1139
Denning-area fidelity and mitochondrial DNA
diversity of female polar bears (Ursus maritimus)
in the Barents Sea
E. Zeyl, D. Ehrich, J. Aars, L. Bachmann, and Ø. Wiig
Abstract: Polar bears (Ursus maritimus Phipps, 1774) show fidelity to general denning areas in subsequent reproductive
events. Studying the level and spatio-temporal scale of denning-area fidelity is critical to determine the adaptability of polar bears to climate change. We used mark–recapture data in conjunction with mitochondrial DNA (mtDNA) data to investigate the level of fidelity of polar bears from the Barents Sea population to five maternal denning areas. There was no
differentiation in mtDNA haplotype frequencies between denning areas. The fidelity of females to denning areas is at a local geographic scale and small groups of neighboring females (3–13) shared similar haplotypes with higher probability
than expected by chance. The transmission of denning-area fidelity is supported by the short distances (£60.0 km) observed between capture locations of six (out of eight) denning mother–daughter pairs. Moreover, our results suggested that
some females (3 out of 13) used different denning areas in subsequent denning events. This behavioral plasticity implies
that females are likely to be able to change denning locations if unsuitable ice conditions prevent them from reaching their
preferred denning areas. We consider this plasticity an important attribute of polar bears when facing climate change.
Résumé : Les ours blancs (Ursus maritimus Phipps, 1774) sont fidèles à des zones générales où ils construisent leurs tanières maternelles, lors de reproductions consécutives. Étudier le degré et l’échelle spatio-temporelle de la fidélité aux zones
de tanières maternelles est primordial dans l’optique de déterminer l’adaptabilité des ours blancs au changement climatique.
Nous avons utilisé des données de marquage–recapture conjointement avec des données d’ADN mitochondrial pour examiner le degré de fidélité des ours blancs de la population de la mer de Barents à cinq zones de tanières maternelles. Il n’y
avait pas de différence de fréquence haplotypique entre les zones de tanières maternelles. La fidélité des femelles aux zones
de tanières maternelles est à une échelle géographique relativement petite, et de petits groupes de femelles voisines (3–13)
ont une plus forte probablité de partager des haplotypes similaires qu’attendu par chance. La transmission de la fidélité aux
zones de tanières maternelles est soutenue par les courtes distances (£60,0 km) observées entre les localités de capture de
six (parmi huit) paires mère–fille, ayant été dans des tanières maternelles. De plus, nos résultats ont démontré que quelques
femelles (3 parmi 13) ont changé de zone de tanières maternelles entre des événements de reproduction consécutifs. Cette
plasticité comportementale implique que les femelles sont probablement capables de changer de zone de tanières maternelles si des conditions de glace défavorables les empêchent de rejoindre leur zone préférée. Nous considérons cette élasticité
comme un attribut important des ours blancs lorsque confrontés au changement climatique.
Introduction
Maternal denning areas are important resources for polar
bears (Ursus maritimus Phipps, 1774) because the dens provide shelter and thermal isolation to their altricial offsprings.
Unlike other bear species, only the pregnant females enter
overwintering dens, usually between September and December (Harington 1968; Lentfer 1975; Messier et al. 1994; Wiig
1998). Most cubs are then born between mid-November and
January (Harington 1968; Derocher et al. 1992; Messier et al.
1994). The mother with cubs of the year (COYs) do not leave
the den until the COYs’ locomotion skills are developed sufficiently by the age of at least 2 months, and they are able to
cope with the harsh environmental conditions (Amstrup
1993; Linnell et al. 2000). In the Barents Sea population,
most maternal dens are opened in March or early April and
abandoned by late April (Larsen 1985; Messier et al. 1994;
Wiig 1998; A.E. Derocher et al., submitted).2 Long-term fidelity to denning areas and faithfulness to denning substrate
(i.e., land vs. ice) has been observed (Ramsay and Stirling
1990; Amstrup and Gardner 1994; Wiig 1995; Mauritzen et
al. 2001). Most maternal denning takes place on land,
Received 8 January 2010. Accepted 8 September 2010. Published on the NRC Research Press Web site at cjz.nrc.ca on 10 November
2010.
E. Zeyl,1 L. Bachmann, and Ø. Wiig. Natural History Museum, National Centre for Biosystematics, University of Oslo, P.O. Box 1172
Blindern, NO-0318 Oslo, Norway.
D. Ehrich. University of Tromsø, Department of Biology, NO-9037 Tromsø, Norway.
J. Aars. Norwegian Polar Institute, NO-9296 Tromsø, Norway.
1Corresponding
author (e-mail: eve.zeyl@nhm.uio.no).
Derocher, M. Andersen, Ø. Wiig, J. Aars, E. Hansen, and M. Biuw. Sea-ice dynamics affects polar bear den ecology at Hopen
Island, Svalbard, Norway. Submitted for publication.
2A.E.
Can. J. Zool. 88: 1139–1148 (2010)
doi:10.1139/Z10-078
Published by NRC Research Press
1140
although it has also been observed on land-fast ice and drifting multiyear ice in the Beaufort Sea (Lentfer 1975; Amstrup
and Gardner 1994).
Microhabitat parameters, such as snow thickness, a topography that favors the accumulation of drifted snow, and substrate stability (land, land-fast ice, or pack ice) are important
for successful denning (Lentfer and Hensel 1980; Richardson et al. 2005). Moreover, favorable sea-ice conditions are
necessary to allow access to denning areas at appropriate
times of the year (Jonkel et al. 1972; Durner et al. 2003; Richardson et al. 2005). This may explain the variability in
distributions of maternal dens within the population ranges
of polar bears (Richardson et al. 2005). Dens can sometimes
be found at low densities or can be more aggregated, either
on land or on land-fast ice near coastlines (Lentfer and Hensel 1980; Ramsay and Stirling 1990; Amstrup 1993;
Amstrup and Gardner 1994; Messier et al. 1994; Durner et
al. 2001).
Lønø (1970) concluded that maternal denning in Svalbard
mainly occurred on the eastern islands of the archipelago, on
Nordaustlandet, and along the northern part of the east coast
of Spitsbergen. Larsen (1985) made the first surveys of polar
bear dens in Svalbard during the 1970s and early 1980s. He
suggested that there were between 150 and 175 dens each
spring, with only 20–30 dens outside the three main denning
areas of Nordaustlandet, Edgeøya–Barentsøya, and Kong
Karls Land. Hopen, a small island farther south in the archipelago, has been shown to have a significant number of dens
(up to 36 in 1996) in years with sea ice arriving early in the
autumn, but only few dens following autumns with little sea
ice (A.E. Derocher et al., submitted).2 A total of 523 maternal dens were recorded throughout the Svalbard archipelago
between 1973 and 2009 (Andersen et al. 2009), again with
the highest number recorded on the eastern and northern islands. The great majority of dens were on land, within 1 km
from the shoreline. Lønø (1970) suggested that sea-ice conditions may not be suitable for pack-ice denning in Svalbard, although it cannot entirely be ruled out.
Space use by polar bears is believed to reflect family tradition and young bears may learn navigational patterns from
their mother (Lunn and Stirling 1985; Derocher and Stirling
1990; Wiig et al. 2008). If so, fidelity to denning areas may
be transmitted from mothers to daughters. Zeyl et al. (2009)
documented a kin structure in polar bears of the Barents Sea
population, which was stronger in females than in males.
Distances between capture localities of related females
tended to be smaller than those between unrelated females,
an observation which may also indicate female fidelity to
denning areas. Assuming that female polar bears are philopatric and faithful to specific denning areas, geographically
restricted maternal mitochondrial DNA (mtDNA) lineages
might be detectable. A clear structuring of maternal mtDNA
lineages among denning areas can, however, only be expected in clusters that have been stable over several generations (i.e., in the absence of substantial immigration).
Climate change is currently the most pressing concern for
the conservation of polar bears (Stirling and Derocher 1993;
Derocher et al. 2004; Amstrup et al. 2008; Wiig et al. 2008;
Durner et al. 2009). The bears are dependent on sea ice to
allow them to reach traditional denning areas (Derocher et
al. 2004). Reduced ice extent following global warming
Can. J. Zool. Vol. 88, 2010
may affect the abilities of pregnant female polar bears to
reach their preferred denning locations (Derocher et al.
2004). The degree of fidelity of females to denning areas
and the degree to which this behavior is transferred to
daughters may be important parameters for populations of
polar bears when it comes to adapting to varying local seaice conditions.
The objectives of the present study were (i) to assess the
fidelity of individual female polar bears from the Barents
Sea population to their denning areas over several breeding
cycles, (ii) to investigate whether denning-area fidelity is
transmitted from mothers to daughters, and (iii) to examine
whether fidelity is sufficient to lead to genetic structuring
through maternal lineages.
Materials and methods
Study area, capture, and sample collection
The Barents Sea population of polar bears extends from
728N to 838N latitude and from 108E to 608E longitude in
the Norwegian and Russian Arctic zones (Wiig and Derocher 1999) (Fig. 1). This area includes the Svalbard archipelago (748N–818N, 108E–348E), which consists of five
large island groups and several small islands.
As part of a long-term project on the ecology of polar
bears conducted by the Norwegian Polar Institute, Tromsø,
Norway, polar bears were captured each year between 1990
and 2008, in spring and summer (March through September). Bears were caught by remote injection of a dart (CapChur Equipment, Douglasville, Georgia, USA) containing
the drug Zoletil1 (Virbarc, Carros, France) fired from a
helicopter (Stirling et al. 1989). Bears were individually
marked using numbered ear tags, a tattoo on the upper lip,
and a microchip. A vestigial premolar was extracted from
the majority of the captured animals to determine age based
on counts of cementum growth layers (Calvert and Ramsay
1998; Christensen-Dalsgaard et al. 2010). For a few bears,
age was estimated from field observations of body size and
tooth wear, a method that usually gives age estimates close
to those estimated by cementum growth layers (Hensel and
Sorensen 1980). Blood samples were collected from the
femoral vein into heparinized vials and stored cool until
centrifuged within 8 h of collection to separate plasma from
blood cells. Samples were stored at –20 8C until analysis.
The animal-handling methods used were approved by the
Norwegian Animal Health Authority (Oslo, Norway).
Laboratory methods
DNA isolation
DNA was isolated from tissue samples following either a
standard chloroform–phenol protocol (Sambrook and Russell
2001) or the manufacturer’s instructions of the DNeasy Tissue Kit (Qiagen, Hilden, Germany). Plasma samples were
processed using the E.Z.N.A. Blood DNA kit II (Omega
Bio-tek, Doraville, Georgia, USA) following the manufacturer’s ‘‘blood and body fluid DNA spin’’ protocol with
some minor adjustments. The quantity of isolated DNA of
tissue samples was estimated visually on a 2% agarose gel
compared with a reference sample that had been calibrated
with a NanoDrop ND-1000 spectrophotometer (Thermo
Published by NRC Research Press
Zeyl et al.
Fig. 1. Localities of 78 female polar bears (Ursus maritimus) captured with cubs of the year (COYs) in spring (March–May) in the
Svalbard area. Each female capture location is indicated by a circle.
The predefined maternal denning areas are depicted as shaded
areas. The summary of the mitochondrial DNA (mtDNA) haplotypes of those females in each denning area is given in Table 1.
One female captured far from the others in the Barents Sea
(76.438N, 42.158E) is not presented.
Fisher Scientific). For plasma samples, the DNA concentration was lower than the detection limit of the NanoDrop;
therefore, successful DNA isolation from such samples was
tested by means of specific polymerase chain reaction (PCR)
amplification protocols (see below).
Primer design
Published mitochondrial genome sequences of six bears
(American black bears (Ursus americanus Pallas, 1780):
GenBank accession nos. AF303109 and NC_003426;
U. maritimus: GenBank accession nos. AF303111 and
AJ428577; brown bears (Ursus arctos L., 1758): GenBank
accession nos. AF303110 and NC_003427) were aligned
with GeneTool version 2.0 (BioTools Incorporated, Edmonton, Alberta, Canada). Specific primers were designed targeting the mitochondrial genes for transfer RNA for
glutamine (tRNAglu), cytochrome b (cyt b), transfer RNA for
theronine (tRNAThr), transfer RNA for proline (tRNAPro), and
487 base pairs (bp) of the adjacent control region (CR) using
the Web-based software Primer3 version 0.4.0 (Rozen and
Skaletsky 2000). Primers were optimized for high annealing
temperatures (61 8C). Two external primers allowed amplification of a 2036 bp fragment that was sequenced with a set
of 12 internal primers (Appendix Table A1). The tRNAglu
gene and the 5’ end of the cyt b gene did not show any sequence variation in a test sample set (seven nonrelated individuals); thus, the targeted region was reduced to 1561 bp.
1141
PCR and cycle sequencing
PCR was performed in a 15 mL reaction volume containing 1–1.5 ng template DNA, 0.4 mmol/L of each dNTP
(Roche Applied Science, Indianapolis, Indiana, USA), 1
PCR buffer (consisting of 10 mmol/L Tris–HCL at pH 8.8
and 25 8C, 50 mmol/L KCl, and 0.1% Triton X-100),
2.3 mmol/L MgCl2, 0.2 mmol/L of each external primers
(Appendix Table A1), and 0.5 units of DyNAzyme II DNA
polymerase (Finnzymes, Espoo, Finland). Initial heating to
95 8C for 3 min was followed by 35 cycles for tissue samples and 45 cycles for plasma and serum samples, each consisting of 30 s at 95 8C, 30 s at 61 8C with a time increment
of 5 s per cycle, and 15 s at 68 8C, followed by a final elongation of 10 min at 68 8C. Five microlitres of the final product was run out on a 2% agarose gel to test for successful
amplification. Four microlitres of one-tenth diluted ExoSAP-IT enzyme (USB Corporation, Cleveland, Ohio, USA)
were added to the remaining 10 mL of the PCR reaction and
incubated at 37 8C for 30 min for removing excess primers,
followed by 15 min inactivation at 80 8C.
Cycle sequencing reactions were performed using the BigDye (version 1.1 or version 3.1) sequencing chemistry (Applied Biosystems, Inc., Foster City, California, USA). Each
sequencing reaction was performed with 0.7 mL BigDye terminator mix, 1 sequencing buffer, 0.1 mmol/L primer (Appendix Table A1), and 3 mL of purified PCR product
(diluted according to concentration estimated on agarose
gel), and run for 30 cycles, each consisting of denaturation
at 96 8C for 30 s, annealing at 61 8C for 30 s, and elongation at 60 8C for 4 min. The sequences were purified using a
standard cold ethanol–sodium acetate precipitation (Sambrook and Russell 2001) and subsequently resuspended in
12 mL HiDi formamide (Applied Biosystems, Inc., Foster
City, California, USA). Sequencing was performed on an
ABI 3100 analyzer (Applied Biosystems, Inc., Foster City,
California, USA).
Sequence alignment
The sequences were edited and the different fragments
were assembled for each individual using the Staden Package softwares Pregap4 and Gap4 (Bonfield et al. 1995; Staden 1996). Sequence data were obtained for 108 adult
females (including 3 adult mother–daughter pairs). To verify
that there were no mutational differences between mothers
and offspring, data from 18 juvenile bears (15 females and
3 males, from which mothers were identified from field
data and parentage analysis; see Zeyl et al. 2009) were analyzed but were subsequently excluded from the statistical
analysis of denning. Sequences were aligned manually in
MEGA version 4 (Tamura et al. 2007; Kumar et al. 2008)
and trimmed to a length of 1358 bp (positions 15 705 to 46
in the polar bear reference sequence AF303111, covering
part of the cyt b, tRNAThr, and tRNAPro genes and part of
the CR).
Genetic diversity
To illustrate the intrapopulation mtDNA phylogeny, a
haplotype network was constructed using the TCS version
1.21 software (Clement et al. 2000). Haplotype diversity
and nucleotide diversity were estimated for the total data
set of adult females and for groups of females attributed to
Published by NRC Research Press
1142
different denning areas (see below) using the Arlequin version 3 software (Excoffier et al. 2005).
Fidelity to denning areas
For the statistical analyses, six denning areas were defined
in the Svalbard area based on earlier studies and observations of maternal dens (Lønø 1970; Larsen 1985; Theisen
and Brude 1998; Andersen et al. 2009). These areas were
Hopen, Southern Spitsbergen, Edgeøya–Barentsøya, Kong
Karls Land, Northern Spitsbergen, and Nordaustlandet
(Fig. 1). Females with COYs were captured on or close to
their den during spring (between 28 March and 5 May). Females captured on sea ice were assumed to have denned in
the nearest denning area (Stirling and Andriashek 1992). Females with COYs have been found to move with an mean
speed of about 0.3–0.5 km/h after leaving their dens in
spring (Wiig et al. 2003; Andersen et al. 2008). Accordingly, in 3 weeks, they may cover about 200 km, which is
longer than the distance between some of the defined denning areas. One female was captured far from any terrestrial
denning area (76.438N, 42.158E) and may have denned on
ice. Given this uncertainty, we excluded this female from
subsequent analyses.
The degree of fidelity of individual females to denning
areas was investigated using mark–recapture data. Only females captured with COYs in different years were taken
into account. To what extent denning-area fidelity is passed
from mothers to their daughters was investigated using several approaches. First, we used the parentage analysis of
Zeyl et al. (2009) to search for mother and daughter pairs,
where both the mother and the daughter have been captured
as adults with COYs. We also used mark–recapture data
from females captured as COYs together with their mother
and later recaptured as adults together with COYs (two
cases). As an alternative approach, the mtDNA data were investigated for evidence of spatially localized female lineages.
The mitochondrial sequences of females captured with
COYs were grouped according to the six predefined denning
areas. Genetic differentiation between these groups was assessed through AMOVA using Arlequin version 3 (Excoffier
et al. 2005) and significance was assessed by permutation
tests (10 000 permutations). As we were not considering historical patterns, we used conventional FST based on haplotype frequencies. The northwestern Spitsbergen denning
area was excluded from the AMOVA because only two females were captured there. For the two females, it was not
possible to assign them to a particular denning area because
they were captured on ice between Hopen and Edgeøya. Accordingly, these two females were also excluded from the
AMOVA analysis.
To test whether females with identical mtDNA haplotypes
grouped according to a geographic pattern other than the
predefined denning areas (e.g., at a smaller scale), we carried out a permutation test that counted how many different
haplotypes were observed, on average, in groups of three to
20 closest (by distance) neighboring females. This procedure
was repeated for 1000-permutated data sets with haplotypes
randomly distributed among capture locations. An observed
mean number of haplotypes per group smaller than obtained
in the randomized data sets would indicate that females with
Can. J. Zool. Vol. 88, 2010
similar haplotypes are grouped locally. All statistical analyses were done in R version 2.8.0 (R Development Core
Team 2008) if not stated otherwise.
Results
mtDNA and haplotype diversity
The final data set included 108 concatenated mtDNA sequences from female polar bears trimmed to a length of
1358 bp. The alignment of the sequences was straightforward, except for a stretch of homopolymer runs of 3–5 T
followed by 7–8 C in the CR. These two ambiguous
stretches were therefore removed from the alignment.
Among the 108 mtDNA sequences, 21 different haplotypes were identified, 6 of which occurred only once. In total, there were 24 polymorphic sites, all transitions. Nine
substitutions relate to cyt b and 15 substitutions to the CR.
In cyt b, 7 substitutions were silent (6 substitutions affecting
the third position and 1 substitution affecting the first position of the respective codons). Two substitutions at the second codon positions led to isoleucine–threonine exchanges.
No polymorphic sites were found in the tRNA genes. Haplotype diversity in the total sample was 0.902 (SD = 0.014,
n = 108). The mean number of pairwise differences between
sequences was 4.36 (SD = 2.17), resulting in a nucleotide
diversity (p) of 0.00322 (SD = 0.00178). The reticulated
haplotype (Fig. 2) network showed several groups of haplotypes. The haplogroup consisting of haplotypes G and I was
separated from the rest of the network by three substitutions.
Fidelity to denning areas
Thirteen females were captured with COYs in different
years. Ten were recaptured in the same denning area, with a
mean distance between capture locations of 23.7 km (SD =
20.2 km, range = 4.8–69.6 km) (Fig. 3). One female was
first captured at Edgeøya in 1998 and recaptured 187.8 km
away in the Nordaustlandet denning area on 24 April 2006.
We consider it unlikely that the females had moved from
Edgeøya to Nordaustlandet after den emergence because the
sea ice between these areas is usually open and dynamic,
and therefore difficult to cross for COYs. One female was
first captured at Hopen in 1999 and recaptured at a distance
of 159.4 km to the north near the Edgeøya denning area on
12 April 2001. In both years, there were very few dens (4
and 1, respectively) at Hopen and it seems unlikely that the
female had moved from Hopen to Edgeøya after den emergence. A third female was first captured in the North Spitsbergen denning area in 1994 and recaptured 126.5 km
farther south, outside the predefined denning area but on
the same island, in 2002. We cannot rule out that this female had moved south from the denning area after den
emergence, but we consider it unlikely. To conclude, at least
two of these three recaptured females had probably shifted
denning area and one of these two instances could be related
to impaired ice conditions at Hopen during the preceding
autumn (A.E. Derocher et al., submitted).2
According to parentage analysis (Zeyl et al. 2009), both
mother and adult daughter were captured accompanied by
their respective COYs in eight instances (a total of 15 different females, as one mother had two daughters both captured
with COYs). It was therefore possible to use mark–recapture
Published by NRC Research Press
Zeyl et al.
1143
Fig. 2. Phylogenetic network of 21 mitochondrial DNA (mtDNA) haplotypes detected in 108 female polar bears (Ursus maritimus) from the
Barents Sea population as determined by TCS version 1.21. Circle size corresponds to haplotype frequency. The numbers refer to the position of the variable nucleotides.
data to determine whether females were faithful to the denning area of their mother (Fig. 4). In six pairs, the capture
locations were within the same denning area, separated by a
mean of 27.5 km (SD = 21.4 km, range = 2.7–60.0 km), indicating that daughters returned to the denning area of their
mother. Among these six pairs, two females were captured
as COYs accompanied by their mother and were later recaptured as adult mothers accompanied by their own COYs.
Both were recaptured close to the localities where they
were captured first as COYs (at 14 and 60.3 km, respectively; Fig. 4). The two mother–daughter pairs that did not
show fidelity to the denning area of their mother (i.e., that
were captured in different denning areas than their mother)
were separated by a distance of 136.0 and 167.2 km, respectively.
Seventy-nine females were captured with COYs on one or
more occasions (Fig. 1). These were used to investigate the
hypothesis that fidelity to denning area leads to the establishment of maternal lineages in particular denning areas.
Six of these females were captured twice in different years
with COYs; one female was captured three times. All recaptured females remained in the same denning area. Among
the 79 females, 20 different haplotypes were found (Table 1,
Fig. 1). Haplotype diversity was similar for the different
denning areas as shown by the overlap in confidence intervals of the haplotype diversity (Table 1). The majority of
private haplotypes was found in bears captured in the
Edgeøya–Barentsøya denning area, but the sample size was
largest in this area. The AMOVA showed that only 0.27%
of the variance in haplotype frequencies could be accounted
for by differences between denning areas (SD = 0.005, P =
0.393). Thus, there was no support for genetic differentiation
of females captured in five different denning areas (Hopen,
Edgeøya–Barentsøya, Kong Karls Land, Nordaustlandet,
and South Spitsbergen). However, at a more local scale,
haplotypes were geographically structured. The number of
haplotypes found in groups of neighboring females with
COYs was, on average, smaller than expected by chance for
groups of 3–13 females (Fig. 5), although this trend was not
apparent for groups of 14–20 females. The observed tendency of females with identical haplotypes to den close to
each other was significant, as the 95% confidence interval
for the mean number of haplotypes per group based on
1000 permutations excluded the observed values up to a
Published by NRC Research Press
1144
Fig. 3. Localities of thirteen adult female polar bears (Ursus maritimus) captured and recaptured with cubs of the year (COYs) during spring (March–May) in the Svalbard area. Each female capture
location is indicated by a solid or open circle. The lines represent
the distance between capture locations of the individuals. The broken lines indicate movement between denning areas and solid lines
indicate movement within denning areas. The arrows indicate the
direction of movement from first to last capture location. No line is
presented for females recaptured in the vicinity of their previous
capture; in such case, each female is identified by a specific combination of symbol and color. The predefined maternal denning
areas are depicted as shaded areas.
group size of 13 (Fig. 5). Using first or last capture locations
for females captured several times with COYs, as described
in Zeyl et al. (2009), did not change the result.
Discussion
In general, our results corroborate the observations of earlier studies, i.e., female polar bears show a certain degree of
fidelity to denning areas (Ramsay and Stirling 1990;
Amstrup and Gardner 1994; Scott and Stirling 2002). Furthermore, we documented that daughters tend to den in the
same area as their mothers. A local genetic structuring exists
as indicated by maternal lineages.
However, there is always a risk of sampling bias when estimating fidelity to denning areas because females with
COYs might theoretically move to another denning area
after den emergence in the spring. With a mean travelling
speed of about 0.3–0.5 km/h after leaving the den in the
spring (Wiig et al. 2003; Andersen et al. 2008), they may
cover up to about 200 km over 3 weeks. Nevertheless, we
find it unlikely that this applies to many of the families
used in the current study. If so, they must have moved in a
more or less a straight direction after leaving the den site.
The distances between successive capture–recapture locations were of the same order of magnitude as those reported
for land-denning females in western Hudson Bay by Ramsay
Can. J. Zool. Vol. 88, 2010
Fig. 4. Localities of eight pairs of adult mother-daughter polar
bears (Ursus maritimus) with cubs of the year (COYs) captured
during spring (March–May) in the Svalbard area. Each pair is represented by a different combination of symbol and grey color.
Broken lines indicate movement between denning areas. The predefined maternal denning areas are depicted as shaded areas.
and Stirling (1990) (median = 34 km, range = 3–54 km, n =
11). This is in sharp contrast with the results of Amstrup and
Gardner (1994) who reported that in the Beaufort Sea, sequential dens were, on average, separated by a distance of
308 km (SD = 262 km, n = 30). The larger distance between
subsequent denning locations in the Beaufort Sea may be
explained by the considerable proportion of bears denning
on sea ice, a behavior that has not been reported for bears
denning in the Barents Sea (Andersen et al. 2009). Fidelity
to denning areas by polar bears is rather low compared with
some other bear species. Female brown bears show a greater
degree of denning-area fidelity than male brown bears (Linnell et al. 2000). Mean distances separating dens in successive years were 3.5 and 8.8 km in southeast Alaska, and
were 1.7 and 7.8 km on Kodiak Island, for females and
males, respectively. Manchi and Swenson (2005) found that
distance between dens for adult female brown bears in central Sweden was 7.1 km (SD = 4.9 km, n = 124). In black
bears, rates of reuse of dens vary from 5%–6% to 30%–
58% for excavated dens and up to 70%–100% for natural
cavities; reuse by the same bear is rare (Linnell et al. 2000).
On the other hand, Angerbjörn et al. (2004) showed that arctic foxes (Vulpes lagopus (L., 1758)) may use the same den
for up to 5 years. To summarize, the pattern of den selection
varies considerably between species.
Haplotype diversity observed in this study was rather low
compared with other mammals (Nabholz et al. 2008) but
was similar to previous diversity estimates for polar bears
(Cronin et al. 2006). Assuming populations of polar bears
with a stable size and little immigration, together with female philopatry and denning-area fidelity, one expects the
establishment of maternal lineages. This prediction was supPublished by NRC Research Press
Zeyl et al.
1145
Table 1. Number of different mitochondrial DNA (mtDNA) haplotypes detected in female polar bears (Ursus maritimus) captured with cubs
of the year (COYs) in six denning areas from the Barents Sea population (for illustration see Fig. 1).
Denning areas
Haplotype
A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
Total
No. of haplotypes
No. of private haplotypes
Haplotype diversity (SD)
H
5
EB
1
1
3
1
1
2
3
3
1
2
4
1
3
1
1
2
1
1
1
1
1
KKL
3
1
1
1
N
2
U
2
1
3
1
3
1
3
1
24
14
4
0.942 (0.026)
NWS
1
3
1
1
1
1
1
1
21
10
1
0.905 (0.037)
SS
3
1
1
12
9
1
0.939 (0.058)
1
5
4
1
0.900 (0.161)
12
6
0
0.864 (0.064)
2
2
0
na
3
2
0
na
Total
17
1
3
7
3
4
9
4
10
2
2
3
1
5
2
1
2
1
1
1
79
20
0.911 (0.017)
Note: H, Hopen Island; EB, Edgeøya–Barentsøya; KKL, Kong Karls Land; N, Nordaustlandet; SS, South Spitsbergen; NWS, North West Spitsbergen; U,
individuals from the Barents Sea not captured within any of the defined denning areas; na, not applicable.
ported by our study, as the number of mitochondrial haplotypes observed in groups of 3–13 neighboring females was
significantly lower than expected by chance.
Mitochondrial haplotype frequencies were very similar in
the five denning areas that were defined a priori. This indicates that denning-area fidelity in polar bears can only affect
mtDNA structure on a local scale. These findings are consistent with the pattern of kin structure detected earlier with
microsatellite data (Zeyl et al. 2009). Given that 3 out of 13
females were found to have changed denning areas between
subsequent denning events and 2 out of 8 daughters denned
in different areas than their mothers did, one may not expect
genetic differentiation between denning areas, even less
when assuming behavioral plasticity. Altogether, our analyses indicated that matrilines do form locally but that
different matrilines overlap between the predefined geographically distinct denning areas.
The observed pattern of overlapping local mitochondrial
matrilines reflects a level of fidelity to denning areas that is
probably affected by local denning conditions. A sufficient
layer of snow is needed to build a den in autumn, whereas
sea ice connecting the islands and the hunting areas is important for successful reproduction. Environmental conditions, notably sea-ice conditions, are highly variable
between years (Parkinson 1992) and may force polar bears
to adopt behavioral plasticity. Females shifting denning
areas between successive captures highlight this possibility
and suggest that they can shift denning location if unable to
reach their preferred areas. This plastic behavior, however,
depends upon the spatial and temporal availability of alternative denning locations. In Hopen, for example, the timing
of ice arrival in autumn fluctuates largely between years; in
years with little ice in autumn, few females den at Hopen
(A.E. Derocher et al., submitted).2 Our results indicate that
if females are not able to den in their preferred denning
area, then they will not defer denning but will den in another area.
However, our results might also be affected by the recent
recolonization of the study area by immigrating polar bears.
A potentially existing genetic structure relating to the denning areas may have been wiped out and overlaid with new
immigrant lineages. Polar bears from the Barents Sea were
intensively hunted for 100 years (from 1870 to 1970), and
in some years up to 900 individuals were harvested (Lønø
1970). It is very unlikely that such catches could have been
sustained without immigration from neighboring areas, and
even so, population size was significantly reduced (Larsen
1986). A hunting ban was implemented in Svalbard in
1973, thus the time since hunting cessation represents only
3.5 polar bear generations, assuming a generation time of
10 years according to Cronin et al. (2009). A.E. Derocher et
al. (submitted)2 suggested that the large number of denning
females on Hopen Island observed in the 1990s (up to
36 dens/year) may have reflected a reestablishment of the
Island as a denning area as a result of recovery of the
Barents Sea population after heavy hunting. As suggested
Published by NRC Research Press
1146
Fig. 5. Mean number of different mitochondrial DNA (mtDNA)
haplotypes divided by group size for groups of 3–20 neighboring
denning female polar bears (Ursus maritimus) in the Svalbard area.
A data point indicates the number of haplotypes divided by group
size (N Hapl) and N Fem indicates the group size of neighboring
denning females. The shaded area shows how many haplotypes are
expected given a random distribution of haplotypes in space (95%
confidence interval). The N Hapl points outside the confidence interval show that the number of haplotypes observed is significantly
inferior to what is expected by chance for group sizes of 3–13.
Can. J. Zool. Vol. 88, 2010
of habitat is symptomatic of larger ecosystem changes that
cumulatively present a threat to the persistence of polar
bears (A.E. Derocher et al., submitted).2
Recent evidence of changes in sea-ice conditions emphasizes that knowledge of denning behaviors by polar bears in
different parts of the Arctic is key to understand how polar
bears may cope with future climate change. Given that different populations of polar bears have very different denning
ecology and operate under very different ecological constraints (Amstrup 2003), studies that include more populations, as well as a data on genetics, capture, and telemetry,
could prove useful.
Acknowledgements
We thank the anonymous reviewers for their constructive
comments. This work was supported by the Natural History
Museum of the University of Oslo (Oslo, Norway) and the
Norwegian Research Council through the National Centre
for Biosystematics (project no. 146515/420). Samples were
provided by the Norwegian Polar Institute (Tromsø, Norway).
References
by Støen et al. (2005) for an expanding population of brown
bears in Sweden, dispersing females may settle in areas not
inhabited by other bears and then establish matrilinear assemblages through subsequent philopatric behavior. A similar scenario could partly explain the small groups of females
sharing identical haplotypes that we found in polar bears,
while a larger matrilineal structure is absent.
Various studies have identified declining sea-ice coverage
and suitability as the two most important factors causing a
projected decline in the abundance of polar bears (A.E. Derocher et al., submitted).2 The documented flexibility of polar
bears in fidelity to denning areas is considered an important
behavior in the face of climate change, at least as long as it
is possible to move between hunting areas and suitable denning habitats. Accordingly, in western Hudson Bay, a northward shift in the distribution of maternal dens that might
relate to changes in sea-ice conditions has been reported
(Ramsay and Stirling 1990). Fischbach et al. (2007) found
that the proportion of dens on pack ice in the Beaufort Sea
declined from 62% in 1985–1994 to 37% in 1998–2004 and
concluded that this was due to the reduction of ice stability.
At Hopen Island in the Barents Sea, A.E. Derocher et al.
(submitted)2 found a decrease in the number of dens with
delayed arrival of 60% sea-ice cover the previous autumn.
At lower sea-ice coverage, pregnant females do not manage
to reach the island in time to make their den in the autumn.
In conclusion, loss of one island or area for maternity denning may not be a major cause for concern because the females are able to relocate to other areas. However, the loss
Amstrup, S.C. 1993. Human disturbances of denning polar bears in
Alaska. Arctic, 46(3): 246–250.
Amstrup, S.C. 2003. Polar bear, Ursus maritimus. In Wild mammals of North America: biology, management, and conservation.
Chap. 27. Edited by G.A Feldhamer, B.C Thompson, and J.A
Chapman. The Johns Hopkins University Press, Baltimore, Md.
pp. 587–610.
Amstrup, S.C., and Gardner, C. 1994. Polar bear maternity denning
in the Beaufort Sea. J. Wildl. Manage. 58(1): 1–10. doi:10.2307/
3809542.
Amstrup, S.C., Marcot, B.G., and Douglas, D.C. 2008. A Bayesian
network approach to forecasting the 21st century worldwide status of polar bears. In Arctic sea ice decline: observations, projections, mechanisms, and implications. Edited by E.T.
DeWeaver, C.M. Bitz, and L.B. Tremblay. American Geophysical Union, Washington, D.C. pp. 213–268.
Andersen, M., Derocher, A.E., Wiig, Ø., and Aars, J. 2008. Movements of two Svalbard polar bears recorded using geographical
positioning system satellite transmitters. Polar Biol. 31(8): 905–
911. doi:10.1007/s00300-008-0428-x.
Andersen, M., Derocher, A.E., Wiig, Ø., and Aars, J. 2009. Polar
bear (Ursus maritimus) maternity denning in Svalbard, Norway.
In Proceedings of the 18th Biennial Conference on the Biology
of Marine Mammals, Québec, Q.C., 12–16 October 2009. Society for Marine Mammalogy, Québec, Q.C. p. 15.
Angerbjörn, A., Hersteinsson, P., and Tannerfeldt, M. 2004. Europe
and North and Central Asia (Palearctic). In Canids: foxes,
wolves, jackals and dogs — 2004 status survey and conservation
action plan. Chap. 5. Edited by C. Sillero-Zubiri, M. Hoffmann,
and D.W. Macdonald. IUCN/SSC Canid Specialist Group,
Gland, Switzerland, and Cambridge, UK.
Bonfield, J.K., Smith, K.F., and Staden, R. 1995. A new DNA sequence assembly program. Nucleic Acids Res. 23(24): 4992–
4999. doi:10.1093/nar/23.24.4992. PMID:8559656.
Calvert, W., and Ramsay, M.A. 1998. Evaluation of age determination of polar bears by counts of cementum growth layer groups.
Ursus, 10: 449–453.
Christensen-Dalsgaard, S.N., Aars, J., Andersen, M., Lockyer, C.,
and Yoccoz, N.G. 2010. Accuracy and precision in estimation
Published by NRC Research Press
Zeyl et al.
of age of Norwegian Arctic polar bears (Ursus maritimus) using
dental cementum layers from known-age individuals. Polar Biol.
33(5): 589–597. doi:10.1007/s00300-009-0734-y.
Clement, M., Posada, D., and Crandall, K.A. 2000. TCS: a computer program to estimate gene genealogies. Mol. Ecol. 9(10):
1657–1659.
doi:10.1046/j.1365-294x.2000.01020.x.
PMID:
11050560.
Cronin, M.A., Amstrup, S.C., and Scribner, K.T. 2006. Microsatellite DNA and mitochondrial DNA variation in polar bears
(Ursus maritimus) from the Beaufort and Chukchi seas, Alaska.
Can. J. Zool. 84(5): 655–660. doi:10.1139/Z06-039.
Cronin, M.A., Amstrup, S.C., Talbot, S.L., Sage, G.K., and
Amstrup, K.S. 2009. Genetic variation, relatedness, and effective
population size of polar bears (Ursus maritimus) in the southern
Beaufort Sea, Alaska. J. Hered. 100(6): 681–690. doi:10.1093/
jhered/esp061. PMID:19633212.
Derocher, A.E., and Stirling, I. 1990. Distribution of polar bears
(Ursus maritimus) during the ice-free period in western Hudson
Bay. Can. J. Zool. 68(7): 1395–1403. doi:10.1139/z90-208.
Derocher, A.E., Stirling, I., and Andriashek, D. 1992. Pregnancy
rates and serum progesterone levels of polar bears in western
Hudson Bay. Can. J. Zool. 70(3): 561–566. doi:10.1139/z92084.
Derocher, A.E., Lunn, N.J., and Stirling, I. 2004. Polar bears in a
warming climate. Integr. Comp. Biol. 44(2): 163–176. doi:10.
1093/icb/44.2.163.
Durner, G.M., Amstrup, S.C., and Ambrosius, K.J. 2001. Remote
identification of polar bear maternal den habitat in northern
Alaska. Arctic, 54(2): 115–121.
Durner, G.M., Amstrup, S.C., and Fischbach, A.S. 2003. Habitat
characteristics of polar bear terrestrial den sites in northern
Alaska. Arctic, 56: 55–62.
Durner, G.M., Douglas, D.C., Nielson, R.M., Amstrup, S.C., Mcdonald, T.L., Stirling, I., Mauritzen, M., Born, E.W., Wiig, Ø.,
DeWeaver, E., Serreze, M.C., Belikov, S.E., Holland, M.M.,
Maslanik, J., Aars, J., Bailey, D.A., and Derocher, A.E. 2009.
Predicting 21st century polar bear habitat distribution from global climate models. Ecol. Monogr. 79(1): 25–58. doi:10.1890/
07-2089.1.
Excoffier, L., Laval, G., and Schneider, S. 2005. Arlequin (version
3.0): an integrated software package for population genetics data
analysis. Evol. Bioinform. Online, 1: 47–50. PMID:19325852.
Fischbach, A.S., Amstrup, S.C., and Douglas, D.C. 2007. Landward
and eastward shift of Alaskan polar bear denning associated
with recent sea ice changes. Polar Biol. 30(11): 1395–1405.
doi:10.1007/s00300-007-0300-4.
Harington, C.R. 1968. Denning habits of the polar bear (Ursus
maritimus Phipps). Can. Wildl. Serv. Rep. Ser. No. 5. Department of Indian Affairs and Northern Development, Ottawa, Ont.
Hensel, R.J., and Sorensen, F.E., Jr. 1980. Age determination of
live polar bears. In Bears — Their Biology and Management:
Proceedings of the Fourth International Conference on Bear Research and Management, Kalispell, Mont., 21–24 February 1977.
Edited by C.J. Martinka and K.L. McArthur. Bear Biology Association, Tonto Basin, Ariz. pp. 93–100. [Available from Terry
D. White, Southern Appalachian Branch, The University of Tennessee, 274 Ellington Hall, Knoxville, TN 37996, USA; also refer to http://www.bearbiology.com.]
Jonkel, C.J., Kolenosky, G.B., Robertson, R., and Russel, R.H.
1972. Further notes on the polar bear denning habits. In Bears —
Their Biology and Management: Proceedings of the Second International Conference on Bear Research and Management, Calgary, Alta., 6–9 November 1970. Edited by S. Herrero.
International Union for Conservation of Nature and Natural Re-
1147
sources, Morges, Switzerland. pp. 142–158. [Available from
Terry D. White, Southern Appalachian Branch, The University
of Tennessee, 274 Ellington Hall, Knoxville, TN 37996, USA;
also refer to http://www.bearbiology.com.]
Kumar, S., Nei, M., Dudley, J., and Tamura, K. 2008. MEGA: a
biologist-centric software for evolutionary analysis of DNA and
protein sequences. Brief. Bioinform. 9(4): 299–306. doi:10.1093/
bib/bbn017.
Larsen, T. 1985. Polar bear denning and cub production in Svalbard, Norway. J. Wildl. Manage. 49(2): 320–326. doi:10.2307/
3801524.
Larsen, T. 1986. Population biology of the polar bear (Ursus maritimus) in the Svalbard area. Nor. Polarinst. Skr. No. 184.
Lentfer, J.W. 1975. Polar bear denning on drifting sea ice. J.
Mammal. 56(3): 716–718. doi:10.2307/1379497.
Lentfer, J.W., and Hensel, R.J. 1980. Alaskan polar bear denning.
In Bears — Their Biology and Management: Proceedings of the
Fourth International Conference on Bear Research and Management, Kalispell, Mont., 21–24 February 1977. Edited by C.J.
Martinka and K.L. McArthur. Bear Biology Association, Tonto
Basin, Ariz. pp. 101–108. [Available from Terry D. White,
Southern Appalachian Branch, The University of Tennessee,
274 Ellington Hall, Knoxville, TN 37996, USA; also refer to
http://www.bearbiology.com.]
Linnell, J.D.C., Swenson, J.E., Andersen, R., and Barnes, B. 2000.
How vulnerable are denning bears to disturbance? Wildl. Soc.
Bull. 28(2): 400–413.
Lønø, O. 1970. The polar bear (Ursus maritimus Phipps) in the
Svalbard area. Nor. Polarinst. Skr. No. 149.
Lunn, N.J., and Stirling, I. 1985. The Significance of supplemental
food to polar bears during the ice-free period of Hudson Bay.
Can. J. Zool. 63(10): 2291–2297. doi:10.1139/z85-340.
Manchi, S., and Swenson, J. 2005. Denning behavior of Scandinavian brown bears Ursus arctos. Wildl. Biol. 11(2): 123–132.
doi:10.2981/0909-6396(2005)11[123:DBOSBB]2.0.CO;2.
Mauritzen, M., Derocher, A.E., and Wiig, Ø. 2001. Space-use strategies of female polar bears in a dynamic sea ice habitat. Can. J.
Zool. 79(9): 1704–1713. doi:10.1139/cjz-79-9-1704.
Messier, F., Taylor, M.K., Ramsay, M.A., and Messier, F. 1994.
Denning ecology of polar bears in the Canadian Arctic archipelago. J. Mammal. 75(2): 420–430. doi:10.2307/1382563.
Nabholz, B., Mauffrey, J.-F., Bazin, E., Galtier, N., and Glemin, S.
2008. Determination of mitochondrial genetic diversity in mammals. Genetics, 178(1): 351–361. doi:10.1534/genetics.107.
073346. PMID:18202378.
Parkinson, C.L. 1992. Spatial patterns of increases and decreases in
the length of the sea ice season in the north polar region, 1979–
1986. J. Geophys. Res. 97(C9): 14 377 – 14 388. doi:10.1029/
92JC01367.
R Development Core Team. 2008. R: a language and environment
for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Available from http://cran.r-project.org/
[accessed 5 January 2010].
Ramsay, M.A., and Stirling, I. 1990. Fidelity of female polar bears
to winter-den sites. J. Mammal. 71(2): 233–236. doi:10.2307/
1382172.
Richardson, E., Stirling, I., and Hik, D.S. 2005. Polar bear (Ursus
maritimus) maternity denning habitat in western Hudson Bay: a
bottom-up approach to resource selection functions. Can. J.
Zool. 83(6): 860–870. doi:10.1139/z05-075.
Rozen, S., and Skaletsky, H.J. 2000. Primer3 on the WWW for
general users and for biologist programmers. In Bioinformatics
methods and protocols: methods in molecular biology. Edited
by S. Krawetz and S. Misener. Humana Press, Totowa, N.J.
Published by NRC Research Press
1148
pp. 365–386. Available from http://frodo.wi.mit.edu/primer3/
[accessed 5 January 2010].
Sambrook, J., and Russell, D.W. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New
York.
Scott, P.A., and Stirling, I. 2002. Chronology of terrestrial den use
by polar bears in western Hudson Bay as indicated by tree
growth anomalies. Arctic, 55(2): 151–166.
Staden, R. 1996. The Staden sequence analysis package. Mol.
Biotechnol. 5(3): 233–241. doi:10.1007/BF02900361. PMID:
8837029.
Stirling, I., and Andriashek, D. 1992. Terrestrial maternity denning
of polar bears in the eastern Beaufort Sea area. Arctic, 45(4):
363–366.
Stirling, I., and Derocher, A.E. 1993. Possible impacts of climatic
warming on polar bears. Arctic, 46: 240–245.
Stirling, I., Spencer, C., and Andriashek, D. 1989. Immobilization
of polar bears (Ursus maritimus) with Telazol in the Canadian
Arctic. J. Wildl. Dis. 25(2): 159–168. PMID:2716095.
Støen, O.-G., Bellemain, E., Sæbø, S., and Swenson, J.E. 2005.
Kin-related spatial structure in brown bears Ursus arctos. Behav.
Ecol. Sociobiol. 59(2): 191–197. doi:10.1007/s00265-005-00249.
Tamura, K., Dudley, J., Nei, M., and Kumar, S. 2007. MEGA4:
Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24(8): 1596–1599. doi:10.1093/
molbev/msm092. PMID:17488738.
Theisen, F., and Brude, O.W. 1998. Evaluering av områdevernet på
Svalbard, representativited og behov for ytterligere vern. Nor.
Polarinst. Medd. No. 153. [In Norwegian.]
Wiig, Ø. 1995. Distribution of polar bears (Ursus maritimus) in the
Svalbard area. J. Zool. (Lond.), 237(4): 515–529. doi:10.1111/j.
1469-7998.1995.tb05012.x .
Wiig, Ø. 1998. Survival and reproductive rates for polar bears at
Svalbard. Ursus, 10: 25–32.
Wiig, Ø., and Derocher, A.E. 1999. Application of aerial survey
methods to polar bears in the Barents Sea. In Marine mammal
survey and assessment methods. Edited by G.W. Garner, S.C.
Amstrup, J.L. Laake, B.F.J. Manly, L. L. McDonald, and D.G.
Robertson. A.A. Bolkema Publishers, Rotterdam, the Netherlands. pp. 27–36.
Wiig, Ø., Born, E.W., and Pedersen, L.T. 2003. Movements of female polar bears (Ursus maritimus) in the East Greenland pack
ice. Polar Biol. 26(8): 509–516. doi:10.1007/s00300-003-0513-0.
Wiig, Ø., Aars, J., and Born, E.W. 2008. Effects of climate change
on polar bears. Sci. Prog. 91(2): 151–173. doi:10.3184/
003685008X324506. PMID:18717367.
Zeyl, E., Aars, J., Ehrich, D., and Wiig, Ø. 2009. Families in space:
relatedness in the Barents Sea population of polar bears (Ursus
maritimus). Mol. Ecol. 18(4): 735–749. doi:10.1111/j.1365294X.2008.04049.x. PMID:19175504.
Can. J. Zool. Vol. 88, 2010
Appendix A
Table A1. Primer sequences for polymerase chain reaction (PCR)
amplification of parts of the mtDNA genome of the polar bear
(Ursus maritimus).
Primer
Position in
AF303111
Sequence 5’–3’
Target polymorphic regions
F1DL*
ggacggggcctgtactatgg
F1DIDL
accccacatcaaacccgagt
F1DIGH{
tggGgtgctcagtggatttg
ctccactaccagcacccaaag
F2L
F1DH
gctttgggtgctggtagtggag
F2IDL
tccgggagcttaatcaccag
F2IGH
cccggagcgagaagaggta
gcccgacccgtgaaagata
F2H*
15 595
16 095
16 095
16 528
16 549
16 804
16 876
143
Target monomorphic regions
acacccaacacccccactaa
F1GL
F1GIDL
tccgaaaaacccacccattag
F1GIGH
gaacgtctcggcaaatgtgg
F1GH
cggaaaagccccctcagat
15 105
15 311
15 520
15 808
Note: The position of the primers relate to the complete mitochondrion
reference sequence of polar bears (GenBank accession no. AF303111).
The primers were designed to also facilitate amplification of the corresponding mtDNA segments in brown bears (Ursus arctos) and American
black bears (Ursus americanus). All primers have a Tm of ~61 8C.
*External primer.
{
The G at the 4th position of F1DIGH needs to be replaced by A to
amplify the mtDNA of U. arctos.
Published by NRC Research Press