorylation in GnRH
and PMA treated cells. Both GnRH and PMA increase MAPK 1/3 phosphorylation to a
similar degree. (D) Summary of three independent Western blot analyses of EIF4E
phosphorylation in response to GnRH and PMA treatment. GnRH and PMA both
increase EIF4E phosphorylation to a similar degree. In both (C and D) dashed lines
represent control ratio of phospho-MAPK1/3 to total MAPK 1/3 or phospho-EIF4E to
total-EIF4E normalized to one. Asterisks indicate significant difference from
untreated control as determined by Student’s t test and groups with different
letters are significantly different from each other as determined by two-sample t
test.
3.7. The Dusp1 30 UTR confers resistance to translational inhibition
To understand which mechanisms may be responsible for
enrichment of Dusp1 mRNA in polyribosomes, we explored the
PD PD+GnRH
Fig. 4. Polyribosome enrichment of Dusp1 mRNA is attenuated by inhibition of the
MAPK1/3 signaling cascade. (A) Summary of redistribution of Lhb and Dusp1 mRNA
pre-treated with vehicle or with 30 lM PD098059 for 30 min prior to a 30 min
stimulation with vehicle or 10 nM GnRH. A summary of the independent determinations of fold change relative to vehicle-treated controls is plotted. Asterisks
indicate significant change from control from three independent experiments as
determined by Student’s t test. (B) Example Western blot images from LbT2 cells
treated with vehicle (Veh), GnRH, PD 098059 (PD), or GnRH + PD098059 (G + PD). M
indicates molecular weight marker. Images show activation of EIF2AK3 and EIF4E
by GnRH is not affected by PD098059 pretreatment but MAPK 1/3 phosphorylation
is attenuated. Chemiluminescent images are displayed in inverted grayscale. (C)
Summary of three independent Western blot analyses of MAPK 1/3 phosphorylation
in GnRH, PD098059 or PD098059 plus GnRH-treated cells. GnRH-induced phosphorylation of MAPK1/3 is attenuated by PD098059. (D) Summary of three
independent determinations of GnRH-induced phosphorylation of EIF4E either
alone or in the presence of PD098059 showing no effect on phosphorylation. In both
(C and D) dashed lines represent control ratio of phospho-MAPK1/3 to total MAPK
1/3 or phospho-EIF4E to total-EIF4E normalized to one. Asterisks indicate significant difference from untreated control as determined by Student’s t test and groups
with different letters are significantly different from each other as determined by
ANOVA and post hoc analysis with Tukey’s HSD test.
structure of the mRNA. The Dusp1 mRNA is predicted to be a structurally complex molecule that interacts with a number of RNAbinding proteins including tristetraproline/ZFP36 and ELAV1/HuR
354
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
Input α-ELAV1
A
M
+
-
+
-
IgG
+
- RT
200 bp
100 bp
50 bp
B
C
Fig. 5. Polyribosome or RNP enrichment of Lhb or Dusp1 mRNA by GnRH is not
affected by rapamycin. (A) Summary of three independent determinations of
polyribosome or RNP enrichment of Lhb and Dusp1 mRNA by GnRH either alone or
with 30 min pretreatment with the mTOR inhibitor rapamycin showing that neither
Lhb nor Dusp1 enrichment is sensitive to inhibition of cap-dependent translation.
Phospho-4EBP is reduced by pretreatment with rapamycin and the hypo- and unphosphorylated a, b and c isoforms are increased in abundance. Chemiluminescent
images are presented in inverted grayscale. (C) Summary of three independent
Western blot determinations of MAPK 1/3 phosphorylation by GnRH after
pretreatment with vehicle or rapamycin showing no effect on basal or GnRHinduced levels of phospho-MAPK 1/3. (D) Summary of three independent determination of EIF4E phosphorylation after pretreatment with vehicle or rapamycin
showing a modest increase in EIF4E phosphorylation in response to GnRH in both
vehicle and rapamycin-treated cells. In both (C and D) dashed lines represent
control ratio of phospho-MAPK1/3 to total MAPK 1/3 or phospho-EIF4E to totalEIF4E normalized to one. Asterisks indicate significant difference from untreated
control as determined by Student’s t test and groups with different letters are
significantly different from each other as determined by ANOVA and post hoc
analysis with Tukey’s HSD test.
which bind an AU-rich element in the distal 30 UTR (Emmons et al.,
2008; Kuwano et al., 2008; Lin et al., 2008). We confirmed the
interaction of ELAV1 with Dusp1 mRNA by RNA-IP using an
Cont. TK p
Luc
Dusp1 TK p
Luc
Lhb
Luc
TK p
Dusp1 3′ UTR
Lhb 3′ UTR
TK p
Luc
TK p
Luc
ELAV - ELAV +
TK p
Luc
ELAV -
TK p
Luc
ELAV +
Dusp1 3′ UTR
Fig. 6. The 30 UTR of Dusp1 mRNA is bound by ELAV1 and confers resistance to
GnRH-induced reduction of expression in LbT2 gonadotrope cells. (A) Immunoprecipitation of LbT2 cell extracts with anti ELAV1 antibody (a-ELAV1) followed by RTPCR using primers directed against Dusp1 mRNA shows interaction between ELAV1
and Dusp1 mRNA. Input, direct RT-PCR of LbT2 cell extracts. IgG, immunoprecipitation with normal mouse IgG. ± Indicates presence or absence of reverse
transcriptase in the cDNA reaction prior to PCR. M designates marker lane. (B)
Structure of reporter genes bearing the encoded pGL3 SV40 poly-Adenylation site
without an encoded 30 UTR (Cont., Control), the 30 UTR from Dusp1 (Dusp1), or the
30 UTR from Lhb (Lhb). Reporter plasmids were co-transfected into LbT2 cells with an
internal control plasmid expressing b-galactosidase. Cells were stimulated with
10 nM GnRH for the times indicated and assayed for luciferase and b-galactosidase
activity. The ratio of Luciferase to b-galactosidase is plotted in the figure. Asterisks
indicate significant difference from the time vehicle control from four independent
experiments as determined by ANOVA and Tukeys’ HSD post hoc test. (C) Reporter
plasmids bearing no 30 UTR (Control), the Dusp1 30 UTR (30 UTR), the Dusp1 30 UTR
with a deletion of the region containing the predicted sequence and secondary
structure interacting with ELAV1 (ELAV) or the remaining region of the Dusp1
30 UTR were co-transfected with a control vector expressing b-galactosidase into
LbT2 cells and treated with GnRH for 4 h. Cells were harvested and assayed for
luciferase and b-galactosidase activity and plotted in the chart. Asterisks indicate
significant difference from vehicle-treated control level normalized to one as
determined by Student’s t-test of four independent experiments.
antibody directed against mouse ELAV1 followed by RT-PCR with
Dusp1-specific primers (Fig. 6A).
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
To evaluate the effect of the Dusp1 30 UTR on gene expression,
we constructed three reporter genes of identical plasmid backbone,
the 80 bp proximal TK promoter, and the firefly luciferase gene,
that differ only in the composition of the 30 UTR. One contained
only the reporter sequences up to the SV40 poly-adenylation signal, the second included the Lhb 30 UTR and the third contained
the full Dusp1 30 UTR. Each of these was individually transfected
into LbT2 cells with an internal control plasmid containing the
same plasmid backbone but including the CMV immediate-early
promoter and the b-galactosidase reporter gene. Earlier studies
showed that GnRH-induced translational pausing is transient (Do
et al., 2009). Redistribution peaks at 30 min after GnRH stimulation
and resolves at 60 min after stimulation. If enrichment of mRNA
into the RNP pool is due to decreased translation, a transient loss
of translational activity would be accompanied by a corresponding
decrease in reporter gene activity after GnRH treatment. To examine the possibility that the Dusp1 30 UTR confers resistance to
translational pausing, transfected cells were treated with GnRH
and harvested at 2 h, 4 h, and 6 h after treatment. The half-life of
firefly luciferase in eukaryotic cells has been measured at approximately 3.7 h (Leclerc et al., 2000). Consistent with the measured
half-life of luciferase and the occurrence of maximal translational
pausing at 30 min after GnRH stimulation, we observed a significant decrease in luciferase activity derived from the control and
Lhb 30 UTR reporter genes 4 h after GnRH stimulation (Fig. 6B). In
contrast, the reporter construct bearing the Dusp1 30 UTR was resistant to the GnRH-induced decrease in luciferase activity, although
relative activity of the reporter gene to the internal control was
lower. To test whether the ELAV1 binding region of the Dusp1
mRNA alone was sufficient to confer resistance to GnRH-induced
inhibition of translation, we examined deletion constructs of the
30 UTR. Although the intact 30 UTR is able to confer resistance to
translational inhibition by GnRH, the ELAV1 binding region alone
or the 30 UTR minus the ELAV1 binding region were both sensitive
to GnRH-induced repression of reporter gene expression (Fig. 6C).
Thus the entire 30 UTR may be necessary to confer resistance, or
deletion of portions of the 30 UTR are disruptive to the overall structure of the 30 UTR and prevent proper function.
4. Discussion
The regulation of translation allows for rapid, reversible, and
fine control of gene expression in response to changes in the cellular environment. This regulation may involve either changes that
affect mRNAs at the global level, or those that affect a subset of
mRNAs in response to changes in environment or to extracellular
signals. (Dang Do et al., 2009; Kuhn et al., 2001; Mathews et al.,
2000). Subcellular localization of translation is also a component
of regulation, as in the case of distal axonal translation of numerous mRNAs (Deglincerti and Jaffrey, 2012), and regulation of the
UPR translational response is also localized to specific areas associated with the ER and mitochondria (Verfaillie et al., 2012). Translational control can operate selectively through dependence on the
cap-binding translation initiation complex or through independence from cap-dependent translational initiation by utilization
of internal ribosomal entry for initiation. Additional mechanisms
contributing to the utilization of mRNA by the translational
machinery include sequestration in stress granules or processing
bodies, interaction with 30 UTR binding proteins and targeting by
miRNAs. All of these processes can be affected by extracellular signals or changes in physiological status.
Altogether these regulatory mechanisms comprise a complex
network that can operate independently of transcriptional regulation, providing a layer of gene regulation that may not be evident
by direct examination of transcriptional regulation or examination
355
of steady-state mRNA levels in cells. It has become clear that observed transcriptional changes do not strictly correspond in timing
or magnitude to observed changes in protein levels demonstrated
in both in vivo and in vitro studies. One striking example of this includes the modest and delayed increase in Lhb mRNA in response
to pulsatile GnRH in rats. Measurements in vivo show only moderate increases in Lhb mRNA levels (Burger et al., 2002), although
primary transcript levels and LH hormone output are increased
substantially (Burger et al., 2004). Microarray based approaches
of gene expression analysis have also shown only modest increases
in mRNA levels in response to various condition of GnRH stimulation (Kakar et al., 2003; Lawson et al., 2007; Wurmbach et al.,
2001). Increased LH protein synthesis can occur in the absence of
transcriptional activity (Nguyen et al., 2004) and increased DUSP1
protein levels precedes increases in mRNA (Lawson et al., 2007;
Nguyen et al., 2010), providing evidence in gonadotropes of an
independent and complementary translational regulatory regime.
Earlier work showed that GnRH activates the cap-dependent
translational initiation machinery and this may provide a regulatory mechanism to increase overall levels of protein synthesis to
meet secretory demand (Nguyen et al., 2004). Other work has
shown that GnRH induces the UPR and transiently attenuates the
translation of Lhb and Cga mRNAs (Do et al., 2009). These regulatory schemes are not entirely incompatible and together may allow
for fine regulation of translation that fundamentally contributes to
protein quality and quantity. For example, it is known that the UPR
maintains integrity of the ER and the loss of UPR signaling components compromises differentiation and the ability of the cell to
manage stress (Feng et al., 2009; Saito et al., 2011; Wei et al.,
2008; Zhang et al., 2002). Specifically, in this study we show that
GnRH elicits a complex regulatory response that includes both
enrichment of mRNA in polyribosomes or RNP subcellular
fractions, suggesting both processes are integral to the GnRH regulatory response. Such a mixed response may allow for gonadotropes to increase the overall rate of translation via activation of
cap-dependent initiation, select specific mRNAs for regulation via
structures such as the 30 UTR, and control the quality of protein
synthesis by engaging the UPR.
It is of interest that Dusp1 is a target of translational control by
GnRH. The transient activation of MAPK1/3 can be modulated by
DUSP1 levels through an ultrashort feedback loop. (Caunt et al.,
2008; Nguyen et al., 2010) and DUSP1 is modulated through phosphorylation by MAPK1/3, which contributes to regulation of activity or protein stability and gene transcription (Brondello et al.,
1999; Jeffrey et al., 2006; Li et al., 2011). DUSPs are important
modulators of the MAPK signaling and participate in establishing
hysteresis of signaling cascades (Bhalla et al., 2002). The precise
mechanisms for enrichment of Dusp1 mRNA in polyribosomes
after GnRH stimulation remain to be fully described. Although
we have identified the interaction of Dusp1 mRNA with ELAV1,
an AU-rich element-binding protein, its role is not clear. Other factors interacting at the 30 UTR or elsewhere may contribute to the
overall regulation of Dusp1 and similarly regulated mRNAs. Identification of other RNA binding proteins such a tristetraprolin (Clement et al., 2011) or NF90 (Kuwano et al., 2008) and definition of
their role in the translational control of Dusp1 and similar mRNAs
identified here may shed light on the overall mechanisms by which
cells achieve targeted translational regulation of specific mRNAs.
Confirmation of interaction of similarly regulated mRNAs with specific mRNA binding proteins or identification of specific RNA structures or motifs in regulated mRNA’s that confer polyribosomal
enrichment will be required to fully understand the mechanisms
controlling this process.
In summary, we have shown that GnRH is not equivalent to
chemical insult with regard to UPR activation and its effect on
Dusp1 mRNA distribution. GnRH induces a change in the mRNA
356
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
composition of polyribosomes and ribonucleoprotein complexes in
LbT2 cells. Evaluation of the behavior of individual mRNAs shows
that the redistribution of mRNA can be attributed to both UPR
and MAP kinase signaling cascades. Transcriptome-wide assessment of the compositional changes in mRNA indicates that select
mRNAs are sensitive to this regulatory mechanism and are specifically enriched in either the polyribosome or RNP pools. Finally,
analysis of the Dusp1 mRNA suggests that resistance to UPR-induced translational pausing may be attributed to the 30 UTR and
may involve regulation by RNA-binding proteins. Although the
30 UTR binding protein ELAV1 is associated with the Dusp1 mRNA
in LbT2 cells, resistance to translational pausing requires an intact
30 UTR.
Acknowledgements
This work was supported by the National Institutes of Health
Grants R01 HD 43758 and U54 HD 12303 to M.AL. M.T.D. was supported in part by NIH Grant T32 GM08666. U.A. was supported by
T36 GM095349.
Appendix A. Supplementary material
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.mce.2013.10.007.
References
Alarid, E.T., Windle, J.J., Whyte, D.B., Mellon, P.L., 1996. Immortalization of pituitary
cells at discrete stages of development by directed oncogenesis in transgenic
mice. Development 122, 3319–3329.
Armstrong, S.P., Caunt, C.J., Fowkes, R.C., Tsaneva-Atanasova, K., McArdle, C.A., 2009.
Pulsatile and sustained gonadotropin-releasing hormone (GnRH) receptor
signaling: does the Ca2+/NFAT signaling pathway decode GnRH pulse
frequency? J. Biol. Chem. 284, 35746–35757.
Armstrong, S.P., Caunt, C.J., Fowkes, R.C., Tsaneva-Atanasova, K., McArdle, C.A., 2010.
Pulsatile and sustained gonadotropin-releasing hormone (GnRH) receptor
signaling: does the ERK signaling pathway decode GnRH pulse frequency? J.
Biol. Chem. 285, 24360–24371.
Beretta, L., Gingras, A.C., Svitkin, Y.V., Hall, M.N., Sonenberg, N., 1996. Rapamycin
blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation of
translation. EMBO J. 15, 658–664.
Bhalla, U.S., Ram, P.T., Iyengar, R., 2002. MAP kinase phosphatase as a locus of
flexibility in a mitogen-activated protein kinase signaling network. Science 297,
1018–1023.
Brondello, J.M., Pouyssegur, J., McKenzie, F.R., 1999. Reduced MAP kinase
phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation.
Science 286, 2514–2517.
Burger, L.L., Dalkin, A.C., Aylor, K.W., Haisenleder, D.J., Marshall, J.C., 2002. GnRH
pulse frequency modulation of gonadotropin subunit gene transcription in
normal gonadotropes-assessment by primary transcript assay provides
evidence for roles of GnRH and follistatin. Endocrinology 143, 3243–3249.
Burger, L.L., Haisenleder, D.J., Dalkin, A.C., Marshall, J.C., 2004. Regulation of
gonadotropin subunit gene transcription. J. Mol. Endocrinol. 33, 559–584.
Burger, L.L., Haisenleder, D.J., Marshall, J.C., 2011. GnRH pulse frequency
differentially regulates steroidogenic factor 1 (SF1), dosage-sensitive sex
reversal-AHC critical region on the X chromosome gene 1 (DAX1), and serum
response factor (SRF): potential mechanism for GnRH pulse frequency
regulation of LH beta transcription in the rat. Endocrine 39, 212–219.
Caunt, C.J., Armstrong, S.P., Rivers, C.A., Norman, M.R., McArdle, C.A., 2008.
Spatiotemporal regulation of ERK2 by dual specificity phosphatases. J. Biol.
Chem. 283, 26612–26623.
Clement, S.L., Scheckel, C., Stoecklin, G., Lykke-Andersen, J., 2011. Phosphorylation
of tristetraprolin by MK2 impairs AU-rich element mRNA decay by preventing
deadenylase recruitment. Mol. Cell. Biol. 31, 256–266.
Dang Do, A.N., Kimball, S.R., Cavener, D.R., Jefferson, L.S., 2009. EIF2alpha kinases
GCN2 and PERK modulate transcription and translation of distinct sets of
mRNAs in mouse liver. Physiol. Genom. 38, 328–341.
Deglincerti, A., Jaffrey, S.R., 2012. Insights into the roles of local translation from the
axonal transcriptome. Open Biol. 2, 120079.
Do, M.H., Santos, S.J., Lawson, M.A., 2009. GnRH induces the unfolded protein
response in the LbetaT2 pituitary gonadotrope cell line. Mol. Endocrinol. 23,
100–112.
Dobkin-Bekman, M., Rahamin-Ben Navi, L., Shterntal, B., Sviridonov, L., Przedecki, F.,
Naidich-Exler, M., Brodie, C., Seger, R., Naor, Z., 2010. Differential role of PKC
isoforms in GnRH and phorbol 12-myristate 13-acetate activation of
extracellular signal-regulated kinase
and Jun N-terminal kinase.
Endocrinology 151, 4894–4907.
Eisen, M.B., Spellman, P.T., Brown, P.O., Botstein, D., 1998. Cluster analysis and
display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95,
14863–14868.
Emmons, J., Townley-Tilson, W.H., Deleault, K.M., Skinner, S.J., Gross, R.H., Whitfield,
M.L., Brooks, S.A., 2008. Identification of TTP mRNA targets in human dendritic
cells reveals TTP as a critical regulator of dendritic cell maturation. RNA 14,
888–902.
Feng, D., Wei, J., Gupta, S., McGrath, B.C., Cavener, D.R., 2009. Acute ablation of PERK
results in ER dysfunctions followed by reduced insulin secretion and cell
proliferation. BMC Cell Biol. 10, 61.
Ferris, H.A., Shupnik, M.A., 2006. Mechanisms for pulsatile regulation of the
gonadotropin subunit genes by GNRH1. Biol. Reprod. 74, 993–998.
Fribley, A., Zhang, K., Kaufman, R.J., 2009. Regulation of apoptosis by the unfolded
protein response. Methods Mol. Biol. 559, 191–204.
Gentleman, R., Carey, V., Huber, W., Irizarry, R., Dudoit, S., 2005. Bioinformatics and
Computational Biology Solutions Using R and Bioconductor. Springer, New
York.
Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B., Speed, T.P., 2003.
Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 31, e15.
Jain, R., Devine, T., George, A.D., Chittur, S.V., Baroni, T.E., Penalva, L.O., Tenenbaum,
S.A., 2011. RIP-Chip analysis: RNA-binding protein immunoprecipitationmicroarray (chip) profiling. Methods Mol. Biol. 703, 247–263.
Jeffrey, K.L., Brummer, T., Rolph, M.S., Liu, S.M., Callejas, N.A., Grumont, R.J.,
Gillieron, C., Mackay, F., Grey, S., Camps, M., Rommel, C., Gerondakis, S.D.,
Mackay, C.R., 2006. Positive regulation of immune cell function and
inflammatory responses by phosphatase PAC-1. Nat. Immunol. 7, 274–283.
Kakar, S.S., Winters, S.J., Zacharias, W., Miller, D.M., Flynn, S., 2003. Identification of
distinct gene expression profiles associated with treatment of LbetaT2 cells
with gonadotropin-releasing hormone agonist using microarray analysis. Gene
308, 67–77.
Kondratyev, M., Avezov, E., Shenkman, M., Groisman, B., Lederkremer, G.Z., 2007.
PERK-dependent compartmentalization of ERAD and unfolded protein response
machineries during ER stress. Exp. Cell Res. 313, 3395–3407.
Kuhn, K.M., DeRisi, J.L., Brown, P.O., Sarnow, P., 2001. Global and specific
translational regulation in the genomic response of Saccharomyces cerevisiae
to a rapid transfer from a fermentable to a nonfermentable carbon source. Mol.
Cell. Biol. 21, 916–927.
Kuwano, Y., Kim, H.H., Abdelmohsen, K., Pullmann Jr., R., Martindale, J.L., Yang, X.,
Gorospe, M., 2008. MKP-1 mRNA stabilization and translational control by RNAbinding proteins HuR and NF90. Mol. Cell. Biol. 28, 4562–4575.
Lawson, M.A., Tsutsumi, R., Zhang, H., Talukdar, I., Butler, B.K., Santos, S.J., Mellon,
P.L., Webster, N.J., 2007. Pulse sensitivity of the luteinizing hormone beta
promoter is determined by a negative feedback loop involving early growth
response-1 and Ngfi-A binding protein 1 and 2. Mol. Endocrinol. 21, 1175–1191.
Leclerc, G.M., Boockfor, F.R., Faught, W.J., Frawley, L.S., 2000. Development of a
destabilized firefly luciferase enzyme for measurement of gene expression.
Biotechniques 29, 590–591, 594–596, 598 passim.
Li, S., Zhu, F., Zykova, T., Kim, M.O., Cho, Y.Y., Bode, A.M., Peng, C., Ma, W., Carper, A.,
Langfald, A., Dong, Z., 2011. T-LAK cell-originated protein kinase (TOPK)
phosphorylation of MKP1 protein prevents solar ultraviolet light-induced
inflammation through inhibition of the p38 protein signaling pathway. J. Biol.
Chem. 286, 29601–29609.
Lim, S., Pnueli, L., Tan, J.H., Naor, Z., Rajagopal, G., Melamed, P., 2009. Negative
feedback governs gonadotrope frequency-decoding of gonadotropin releasing
hormone pulse-frequency. PLoS One 4, e7244.
Lin, N.Y., Lin, C.T., Chang, C.J., 2008. Modulation of immediate early gene expression
by tristetraprolin in the differentiation of 3T3-L1 cells. Biochem. Biophys. Res.
Commun. 365, 69–74.
Mathews, M.B., Sonenberg, N., Hershey, J.W.B., 2000. Origins and principles of
translational control. In: Sonenberg, N., Hershey, J.W.B., Mathews, M.B. (Eds.),
Translational Control of Gene Expression, second ed. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, pp. 1–31.
Nanbru, C., Lafon, I., Audigier, S., Gensac, M.C., Vagner, S., Huez, G., Prats, A.C., 1997.
Alternative translation of the proto-oncogene c-myc by an internal ribosome
entry site. J. Biol. Chem. 272, 32061–32066.
Nguyen, K.A., Intriago, R.E., Upadhyay, H.C., Santos, S.J., Webster, N.J., Lawson, M.A.,
2010. Modulation of gonadotropin-releasing hormone-induced extracellular
signal-regulated kinase activation by dual-specificity protein phosphatase 1 in
LbetaT2 gonadotropes. Endocrinology 151, 4882–4893.
Nguyen, K.A., Santos, S.J., Kreidel, M.K., Diaz, A.L., Rey, R., Lawson, M.A., 2004. Acute
regulation of translation initiation by gonadotropin-releasing hormone in the
gonadotrope cell line LbetaT2. Mol. Endocrinol. 18, 1301–1312.
Rosenfeld, S., Wang, T., Kim, Y., Milner, J., 2004. Numerical deconvolution of cDNA
microarray signal: simulation study. Ann. NY Acad. Sci. 1020, 110–123.
Ruf, F., Sealfon, S.C., 2004. Genomics view of gonadotrope signaling circuits. Trends
Endocrinol. Metab. 15, 331–338.
Saito, A., Ochiai, K., Kondo, S., Tsumagari, K., Murakami, T., Cavener, D.R., Imaizumi,
K., 2011. Endoplasmic reticulum stress response mediated by the PERKeIF2(alpha)-ATF4 pathway is involved in osteoblast differentiation induced by
BMP2. J. Biol. Chem. 286, 4809–4818.
Scheuner, D., Kaufman, R.J., 2008. The unfolded protein response: a pathway that links
insulin demand with beta-cell failure and diabetes. Endocr. Rev. 29, 317–333.
Storey, J.D., 2002. A direct approach to false discovery rates. J. R. Stat. Soc. Ser. B,
479–498.
Minh-Ha T. Do et al. / Molecular and Cellular Endocrinology 382 (2014) 346–357
Tsaneva-Atanasova, K., Caunt, C.J., Armstrong, S.P., Perrett, R.M., McArdle, C.A., 2012.
Decoding neurohormone pulse frequency by convergent signalling modules.
Biochem. Soc. Trans. 40, 273–278.
Tusher, V.G., Tibshirani, R., Chu, G., 2001. Significance analysis of microarrays
applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 98, 5116–
5121.
Vasilyev, V.V., Lawson, M.A., Dipaolo, D., Webster, N.J., Mellon, P.L., 2002. Different
signaling pathways control acute induction versus long-term repression of
LHbeta transcription by GnRH. Endocrinology 143, 3414–3426.
Verfaillie, T., Rubio, N., Garg, A.D., Bultynck, G., Rizzuto, R., Decuypere, J.P., Piette, J.,
Linehan, C., Gupta, S., Samali, A., Agostinis, P., 2012. PERK is required at the ERmitochondrial contact sites to convey apoptosis after ROS-based ER stress. Cell
Death Differ..
Walter, P., Ron, D., 2011. The unfolded protein response: from stress pathway to
homeostatic regulation. Science 334, 1081–1086.
357
Wei, J., Sheng, X., Feng, D., McGrath, B., Cavener, D.R., 2008. PERK is essential for
neonatal skeletal development to regulate osteoblast proliferation and
differentiation. J. Cell Physiol. 217, 693–707.
Wurmbach, E., Yuen, T., Ebersole, B.J., Sealfon, S.C., 2001. Gonadotropin-releasing
hormone receptor-coupled gene network organization. J. Biol. Chem. 276,
47195–47201.
Zhang, K., Kaufman, R.J., 2006. Protein folding in the endoplasmic reticulum and the
unfolded protein response. Handb. Exp. Pharmacol., 69–91.
Zhang, P., McGrath, B., Li, S., Frank, A., Zambito, F., Reinert, J., Gannon, M., Ma, K.,
McNaughton, K., Cavener, D.R., 2002. The PERK eukaryotic initiation factor 2
alpha kinase is required for the development of the skeletal system, postnatal
growth, and the function and viability of the pancreas. Mol. Cell. Biol. 22, 3864–
3874.
Zhang, T., Roberson, M.S., 2006. Role of MAP kinase phosphatases in GnRHdependent activation of MAP kinases. J. Mol. Endocrinol. 36, 41–50.