By Won Seon Choi
B.S. Chemical Engineering, Seoul National University, 1997
M.S. Chemical Engineering, Massachusetts Institute of Technology, 2001
Submitted to the Harvard-MIT Division of Health Sciences and Technology in Partial Fulfillment of the Requirements for the Degree of
DOCTOR OF PHILOSOPHY IN BIOMEDICAL ENGINEERING at the
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
September 2005
_ S INSTMTu
IOF
TECHNOLOGY
OCT 9 2005
©2005 Massachusetts Institue of Technology
All rights reserved.
The author hereby grants to MIT permission to reproduce and to distribute publicly paper and electronic copies of the thesis document in whole or in part.
Signature of Author: ,,_ _
Harvard-MIT Division of Health Sciences and Technology
August 5, 2005
2 A,
Certified by:
Irene E. Kochevar, Ph.D.
Professor of Dermatology, Harvard Medical School
Thesis Supervisor
Accepted by:
: A N ?:, ";z" '11J' i~~~~~~~~~~~~~~~~~~~~~~~
Martha L. Gray, Ph.D.
Edward Hood Taplin Professor oMedical and Electrical Engineering
Co-Director, Harvard-MIT Division of Health Sciences and Technology
ARCHIVES,
1

By Won Seon Choi
Submitted to the Harvard-MIT Division of Health Sciences and Technology on August 5, 2005 in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy in Biomedical Engineering
ABSTRACT
The goal of this thesis study was to understand the role of TGF-3 in skin photoaging, especially in solar elastosis. Solar elastosis, the accumulation of elastotic material in the dermal extracellluar matrix, is a major hallmark of photoaging. However, the mechanisms by which UV radiation causes solar elastosis are poorly understood.
TGF-3 is a multifunctional cytokine involved in the regulation of extracelluar matrix and is known to be up-regulated by UVR. Involvement of reactive oxygen species
(ROS) in the development of solar elastosis has been demonstrated by many studies using antioxidants and anti-inflammatory agents in the mouse skin in vivo. We hypothesized that ROS produced by TGF-P3 are key components in the tropoelastin (TE, a soluble precursor of elastin) up-regulation in dermal fibroblasts, and that TGF-P3 is a major regulator in the photoaging processes.
Using human skin fibroblasts system in vitro, we found that ROS generated from
NADPH oxidase and mitochondria are involved in the TGF-3 induced elastin production, and intracellular sources of ROS vary with time. We showed that both Smad and non-Smad pathways, e.g. MAPK and PKC pathways, are required for TE mRNA up-regulation by TGF-3. However, ROS were not involved in some of the important steps in these pathways, such as phosphorylations of p38 or ERK or Smad2, suggesting that ROS acts downstream of these pathways. The in vivo chronic UVB irradiation study using a Skh- 1 hairless mouse model with a small molecule inhibitor for the TGF-
,3 type I receptor showed that the TGF-P receptor inhibitor increased the number of mast cells, but decreased the levels of active TGF-[3 protein, and mRNA levels for collagen
III and IV, MMP-2 and 9, and TE in the chronically UVB irradiated mouse skin.
However, those responses did not result in the changes in the collagen and elastin content, or the wrinkle formation. Overall, this work indicates that TGF-3 contributes to the solar elastosis, through the effects on the TE mRNA level in skin. Implication of this
2

role of TGF-[3 in the elastin fiber deposition or visible changes of photoaged skin requires further investigation.
Thesis Supervisor:
Irene E. Kochevar, Ph.D.
Professor of Dermatology, Harvard Medical School
Thesis Committee:
Peter T. So, Ph.D. (Committee Chair)
Professor of Mechanical Engineering and Biological Engineering, MIT
R. Rox Anderson, M.D.
Professor of Dermatology, Harvard Medical School
Director of Wellman Center for Photomedicine, MGH
En Li, Ph.D.
Vice President and Global Head of Animal Models of Disease,
Novartis Institute for Biomedical Research
Laurel A. Raftery, Ph.D.
Associate Professor of Dermatology, Harvard Medical School
3

First of all, I would like to thank my thesis advisor, Prof. Irene Kochevar, for her guidance and support. From the moment I stepped in her office looking for a lab working on skin aging, she has been the best mentor who has helped me reach my full potential. I deeply appreciate her great patience and enormous encouragement during the course of the study. I have learned a great deal and have grown a lot through all the experiences in her lab, not only as a scientist but also as a person.
I would like to thank my thesis committee members, Prof. Peter So, Prof. Rox Anderson,
Dr. En Li, and Prof. Laurel Raftery, for their invaluable advice and discussions. Each committee meeting has made me leap up one more step as a scientist. Also, their contributions to this thesis as readers are very much appreciated.
I would like to thank our collaborators, Dr. Nicholas Laping at GlaxoSmithKlein for providing us with TGF-3 receptor inhibitor, and Prof. Barry Starcher at University of
Texas for elastin and collagen assays. I also thank John Demirs and Bill Farinelli for all their technical support. This work would not have been possible without their help.
I also thank Kochevar group members, Chelvi Rajadurai, Antonio Valencia, Hongjun
Wang, and Kenneth Bujold. They are excellent colleagues and friends, who have not only helped me with various research techniques, but also spared me lots of wisdom in life. I specially thank Hongjun for the TGF-P assay and our valuable discussions. I thank Prof. Bobby Redmond and his group members, Asima Chakraborty, Yin-Chu
Chen, and Elaine Rafferty for their help and friendship. I also thank all the people at
Wellman2 and Bartlett7 for their wonderful friendship. Everyday was such an enjoyable time because of them, and I truly appreciate it for the time we have spent together in and out of the lab. I will cherish all those memories for the rest of my life.
I would like to take this opportunity to thank my ballet teachers, Susan Alt, Susan
Endrizzi, and Liz Lapuh for their great classes that have helped me keep my sanity all these years. I feel so lucky to meet such wonderful teachers and found the joy of art and the appreciation of life. I also thank Jihyun Yang for her wonderful friendship and for all those times we have spent together in classes, restaurants, and theaters (especially in our home sweet home the Wang Center). I also thank all my friends in Boston and Seoul
4

just for being there for me.
Most importantly, I would like to thank my parents, Koo-Young Choi and Myung-Ai
Kim, for their unconditional love and support. I cannot thank enough for their trust and encouragement. It makes me so happy to make them proud. My deepest thanks will always be theirs, and all the accomplishments in my life will always be dedicated to them.
5

Abstract ..................................... 2
Acknowledgements ........................................
List of Contents ......
4
List of Figures ........................................................
List of Tables ........................... ... ...... ...........
9
...... 12
Chapter 1. General Introduction ........................................
14 1.1. Motivations and Thesis Objectives ...............................
1.2. Effects of UVR on the Skin ..........................
1.2.1. Structure of human skin .........................................................
1.2.1.1. Epidermis ..........................................................................
1.2.1.2. Dermal-epidermal junction .................
1.2.1.3. Dermis ..............................................................................
1.2.2. Ultraviolet radiation ..............................................................
1.2.3. Acute effects of UVR ..............................................................
1.2.3.1. Sunburn (UV-induced inflammation) ...........................................
1.2.3.2. Pigmentation .......................................................................
1.2.4. Chronic effects of UVR ................... .................................
1.2.4.1. Cutaneous malignancies .........................................................
1.2.4.2. Photoaging .........................................................................
1.3. Photoaging ............................................................
1.3.1. Chronological aging vs. photoaging ........................................
1.3.2. Epidermal changes in photoaged skin .......................................
1.3.3. Dermal changes in photoaged skin ........................................
1.3.3.1. Changes in collagen ...............................................................
1.3.3.2. Changes in elastin .................................................................
1.4. Regulation of Elastin ................................................
1.4.1. Synthesis ............................................................................
1.4.2. Integration into elastic fibers .......................................
16
17
25
25
28
28
28
29
32
33
34
21
23
23
23
24
18
20
21
6

1.4.3. Pathology of elastic fibers ....................................................... 36
1.5. Transforming Growth Factor-5 ................................... 38
1.5.1. Synthesis of TGF- ...............................................................
1.5.2. Regulation of TGF-P bioactivity ................................................
1.5.3. TGF-P signaling pathways ......................................................
1.5.4. Effects of TGF- on ECM regulation .........................................
1.5.4.1. Role of TGF-3 in wound healing and fibrosis ................................
1.5.4.2. Role of TGF-3 in elastin regulation ............................................
39
41
43
45
45
46
48
1.6.1. Reactive oxygen species (ROS) .................................................
1.6.2. Involvemnet of ROS in photoaging ............................................
References ..................................................
48
50
53
Chapter 2. Involvement of Reactive Oxygen Species in the TGF-31-
Induced Tropoelastin Expression in Human Dermal Fibroblasts ..... 65
2.1. Introduction ................
........... 66...................
2.2. Materials and Methods ...........................................
2.2.1. Materials ........................................ ................... 68
2.2.2. Cell culture and treatment with TGF-31 ..................................... 68
2.2.3. Real-time reverse transcription-polymerase chain reaction (RT-PCR) 69
2.2.4. ROS measurement ......................................................... 70
70 2.2.5. Western blots ........................................
2.2.6. RNA interference .......................................
.................
..................
2.2.7. Statistical Analysis .........................................................
70
71
2.3. Results ....................................... .........
68
72
2.3.1. TE expression induced by TGF-P1 in human adult skin fibroblasts ... 72
2.3.2. Involvement of ROS in TGF-[1 induced TE expression .................. 73
2.3.3. Pulse treatment vs. continuous treatment ....................................
76
2.3.4. ROS measurement ......................................................... 78
2.3.5. Requirement for new protein synthesis .......................................
2.3.6. Involvement of non-Smad pathways ..........................................
2.3.7. Involvement of the Smad pathway ....................................
79
80
...... 84
2.3.8. Crosstalk between Smad and non-Smad pathways ........................ 90
7

2.4. Discussion .............................................................
References ....................................................................
Chapter 4. Conclusions and Future Directions ..........................
References .........................................
92
98
Chapter 3. Involvement of TGF-P in Skin Photoaging: an In Vivo
Study ................................................. 105
3.1. Introduction ........................................ 106
3.2. Materials and Methods ........................................ 109
3.2.1. Animals ........................................
3.2.2. Materials ........................................
3.2.3. Inhibitor protocols ........................................
3.2.4. Irradiation protocols ........................................
109
109
109
110
3.2.5. Histology ........................................
3.2.6. Immunohistochemistry ............................ ............
112
113
3.2.7. Biochemical assays ........................................
3.2.10. Statistical analysis ........................................
114
3.2.8. Bioassays for TGF- ............................................................
3.2.9. Real-time reverse transcription-polymerase chain reaction (RT-PCR)
115
................................................................................................ 116
.................. 117
3.3. Results ................................................. 118
3.3.1. Acute UVB irradiation .........................................................
3.3.2. Chronic UVB irradiation ......................................................
3.3.2.1. Plasma level of SB-505124 .................................................
3.3.2.2. Gross appearance ........................................
3.3.2.3. Histology ......................................................................
3.3.2.4. Biochemical changes .........................................................
3.3.2.5. Total and active TGF-PI1 levels .............................................
3.3.2.6. mRNA levels of TGF-p-regulated genes .......................
3.4. Discussion ............................................................
122
126
128
130
118
121
121
122
139
References ................................................................... 143
149
155
8

Figure 1-1. Structure of the skin ............................................................ 16
Figure 1-2. Action spectra for erythema and epidermal DNA photodamage (thymine dimers) ........................................ .................... 22
Figure 1-3. Solar elastosis in human skin ..................................................... 30
Figure 1-4. Immunohistochemical visualization of elastin in human skin ............... 32
Figure 1-5. Elastic fiber formation ............................................................ 34
Figure 1-6. Desmosine and isodesmosine formation by the actions of lysyl oxidase ... 35
Figure 1-7. TGF-3 large latent complex (LLC) ...................................
Figure 1-8. TGF-P superfamily signaling through signal-transducting Smad and
........ 40 inhibitory Smad proteins ............................................................ 44
Figure 1-9. Generation of various ROS ...................................................... 48
Figure 2-1. Time course for induction of TE gene expression by TGF-3 1. in adult human dermal fibroblasts ........................................ .................... 72
Figure 2-2. NAC added up to 1.5 h after TGF-31. treatment inhibited TE gene
......................
Figure 2-3. DPI and mitoQ inhibited TE gene expression .................................
74
75
Figure 2-4. Pulse treatment (30 min) with TGF-31. has the same effect on TE mRNA level as continuous treatment ............................................................. 77
Figure 2-5. TGF-PI31 78
Figure 2-6. New protein synthesis is required for TE gene expression by TGF- 31 .... 79
Figure 2-7. Effect of kinase inhibitors for the selected signaling molecules in non-Smad pathways on TGF-3 1-induced TE mRNA .............................................. 81
9

Figure 2-8. p
3 8 and p-p38 level is not influence by antioxidants ....................................... 82
Figure 2-9. ERK MAPK remains phosphorylated up to 120 min after TGF-t31 treatment and p-ERK level is not influence by antioxidants ....................................... 83
Figure 2-10. TGF-Pl -induced Smad2 phosphorylation is not mediated by ROS ....... 84
Figure 2-11. FACS analysis for siRNA transfection efficiency ........... ......... 85
Figure 2-12. Time course of the smad4 protein levels after the RNAi treatment ........ 87
Figure 2-13. Smad4 RNAi and TGF-31 treatment .......................................... 88
Figure 2-14. TGF-P I-induced TE level after Smad4 RNAi treatment .................... 89
Figure 2-15. Smad4 RNAi and TGF-31 treatment .......................................... 90
Figure 2-16. Overall schematic diagram ...................................................... 96
110 Figure 3-1. Spectrum of the light source ....................................................
Figure 3-2. Irradiation schedule ............................................................ 111
113 Figure 3-3. Toluidine Blue staining for mast cells .
... .......................
Figure 3-4. Neutrophil infiltration after a single UVB irradiation .................. 119
Figure 3-5. Effect of the inhibitor on TGF-13 regulated genes after acute UVB irradiation
........ ... ............ . ........... ....... .. ... ...............
Figure 3-6. Effects of chronic UVB treatments on thickness of Skh-1 hairless mouse
Skin ................................................................ 123
Figure 3-7. Effects of chronic UVB treatments on the number of mast cells .......... 124
Figure 3-8. Resorcin-fuchsin staining for elastin fibers .
....................... 125
Figure 3-9. Effects of chronic UVB treatments on the protein levels ..... ......... 126
Figure 3-10. Effects of chronic UVB treatments on elastin and collagen protein levels
..................................................................................................... 127
10

Figure 3-11. Effects of chronic UVB treatments on total and active TGF-31 levels .. 129
Figure 3-12. Effects of chronic UVB treatments on TE mRNA levels .................. 132
Figure 3-13. Effects of chronic UVB treatments on collagen mRNA levels ........... 134
Figure 3-14. Effects of chronic UVB treatments on MMP mRNA levels ........... ... 136
Figure 3-15. Effect of chronic UVB treatments on PAI-I and fibronectin mRNA levels
.......... .............................. ..
.... .... ......... ....... 137....
11

Table 1-1. Features of chronological and photoaged skin .................................. 27
Table 3-1. Inhibitor (SB-505124) level in the mouse plasma ................... .......... 121
12

Chapter 1
13

1.1. Motivations and Thesis Objectives
Photoaging is a premature skin aging caused by repeated UV exposure. Overwhelming epidemiologic and laboratory evidence indicates that sun exposure and other sources of
UV radiation (UVR) play the major role in causing the undesirable skin changes of fine and coarse wrinkles, roughness, laxity, mottled pigmentation, actinic lentigines, actinic keratoses, leathery texture/coarseness, and telangiectasia in photoaging. Cigarette smoking is the only other environmental factor that has been related to the development of changes in the skin associated with aging.
In this era of a longer average human life span than ever before with the unprecedented prosperity and the beauty-oriented culture, the economic implications of photoaging are evident with $14 billion per year spent in the United States on cosmetics specifically intended to conceal the changes of photoaging. Also, a significant amount of money is spent on aesthetic surgical procedures attempting to reverse the changes of photoaging. Photoaging is a real medical problem, not just a cosmetic or aesthetic concern, because prevention of photoaging may prevent the progression of changes toward skin cancer, the most common form of cancer in the United States.
The goal of this thesis study is to understand the role of TGF-P in skin photoaging.
Solar elastosis, the accumulation of abnormal elastin-rich material in the dermal extracelluar matrix, is a major hallmark of photoaging. Elastin production occurs via tropoelastin (TE) precursors. TGF-P is a multifunctional cytokine involved in the regulation of extracelluar matrix, and is known to be up-regulated by UVR. Involvement of reactive oxygen species (ROS) in the development of solar elastosis has been demonstrated by studies in which antioxidants and anti-inflammatory agents suppress photoaging in the mouse skin in vivo. Therefore, we hypothesized that TGF-P is a major regulator in the photoaging processes, and the ROS produced by the TGF-[ are key components in the TE up-regulation in dermal fibroblasts.
In Chapter 1, the current understanding of the important concepts for this thesis is introduced: UVR and skin, photoaging, elastin, TGF-3, and ROS.
14

In Chapter 2, we tested the hypothesis that up-regulation of TE, the soluble precursor molecule of elastin, by TGF-p 1 is mediated by ROS using human dermal fibroblasts in vitro. Specifically, we tried to understand the time course of ROS involvement and the sources of ROS involved in the mechanism. Also, we investigated which TGF-3-induced signaling pathways are important in the mechanism and how ROS are involved in these pathways.
In Chapter 3, we tested the hypothesis that TGF-P mediates skin photoaging, especially, solar elastosis. Using the Skh-l hairless mouse model in vivo with a TGF-P type I receptor inhibitor, we tried to understand the role of TGF-P in the mechanism of photoaging. Specifically, we studied how the abrogation of TGF-P signaling processes affected morphological, histological, and biochemical changes induced by chronic UVB irradiation.
Finally, conclusions and future directions are presented in Chapter 4.
15

1.2.1. Structure of human skin
The skin is the largest organ of the human body (1,2).
It covers between 1.5 and 2 m
2 and comprises about one sixth of the total body weight.
It supports the body with connective tissues, serves as a barrier to the environment, and protects the body from water loss, external injuries, micro-organisms and ultraviolet radiation (UVR).
It also provides sensation, thermoregulation, and biochemical, metabolic and immune functions.
The skin consists of two basic tissue types (epithelium and connective tissues) arranged as two fundamental layers: an outer epidermis (epithelium) and an inner dermis
(connective tissue). These are separated by the basement membrane zone (Fig. 1-1).
The epidermis is approximately 40 -150 ~m in thickness except for the palms and soles.
Dermis is much thicker, 1.5- to 4-mm (3).
Epidermis
Dermis
Subcutaneous layer
Basal cell membrane
Basal cell
Squamous cell
Horny layer
Hair follicle
Dendritic cells
Melanocytes
Meissner"s corpuscules
Sebaceous glands
Arrector pill muscle
Blood vessels
Sweat glands
Free nerve endings
Lymphatic channels
Nerve fibres
Pacinian corpuscules
Figure 1-1. Structure of the skin. (not to scale, modified from http://skincancer.dermis.net
)
16

1.2.1.1. Epidermis
The epidermis is a keratinized, stratified squamous epithelium, mainly consisting of keratinocytes. It also contains melanocytes that produce the melanin providing UV protection, Langerhans cells that can process and introduce antigens, and Merkel cells that serve as sensory receptors. The epidermis has four layers: the stratum basale (basal layer), stratum spinosum (spinous or prickle cell layer), and stratum granulosum (granular layer), and stratum corneum (surface layer).
Basal cells form a single cell layer on an intact basement membrane. The basal layer includes stem cells, transient amplifying cells, and postmitotic cells. Stem cells exist within the bulge region of the hair follicles and within the basal layer of epidermis. The transient amplifying cells are the most common cells in the basal layer, and these cells give rise to the postmitotic cells after several cell divisions. The postmitotic cells undergo terminal differentiation, detaching from the basal lamina and migrating upwards into the cornified cells. As they migrate upward, keratinocytes flatten out and there is progressive synthesis of keratin proteins, which constitute part of the protective interface between the body and the environment (4).
1.2.1.2. Dermal-epidermal junction
The dermal-epidermal junction (DEJ) is a basement membrane zone that forms the interface between the epidermis and the dermis. DEJ provides adhesion and dynamic interface between them, thus determining the overall structural integrity of the skin. It serves as a support for the epidermis, determines the polarity of growth, directs the organization of the cytoskeleton in basal cells, provides developmental signals, and serves as a semipenetrable barrier (3).
The DEJ can be subdivided into three supramolecular networks: the hemidesmosome-anchoring filament complex, the basement membrane itself, and the anchoring fibrils. The hemidesmosome-anchoring filament complex binds basal keratinocytes to the basement membrane. The lamina lucida is the primary location of several noncollagenous glycoproteins (laminins, entactin/nidogen and fibronectin) which
17

bind to other matrix molecules or cells, and promote adhesion between the epidermal cells and the lamina densa. The lamina densa is mainly composed of type IV collagen. It functions as a barrier/filter that restricts passage of molecules with a molecular mass 2 40 kDa, but it allows the passage of migrating and invading cells under normal (i.e.
melanocytes and Langerhans cells) and pathological (i.e. lymphocytes and cancer cells) conditions. The anchoring fibrils penetrate into the deepest zone of the DEJ. In addition to the interstitial collagens (types I, II, V, and VI) and procollagens (type I and III), the first fibers of the elastic fiber system are present in this zone (3). The oxytalan fibers originate from the lamina densa and insert into the planar networks of elaunin elastic fibers organized at the junction between papillary and reticular dermis. The elastic fiber system will be described in detail in chapter 3.
1.2.1.3. Dermis
The dermis is an integrated system of fibrous, filamentous, amorphous connective tissue that accommodates nerve and vascular networks, epidermally derived appendages, fibroblasts, macrophages, mast cells, and other blood-borne cells, including lymphocytes, plasma cells, and other leukocytes (3).
The dermis is divided into two layers, the upper papillary dermis and the lower reticular dermis. The papillary dermis is characterized by small bundles of small-diameter collagen fibrils and oxytalan fibers. Mature elastic fibers are usually not found in normal papillary dermis but they are common in photoaged skin. The papillary dermis is rich in fibroblasts, macrophages and mast cells, and has numerous blood vessels that penetrate from the deeper layers. The reticular dermis is composed primarily of large-diameter collagen fibrils organized into large, interwoven fiber bundles. Mature, bandlike, branching elastic fibers form a superstructure around the collagen fiber bundles.
Extracellular matrix (ECM) of interstitial connective tissue is formed by complex and intricate networks in which protein molecules are precisely organized. Collagen is the most abundant structural component of ECM, and the dermis mainly consists of type I and type III collagens (-75% of dry weight), but also contains other types of collagen (V,
VII). The type I collagen fibers provide mechanical strength while type III collagen gives
18

flexibility to the tissues (5). Approximately 80 to 90 percent of the collagen is type I collagen and 8 to 12 percent is type III collagen (3). A characteristic property of collagen is to form highly organized triple-stranded polymers in which three polypeptide ac-chains are wound around one another in a superhelix with approximate dimensions of 1.5 x 300 nm (6). Collagen I and III are rich in proline, hydroxyproline and glycine and have classical Gly-X-Y triplets in their triple helical domains. Type I procollagen is a heterotrimer of two ca (I) and one cc2(I) chains. Type III procollagen is a monotrimer of three cl (III) chains. Collagens are synthesized as procollagens and after secretion into the extracellular space, procollagen molecules are converted to collagen by proteolysis, which removes the extension peptides on the molecule. Then, the collagen molecules are cross-linked by lysyl oxidase and associate with other extracellular matrix proteins such as leucine-rich small proteoglycans, to form regularly arranged fibrillar structures. This process, called fibrillogenesis, results in formation of collagen bundles that are responsible for the strength and resiliency of the skin (7).
The elastic fibers (2-4% of dry weight) are found throughout the dermis between the collagen bundles (1, 4). The elastic fiber is a complex structure containing elastin, microfibrillar proteins, and proteoglycans. Elastin is the predominant protein of mature elastic fibers and endows the fiber with the characteristic property of elastic recoil.
Elastin is rich in glycine, proline, hydrophobic amino acids, as well as alanine-rich, lysine-containing domains that form crosslinks (8). See Chapter 4 for the details.
Proteoglycans (PGs) and glycosaminoglycans (GAGs) are the molecules of the
"ground substances" that surrounds and embeds the fibrous components. They can account for up to 0.2 percent dry weight of the dermis. PGs are unusually large molecules
(100 to 2500 kDa) consisting of a core protein that is specific for the molecule and the covalently linked linear carbohydrate chains known as GAGs (9). The PGs and GAGs can bind up to 1000 times their own volume and thus regulate the water-binding capabilities of the dermis and influence dermal volume and compressibility (1, 3).
Fibronectin (in the dermal matrix), laminin (restricted to basement membrane), thrombospondin, vitronectin, and tenascin are glycoproteins found in the dermis and, like the PGs/GAGs, they interact with other matrix components and with cells through
19

specific integrin receptors (3). Fibronectin is an insoluble, filamentous glycoprotein synthesized in the skin by both epithelial and mesenchymal cells.
The fibroblast is a mesenchymally derived cell that migrates through the tissue and is responsible for the synthesis and degradation of connective tissue proteins and a number of soluble factors. Fibroblasts become highly proliferative in wound healing and during formation of hypertropic scars.
1.2.2. Ultraviolet radiation
Human skin is exposed daily to ultraviolet radiation (UVR) from sun, occupational light sources, and in case of some patients, phototherapy systems. The UVR is a part of the spectrum of electromagnetic radiation, which includes very short-wavelength radiations such as X rays (0.1-10 nm) and gamma rays (< 0.1 nm), and very long wavelength radiation such as microwave radiation (>106 nm). UVR is a spectrum of light wavelengths ranging from 200 to 400nm (10). Ultraviolet C (UVC, 200-290 nm) does not reach the earth's surface because it is absorbed by the ozone layer in the stratosphere.
Ultraviolet B (UVB, 290-320 nm) is the most erythemogenic sunburn-causing wavelength band reaching the earth's surface. Ultraviolet A (UVA, 320-400 nm) is approximately 1000 times less erythemogenic than UVB, but it reaches the earth in a quantity about 100-fold greater than UVB (10). In contrast to UVB irradiation which is mainly absorbed by the epidermis, UVA irradiation penetrates into the dermis, making the fibroblast an accessible target even in the deep dermis. Transmission also depends on the thickness of the stratum corneum, its state of hydration, and the pigmentation of the epidermis (11).
UVB range wavelengths are mostly absorbed by nucleic acids, proteins, melanin, urocanic acid, and other components of epidermal cells, which, along with scattering, accounts for the low penetration of these wavelengths into skin (12). In cellular proteins tryptophan and tyrosine are the main amino acids that absorb UVB. In dermal collagen and elastin the cross-linking amino acids (e.g. desmosine and isodesmosine) absorb at about 290 nm. Other biomolecules that absorb in the UVB range are NADH, quinones, flavins, prophyrins, 7-dehydrocholesterol, and urocanic acid. Among the UVB-absorbing
20

molecules in the skin, photodamage and repair of DNA has been studied intensively and is linked to most effects of UVB on cells and tissues (13). UVA-induced responses in cells are thought to be induced mainly by oxidative processes initiated by endogenous photosensitizations (13). Another skin-specific chromophore with a broad absorption spectrum is melanin. Although highly abundant, its chemical structure and biological functions are still not fully understood. Although melanin is generally believed to be photoprotective, its irradiation leads to the formation of free radicals and has been linked to photodamage (14).
1.2.3. Acute effects of UVR
Sunburn (erythema) and suntan (pigmentation) are major responses of normal human skin exposed to a single dose of UVR (15). Other acute responses include increases in the thickness of the epidermis, vitamin D synthesis, and immunologic alterations.
1.2.3.1. Sunburn (UV-induced inflammation)
Sunburn is associated with the classical signs of inflammation. Erythema (redness) results from vasodilation. Other features include heat from increased blood flow, swelling because of vasopermeability with exudation of plasma and cells, and pain and pruritus due to the effects of chemical mediators on nerve endings (15).
Erythema is UVR dose-dependent. The most commonly used biological dose unit in photobiology is the minimal erythemal dose (MED). An MED is the lowest UVR dose required to produce either a just perceptible erythema on exposed skin of a given individual after 24 h or an erythema with sharp margins after 24 h. The erythema that occurs after UVB exposure is delayed in onset and appears in 3-5 h, reaches a maximum intensity between 12 and 24 h, and fades over 72 h (16). Human skin exposed to 3 MED in a single exposure showed apoptotic keratinocytes (sunburn cells) as early as 30 min after exposure, most prominent at 24 h (16). Dermal neutrophils appeared as early as 3 h after UVB exposure, reached peak levels at 14-24 h, and decreased up to 48 h (17).
21

Mononuclear cells that consisted of macrophages but not T-lymphocytes gradually increased after irradiation up to 48 h (17).
UVB induces photoproducts in DNA between adjacent pyrimidine bases on one strand of DNA. Two types of photoproducts are preferentially created, namely cyclobutylpyrimidine dimers (usually referred to as thymine dimers) and (6-4) photoproducts (13). Figure 1-2 shows that the action spectra for erythema for thymine dimers and for erythema in the same pool of volunteers are very similar, providing strong but indirect evidence that DNA is a major chromophore for erythema (18).
1.0
0.0w
*0
0
0
0)
-J
*1.0-
-2.0
-
MEDjp
-/- Upper epidermis
-6- Mid epidermis
\ .
-asal ayer (8+)
-E
~S;B1 a~g
-3.0
270
] ] [I I
290 310 330 350 370
Wavelength (nm)
Figure 1-2. Action spectra for erythema and epidermal DNA photodamage (thymine
dimers). Comparison in the same group of 40 skin-type I/II volunteers (18).
Elevated levels of vasodilators, such as histamine, serotonin, tumor necrosis factor
(TNF), and prostaglandin D
2
(PGD
2
), PGI
2 and PGE
2 were detected in experimental blister fluid aspirates after UVB irradiation. Serum level of proinflammatory cytokines, such as interleukin-1 (IL-1) and IL-6 were also elevated (reviewed in (15)).
22

1.2.3.2. Pigmentation
The pigmentary response occurs in immediate and delayed phases that have different action spectra (15). UVR exposure induces an increase in epidermal melanin pigmentation ("tanning") by activation of cutaneous melanocytes. Immediate pigment darkening (IPD) begins during UV irradiation, is maximal immediately afterward, fades within hours after exposure to small doses, and can be caused by UVA as well as by the visible light. Delayed tanning (suntan) becomes visible after 72 h, and its main function appears to be photoprotection. The action spectrum for tanning is broadly similar to that for erythema, however, for the UVB wavelengths, UVR effectiveness is greater for erythema than tanning in fair-skinned individuals (19). Delayed tanning is associated with increases in the number of melanocytes, the number of melanosomes synthesized, the degree of melanization, and the number of melanosomes transferred to keratinocytes
(20).
1.2.4. Chronic effects of UVR
Chronic photodamage is primarily manifest in two distinct ways: cutaneous malignancies
(skin cancer) and photoaging. Both are complex chronic processes with intermediate steps, and, for skin cancer, precursor lesions.
1.2.4.1. Cutaneous malignancies
The incidence and mortality rates of skin cancers have dramatically increased over the past decades. Ultraviolet radiation from sun exposure is the most important cause of nonmelanoma skin cancer. Sunburns and excessive exposure cause cumulative damage that induces immunosuppression and skin cancers. Ozone depletion, latitude, altitude and weather conditions influence the amount and the spectrum of UV radiation reaching the earth's surface (21). Cutaneous malignancies related to chronic UV exposure are the nonmelanoma skin cancers, which include basal cell carcinomas and squamous cell
23

carcinomas. Malignant melanoma is related to both chronic and wevere acute UV exposures. Non-melanoma skin cancers are the most common cutaneous malignancies and together the most common form of human cancer (10). These tumors represent neoplasms of the keratinocytes that arise on the background of sun-damaged skin.
The blockage of RNA transcription that occurs as a result of the formation of
DNA photoproducts leads to the activation of the p53 protein, which interferes with apoptosis (13). In the surviving cells, the primary response to photodamage of DNA is repair of the photolesions. Failing DNA repair mechanisms might lead to mutagenesis resulting mainly in C to T substitutions characteristic for UV. When such mutations occur in the p53 gene, keratinocytes lose their ability to undergo cell death upon high dose
UVR exposure. Clonal expansion of these p53 mutated cells gives rise to actinic keratosis, a precursor of squamous cell carcinomas, and ultimately leads to basal cell carcinomas and squamous cell carcinoma (13).
The incidence of melanoma is growing faster than that of any other cancer and, therefore, poses a major health threat worldwide. Melanoma is a lethal neoplasm that either arises de novo or in association with pre-existing nevi (22). The frequency of melanomas in the continuously sun-exposed areas such as face is relatively high in old patients, although it appears to be low on the other exposed sites such as forearm and hands. Although the underlying factors for the increased incidence of melanoma are poorly understood, the increased total exposure to UVR is strongly implicated (22).
1.2.4.2. Photoaging
Photoaging is premature skin aging caused by repeated exposure to UVR. The photoaged phenotype is characterized by fine and coarse wrinkles, mottled pigmentation, sallow color, dilated blood vessels, epidermal lesions, and rough textures on habitually sunexposed skin. The current understanding of photoaging will be discussed in detail in
Chapter 1.3.
24

1.3. Photoaging
1.3.1. Chronological aging vs. photoaging
Cutaneous aging consists of two components, chronological aging and photoaging.
Chronological aging, also known as innate or intrinsic aging, affects the skin in a manner similar to other organs (23). Photoaging, also known as actinic damage, is premature skin aging caused by repeated exposure to UVR. While the consequences of chronological aging can be evaluated in areas protected from sun, sun exposed areas like the face and the backside of the hands reveal the overall damage from the innate and the extrinsic aging process.
Clinically, photoaging comprises two distinct types: the type of Milian's citrine skin and the atrophic, teleangiectatic phenotype (24). The first phenotype is characterized by deep wrinkles, laxity, a leathery appearance, increased fragility, blister formation and impaired wound healing. By contrast, chronologically aged skin appears thin, smooth, unblemished with sagging and fine wrinkling, and reduced elasticity and recoil in sunprotected areas (25, 26). On the back of the neck, furrows are arranged in a typical rhomboidal pattern called cutis rhomboidalis nuchae. The Favre Racouchot syndrome belongs to this first type of photoaging and is characterized by deep furrowing, nodular elastotic plaques on the periorbital and malar skin in combination with enlarged pilosebaceous orifices, comedones and keratinous cysts. The atrophic variant of photoaged skin reveals marked teleangiectasia, and the degree of wrinkle formation is rather limited.
At the histological level, photoaged skin is characterized by a loss of mature dermal collagen, a distinct basophilic hematolxylin-staining appearance of collagen
('basophilic degeneration'). Also, collagen type VII containing anchoring fibrils which contribute to the stabilization of the epidermal-dermal junction are severely reduced in photoaged skin. There is an increase in deposition of glycosaminoglycans and dystrophic elastotic material in the deep dermis which reveal immunohistochemical and immunopositive staining for severely disorganized tropoelastin and its associated microfibrillar component fibrillin (27). By contrast, using immunostaining and confocal
25

microscopy the microfibrillar component fibrillin appeared significantly truncated and depleted in the upper dermis at the dermal-epidermal junction of photoaged skin (28). By contrast, chronologically aged skin shows general atrophy of the extracellular matrix with decreased elastin, and decreased thickness in the fibrils of interstitial collagen. This impairment is thought to result from both decreased protein synthesis that particularly affects type I and III collagens in the dermis and increased breakdown of extracellular matrix protein (7).
Apart from changes in the organization of the structural components of the connective tissue, also the resident fibroblasts of the dermal connective tissue reveal characteristic features in the photoaged skin. The fibroblasts adopt a stellate phenotype and at the ultrastrucutural level reveal a highly activated rough endoplasmic reticulum indicating an increased biosynthetic activity (23). Furthermore, an increase in mast cells, mononuclear cells and neutrophils have been reported in murine photoaged skin, while hypocellularity is the rule in chronologically aged skin.
The severity of photoaging is proportional to accumulated sun exposure and inversely related to degree of skin pigmentation. Individuals with fair skin are more susceptible to solar UV-induced skin damage than darker-skinned individuals (7).
Table 1-1 summarizes the comparison between the features of chronologically aged skin and the photoaged skin.
26

I
Clinical appearance
Smooth, unblemished Nodular, leathery, blotchy
Loss of elasticity Deep Wringling
Epidermis
Thickness Thinner than normal Hyperplasia in early stages,
Atrophy in end-stages
Proliferative rate
Basal keratinocytes
Keratinization
Stratum Corneum
Lower than normal
Modest cellular irregularity
Unchanged
Normal thickness
Higher than normal
Marked heterogeneity,
Numerous dyskeratoses
Unchanged heterogeneity
Dermal-epidermal junction Loss of rete pegs, flat
Modest reduplication of lamina densa
Loss of rete pegs, flat
Extensive reduplication of laminar densa
Dermis
Grenz zone
Elastin
Absent
Elastogenesis, followed by elastolysis
Prominent
Marked elastogenesis followed by massive degeneration - dense accumulations in fibers
Modest change in bundle Collagen Modest change in bundle size
Microvasculature size and organization
Normal architecture Abnormal deposition of basement membrane-like
Inflammatory cells No evidence of inflammation material
Perivenular, histiocyticlymphocytic infiltrate
Table 1-1. Features of chronological and photoaged skin (26).
27

1.3.2. Epidermal changes in photoaged skin
Epidermal changes involve thinning of stratum spinosum and flattening of the dermoepidermal junction. The senescent keratinocytes become resistant to apoptosis and may survive for a long time giving time for DNA and protein damage to accumulate with possible implication for carcinogenesis. The numbers of melanocytes decrease with age with dysregulation of melanocyte density resulting in freckles, lentigines and nevi (29).
The number of dendritic Langerhans cells also decreases with photoaging and the cells get less dendrites and have reduced antigen-trapping capacity.
1.3.3. Dermal changes in photoaged skin
Many of the changes responsible for the obvious signs of photoaging reside in the dermal connective tissue. Major alterations include extensive collagen turnover, increased elastin content with an amorphous appearance, increased level of ground substances which are made up of proteoglycans (PGs) and glycosaminoglycans (GAGs), dilated vasculature and the recruitment of various inflammatory cells (30).
1.3.3.1. Changes in collagen
As the major structural protein of the skin, collagen has been central to an understanding of the mechanisms involved in photoaging. Total amount of collagen in photoaged skin shows slight decrease or no change, but collagen fibrils become highly disorganized.
Regulation of procollagen expression is complex, but evidence suggests that transcriptional control is involved as its major mechanism (31). There are two important regulators of collagen production: transforming growth factor (TGF-P) and activator protein- 1 (AP- 1).
TGF-3 is a multifunctional cytokine that positively regulates type I and III procollagen production. See chapter 4 for the detailed information on TGF-3/Smad signaling pathway. TGF-,3 not only stimulates collagen synthesis but also prevents its loss by inhibiting the enzymes involved in the breakdown of collagen. Thus, TGF-3/Smad
28

signaling results in a net increase in procollagen production. UV irradiation has been shown to impair the TGF-P signaling pathway by reducing TGF-P type II receptor
(T3RII) expression and, to a lesser extent, increasing Smad7 (32). Thus, UV irradiation causes an impairment of the initial step of the TGF-P/Smad signaling cascade. This inhibition may also contribute to UV reduction of type I collagen synthesis.
AP- 1 is a transcription factor that figures importantly in the inflammation response
(31). AP- 1 is a dimeric complex of the proto-oncoproteins jun and fos that is induced by growth factors, cytokines, tumor promoters, and UVR. Unlike TGF-p that positively regulates procollagen gene transcription, AP- 1 inhibits it. This inhibitory action of AP- 1 seems to result from physically preventing Smad 2, 3, 4 transcription factor complex from binding to the procollagen promoter or from directly binding to a negative regulatory sequence of the collagen gene promoter (31). Voorhees and coworkers have proposed that UV irradiation triggers an increase of growth factor and cytokine receptor synthesis in fibroblasts and keratinocytes. This increased receptor synthesis, in turn, leads to an activation of the transcription factor AP-1 (33, 34) through a mitogen-activated protein kinase (MAP kinase) signaling cascade, an increase in the expression of genes encoding several collagen-degrading matrix metalloproteinases (33), and a decreased expression of the genes encoding type I and III procollagen.
Most of the studies in support of this hypothesis, however, have been conducted using UV-irradiated sun-protected skin. The relationship between chronic sun exposure of skin and a short-term UV exposure of sun-protected skin is unclear.
1.3.3.2. Changes in elastin
Elastic fibers in the extracellular matrix are an integral component of dermal connective tissue. The resilience and elasticity required for normal structure and function of the skin may be attributed to the network of elastic tissue. Chronically sun-damaged human skin is characterized by dermal connective tissue damage that includes the massive accumulation of abnormal elastic fibers with a clearly altered morphology in the superficial dermis of sun-exposed skin, called solar elastosis (Fig. 1-3). The content of
29

elastin, the major protein component of elastic fibers, is increased two to six fold in sundamaged skin (35).
Figure 1-3. Solar elastosis in human skin.
Non-sunexposed skin shows normal thin, fme elastic fibers, whereas chronically sun-exposed skin shows extensive deposition of elastic fibers in dermis. Verhoeff- van Gieson staining.
Several reports have demonstrated that elastic fibers deposited during so 1ar elastosis consist of the same components as normal elastic fibers, and these include elastin (the insoluble and crosslinked protein that makes up the amorphous component of elastic fibers) and fibrillin, the major microfibrillar component of elastic fibers. In response to UV A and/or UVB radiation, keratinocytes secrete many mediators that could stimulate fibroblast synthetic activity, and some of them, e.g., TGF-J3, interleukin (IL)-
IJ3, and IL-IO, have been shown to increase the promoter activity of the elastin gene, steady-state mRNA levels, and elastin accumulation (36-38). Bernstein et aI.
have noted increased elastin mRNA and elastin promoter activity in photoaged skin (39, 40).
It was speculated that a post-transcriptional mechanism might lead to an increased translational efficiency responsible for elastin protein accumulation in response to UV irradiation in
30

the absence of increased mRNA levels (35). These results indicate that aberrant expression of genes encoding structural proteins of elastic fibers, as a consequence of UV exposure, could be the basis of solar elastosis. Indeed, several reports have demonstrated changes in steady-state mRNA levels not only of elastin but also of fibrillin (41).
Additional observations have also noted changes in the levels of elastic fiber proteins such as lysyl oxidase, the copper-dependent amine oxidase responsible for the catalysis of elastin crosslinking (42).
31

Elastin provides resiliency to a wide variety of connective tissue structures in concert with microfibrillar glycoproteins. The reticular dermis of the skin contains thick, horizontally arranged elastic fibers, whereas the papillary dermis contains a thinner superficial dermal plexus of elastic fibers, the elauDin network, which runs parallel to skin surface, and the oxytalan fibers, which are perpendicular to skin surface and intercalate into the dermal-epidermal junction (8, 43) (Fig. 1-4). This continuous elastic network imparts elasticity throughout the skin from the reticular and papillary dermis to the epidermis. Elastin is an extremely insoluble protein due to the extensive crosslinking at lysine residues. Tissues rich in elastin include aorta and major vascular vessels (28-
32% dry weight), lung (3-7%), elastic ligaments (50%), tendon (40/0) and skin (2-3%)
(44).
Figure 1-4. Immunohistochemial visualization of elastin in human skin (Verhoeff-
VanGieson stain, x 20). Arrow point elastic fibers.
32

1.4.1. Synthesis
The human elastin gene contains 34 exons (numbered from 1 to 33 and 36) encoding for alternating segments of hydrophobic domains that are rich in valine and alanine, and crosslinking domains that are characterized by the presence of lysyl residues separated by two or three alanine residues (45). Mammalian tropoelastin, the soluble precursor to elastin is a moderately conserved protein. Interactions between hydrophobic domains are important in assembly and essential for elasticity (46). A large amount of divergence is tolerated in the hydrophobic domains if the overall hydrophobicity is maintained. The crosslinking domains, however, are much more highly conserved (47).
Tropoelastin is secreted as an approximately 72 kDa protein in the human (48).
Expression of tropoelastin mRNA and elastic fiber synthesis is highest in early development and any damaged elastin is either not replaced or replaced with nonfunctional fibers (49). Elastin turnover is extremely slow with a half-life approaching the age of organism, and unlike other fibrous matrix proteins such as the collagens, elastin does not appear to undergo extensive, post-developmental remodeling (50).
A strong correlation exists between tropoelastin mRNA levels and the protein synthesis indicating elastin synthesis is mainly under pre-translational control with both pre-and post-transcriptional control mechanisms described (51). Various growth factors and hormones have been shown to affect tropoelastin synthesis either at the promoter level or at the post-transcriptional level by affecting the stability of tropoelastin mRNA.
TNF-oc decreases elastin mRNA abundance primarily by suppressing promoter activity
(52). TGF-3 has been shown to up-regulate elastin gene expression in human skin fibroblasts, and the evidence from transient transfection with elastin promoter and the reporter gene constructs suggests that this up-regulation is, at least in part, posttranscriptional (36). In fact, assay of elastin mRNA half-life suggests that TGF-3 stabilizes the elastin mRNA, leading to elevated steady-state levels. Subcutaneous injection of TGF-p in transgenic mice expressing the human elastin promoter enhanced the promoter activity in a time-dependent manner up to 10-fold (53). Vitamin D
3 also modulates elastin gene expression. Specifically, incubation of fibroblasts with vitamin D
3
33

results in an 80 to 90 percent decrease in total accumulation of tropoelastin accompanied by a parallel decrease in steady state levels of the corresponding mRNA (54). Insulin-like growth factor (IGF)-l (55,56) and IL-l~ (37) have been shown to enhance elastin gene expression at the transcriptional level.
1.4.2. Integration into elastic fibers
Fibrlllin assembly at cell surface
~
••
~~~--
.................
TRANSGLUT AMINASEr •
\
•••• ECM MOLECULES .,.............••
Microfibril (MF) maturation
.......
.. • INTER-MICROFIBRIL ••
•• CROSS LINKS
.........•.....
.-
Microfibril bundles
MF
...............
•• ASSOCIATION WITH •••
-•• IROPOELASTIN (T~ •••
............
Elastic fibres
Figure 1-5. Elastic fiber formation.
Fibrillin is assembled pericellularly into microfibrillar arrays that appear to undergo time-dependent maturation into beaded trans glutaminase-crosslinked microfibrils. Mature microfibrils form parallel bundles that may be stabilized at inter-microfibrillar crosslinked regions. In elastic tissues, tropoelastin is deposited on microfibril bundles, and lysyl oxidase-derived crosslinks then stabilise the elastin core (8). TE: tropoelastin, MF: microfibril.
Genesis of elastic fibers in early development involves deposition of tropoelastin on a preformed template of fibrillin-rich microfibrils (8). Thus mature elastic fibers are composed of outer microfibrillar mantle and an amorphous inner core of laterally packed,
34

thin ordered filaments, elastin (Fig. 1-5). The largest of the microfibrillar proteins and, quantitatively, perhaps the most important ones, are the fibrillins (FBN1 and FBN2), 350 kDa glycoproteins that form an integral part of the microfibril structure (45). These proteins contain multiple repeats of a sequence motif previously observed in epidermal growth factor (EGF) precursor molecule, each motif having six conserved cysteines.
Several members of latent TGF-P-binding protein (LTBP) family have been cloned and shown to contain repeating domains similar to those found in FBN1 and
FBN2. Immunohistologic studies have localized both LTBP1 and LTBP2 to microfibrils in elastic fibers, strongly suggesting that one or more of LTBPs may be a component of these fibrils (57). Furthermore, levels of LTBP1 are altered in a number of pathologic conditions, including solar elastosis and actinic keratosis (58).
I
Tetrafunctional lysyl-derived crosslinks (elastin)
P -CH
2
-CH
2
-
-CH
2
-CH
2
-CH
2
-P'
/
-CH
2
-CH
2
-P"
P -CH-CH
2
-CH
2
-P
I
+ /-CH
2
-CH
2
-CH
2
-P"
N
(H
2
-CH
2
-CH
2
-CH
2
-PIII
ISODESMOSINE
DESMOSINE
N
6H
2
-CH
2
-CH
2
-CH
2
-P"'
_
Figure 1-6. Desmosine and isodesmosine formation by the actions of lysyl oxidase.
Lysyl oxidase catalyses the oxidative deamination of certain lysine residues in elastin and subsequent, probably spontaneous, reactions lead to the formation of bifunctional crosslinks (dehydrolysinonorleucine and allysine aldol), a trifunctional crosslink
(dehydromerodesmosine), and two tetrafunctional crosslinks (desmosine and isodesmosine, shown here) (8).
Fibulins (FBLNs) are a family of extracellular matrix glycoproteins that contain tandem EGF-like repeats similar to fibrillins and LTBPs (45). Fibulins 1, 2, and 5 are located within the elastic fibers. Specifically, FBLN1 resides within the elastin core in the skin, and FBLN2 is located at the interface between the FBN1 microfibrils and the elastic
35

core, while FBLN5 binds both smooth muscle cells and elastin, thus facilitating the cellmatrix interactions (45).
Deposition of tropoelastin into the extracellular matrix occurs only at specific regions on the cell surface and tropoelastin is rapidly insolubilized by cross-link formation without any further modifications or proteolytic processing (59). The initial reaction is an oxidative deamination of Lys residues by the enzyme lysyl oxidase to produce allysine, also known as cc-amino adipic 6-semialdehyde. All subsequent reactions are spontaneous and involve the condensation of closely positioned Lys and allysine residues to produce cross-links such as allysine aldol, lysinonorleucine, merodesmosine and tetrafunctional cross-links unique to elastin, such as desmosine and isodesmosine (60) (Fig. 1-6).
1.4.3. Pathology of the elastic fibers
Destruction or injury to the elastic tissue architecture of the lung and skin often fails to result in an orderly, new deposition of elastic fibers (50). These changes of elastic fibers are observed in several diseases, such as aortic aneurysms, lung emphysema, atherosclerosis, and photoaged skin. For example, in pulmonary emphysema, both elastin degradation and synthesis are active, but the structure and the function of newly synthesized elastin are abonormal (61).
Elastin gene mutations cause Williams syndrome, supravavular stenosis (SVAS) and cutis laxa. SVAS is narrowing of arteries and disrupted architecture of the aorta (62).
Cutis laxa, in its most severe, prenatal form, results in the near absence of detectable elastic fibers in the skin and the internal organs, leading to very early demise of these patients (63). Skin fibroblasts from these patients produce undetectable level of tropoelastin protein and mRNA, which can be increased by TGF-P 1 (64). TGF- 1 does not change the transcription rate, but increases the elastin mRNA stability more than 10 fold in these fibroblasts (64). Cutis laxa also exists in so-called 'acquisita' forms, in which loss of cutaneous elastic fibers can be very dramatic as a result of localized or generalized inflammatory events. Excessive, distorted and frequently calcified elastic fibers are typical of the pathology of pseudoxanthoma elasticum, an autosomal dominant
36

disease which affects most particularly the cutaneous areas of highest flexion and extension such as axilla, and produces internal pathology through calcification of an elastic structure in the eye, Bruch's membrane, and blood vessels (65). Specific overaccumulation of elastin is also noted in the cutaneous, autosomal dominant disorder,
Buschke-Ollendorff syndrome (BOS), in which papules containing dense collections of elastic fibers are found on the extremities (66). Cultured fibroblasts from these patients produce 2-8 times more tropoelastin than normal skin fibroblasts and tropoelastin mRNA levels are also elevated (50).
Fibrillin-1 mutations result in Marfan syndrome, which is associated with cardiovascular, ocular and skeletal defects. Fibrillin-2 mutations cause congenital contractural arachnodactyly (CCA) with overlapping skeletal and ocular symptoms.
37

UV radiation stimulates and activates various cells to produce and release cytokines that may play a significant role in the process of photoaging (67). Numerous studies have suggested that cytokines such as TGF-cc, TGF-, PDGF, IL-1, IL-6, and TNF-a are likely to control both the connective tissue formation and remodeling phases of dermal fibrotic repair (67). In particular, TGF-P increases synthesis and secretion of a wide variety of matrix proteins, decreases degradation of matrix proteins both by decreasing protease synthesis (MMP-1 and MMP-3) and increasing the synthesis of protease inhibitors
(TIMP-1), and also increases synthesis of integrin receptors, thereby enhancing the ability of the cells to interact with matrix (68, 69). Synthesis of TE by dermal fibroblasts in
Studies from our group using dermal fibroblasts grown in contracted collagen gels, which more closely simulate the environment of dermal fibroblasts in vivo, showed that TGF-3 1 had no effect (70). A role for TGF-P in development of solar elastosis is also supported by the observations that
UVB irradiation up-regulates TGF-3 protein levels by keratinocytes both in active and latent forms (71), and induces TGF-3 mRNA in murine skin (72) as well as in keratinocytes in vitro (73). Also, it was demonstrated that TGF-P up-regulates human elastin promoter activity in transgenic mice (74). TGF-P, latent TGF-3 binding protein-i and elastic fibers co-localize in human skin and their levels correlate with solar elastosis
(58).
TGF-P is a multi-functional cytokine which regulates many biological functions, such as cellular growth and differentiation, extracellular matrix synthesis, inflammatory responses, angiogenesis, and immune functions (75, 76). TGF-P belongs to a superfamily of structurally related regulatory proteins that include five isoforms of TGF-p, three of which, TGF-P 1, -2, and -3 are expressed in mammals, activin/inhibins, bone morphogenetic proteins, and other related morphogenetic proteins (77, 78). The three mammalian isoforms of TGF-,3, although encoded by unique genes and differentially
38

regulated (79), have highly conserved structural features. The mature processed proteins share 70-80% amino acid sequence identity, bind to the same receptors, induce similar responses, and for the most part are interchangeable (77, 79).
TGF-3 1 is the most abundant isoform in most tissues, and the predominant isoform secreted by wound fibroblasts and macrophages (80). The TGF-Ps and their receptors are ubiquitously expressed in normal tissue and most cell lines (78, 81, 82).
Their cellular effects are dependent on cell type and cellular context. For example, TGF-P stimulates proliferation of fibroblasts in connective tissue and inhibits growth of epithelial cells (83).
1.5.1. Synthesis of TGF-P
The isoforms of TGF-3 are encoded as large precursor proteins that are 290-412 amino acids in size. TGF-3 proteins undergo a number of processing steps intracellularly prior to their secretion by a cell. The most important processing step appears to be the proteolytic digestion of the precursor by the endopeptidase furin, which cleaves the TGF-
3 protein between amino acids 278-279 (84). The proteolysis yields two products that assemble into dimers. The 65-75 kDa dimer protein from the N-terminal region is called the latency-associated peptide (LAP), while the second 25 kDa dimer from the C-terminal portion of the precursor is called the mature TGF-P. These two dimers remains noncovalently associated, and this is called small latent complex (SLC). Mature TGF- is produced constitutively by most tissues and cells in a latent form, unable to associate with
TGF-3 signaling receptors. The presence of the LAP protein facilitates transit of TGF-p from the cell (85) and makes the TGF-[ biologically inactive. The structure of TGF- 1
L,AP (LAP-) is most extensively described (84). There are 3 cysteines in each LAP-1 where the cysteines in positions 223 and 225 are important for dimerization of the LAP monomers by interchain disulfide bonds. When serines are substituted for cysteines in positions 223 and 225 of the LAP-1, the TGF- 1 is secreted in an active form suggesting that these cysteines are important for the association of LAP-1 with TGF-P 1.
39

lAP'
~
(IJ lAP " TGF~
I bopcpdde Bood
\t
8-Cys (CR) domain
J ea 1
+ binding EGt'-UIa: domain
I
Disulfide 8000
Noo.ai2 .. binding EOf.lila: domlin • RGO Scqurocc U)brld domain
Figure 1-7. TGF-8 large latent complex (LLC).
The LLC comprises TGF-B (black),
LAP (dark grey) and LTBP. TGF-B and LAP are proteolytically separated at the site indicated by the arrowhead. After processing, TGF-B remains noncovalently associated with LAP. LAP and LTBP are joined by disulfide bonds (light grey lines). The LLC is covalently linked to the extracellular matrix (ECM) through an isopeptide bond (thick light grey) between the N-terminus ofLTBP (somewhere between EGF2 and the hinge domain) and a currently unidentified matrix protein. The hinge domain (arrow) of LTBP is a protease-sensitive region that allows LLC to be proteolytically released from the
ECM (86).
The third cysteine is in position 33 and is involved in binding to another protein called the latent TGF-p-binding protein (LTBP) (84). When SLC is associated with an
LTBP protein it is called the large latent complex (LLC) (Fig. 1-7). The LTBPs are characterized by repetitive 15-19 epidermal growth factor (EGF)-like repeats and a number of cysteine residues (78, 84). The LTBPs share homology with fibrillins 1 and 2 which are major constituents of connective tissue microfibrillar structure, suggesting that the LTBPs may also be important as part of the structural proteins of extracellular matrix composition in tissues.
An additional role of LTBP is that by associating with latent TGFp in the Golgi apparatus they facilitate rapid secretion of the small latent TGF -p (87).
However, the most commonly described function of LTBP is to localize latent TGF-p to
40

the extracellular matrix. LTBP bound to latent TGF-3 and to the extracellular matrix serves as a reservoir of TGF-P (57). The major fraction of secreted LTBPs does not contain TGF-P (87). LTBPs thus seem to possess separate roles in vivo as structural components of the ECM and as TGF-3 targeting molecules.
There are many sources of TGF-3 in the human skin, including keratinocytes, fibroblasts, mast cells, macrophages and neutrophils. TGF-p1 protein is constitutively expressed in keratinocytes (88). UVB can induce keratinocytes to produce increased amount of TGF-3 both in latent and active forms (71). It was proposed that TGF-P I1 molecules from epidermis can be transferred to the underlying dermis (89). Alternatively, various inflammatory cells or fibroblasts in dermis could actively produce TGF-P molecules. Histological features of photoaged skin include increases in the number of mast cells and inflammatory cells (90). It was suggested that products of mast cells are important in the development of solar elastosis in murine skin either by directly inducing elastin production by fibroblasts or indirectly by mediating the presence of other cell types that secrete products that increase fibroblast elastin production (91).
1.5.2. Regulation of TGF-P bioactivity
The regulation of TGF-3 function could occur at several levels, e.g., (i) synthesis of latent
TGF-3 produced by induction of transcription and translation, involving transcription factor-promoter interactions, (ii) message stability, (iii) release of latent TGF-P from extracellular matrix (ECM), (iv) activation of TGF-3 from its latent form, (v) TGF-3 signal transduction (79, 92). However, the extracellular concentration of TGF-3 activity is primarily regulated by the conversion of latent TGF-P to active TGF-P. Tissues contain significant quantities of latent TGF-p and activation of only a small fraction of this latent
TGF-3 generates maximal cellular responses (86).
Release of active TGF-[ from matrix-associated latent complexes may require two steps, the release of the complex from ECM by proteolysis and subsequent activation, which can be achieved by many different mechanisms. Release of LLC from the ECM involves the cleavage of LTBP- 1 at protease-sensitive sites (hinge region)
41

between the domains responsible for binding to ECM and to small latent TGF-[ (57).
LLC can be released from ECM by multiple proteinases of the serine protease family, including plasmin, mast cell chymase, and leukocyte elastase (93).
The activation of SLC of TGF-p involves the disruption of the non-covalent interaction between the LAP and TGF-[, enabling TGF-3 to bind its signaling receptors.
The LAP has to be either released from its association or undergo conformational change such that the LAP not released but exposed to the TGF-P receptor binding site (84). In vitro the LAP from all isoforms of latent TGF-P can be removed by extremes of pH, such as 2 or 8, heat such as 100°C, chaotropic agents and substances like SDS and urea (78,
84). In many TGF-[3 purification procedures, one or more of the listed conditions are used, and the purified TGF-p is thus frequently obtained in its active form. From the physiological point of view, the acidic environment in the bone (osteoclasts) or during wound healing could induce the activation of TGF-P. It was found that ionizing radiation caused an increase in active TGF-3 in the tumors (94). It was also observed that latent soluble TGF-3 complexes were activated by irradiation in vitro. Radiation produces reactive oxygen species leading to redox-mediated activation of latent TGF-3 complexes
(95). Redox-mediated TGF-[ activation may be involved in chronic tissue processes, in which oxidative stress is implicated, such as carcinogenesis and photoaging.
Also many physiological substances have been reported to activate latent TGF-P.
Some examples are the serine protease, plasmin, other proteases such as endoglycosidase
F, sialidase, neuraminidase, cathepsins B and D, calpain, and the glycoprotein, thrombospondin-1 (84, 93). Proteolysis targets the degradation of LAP propeptide and, thus the release of active TGF-3. Plasmin is derived from plasminogen by the enzymatic action of urokinase plasminogen activator (uPA) or tissue-type plasminogen activator
(tPA). Plasmin treatment of latent TGF-P 1 in vitro resulted in the activation of the complex (96). Plasmin-mediated TGF-3 activation is neutralized via feedback inihibition, since TGF-3 induces the production of plaminogen activator inhibitor-1 (PAI-I), which decreases the formation of active plasmin. Thrombospondin is a platelet cc-granule and a component of the extracellular matrix. Its expression is induced during wound healing.
Using purified plasma thrombospondin and the recombinant thrombospondin, it was
42

found that it can bring about activation of both SLC and LLC of TGF-3.
Thrombospondin-deficient mice display many phenotypic alterations, similar to those senen in TGF-3 1-deficient mice (97). Integrin avP3 is also able to activate TGF-3 (98).
The LAP part of TGF-3 contains an RGD-motif, which is recognized by integrin
OC3 6.
Integrin P6 chain deficient mice show increased inflammation and decreased fibrosis, which also overlaps with the phenotype of TGF-p 1-deficient mice (99).
Hormone or drug-induced activation of TGF-p was also reported. Antiestrogens, retinoids, vitamin D3 derivatives and glucocorticoids are some of the examples (93).
1.5.3. TGF-3 signaling pathways
Type I (53 kDa) and type II (70-80kDa) receptors, transmembrane serine-threonine kinases, participate in TGF-3 induced signaling. The type III receptor (300 kDa), also referred to as betaglycan, is a proteoglycan that probably does not directly mediate the biological activities of TGF-[ but may control the availability of TGF-P and facilitate its interaction with the signaling receptor complex (77). Each of the TGF-P isoforms interacts with all three receptor types (77).
TGF-[-induced biological responses are initiated by its binding to the constitutively active type II serine-threonine kinase receptor (T3RII), which then associates with and phosphorylates the type I receptor (T3RI). The activated ligandreceptor complex, in turn, activates one or more down stream signaling pathways. The most prominent pathway involves Smad proteins (Fig. 1-8) although non-Smad pathways are increasingly being shown to participate in various cell types (100). The TPRl-binding
R-Smads (Smad2 and Smad3) are phosphorylated by TPRI and subsequently form heterotrimers comoposed of two R-Smads and one Smad4, or heterodimers of Smad2 or
Smad3 with Smad4. Smad7 is an inhibitory Smad protein that prevents the phosphorylation of Smad2/3 by TpR1. The Smad2/3-Smad4 complex translocates to the nucleus where it binds to DNA directly or via other DNA-binding proteins to the promoters of TGF-3 responsive genes to stimulate or repress their transcription (83, 101).
Recent progress suggests that TGF-3 may also stimulate other downstream pathway,
43

involving RhoA, as well as the mitogen activated protein kinase (MAPK) kinases, extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinasese (JNKs), and p38
MAPKs (101). These non-Smad mediated signaling pathways have been shown to activate transcription factors that interact with Smad-mediated transcription as well as modulating Smad protein levels or activity (100,102,103).
TGF..pIAcllvln
TIlR~1
ActR"1
Srnad11518
Ac::..B"
SrnadZ/3 -'-t
V ~
~t
~R'"
--.e
I ~
.0.
1'-=~
~
BMP nucleus
Figure 1-8. TGF
-13 superfamily signaling through signal-transducing Smad and inhibitory Smad proteins. After type I receptor activation, R-Smads become phosphorylated, form homomeric complexes with each other, and assemble into heteromeric complexes with Co-Smad, Smad4. The heteromeric complexes translocate into the nucleus, where they regulate, in combination with other transcription factors, transcription of target genes. Inhibitory Smads act opposite from R-Smads by competing with them for interaction with activated type I receptors or by directly competing with R-
Smads for heteromeric complex formation with Co-Smad. Smad7 appears to be a general inhibitor ofTGF-p superfamily signaling whereas Smad6 preferentially inhibits BMPinduced responses (104).
44

1.5.4. Effects of TGF- on ECM regulation
1.5.4.1. Role of TGF-p in wound healing and fibrosis
Various cytokines, chemokines, and growth factors play important roles in ECM regulation. However, TGF-P is considered to be the most potent and ubiquitous prominent in pathological conditions such as wound healing and fibrotic diseases.
Irrespective of the affected tissue, the wound healing process follows a conserved sequence of events, including initiation and execution of (i) the coagulation cascade, (ii) an inflammatory response (associated with angiogenesis, formation of granulation tissue, and reepithelialization of denuded areas), and (iii) a fibroproliferative response (including proliferation of mesenchymal cells and increased synthesis of ECM) (92).
Normal wound healing is regulated by a complex set of interactions within a network of profibrotic and antifibrotic cytokines and secreted proteins. These proteins include profibrotic proteins TGF-P and connective tissue growth factor (CTGF) and the antifibrotic proteins tumor necrosis factor-a (TNF-a) and interferon-y (IFN-y). As TGF-3 induces fibroblasts to synthesize and contract ECM, this cytokine has long been believed to be a central mediator of the fibrotic response (106). CTGF is induced by TGF-P and is considered a downstream mediator of the effects of TGF-P on fibroblasts. Similarly,
TGF-P induces expression of the ED-A form of the matrix protein fibronectin (ED-A
FN), a variant of fibronectin that occurs through alternative splicing of the fibronectin transcript (107). This induction of ED-A FN is required for TGF-P 1-triggered enhancement of collagen type I expression (108).
TGF-3 causes matrix deposition in mesenchymal cells in culture by promoting expression of ECM genes and suppressing the activity of genes such as matrix metalloproteinases, which degrade ECM (109). It has been shown that Smad 3 is essential for the induction of matrix, as induction of profibrotic genes such as type I collagen and connective tissue growth factor (CTGF) is prevented in fibroblasts lacking the Smad3 gene (1 10). In mesangial cells, TGF-3 induction of type I collagen promoter also requires
45

the ras/MEK/ERK MAP kinase cascade but not the p38 MAP kinase cascade; conversely, in dermal fibroblasts this response requires p38 and not ras/MEK/ERK (1 1 1, 1 12).
Induction of fibronectin by TGF-[3 in fibroblasts is Smad independent, requiring the JNK
MAP kinase cascade and c-jun (1 13). Overall, these studies point to the potential complexity of the interplay among MAP kinase and Smad signaling pathways in the control of matrix expression.
In normal wound healing, a network of negative feedback mechanisms activated after successful healing is responsible for the proper termination of the proliferative and fibrotic processes, thus restoring tissue integrity. If these feedback mechanisms fail to operate, however, continuous ECM secretion and deposition will lead to perturbation of normal tissue architecture and the eventual development of tissue fibrosis. Alternatively, such fibrosis may also be due to repeated injuries leading to continuous activation of the fibroproliferative response. Although the exact molecular mechanisms leading to such unregulated and continuous deposition of ECM molecules remain enigmatic, accumulating evidence from multiple in vivo and in vitro observations suggests that
TGF-3 is a key soluble mediator in the development of fibrosis (92).
The pathophysiology of tissue fibrosis is characterized by two related events, (i) transdifferentiation of fibroblasts into activated myofibroblasts, and (ii) enhanced synthesis and secretion of ECM molecules by these cells. The pathological hallmark of fibrosis is the accumulation of excess amounts of ECM in the affected tissue, due to both quantitative and qualitative changes in ECM composition. TGF-[P has been shown to play a pivotal role in the initiation and degree of fibrosis in a variety of organ systems, and attempts to inhibit or antagonize TGF-3 activity have led to promising results in downregulating or reversing tissue fibrosis (92). Examples of fibrotic diseases include diabetic nephropathy, liver cirrhosis, idiopathic pulmonary fibrosis, rheumatoid arthritis, fibrosarcomas, arteriosclerosis, and scleroderma (systemic sclerosis; SSc) (106).
1.5.4.2. Role of TGF-P in elastin regulation
As described in chapter 1.4., once elastin has been deposited together with other elements of the elastic fiber, elastin synthesis ceases and there is virtually no turnover. However, a
46

program of neosynthesis of elastin can be rapidly activated at various pathological statuses such as pulmonary hypertension, pulmonary fibrosis, and solar elastosis. TGF-P is one of the most potent modulators of elastin production, and TGF-p 1 has been the most commonly found isoform of TGF-3.
TGF-p 1 has been shown to up-regulate elastin gene expression in human skin fibroblasts, and suggests that this up-regulation is, at least in part, post-transcriptional
(36). The assay of elastin mRNA half-life suggests that TGF-3 1 stabilizes the elastin mRNA, leading to elevated steady-state levels, but transient transfection with an elastin promoter failed to demonstrate an effect of TGF-p 1 on elastin promoter activity.
Interestingly, smooth muscle cell cultures established from the aorta of same transgenic animals clearly responded to TGF-P 1, suggesting the cell-specific up-regulation of elastin promoter activity. Meanwhile, subcutaneous injection of TGF-3 1 in transgenic mice expressing the human elastin promoter enhanced the promoter activity in a timedependent manner up to 10-fold (53).
human fetal lung fibroblasts (114-116). Kucich et al. demonstrated that TGF- 1 has no effect on transcription of the elastin gene, but does stabilize elastin mRNA. A corresponding increase in production of tropoelastin accompanied by the elastin mRNA was also found. It was shown that phosphatidylcholine-specific phospholipase C (PLC) and protein kinase C (PKC) are involved in mediating the elastin message stabilization
(114). In subsequent studies, they found that geranylgeranylated and acylated proteins are required for this TGF-p 1 effect, and by using tyrosine kinase inhibitor genistein, TGF- 1 signaling pathway requires not only receptor serine/threonine kinase activity, but also tyrosine kinase and small GTPase activities (116). Also, de novo protein synthesis and active Smads, the extended activity of PKC-6 and the stress-activated protein kinase, p38 were requied for TGF-B 1 to achieve elastin mRNA stabilization (115).
47

1.6.1. Reactive oxygen species (ROS)
The term reactive oxygen species (ROS) not only collectively includes oxygen-centered radicals such as the superoxide anion
(02-) and the hydroxyl radical (OH), but also some nonradical species, such as hydrogen peroxide (H
2
0
2
) and singlet oxygen (102), all being produced in the skin upon UVR (1 1). While low levels of reactive oxygen species are continuously produced in vivo and are involved in physiological processes, increased
ROS production following UVA and UVB irradiation of the skin alters gene and protein structure and function, leading to skin damage (24). Besides direct absorption of UVB photons by DNA and subsequent structural changes, generation of ROS following irradiation with UVA and UVB requires the absorption of photons by endogenous chromophores.
2 e-
4 Ad 202.- H2
* QI U alUrlfl
2
02
+
NO
Peroxidase
ONOO-
*Thioredoxin
Fe
2
+
4!~~~~~~~~~
*OH.. , Oxidation
Fe
3
+
Figure 1-9. Generation of various ROS. It demonstrates how the univalent reduction of oxygen, in the presence of a free electron (e), yields '02-, H
2
0
2 and OH. SOD = superoxide dismutase (117).
48

ROS are formed as intermediates in redox processes, leading from oxygen to water (1 17). The univalent reduction of oxygen, in the presence of a free electron (e), yields '02-, H
2
0
2 and OH (Fig. 1-9). Superoxide has an unpaired electron, which has high reactivity and makes it unstable and short-lived. It is water soluble and membrane impermeable, but can cross cell membranes via anion channels (118). In physiological conditions in aqueous solutions at a neutral pH, superoxide dismutates yielding H
2
0
2
.
However, when produced in excess, a significant amount of '02- reacts with NO to produce ONOO- (119). Hydrogen peroxide production from dismutation of '02 can be spontaneous or can be catalyzed by superoxide dismutase (SOD), of which there are three isoforms, CuZnSOD, MnSOD and extracellular SOD (EC-SOD) (117). H
2
0
2 is not a free radical and is a much more stable molecule. Hydrogen peroxide is lipid soluble, crosses cell membranes and has a longer half-life than '02
.
In biological systems, it is scavenged by catalase and by glutathione peroxidase (120). Hydrogen peroxide can also be reduced to generate the highly reactive OH in the presence of metal-containing molecules such as
Fe
2+
(117). Hydroxyl radical is extremely reactive and, unlike '02- and H
2
0
2
, which travel some distance from their site of generation, OH induces local damage where it is formed.
Under normal conditions, the rate of ROS production is balanced by the rate of elimination by anti-oxidants such as SOD, catalase, thioredoxin, glutathione, anti-oxidant vitamins, and other small molecules (121).
NADPH oxidase is a well-characterized ROS-generating system that catalyzes the one-electron reduction of oxygen to '02- in phagocytic cells. It is a multicomponent enzyme complex that includes two membrane-spanning polypeptide subunits p
22
Phox and gp9 ph
° x that are associated with the membrane cytoskeleton (which together comprise flavocytochrome b
55 8
) and four cytoplasmic polypeptide subunits, p
4 7 pho, p
6 7 pho x
, p
4
0 ph ox and the cytosolic guanine nucleotide-binding protein p21 ra, a member of the Ras family of peptides (122). Exposure of the cell to a variety of stimuli induces phosphorylation of cytosolic components and association of cytosolic and membrane-associated components and activates normally dormant oxidase. (123). In fibroblasts, it has been suggested that
TGF-P activates H
2
0
2 generating NAD(P)H oxidase (124).
49

Numerous reports have demonstrated NADPH oxidase in non-phogocytic cells, such as vascular smooth muscle cells, endothelial cells and fibroblasts (122, 124-126).
Expression of gp91phx homologues, noxl 1, nox 2 and nox4, and presence of p
2 2 phox were reported, and cytoplasmic polypeptide subunits p
47 ph ox and p
6 7P ph o were also detected in fibroblasts (122, 127).
As the primary site of oxygen consumption in the cell, mitochondria represent an important source of intracellular ROS production. Oxidative phosphorylation, the process where energy is captures via the step-wise reduction of 02 to H
2
0, occurs in the mitochondria of eukaryotic cells. During this process, partial reduction of oxygen leads to the formation of ROS. Complex I, NADH-ubiquinone oxidoreductase, and complex III, uniquinol cytochrome c oxidoreductase, are the two sites in the mitochondrial electron transport chain where superoxide is produced (125). Other sources of ROS include enzymes such as cytochrome p450 in the endoplasmic reticulum, cyclooxygenase and xanthine oxidase
1.6.2. Involvement of ROS in photoaging
Under physiological conditions the cellular redox state is tightly controlled and UVgenerated ROS can compromise this homeostatic state. Oxidative stress is thought to play a central role in initiating and driving the signaling events that lead to cellular response following UV irradiation. UV irradiation of skin increases hydrogen peroxides and other
ROS, and decreases anti-oxidant enzymes (128). Furthermore, UVA-generated singlet oxygen has recently been described to cause the so-called common deletion of mitochondrial DNA (129). Damage to DNA is a major consequence of UV-induced oxidative reactions. Guanine is the preferential target for ROS leading to the formation of
8-oxo-7,8-dihydroguanine, strand breaks, and other less prevalent reaction products.
These lesions can lead to mutagenesis, particularly to G to T transversions, which have been observed in human skin cancer (13). Neutrophils, which are increased in photodamaged skin, through their ability to produce superoxide anion and hydrogen peroxide further contribute to the load of ROS in photoaging (130).
50

Involvement of ROS in the development of solar elastosis has been demonstrated by many in vivo studies. Solar elastosis was inhibited by antioxidants during the course of chronic UVB exposure in murine skin (131-134). Also, a green tea constituent which possesses antioxidant activity also reduced acute and chronic UVB-induced skin damage
(133, 134). It was reported that the topical application of benzoyl peroxide produced skin changes similar to photoaging including increase in elastin content in murine skin (135).
Elastin accumulation and collagen degradation are prominent hallmarks in photodamaged skin. Compelling evidence links ROS with the development of the characteristic alterations of elastic and collagen fibers observed in photodamaged skin
(13). Results of recent studies demonstrating that externally supplied hydrogen peroxide increased the TE mRNA or activity of the TE promoter dermal fibroblasts suggests that
ROS may be involved in development of solar elastosis (40, 136). Furthermore, ROS not only interact directly with collagen and other dermal interstitial proteins, but also inactivate tissue inhibitors of metalloproteases (TIMP) and induce the synthesis and activation of matrix-degenerating metalloproteases (MMPs) (24). Specific MMPs are induced by UVA through singlet oxygen and hydrogen peroxide (MMP-1, MMP-2, and
MMP-3), whereas UVB generated hydroxyl radicals and lipid peroxidation induce MMP-
1 and MMP-3.
From studies on the mechanism of gene regulation through UVR, it can be concluded that H
2
0
2
, generated after exposure to UVA, leads to increased expression of
c-jun and c-fos mRNA and by this to an increased activation of the transcription factor
AP-1 (137). Activation of mitogen-activated protein kinases through UV-induced singlet oxygen is another pathway that leads to MMP induction. This signaling pathway leads to the expression and secretion of cytokines (IL- oc, IL-1 3 and IL-6) which, through an autocrine and paracrine loop enhance the expression of MMPs. Therefore, accumulation of intracellular ROS, as observed after exposure to UV, can lead to the modulation of genes that are involved in the regulation of connective tissue synthesis and degradation.
Inhibition of the epidermal growth factor receptor (EGFR) tyrosine kinase activity by specific inhibitors results in a very rapid (less than 1 min) complete dephosphorylation of the EGF-R. Treatment of cells with UV irradiation substantially prolonged the lifetime of the EGF-R phosphorylated tyrosines (138), suggesting an inhibitory effect of UV
51

irradiation on protein tyrosine phosphatases (PTPs). This inhibition of PTP activity by
UV was sensitive to N-acetylcysteine (NAC), a scavenger of reactive oxygen intermediates, and could be mimicked by treating cells with H
2
0
2
. UV-induced inactivation of PTP activity is postulated to result from oxidation of a critical cysteine residue that is present in the catalytic active site of all PTPs (139). The environment of this conserved cysteine residue within the catalytic domain of all PTPs makes it highly susceptible to ROS-mediated oxidation (140, 141).
52

References
1. Archer, C. (1998) Functions of the skin. In Textbook of Dermatology (Champion,
R., Burton, J.L., Bums, D. A., Breathnach, S. M., ed) pp. 113-122, Blackwell
Science, Oxford
2. Chan, L. S. (1997) Human skin basement membrane in health and in autoimmune diseases. Front Biosci 2, d343-352
3.
4.
5.
6.
Chu, D. H., Haake, A. R., Holbrook, K., and Loomis, C. A. (2003) The structure and development of skin. In Fitzpatrick's dermatology in general medicine
(Freedberg, I. M., Eisen, A. Z., Wolff, K., Austen, K. F., Goldsmith, L. A., and
Katz, S. I., eds) Vol. I pp. 58-88, McGraw-Hill, New York
Lever, W., Schaumburg-lever, G. (1990) Histology of the skin. In Histopathology
of the skin pp. 9-43, J.B. Lippincott Company, Philadelphia
Prockop, D. J., and Kivirikko, K. I. (1995) Collagens: molecular biology, diseases, and potentials for therapy. Annu Rev Biochem 64, 403-434
Uitto, J., L., P., and Chu, M. L. (2003) Collagen. In Fitzpatrick's dermatology in
general medicine (Freedberg, I. M., Eisen, A. Z., Wolff, K., Austen, K. F.,
Goldsmith, L. A., and Katz, S. I., eds) Vol. I pp. 165-179, McGraw-Hill, New
York
7.
8.
9.
Rittie, L., and Fisher, G. J. (2002) UV-light-induced signal cascades and skin aging. Ageing Res Rev 1, 705-720
Kielty, C. M., Sherratt, M. J., and Shuttleworth, C. A. (2002) Elastic fibres. J Cell
Sci 115, 2817-2828
Gallo, R. L., and Trowbridge, J. M. (2003) Proteoglycans and glycosaminoglycans of skin. In Fitzpatrick's dermatology in general medicine
(Freedberg, I. M., Eisen, A. Z., Wolff, K., Austen, K. F., Goldsmith, L. A., and
Katz, S. I., eds) Vol. I pp. 210-216, McGraw-Hill, New York
10. Kaminer, M. S. (1995) Photodamage: magnitude of the problem. In Photodamage
(Gilchrest, B. A., ed) pp. 1-25, Blackwell science, Cambridge
11. Scharffetter-Kochanek, K. (1997) Photoaging of the connective tissue of skin: its prevention and therapy. Adv Pharmacol 38, 639-655
12. Kochevar, I. E., and Taylor, C. (2003) Photophysics, photochemistry, and photobiology. In Fitzpatrick's dermatology in general medicine (Freedberg, I. M.,
Eisen, A. Z., Wolff, K., Austen, K. F., Goldsmith, L. A., and Katz, S. I., eds) Vol.
I pp. 1267-1275, McGraw-Hill, New York
53

13. Trautinger, F. (2001) Mechanisms of photodamage of the skin and its functional consequences for skin ageing. Clin Exp Dermatol 26, 573-577
14. Hubbard-Smith, K., Hill, H. Z., and Hill, G. J. (1992) Melanin both causes and prevents oxidative base damage in DNA: quantification by anti-thymine glycol antibody. Radiat Res 130, 160-165
15. Soter, N. A. (1995) Sunburn and suntan: immediate manifestations of photodmage. In Photodamage (Gilchrest, B. A., ed) pp. 12-25, Blackwell science,
Cambridge
16. Gilchrest, B. A., Soter, N. A., Stoff, J. S., and Mihm, M. C., Jr. (1981) The human sunburn reaction: histologic and biochemical studies. JAm Acad Dermatol 5, 411-
422
17. Norris, P., Poston, R. N., Thomas, D. S., Thornhill, M., Hawk, J., and Haskard, D.
0. (1991) The expression of endothelial leukocyte adhesion molecule-i (ELAM-
1), intercellular adhesion molecule-i (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) in experimental cutaneous inflammation: a comparison of ultraviolet B erythema and delayed hypersensitivity. J Invest Dermatol 96, 763-
770
18. Young, A. R., Chadwick, C. A., Harrison, G. I., Nikaido, O., Ramsden, J., and
Potten, C. S. (1998) The similarity of action spectra for thymine dimers in human epidermis and erythema suggests that DNA is the chromophore for erythema. J
Invest Dermatol 111, 982-988
19. Parrish, J. A., Jaenicke, K. F., and Anderson, R. R. (1982) Erythema and melanogenesis action spectra of normal human skin. Photochem Photobiol 36,
187-191
20. Pathak, M. A., Jimbow, K., J.A., P., K.H., K., A.L., K., and Fitzpatrick, T. B.
(1976) Effect of UV-A, UV-B, and psoralen on in vivo human melanin pigmentation: cellular and subcellular characterization on delayed tanning reactions induced by single or multiple exposures to UV-A, UV-B or UV-A plus
8-methoxypsoralen. In the 9th International Pigment Cell Conference (V., R., ed)
Vol. 3 pp. 291-298, Basel, Houston
21. Saladi, R. N., and Persaud, A. N. (2005) The causes of skin cancer: a comprehensive review. Drugs Today (Barc) 41, 37-53
22. Hussein, M. R. (2005) Ultraviolet radiation and skin cancer: molecular mechanisms. J Cutan Pathol 32, 191-205
23. Uitto, J. (1986) Connective tissue biochemistry of the aging dermis. Age-related alterations in collagen and elastin. Dermatol. Clin. 4, 433-446
54

24. Wlaschek, M., Tantcheva-Poor, I., Naderi, L., Ma, W., Schneider, L. A., Razi-
Wolf, Z., Schuller, J., and Scharffetter-Kochanek, K. (2001) Solar UV irradiation and dermal photoaging. J. Photochem. Photobiol. B. 63, 41-51
25. Montagna, W., Kirchner, S., and Carlisle, K. (1989) Histology of sun-damaged human skin. J. Am. Acad. Dermatol. 21, 907-918
26. Lavker, R. M. (1995) Cutaneous aging: chronologic versus photoaging. In
Photodamage (Gilchrest, B. A., ed) pp. 123-135, Blackwell science, Cambridge
27. Werth, V. P., Shi, X., Kalathil, E., and Jaworsky, C. (1996) Elastic fiberassociated proteins of skin in development and photoaging. Photochem Photobiol
63, 308-313
28. Watson, R. E., Griffiths, C. E., Craven, N. M., Shuttleworth, C. A., and Kielty, C.
M. (1999) Fibrillin-rich microfibrils are reduced in photoaged skin. Distribution at the dermal-epidermal junction. J Invest Dermatol 112, 782-787
29. Wulf, H. C., Sandby-Moller, J., Kobayasi, T., and Gniadecki, R. (2004) Skin aging and natural photoprotection. Micron 35, 185-191
30. Kligman, L. H. (1989) The ultraviolet-irradiated hairless mouse: a model for photoaging. Jd Am. Acad. Dermatol. 21, 623-631
31. Kang, S., Fisher, G. J., and Voorhees, J. J. (2001) Photoaging: pathogenesis, prevention, and treatment. Clin Geriatr Med 17, 643-659, v-vi
32. Quan, T., He, T., Voorhees, J. J., and Fisher, G. J. (2001) Ultraviolet irradiation blocks cellular responses to transforming growth factor-beta by down-regulating its type-II receptor and inducing Smad7. JBiol Chem 276, 26349-26356
33. Fisher, G. J., Datta, S. C., Talwar, H. S., Wang, Z. Q., Varani, J., Kang, S., and
Voorhees, J. J. (1996) Molecular basis of sun-induced premature skin ageing and retinoid antagonism. Nature 379, 335-339
34. Fisher, G. J., and Voorhees, J. J. (1998) Molecular mechanisms of photoaging and its prevention by retinoic acid: ultraviolet irradiation induces MAP kinase signal transduction cascades that induce Ap- -regulated matrix metalloproteinases that degrade human skin in vivo. JInvestig Dermatol Symp Proc 3, 61-68
35. Schwartz, E., Feinberg, E., Lebwohl, M., Mariani, T. J., and Boyd, C. D. (1995)
Ultraviolet radiation increases tropoelastin accumulation by a post-transcriptional mechanism in dermal fibroblasts. JInvest Dermatol 105, 65-69
36. Kahari, V. M., Olsen, D. R., Rhudy, R. W., Carrillo, P., Chen, Y. Q., and Uitto, J.
(1992) Transforming growth factor-beta up-regulates elastin gene expression in human skin fibroblasts. Evidence for post-transcriptional modulation. Lab Invest
66, 580-588
55

37. Mauviel, A., Chen, Y. Q., Kahari, V. M., Ledo, I., Wu, M., Rudnicka, L., and
Uitto, J. (1993) Human recombinant interleukin-1 beta up-regulates elastin gene expression in dermal fibroblasts. Evidence for transcriptional regulation in vitro and in vivo. JBiol Chem 268, 6520-6524
38. Reitamo, S., Remitz, A., Tamai, K., Ledo, I., and Uitto, J. (1994) Interleukin 10 up-regulates elastin gene expression in vivo and in vitro at the transcriptional level. Biochem J 302 ( Pt 2), 331-333
39. Bernstein, E. F., Chen, Y. Q., Tamai, K., Shepley, K. J., Resnik, K. S., Zhang, H.,
Tuan, R., Mauviel, A., and Uitto, J. (1994) Enhanced elastin and fibrillin gene expression in chronically photodamaged skin. J. Invest. Dermatol. 103, 182-186
40. Bernstein, E. F., Brown, D. B., Urbach, F., Forbes, D., Del Monaco, M., Wu, M.,
Katchman, S. D., and Uitto, J. (1995) Ultraviolet radiation activates the human elastin promoter in transgenic mice: a novel in vivo and in vitro model of cutaneous photoaging. J Invest. Dermatol. 105, 269-273
41. Bernstein, E. F., Chen, Y. Q., Tamai, K., Shepley, K. J., Resnik, K. S., Zhang, H.,
Tuan, R., Mauviel, A., and Uitto, J. (1994) Enhanced elastin and fibrillin gene expression in chronically photodamaged skin. J Invest Dermatol 103, 182-186
42. Smith-Mungo, L. I., and Kagan, H. M. (1998) Lysyl oxidase: properties, regulation and multiple functions in biology. Matrix Biol 16, 387-398
43. El-Domyati, M., Attia, S., Saleh, F., Brown, D., Birk, D. E., Gasparro, F., Ahmad,
H., and Uitto, J. (2002) Intrinsic aging vs. photoaging: a comparative histopathological, immunohistochemical, and ultrastructural study of skin. Exp
Dermatol 11, 398-405
44. Uitto, J. (1979) Biochmistry of the elastic fibers in normal connective tissues and its alterations in diseases. J. Invest. Dermatol., 1-10
45. Uitto, J., and Chu, M. L. (2003) Elastic fibers. In Fitzpatrick's dermatology in
general medicine (Freedberg, I. M., Eisen, A. Z., Wolff, K., Austen, K. F.,
Goldsmith, L. A., and Katz, S. I., eds) Vol. I pp. 180-189, McGraw-Hill, New
York
46. Toonkool, P., Jensen, S. A., Maxwell, A. L., and Weiss, A. S. (2001)
Hydrophobic domains of human tropoelastin interact in a context-dependent manner. JBiol Chem 276, 44575-44580
47. Boyd, C. D., Christiano, A. M., Pierce, R. A., Stolle, C. A., and Deak, S. B.
(1991) Mammalian tropoelastin: multiple domains of the protein define an evolutionarily divergent amino acid sequence. Matrix 11, 235-241
48. Indik, Z., Yoon, K., Morrow, S. D., Cicila, G., Rosenbloom, J., and Ornstein-
Goldstein, N. (1987) Structure of the 3' region of the human elastin gene: great
56

abundance of Alu repetitive sequences and few coding sequences. Connect Tissue
Res 16, 197-211
49. Parks, W. C., Secrist, H., Wu, L. C., and Mecham, R. P. (1988) Developmental regulation of tropoelastin isoforms. J Biol Chem 263, 4416-4423
50. Davison, J. M., Zang, M.-C., Zoia, O and Giro, M.G. (1995) Regulation of elastin synthesis in pathological states. In The molecular biology abnd pathology of
elastic tissues Vol. 192 pp. 81-99, Ciba Foundation Symposium, Wiley,
Chichester
51. Sephel, G. C., Buckley, A., and Davidson, J. M. (1987) Developmental initiation of elastin gene expression by human fetal skin fibroblasts. JInvest Dermatol 88,
732-735
52. Kahari, V. M., Chen, Y. Q., Bashir, M. M., Rosenbloom, J., and Uitto, J. (1992)
Tumor necrosis factor-alpha down-regulates human elastin gene expression.
Evidence for the role of AP- 1 in the suppression of promoter activity. J Biol Chem
267, 26134-26141
53. Katchman, S. D., Hsu-Wong, S., Ledo, I., Wu, M., and Uitto, J. (1994)
Transforming growth factor-beta up-regulates human elastin promoter activity in transgenic mice. Biochem Biophys Res Commun 203, 485-490
54. Pierce, R. A., Kolodziej, M. E., and Parks, W. C. (1992) 1,25-Dihydroxyvitamin
D3 represses tropoelastin expression by a posttranscriptional mechanism. J Biol
Chem 267, 11593-11599
55. Wolfe, B. L., Rich, C. B., Goud, H. D., Terpstra, A. J., Bashir, M., Rosenbloom,
J., Sonenshein, G. E., and Foster, J. A. (1993) Insulin-like growth factor-I regulates transcription of the elastin gene. J Biol Chem 268, 12418-12426
56. Conn, K. J., Rich, C. B., Jensen, D. E., Fontanilla, M. R., Bashir, M. M.,
Rosenbloom, J., and Foster, J. A. (1996) Insulin-like growth factor-I regulates transcription of the elastin gene through a putative retinoblastoma control element. A role for Sp3 acting as a repressor of elastin gene transcription. J Biol
Chem 271, 28853-28860
57. Taipale, J., Miyazono, K., Heldin, C. H., and Keski-Oja, J. (1994) Latent transforming growth factor-beta 1 associates to fibroblast extracellular matrix via latent TGF-beta binding protein. J. Cell. Biol. 124, 171-181
58. Karonen, T., Jeskanen, L., and Keski-Oja, J. (1997) Transforming growth factor beta 1 and its latent form binding protein-i associate with elastic fibres in human dermis: accumulation in actinic damage and absence in anetoderma. Br J
Dermatol 137, 51-58
57

59. Bressan, G. M., and Prockop, D. J. (1977) Synthesis of elastin in aortas from chick embryos. Conversion of newly secreted elastin to cross-linked elastin without apparent proteolysis of the molecule. Biochemistry 16, 1406-1412
60. Reiser, K., McCormick, R. J., and Rucker, R. B. (1992) Enzymatic and nonenzymatic cross-linking of collagen and elastin. Faseb J 6, 2439-2449
61. McGowan, S. E., and McNamer, R. (1990) Transforming growth factor-beta increases elastin production by neonatal rat lung fibroblasts. Am JRespir Cell Mol
Biol 3, 369-376
62. Curran, M. E., Atkinson, D. L., Ewart, A. K., Morris, C. A., Leppert, M. F., and
Keating, M. T. (1993) The elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis. Cell 73, 159-168
63. Olsen, D. R., Fazio, M. J., Shamban, A. T., Rosenbloom, J., and Uitto, J. (1988)
Cutis laxa: reduced elastin gene expression in skin fibroblast cultures as determined by hybridizations with a homologous cDNA and an exon 1-specific oligonucleotide. JBiol Chem 263, 6465-6467
64. Zhang, M. C., Giro, M., Quaglino, D., Jr., and Davidson, J. M. (1995)
Transforming growth factor-beta reverses a posttranscriptional defect in elastin synthesis in a cutis laxa skin fibroblast strain. J Clin Invest 95, 986-994
65. Neldner, K. H. (1988) Pseudoxanthoma elasticum. Int J Dermatol 27, 98-100
66. Giro, M. G., Duvic, M., Smith, L. T., Kennedy, R., Rapini, R., Amett, F. C., and
Davidson, J. M. (1992) Buschke-Ollendorff syndrome associated with elevated elastin production by affected skin fibroblasts in culture. J Invest Dermatol 99,
129-137
67. Kondo, S. (2000) The roles of cytokines in photoaging. J. Dermatol. Sci. 23(1),
S30-S36
68. Roberts, A. B., Flanders, K. C., Kondaiah, P., Thompson, N. L., Van Obberghen-
Schilling, E., Wakefield, L., Rossi, P., de Crombrugghe, B., Heine, U., and Sporn,
M. B. (1988) Transforming growth factor beta: biochemistry and roles in embryogenesis, tissue repair and remodeling, and carcinogenesis. Recent Prog
Horm Res 44, 157-197
69. Verrecchia, F., and Mauviel, A. (2002) Transforming growth factor-beta signaling through the Smad pathway: role in extracellular matrix gene expression and regulation. Jlnvest Dermatol 118, 211-215
70. Kossodo, S., Wong, W. R., Simon, G., and Kochevar, I. E. (2004) Effects of UVR and UVR-induced cytokines on production of extracellular matrix proteins and proteases by dermal fibroblasts cultured in collagen gels%. Photochem Photobiol
79, 86-93
58

71. Wang, H., and Kochevar, I. E. (2005) Involvement of UVB-induced reactive oxygen species in TGF-beta biosynthesis and activation in keratinocytes. Free
Radic Biol Med 38, 890-897
72. Scordi, I. A., and Vincek, V. (2000) Timecourse study of UVB-induced cytokine induction in whole mouse skin. Photodermatol Photoimmunol Photomed 16, 67-
73
73. Lee, H. S., Kooshesh, F., Sauder, D. N., and Kondo, S. (1997) Modulation of
TGF-beta 1 production from human keratinocytes by UVB. Exp. Dermatol. 6,
105-110
74. Katchman, S. D., Hsu-Wong, S., Ledo, I., Wu, M., and Uitto, J. (1994)
Transforming growth factor-beta up-regulates human elastin promoter activity in transgenic mice. Biochem. Biophys. Res. Commun. 203, 485-490
75. Lindstedt, K. A., Wang, Y., Shiota, N., Saarinen, J., Hyytiainen, M., Kokkonen, J.
O., Keski-Oja, J., and Kovanen, P. T. (2001) Activation of paracrine TGF-betal signaling upon stimulation and degranulation of rat serosal mast cells: a novel function for chymase. Faseb J. 15, 1377-1388
76. Taipale, J., Saharinen, J., and Keski-Oja, J. (1998) Extracellular matrix-associated transforming growth factor-beta: role in cancer cell growth and invasion. Adv
Cancer Res 75, 87-134
77. McCartney-Francis, N. L., and Wahl, S. M. (1994) Transforming growth factor beta: a matter of life and death. J. Leuk. Biol. 55, 401-409
78. Lawrence, D. A. (1996) Transforming growth factor-beta: a general review. Eur.
Cytokine Netw. 7, 363-374
79. Roberts, A. B., and Sporn, M. B. (1992) Differential expression of the TGF-beta isoforms in embryogenesis suggests specific roles in developing and adult tissues.
Mol. Reprod. Dev. 32, 91-98
80. Koch, R. M., Roche, N. S., Parks, T., Ashcroft, G. S., Letterio, J. J., and Roberts,
A. B. (2000) Incisional wound healing in transforming growth factor-betal null mice. Wound Rep. Reg. 8, 179-191
81. Segarini, P. R. (1993) TGF-beta receptors: a complicated system of multiple binding proteins. Biochim. Biophys. Acta 1155, 269-275
82. Wrana, J. L. (1998) TGF-beta receptors and signaling mechanisms. Miner Elect.
Metab. 24, 120-130
83. Massague, J., and Wotton, D. (2000) Transcriptional control by the TGFbeta/Smad signaling system. Embo J. 19, 1745-1754
59

84. Khalil, N. (1999) TGF-beta: from latent to active. Microbes. Infect. 1, 1255-1263
85. Lopez, A. R., Cook, J., Deininger, P. L., and Derynck, R. (1992) Dominant negative mutants of transforming growth factor-beta 1 inhibit the secretion of different transforming growth factor-beta isoforms. Mol Cell Biol 12, 1674-1679
86. Annes, J. P., Munger, J. S., and Rifkin, D. B. (2003) Making sense of latent
TGFbeta activation. J Cell Sci 116, 217-224
87. Miyazono, K., Olofsson, A., Colosetti, P., and Heldin, C. H. (1991) A role of the latent TGF-beta 1-binding protein in the assembly and secretion of TGF-beta 1.
Embo J 10, 1091-1101
88. Kane, C. J. M., Hebda, P. A., Mansbridge, J. N., and Hanawalt, P. C. (1991)
Direct evidence for spatial and temporal regulation of transforming growth factor betal expression during cutaneous wound healing. J. Cell. Physiol. 148, 157-173
89. Fowlis, D. J., Flanders, K. C., Duffie, E., Balmain, A., and Akhurst, R. J. (1992)
Discordant transforming growth factor beta 1 RNA and protein localization during chemical carcinogenesis of the skin. Cell Growth Differ. 3, 81-91
90. Lavker, R. M., and Kligman, A. M. (1988) Chronic heliodermatitis: a morphologic evaluation of chronic actinic dermal damage with emphasis on the role of mast cells. J. Invest. Dermatol. 90, 325-330
91. Gonzalez, S., Moran, M., and Kochevar, I. E. (1999) Chronic photodamage in skin of mast cell-deficient mice. Photochem. Photobiol. 70, 248-253
92. Eickelberg, 0. (2001) Endless healing: TGF-beta, SMADs, and fibrosis. FEBS
Lett. 506, 11-14
93. Koli, K., Saharinen, J., Hyytiainen, M., Penttinen, C., and Keski-Oja, J. (2001)
Latency, activation, and binding proteins of TGF-beta. Microsc. Res. Tech. 52,
354-362
94. Barcellos-Hoff, M. H., Derynck, R., Tsang, M. L., and Weatherbee, J. A. (1994)
Transforming growth factor-beta activation in irradiated murine mammary gland.
J Clin Invest 93, 892-899
95. Barcellos-Hoff, M. H., and Dix, T. A. (1996) Redox-mediated activation of latent transforming growth factor-beta 1. Mol Endocrinol 10, 1077-1083
96. Lyons, R. M., Gentry, L. E., Purchio, A. F., and Moses, H. L. (1990) Mechanism of activation of latent recombinant transforming growth factor beta 1 by plasmin.
JCellBiol 110, 1361-1367
60

97. Crawford, S. E., Stellmach, V., Murphy-Ullrich, J. E., Ribeiro, S. M., Lawler, J.,
Hynes, R. O., Boivin, G. P., and Bouck, N. (1998) Thrombospondin-1 is a major activator of TGF-betal in vivo. Cell 93, 1159-1170
98. Munger, J. S., Huang, X., Kawakatsu, H., Griffiths, M. J., Dalton, S. L., Wu, J.,
Pittet, J. F., Kaminski, N., Garat, C., Matthay, M. A., Rifkin, D. B., and Sheppard,
D. (1999) The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell 96, 319-328
99. Huang, X. Z., Wu, J. F., Cass, D., Erle, D. J., Corry, D., Young, S. G., Farese, R.
V., Jr., and Sheppard, D. (1996) Inactivation of the integrin beta 6 subunit gene reveals a role of epithelial integrins in regulating inflammation in the lung and skin. J Cell Biol 133, 921-928
100. Derynck, R., and Zhang, Y. E. (2003) Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 425, 577-584
101. Ungefroren, H., Lenschow, W., Chen, W. B., Faendrich, F., and Kalthoff, H.
(2003) Regulation of biglycan gene expression by transforming growth factorbeta requires MKK6-p3 8 mitogen-activated protein Kinase signaling downstream of Smad signaling. J Biol Chem 278, 11041-11049
102. Engel, M. E., McDonnell, M. A., Law, B. K., and Moses, H. L. (1999)
Interdependent SMAD and JNK signaling in transforming growth factor-betamediated transcription. JBiol Chem 274, 37413-37420
103. Hall, M. C., Young, D. A., Waters, J. G., Rowan, A. D., Chantry, A., Edwards, D.
R., and Clark, I. M. (2003) The comparative role of activator protein 1 and Smad factors in the regulation of Timp-1 and MMP-1 gene expression by transforming growth factor-beta 1. JBiol Chem 278, 10304-10313
104. Piek, E., Heldin, C. H., and Ten Dijke, P. (1999) Specificity, diversity, and regulation in TGF-beta superfamily signaling. Faseb J 13, 2105-2124
105. Liu, R. M., Liu, Y., Forman, H. J., Olman, M., and Tarpey, M. M. (2004)
Glutathione regulates transforming growth factor-beta-stimulated collagen production in fibroblasts. Am JPhysiol Lung Cell Mol Physiol 286, L121-128
106. Leask, A., and Abraham, D. J. (2004) TGF-beta signaling and the fibrotic response. Faseb J 18, 816-827
107. Oyama, F., Murata, Y., Suganuma, N., Kimura, T., Titani, K., and Sekiguchi, K.
(1989) Patterns of alternative splicing of fibronectin pre-mRNA in human adult and fetal tissues. Biochemistry 28, 1428-1434
108. Serini, G., Bochaton-Piallat, M. L., Ropraz, P., Geinoz, A., Borsi, L., Zardi, L., and Gabbiani, G. (1998) The fibronectin domain ED-A is crucial for
61

myofibroblastic phenotype induction by transforming growth factor-betal. J Cell
Biol 142, 873-881
109. Varga, J., and Jimenez, S. A. (1986) Stimulation of normal human fibroblast collagen production and processing by transforming growth factor-beta. Biochem
Biophys Res Commun 138, 974-980
110. Verrecchia, F., Chu, M. L., and Mauviel, A. (2001) Identification of novel TGFbeta /Smad gene targets in dermal fibroblasts using a combined cDNA microarray/promoter transactivation approach. JBiol Chem 276, 17058-17062
111. Hayashida, T., Poncelet, A. C., Hubchak, S. C., and Schnaper, H. W. (1999) TGFbetal activates MAP kinase in human mesangial cells: a possible role in collagen expression. Kidney Int 56, 1710-1720
112. Sato, M., Shegogue, D., Gore, E. A., Smith, E. A., McDermott, P. J., and
Trojanowska, M. (2002) Role of p38 MAPK in transforming growth factor beta stimulation of collagen production by scleroderma and healthy dermal fibroblasts.
J Invest Dermatol 118, 704-711
113. Hocevar, B. A., Brown, T. L., and Howe, P. H. (1999) TGF-beta induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4independent pathway. Embo J 18, 1345-1356
114. Kucich, U., Rosenbloom, J. C., Abrams, W. R., Bashir, M. M., and Rosenbloom,
J. (1997) Stabilization of elastin mRNA by TGF-beta: initial characterization of signaling pathway. Am J Respir Cell Mol Biol 17, 10-16
115. Kucich, U., Rosenbloom, J. C., Abrams, W. R., and Rosenbloom, J. (2002)
Transforming growth factor-beta stabilizes elastin mRNA by a pathway requiring active Smads, protein kinase C-delta, and p38. Am JRespir Cell Mol Biol 26, 183-
188
116. Kucich, U., Rosenbloom, J. C., Shen, G., Abrams, W. R., Blaskovich, M. A.,
Hamilton, A. D., Ohkanda, J., Sebti, S. M., and Rosenbloom, J. (1998)
Requirement for geranylgeranyl transferase I and acyl transferase in the TGFbeta-stimulated pathway leading to elastin mRNA stabilization. Biochem Biophys
Res Commun 252, 111-116
117. Touyz, R. M. (2004) Reactive oxygen species and angiotensin II signaling in vascular cells -- implications in cardiovascular disease. Braz J Med Biol Res 37,
1263-1273
118. Han, D., Antunes, F., Canali, R., Rettori, D., and Cadenas, E. (2003) Voltagedependent anion channels control the release of the superoxide anion from mitochondria to cytosol. JBiol Chem 278, 5557-5563
62

119. Darley-Usmar, V., Wiseman, H., and Halliwell, B. (1995) Nitric oxide and oxygen radicals: a question of balance. FEBS Lett 369, 131-135
120. Schafer, F. Q., and Buettner, G. R. (2001) Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple.
Free Radic Biol Med 30, 1191-1212
121. Halliwell, B. (1999) Antioxidant defence mechanisms: from the beginning to the end (of the beginning). Free Radic Res 31, 261-272
122. Rey, F. E., and Pagano, P. J. (2002) The reactive adventitia: fibroblast oxidase in vascular function. Arterioscler Thromb Vasc Biol 22, 1962-1971
123. Curtin, J. F., Donovan, M., and Cotter, T. G. (2002) Regulation and measurement of oxidative stress in apoptosis. J Immunol Methods 265, 49-72
124. Thannickal, V. J., and Fanburg, B. L. (1995) Activation of an H202-generating
NADH oxidase in human lung fibroblasts by transforming growth factor beta 1. J
Biol Chem 270, 30334-30338
125. Herrera, B., Murillo, M. M., Alvarez-Barrientos, A., Beltran, J., Fernandez, M., and Fabregat, I. (2004) Source of early reactive oxygen species in the apoptosis induced by transforming growth factor-beta in fetal rat hepatocytes. Free Radic
Biol Med 36, 16-26
126. Babior, B. M. (2000) The NADPH oxidase of endothelial cells. IUBMB Life 50,
267-269
127. Dhaunsi, G. S., Paintlia, M. K., Kaur, J., and Turner, R. B. (2004) NADPH oxidase in human lung fibroblasts. J Biomed Sci 1 1, 617-622
128. Yamamoto, Y. (2001) Role of active oxygen species and antioxidants in photoaging. J Dermatol Sci 27 Suppl 1, S1-4
129. Berneburg, M., Grether-Beck, S., Kurten, V., Ruzicka, T., Briviba, K., Sies, H., and Krutmann, J. (1999) Singlet oxygen mediates the UVA-induced generation of the photoaging-associated mitochondrial common deletion. JBiol Chem 274,
15345-15349
130. Kochevar, I. E., Moran, M., and Granstein, R. D. (1994) Experimental photoaging in C3H/HeN, C3H/HeJ, and Balb/c mice: comparison of changes in extracellular matrix components and mast cell numbers. JInvest Dermatol 103, 797-800
131. Bissett, D. L., Chatterjee, R., and Hannon, D. P. (1990) Photoprotective effect of superoxide-scavenging antioxidants against ultraviolet radiation-induced chronic skin damage in the hairless mouse. Photodermatol Photoimmunol Photomed 7,
56-62
63

132. Bissett, D. L., Majeti, S., Fu, J. J., McBride, J. F., and Wyder, W. E. (1990)
Protective effect of topically applied conjugated hexadienes against ultraviolet radiation-induced chronic skin damage in the hairless mouse. Photodermatol
Photoimmunol Photomed 7, 63-67
133. Vayalil, P. K., Mittal, A., Hara, Y., Elmets, C. A., and Katiyar, S. K. (2004)
Green tea polyphenols prevent ultraviolet light-induced oxidative damage and matrix metalloproteinases expression in mouse skin. J Invest Dermatol 122, 1480-
1487
134. Katiyar, S. K., Afaq, F., Perez, A., and Mukhtar, H. (2001) Green tea polyphenol
(-)-epigallocatechin-3-gallate treatment of human skin inhibits ultraviolet radiation-induced oxidative stress. Carcinogenesis 22, 287-294
135. Ibbotson, S. H., Moran, M. N., Nash, J. F., and Kochevar, I. E. (1999) The effects of radicals compared with UVB as initiating species for the induction of chronic cutaneous photodamage. JInvest Dermatol 112, 933-938
136. Kawaguchi, Y., Tanaka, H., Okada, T., Konishi, H., Takahashi, M., Ito, M., and
Asai, M. (1997) Effect of reactive oxygen species on the elastin mRNA expresssion in cultured human dermal fibroblasts. Free Radic. Biol. Med. 23, 162-
165
137. Fisher, G. J., Wang, Z. Q., Datta, S. C., Varani, J., Kang, S., and Voorhees, J. J.
(1997) Pathophysiology of premature skin aging induced by ultraviolet light. N
Engl JMed 337, 1419-1428
138. Knebel, A., Rahmsdorf, H. J., Ullrich, A., and Herrlich, P. (1996)
Dephosphorylation of receptor tyrosine kinases as target of regulation by radiation, oxidants or alkylating agents. Embo J 15, 5314-5325
139. Denu, J. M., and Tanner, K. G. (1998) Specific and reversible inactivation of protein tyrosine phosphatases by hydrogen peroxide: evidence for a sulfenic acid intermediate and implications for redox regulation. Biochemistry 37, 5633-5642
140. Meng, T. C., Fukada, T., and Tonks, N. K. (2002) Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol Cell 9, 387-399
141. Barford, D., Jia, Z., and Tonks, N. K. (1995) Protein tyrosine phosphatases take off. Nat Struct Biol 2, 1043-1053
64

65

Chronic exposure of skin to solar ultraviolet radiation (UVR) causes extensive remodeling of the dermal extracellular matrix (1, 2). The deposition of massive amounts of abnormal elastic material, termed solar elastosis, is a hallmark of photoaged skin.
Elastin, the major protein of elastic fibers, is produced from a soluble precursor, tropoelastin (TE), which undergoes oxidation by lysyl oxidase. The oxidized lysines then participate in reactions to form intermolecular and intramolecular crosslinks (desmosine, isodesmosine, and others) (3). Synthesis of TE, a 68-kDa protein, by dermal fibroblasts occurs mainly during development and early childhood although TE gene expression is reactivated in pathological conditions (3). TE mRNA level has been reported to be higher in photoaged skin than age-matched non-sun-exposed skin (4-6) and in experimentally photoaged mice (7). A strong correlation exists between tropoelastin mRNA levels and protein synthesis, indicating elastin synthesis is mainly under pre-translational control with both pre-and post-transcriptional control mechanisms described (8, 9). Also, the increase in elastin in photoaged skin is attributed mainly to increased synthesis rather than decreased degradation because the crosslinked elastin protein is extremely stable with virtually no turnover in undamaged skin (10, 11). Despite the dramatic alteration in elastin with an increased content of amorphous morphology in the photoaged skin, the underlying mechanisms are only poorly understood.
UV radiation stimulates and activates various cells to produce and release cytokines that may play a significant role in the process of photoaging (12). In particular,
TGF-P increases synthesis and secretion of a wide variety of matrix proteins, decreases degradation of matrix proteins both by decreasing protease synthesis and increasing the synthesis of protease inhibitors, and also increases synthesis of integrin receptors, thereby enhancing the ability of the cells to interact with matrix (13). Various studies have demonstrated the role of TGF-P in regulation of TE and in development of solar elastosis
(14-17). See chapter 1.5 for details.
TGF-P is a member of the TGF-p superfamily of cytokines that regulate many biological functions, such as cellular growth and differentiation, extracellular matrix synthesis, inflammatory responses, angiogenesis, and immune functions (18, 19). TGF-p
66

signaling pathways including both Smad and non-Smad pathways were introduced in chapter 1.5.3.
Reactive oxygen species (ROS) induced in cells by TGF-3 to its receptors also appear to contribute to down stream signaling (20-24). ROS are known to activate certain signal transduction pathways that are also activated by TGF-P such as MAPK and phosphatidylinositol-3-kinase (PI3K) pathways and calcineurin (25, 26). Potential sources of ROS in non-phagocytic cells such as fibroblasts include NADPH oxidase, mitchondria, cytochrome p450, cyclooxygenase and xanthine oxidase (27, 28).
Previously, we have shown that ROS are involved the up-regulation of TE gene expression by TGF-[ 1 in human neonatal dermal fibroblasts (29). The goals of this study were to identify the sources in TGF-P 1 induced ROS that mediate TE gene up-regulation, and to determine which steps in non-Smad and Smad pathways are influenced by these
ROS.
67

2.2.1. Materials
Human recombinant TGF-3 1, N-acetyl-cysteine (NAC), and diphenylene iodonium
(DPI), cycloheximide, and wortmannin were purchased from Sigma (St. Louis, MO). 6-
-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox) was from Aldrich (St.
Louis, MO). MitoQ was a gift from Dr. Michael P. Murphy (Wellcome Trust,
Cambridge, UK). SB203580, PD98059, SP600125, and 7-amino-actinomycin D were from Calbiochem (San Diego, CA). Antibodies against phospho-p38 MAP kinase, p38
MAP kinase, phospho-ERK MAP kinase, phospho-ERK MAP kinase and Smad4 were from Cell Signaling Technology (Beverly, MA). Antibodies against Smad7 and GAPDH were from Santa Cruz Biotechnology (Santa Cruz, CA). 5-(And-6)-chloromethyl-2'7'dichlorodihydrofluorescein diacetate (CM-H
2
DCFDA) was purchased from Molecular
Probes (Eugene, OR). Cell culture reagents were purchased from Invitrogen (Carlsbad,
CA).
2.2.2. Cell culture and treatment with TGF-P1
Normal primary human skin fibroblasts from newborn foreskin (R2F) and adult skin
(P1F) were a gift from Dr. James G. Rheinwald of the Harvard NIH Skin Disease
Research Center. The cells were grown in monolayer culture in Dulbecco's modified
Eagles medium/F12 with 15% of heat-inactivated newborn calf serum and 10 ng/ml epidermal growth factor plus 1% penicillin and streptomycin at 37°C in a humidified 5%
CO
2 atmosphere. Cells were subcultured at 1:10 ratio in 60 mm tissue culture dish (- 1 x
10
5 cells/dish) by exposure to trypsin/EDTA and used at passages 6 to 12. Semi-confluent monolayer (70-80%) of fibroblasts were made quiescent by culturing in serum-free medium for 18-24 h prior to TGF-PI 1 treatments. TGF- 1 stock solution was prepared at
2 ptg/ml according to the manufacturer's instruction, aliquoted and stored at -20 °C. The medium was removed and TGF-PI 1 alone or with the appropriate inhibitor was added in freshly prepared serum-free medium.
68

2.2.3. Real-time reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA from the cells was extracted using the RNeasy Mini Kit (Qiagen, Chatsworth,
CA) according to the manufacturer's protocol. Total RNA (2 [1g) was reverse transcribed with Oligo(dT)
18 primers. The RT reaction was incubated in a thermal cycler at 25°C for
10 min to extend the primers, and 42°C for 30 min, 95
°
C for 5 min and then cooled on ice. PCR primers were synthesized by Invitrogen (Carlsbad, CA) based on the unique sequences in the human TE gene (GI:5881412) and the human hypoxanthine phosphoribosyltransferase (HPRT) gene (GI: 184349). The 5' forward and 3' reversecomplement primers for amplification of each mRNA are as follows: for TE;
CCTGGACTTGGAGTTGGTGT and GATGCCTACTCCACCGAGAG (exons 24-26) and for HPRT; TAATTATGGACAGGACTGAACGTCTTG and
CCCTGAAGTATTCATTATAGTCAAGGGC, respectively. The PCR products for TE,
HPRT were 291 and 480-bp, respectively. For real-time PCR reaction a master mix of the following reaction components was prepared to the indicated end-concentration: 1.5 mM
MgCl
2
, 150 nM forward and reverse primers respectively and 1:60,000 dilution of done with 1 tl cDNA (equivalent to 100 ng reverse transcribed total RNA) mixed with
CA). The reaction mixtures with appropriate combination of specific primers were incubated for 10 min at 95°C. The PCR cycle consisted of denaturation for 30 sec at
95°C, annealing for 1.0 min at 55°C, and extending for 1.5 min at 72°C for HPRT or 1.0
min at 72°C for TE. After the last cycle, the dissociation curve was performed to check the non-specific products. The amplified products were incubated for 1 min at 95°C followed by 81 cycles of incubation with the heating rate of 0.5°C/cycle and 30 sec/cycle, beginning at 55°C and ending at 95°C. Relative TE and HPRT mRNA levels were quantified based on standard curves and TE levels were normalized to the HPRT levels as an internal control.
69

2.2.4. ROS measurement
The intracellular production of ROS was measured using CM-H
2
DCFDA. CM-
H
2
DCFDA is oxidized by ROS to the highly fluorescent 2'7'-dichlorofluorescein (DCF).
Cells were subcultured in 6-well plates, and the subconfluent (70-80%) cells were made quiescent in serum-free medium for 18-24 h and treated with TGF-[3 1 (3 ng/ml) for 15,
30, 45, or 60 min. CM-H
2
DCFDA stock solution was made at 1 mM in DMSO/HBSS
(Hanks' balanced salt solution) (50/50 %). Fifteen min before the each time point, 10 1l
CM-H
2
DCFDA stock solution was added to the cells at 5 ItM end-concentration, and 15 min later, cells were washed with HBSS, and the fluorescence was measured at excitation/emission of 488/525 nm with a Spectra Max Gemini EM plate reader from
Molecular devices (Sunnyvale, CA). Samples were triplicate for each time point.
2.2.5. Western blots
Cells were harvested on ice by scraping with the sample buffer containing 2% SDS.
Lysates were mixed with 2-mercaptoethanol and subjected to SDS-polyacrylamide gel electrophoresis on 10% precast gels (Bio-Rad, Hercules, CA). Proteins were transferred to polyvinylidene difluoride membranes (Immobilon-P; Millipore, Bedford, MA).
Membranes were blocked for 1 h in TBS (Triton-X-added PBS) containing 0.1% Tween
20 and 5% (w/v) nonfat dry milk powder and incubated overnight with an appropriate antibody in TBS containing 0.1% Tween 20 and 2.5% (w/v) nonfat dry milk powder at
4°C. The membranes were then washed with TBS containing 0.1% Tween 20 and incubated for 1 h with HRP-conjugated anti-rabbit secondary antibody (Cell Signaling
Technology, Beverly, MA). Blots were visualized with LumiGLO® reagent (Cell
Signaling Technology, Beverly, MA).
2.2.6. RNA interference
Cells were subcultured at 10% confluency in the normal growth medium without antibiotics. After 24 h, siRNA for human Smad4 gene (Cat# 16708, siRNA ID# 115648
70

(targeting exon 6), 115649 (targeting exon 7), 115650 (targeting exon 13), 50 nM,
Ambion, Austin, TX) was introduced with the Lipofectamine
M
2000 (2.5 tL/mL,
Invitrogen, Carlsbad, CA) in Opti-MEM medium (Invitrogen, Carlsbad, CA). Normal growth medium was added after 4 h, and the medium was changed to serum free medium after 24 h for the experiments. To check the trasfection efficiency, cells were trypsinized, washed with PBS twice, and analyzed using the fluorescence activated cell sorter (FACS).
To sort out the dead cells, 5 ,pg/mL 7-amino-actinomycin D was added to the cell suspension.
2.2.7. Statistical Analysis
The two-tailed, non-paired Student's t-test was used for the statistical analysis.
71

2.3. Results
2.3.1. TE expression induced by TGF-P1 in human adult skin fibroblasts
3 --111·-·-·--·-··11--11·14111·11-
2.5
I
I-
0
,m
1.5
1
2
T
T
T
0.5
u a
4 i
0 6
Time (h)
8 12 24
Figure 2-1. Time course for induction of TE gene expression by TGF-11 in adult
human dermal fibroblasts. Serum depleted cells were treated with 3 ng/ml TGF-P 1. At the indicated time, cells were harvested and relative TE mRNA levels were assessed by
Real-time PCR using HPRT as the control gene. Samples were triplicate for the each time point and the experiments were repeated three times, all resulting in the similar results.
Tropoelastin (TE) expression induced by TGF-3 1 in the human skin fibroblasts was previously described (29-31). Previously in our group, the time course for the TGF-[1induced increase in TE mRNA in human neonatal fibroblasts (R2F) was established using semi-quantitative RT-PCR. When the cells were stimulated with 3 ng/ml TGF-p 1, the relative TE mRNA steady state level was induced after 4 h, remained near the maximum between 6 and 12 h, and was still elevated at 24 h (29). We were interested in human adult skin fibroblasts (P 1F) because they would be closer to the in vivo condition and
72

might act differently. We found that human adult skin fibroblasts behaved in the same manner as the human neonatal fibroblasts (Fig. 2-1), but their responses were drastically attenuated after passage 9 with the morphological changes. For practical purposes, the neonatal fibroblasts were used in the subsequent experiments unless otherwise mentioned.
2.3.2. Involvement of ROS in TGF-P1 induced TE expression
Binding of TGF-[ 1 to its type II receptor and subsequent activation of the type I receptor stimulates formation of reactive oxygen species (ROS) in many cell types including keratinocytes, osteoblasts, and fibroblasts (32, 33). We have previously shown that ROS formed in response to TGF-P31 in dermal fibroblasts are involved in TE mRNA expression, since the TE mRNA level was decreased by N-acetylcysteine (NAC, 10 flavoenzymes such as NADPH oxidase (29). To identify where in the signaling cascade the ROS participated, we investigated ROS produced at different time points during incubation with TGF-P 1. TE mRNA was measured typically at 8 h, the maximum of production. Antioxidants were added either before or after TGF-3 1 at various times up to
2 h after TGF-3 1 addition. Figure 2-2 shows the results obtained with 10 mM NAC.
NAC added prior to TGF-[ 1 decreased TE mRNA levels about 75%. NAC was equally effective even when added up to 1.5 h after TGF-[31. However, when NAC was added 2.5
after TGF-3 1, it was not effective, suggesting that ROS produced during first 2 h are already engaged in the process to up-regulate TE mRNA expression.
Next, using DPI, a more specific inhibitor for NADPH, we found that DPI was able to inhibit the TE mRNA up-regulation only when added at the same time as TGF-
[or at 0.5 or 1 h after TGF- 1 incubation (Fig. 2-3A). Addition of DPI 1.5 h after TGF-
TGF-P 1 addition are important in the mechanism for the induction of TE mRNA. Also,
ROS produced by NADPH oxidase seem to be involved only in the early time period (1 h
73

and less), and some other sources may get engaged later. Therefore, we examined mitochondria as another source for ROS generation.
0.4
0.3
I
,,
.
I-,
0.2
0.1
T
T
T
0
CON No NAC -1 0 0.5 1 1.5
Time relative to TGF-31 addition
2.5
Figure 2-2. NAC added up to 1.5 h after TGF- 1 treatment inhibited TE gene
expression. Serum-depleted adult fibroblasts were treated with 3 ng/ml TGF-3 1. Nacetylcysteine (NAC), 10 mM was added either 1 h prior to TGF-P1 or 0.5, 1, 1.5 or 2.5 h after TGF-f 1. Eight hours following the TGF- 1 addition, cells were harvested and relative TE mRNA levels were determined. There is no statistical difference among the samples from -1 to 1.5. Samples were triplicate for each time point and the experiments were repeated three times, all resulting in similar results.
74

nt
I Jj e'J
-
A
R
0.02
w
0
'U
0.01
0-
T
-
CON
-
No DPI
-----
_
0
--
0.5
,
Time relative to TGF-31 addition
1 1.5
1 i in
I a-
0.8
0.6
0.4
0.2
0
1.2
I
CON No
MitoQ
-1 0.5 1 1.5
Time relative to TGF-31 addition
2
Figure 2-3. DPI and mitoQ inhibited TE gene expression. (A) Addition of NADPH oxidase inhibitor up to 1 h post-TGF- 1 decreases TE gene expression. Serum- depleted neonatal fibroblasts were treated with 3 ng/ml TGF-3 1. Diphenylene iodonium (DPI), 10 tiM, was added at the same time or 0.5, 1 or 1.5 h after TGF-31. Eight hours following
) Addition of mitochondria specific ROS inhibitor up to 1.5 h post-TGF-p1 decreases TE gene expression by 50%. Serum-depleted neonatal fibroblasts were treated with 3 ng/ml
75

TGF-f31. MitoQ, 10 nM, was added either 1 h prior to TGF-ff1 or 0.5, 1, 1.5, or 2 h after
TGF-[ 1. Eight hours following the TGF-P 1 addition, cells were harvested and relative
TE mRNA levels were determined. Samples were triplicate for the each time point and the experiments were repeated three times, all resulting in the similar results.
MitoQ is an extremely potent antioxidant which is covalently coupled with triphenylphosphonium cation, specifically targeted for mitochondria (34). It easily penetrates lipid bilayers by a noncarrier-mediated process and accumulates several hundredfold within mitochondria due to the large membrane potential (34). When the cells were pre-incubated with mitoQ, TE mRNA production was decreased about 50%, and the time course showed that mitoQ was equally effective even when added up to 1.5
h after TGF-P 1 (Fig. 2-3B). Therefore, ROS from mitochondria seem to be at least partial contributors for the early production of ROS. Also, blocking the ROS formed in mitochondria did not completely inhibit the TE mRNA production, indicating that other sources (e.g. NADPH oxidase) are still producing ROS which contribute to the TE mRNA production. On the other hand, blocking of NADPH oxidase was able to inhibit the TE mRNA production completely, suggesting that ROS from NADPH may affect
ROS production from mitochondria.
2.3.3. Pulse treatment vs. continuous treatment
In the experiments described so far, TGF-3 1 remained with the cells during the entire treatment. The results using antioxidants suggested that signaling leading to TE mRNA up-regulation was initiated during a short time period (< 2 h). To test the importance of the early period of time after the incubation of TGF-P 1 with the cells for the induction of
TE mRNA, the cells were incubated with TGF- 1 only for 30 min before the medium was change to fresh serum-free medium. The cells were incubated 7.5 h more and then
TE mRNA level was analyzed. Interestingly, the level of TE mRNA of the cells with 30 min pulse treatment was the same as that observed after 8 h continuous treatment with
TGF-P 1 (Fig. 2-4A). Also, Figure 2-4B shows that the time courses of both pulse and continuous treatments showed the same trend, reaching the maximum TE mRNA
76

induction at 8 h and decreasing to the basal level by 24 h after the treatment (compare to
Fig. 2-1).
A n
U. I
0.008
A
I a. 0.006
.2 0.004
0.002
T
T
Control 30 min 8 hours n nnA
V. UVUI
D T
0.003
I
LU
0.002
o
0.001
0
0
T
I
4
I
8
Time (h)
I
12
II
24
Figure 2-4. Pulse treatment (30 min) with TGF-1 has the same effect on TE mRNA level as continuous treatment. (A) Serum-depleted cells were treated with 3 ng/ml
TGF-3 1 for either 30 min or 8 h. After a total of 8 h, cells were harvested and relative TE mRNA levels were assessed by Real-time PCR using HPRT as the control gene. (B)
77

Serum-depleted cells were treated with 3 ng/ml TGF-p 1 and then incubated with serumfree medium for 7.5 h additionally. At the indicated times, cells were harvested and relative TE mRNA levels were assessed by Real-time PCR using HPRT as the control gene. Samples were triplicate for the each time point and the experiments were repeated twice, all resulting in the similar results.
2.3.4. ROS measurement
2.5
2
C
9 e-
1.5
0
OU
0.5
1
0
0 15 30 time (min)
45 60
Figure 2-5. TGF-P31 stimulates ROS production by dermal fibroblasts. Serumdepleted cells were treated with 3 ng/ml TGF-P 1. At the indicated times, intracellular
ROS was measured by incubating the cells with 5 gM CM-H
2
DCFDA and measuring the fluorescence of DCF (488/525 nm). Samples were triplicate for the each time point and the experiments were repeated three times, all resulting in the similar results.
*p<
0
.
0 5
TGF-f3 1 stimulates production of ROS in many cell types, including fibroblasts, and the
ROS participate in a variety of intracellular signaling pathways (20, 23, 35). The results
78

so far using inhibitors have indicated that ROS are involved in the TGF-3 1-induced TE expression in human skin fibroblasts. ROS levels after TGF-P 1 treatment were measured using CM-H
2
DCFDA, which is oxidized by ROS in cells to DCF (2'7'dichlorofluorescein). The increase in intracellular ROS was - 1.8 fold at 15 min and 30 min after the TGF-3 1 addition to the cells (Fig. 2-5). This result confirmed that ROS are indeed produced during the initial 30 min.
2.3.5. Requirement for new protein synthesis
0.002
0.0015
.
0.001
.
(U
0.0005
T
T
T
I~
0
TGF-31
Cycloheximide
L_
+ +
5 p1g/ml
+
10 jpg/ml
Figure 2-6. New protein synthesis is required for TE gene expression by TGF-P1.
Serum depleted cells were treated with 3 ng/ml TGF- 1 alone or with cycloheximide, a translation inhibitor. Cells were pretreated with cycloheximide for 1 h. Eight hours following the TGF- 1 addition, cells were harvested and relative TE mRNA levels were determined by Real-time PCR using HPRT as the control gene. Samples were triplicate for the each time point and the experiments were repeated three times, all resulting in the similar results.
79

The time course of TE mRNA induction showed that it took 4-6 h for the TE mRNA level to begin to increase in dermal fibroblasts. In lung fibroblasts, it also took 4-6 h for
TE mRNA level to increase, although the maximum expression was abserved at 24 h (36).
When cycloheximide, a translation inhibitor, was added to the cells, TE mRNA induction by TGF-p 1 was inhibited by 75% (Fig. 2-6). It suggests that the up-regulation of TE mRNA may require new protein synthesis.
2.3.6. Involvement of non-Smad pathways
In lung fibroblasts, stimulation of expression of extracellular matrix proteins including
TE involves non-Smad pathways in addition to Smad protein-mediated pathway in response to TGF-P 1 (37, 38). The role of ROS in these signaling pathways has not been explored. Some of the pathways involved in non-Smad-signaling cascades are also are activated by ROS, including protein kinase C, MAP kinase and PI3K pathways (39). We examined whether these pathways are involved in TGF-3 1-induced TE mRNA expression in human skin fibroblasts, and the role of ROS in the pathways. Specific kinase inhibitors of PKC, P38, ERK, JNK and PI3K, SB203580 (10 jiM), PD98059 (5 uM), calphostin C (200 nM), SP600125 (5uM) and Wortmannin (100 nM), respectively, were used. The indicated concentration for each inhibitor was the maximum concentration of dose-response experiments that did not cause any cellular toxicity.
Cellular toxicity was determined by observation of cell survival and proliferation as well as HPRT mRNA level. In case of lung fibroblasts, it was reported that PKC and p38
MAPK were involved in the mechanism, but not ERK MAPK (36). JNK and PI3K were not tested in that report. We found that TE up-regulation by TGF-P 1 was inhibited more than 90% by inhibitors of p38 and PKC, 75% by ERK inhibitor and 60% by JNK inhibitor in skin fibroblasts. No inhibition was observed by PI3K inhibitor (Fig. 2-7).
Therefore, we hypothesized that ROS might be involved in the MAPK or PKC pathways.
80

I .
A..
In
I.'
1.2
T|
~-
TI
I t n 0.8
o 0.6
1
0.4
T
0.2
0-
CON TGF-bl only l
MTN p38 l
PKC ERK
Inhibitors for
JNK P13K
Figure 2-7. Effect of kinase inhibitors for the selected signaling molecules in non-
Smad pathways on TGF- 1-induced TE mRNA. The kinases in the figure were inhibited with SB203580 (10 pM), PD98059 (5 uM), calphostin C (200 nM), SP600125
(5uM) and Wortmannin (100 nM), respectively. Cells were pre-incubated with these inhibitors for 30 min, and treated with TGF-31 for 8 h. Then, cells were harvested and relative TE mRNA levels were assessed by Real-time PCR using HPRT as the control gene. For each inhibitor, the designated concentration is highest concentration without toxicity to the cell. Samples were triplicate for the each time point and the experiments were repeated three times, all resulting in the similar results.
81

A
B
o
10 30 60 90 120 p-p38 p38
10mM
100 JlM
,~_ p-p38
Figure 2-8. p38 MAPK remains phosphorylated up to 120 min after TGFpI treatment and p-p38 level is not influence by antioxidants.
(A) Serum-depleted cells were treated with 3 ng/ml TGF-p 1 and p-p38 was detected by Western blot at times up to 2 h. (B) NAC (IOmM), DPI (10 J..lM)orTrolox (100 J..lM)was added before the
TGF-~I addition. After 1 h, cells were lysed with the sample buffer, and p-p38 levels were detected by Western blot. The experiments were repeated twice, all resulting in the same results.
82

A
o
10
B
only
,
)
A .......
-J
~ ~ -._
Trolox
>.I
.
• ~ 1'7.
'>.
.;; ~
I..
O .•..••.•••••••..•••••
..
~,~
~
,
..
>
(
Figure 2-9. ERK MAPK remains phosphorylated up to 120 min after TGFpI treatment and p-ERK level is not influence by antioxidants.
(A) Serum-depleted cells were treated with 3 ng/ml TGF-pl and p-ERK was detected by Western blot at times up to 2 h. (B) NAC (10mM), DPI (10 J.1M)orTrolox (100 J.1M)was added before the TGF-pl addition. After 1 h, cells were lysed with the sample buffer, and p-p38 levels were detected by Western blot. The experiments were repeated twice, all resulting in the same results.
To test the hypothesis, we targeted p38 and ERK MAPK pathways, and examined whether ROS are involved in the phosphorylation level of these kinases after the stimulation with TGF -p 1. P38 MAPK was rapidly phosphorylated in human skin fibroblasts (within 10 min), and remained phosphorylated up to 120 min (Fig. 2-8A).
When the cells were pre-treated with NAC, DPI, and Trolox (a water-soluble derivative of vitamin E) under conditions that inhibit TE mRNA > 75%, the level of phosphorylated p38 MAPK was not changed (Fig. 2-8B). Similarly, after addition ofTGF-pl, ERK
MAPK was also rapidly phosphorylated within 10 min, and remained phosphorylated up to 120 min after the treatment (Fig. 2-9A). When the cells were pre-treated with NAC,
83

DPI, and Trolox, it also did not affect the level of phosphorylated ERK MAPK (Fig. 2-
9B). Therefore, we conclude that TGF-p- induced ROS are not involved in phosphorylation of p38 or ERK MAPK, and may be involved down stream of these non-
Smad signaling cascade. PKC pathways have not been investigated for the ROS involvement because of the extremely complicated nature (i.e. a variety of isoforms of
PKC) of these pathways. Future work will be required in this area.
2.3.7. Involvement of the Smad pathway
The Smad pathway is the most common signal transduction pathway induced by TGF-
P (25). It was reported that TGF-[31-induced TE mRNA stabilization in lung fibroblasts involved both Smad and non-Smad pathways, although the involvement of ROS in these signaling mechanisms has not been reported (36). Potentially, ROS can be involved in various steps along the Smad pathway. First we tested whether ROS are involved in the the phosphorylation of Smad2. Smad2 was phosphorylated within 30 min in human skin fibroblasts, and the pre-treatment with NAC or DPI under the conditions that inhibit TE mRNA > 75%, the level of phosphorylated Smad2 was not changed (Fig. 2-10), suggesting that ROS are not involved in the phosphorylation of Smad2.
TGF-31
-
+ +
__
Figure 2-10. TGF-31-induced Smad2 phosphorylation is not mediated by ROS.
Serum-depleted cells were treated with 3 ng/ml TGF-[ 1 for 30 min in the presence or absence of 10 M DPI or 10 mM NAC. Cells were lysed with the sample buffer containing 2-mercaptoethanol for SDS-PAGE. Western blotting used anti-phospho-
Smad2 specific antibody, peroxidase-conjugated secondary antibody and chemiluminescence detection. Samples were triplicate for the each time point and the experiments were repeated three times, all resulting in the similar results.
84

o^"Fwhl nn1
I:
Io
L2
C5
To
O
FL1-H
Figure 2-11. FACS analysis for siRNA transfection efficiency. A: cells without siRNA or Lipofectamine, B: cells with siRNA and without Lipofectamine, C: cells without siRNA and with Lipofectamine, D: cells with siRNA and Lipofectamine. were subcultured at 10% confluency in the normal growth medium without antibiotics. After
24 h, 100 nM FAM-labeled scrambled siRNA and/or 5 jil/ml Lipofectamine
T M
2000 were introduced, and the normal growth medium was added after 4 h. After 24 h, cells were trypsinized, and analyzed by the fluorescence activated cell sorter (FACS). Upper quadrants represent the dead cells (7-amino-actinomycin D-positive cells). Right quadrants represent transfected cells (FAM-positive cells). Numbers shown are the percentage of the cells of each quadrant. The experiments were repeated three times, all resulting in the similar results.
85

To determine whether Smad pathway is involved in the TGF-P 1 induced TE mRNA up-regulation, we knocked down the Smad4 mRNA using RNA interference
(RNAi) technique. Smad4 is an essential protein in the Smad signaling pathway, forming a complex with phosphorylated Smad2/3 for the translocation of the whole complex into the nucleus, and the only co-Smad known so far in TGF-P/Smad signaling pathway. We were able to efficiently transfect the human skin fibroblasts primary cells with 100 nM siRNA and 5 l/ml Lipofectamine without toxicity to the cells (Fig. 2-11). However, the proliferation rate of the cells was only 50% of the control cells without siRNA or
Lipofectamine 48 h after the transfection. Therefore, we tried various concentrations of both siRNA and Lipofectamine to achieve as high the proliferation rate as the control cells, maintaining the substantial knock-down of Smad4 protein level. The concentration range of 50-100 nM siRNA and 2.5-5 ptl/ml Lipofectamine were all enough to knockdown more than 90% of the Smad4 protein in the human skin fibroblasts, and the cells treated with 50 nM siRNA and 2.5 Ill/ml Lipofectamine had the same proliferation rate as the control cells, and this condition was used for the subsequent experiments.
Next, we examined the time course for the Smad4 protein level after the siRNA transfection to determine the optimal time frame to test the TE mRNA induction by TGF-
I 1. We used three difference sequences of commercially available siRNA, and all of them result in > 90% reduction of the Smad2 protein level 48 - 72 h after the transfection
(Fig. 2-12).
86

24 h
48 h
72 h
+
+
+
+ +
+ +
GAPDH
GAPDH
GAPDH
Figure 2-12. Time course of the smad4 protein levels after the RNAi treatment. Cells were subcultured at 10% confluency in the normal growth medium without antibiotics.
After 24 h, 50 nM Smad4 specific siRNA (each lane with a difference sequence, see
~aterials and Methods for details) and/or 2.5 J.1VmlLipofectamine™2000 were introduced, and the normal growth medium was added after 4 h. Each time point after the transfection, cells were lysed with the sample buffer containing 2-mercaptoethanol for
SDS-PAGE, and each protein level was detected by Western blot. The experiments were repeated three times, all resulting in the similar results.
87

+ +
+ +
+
+
+ +
Figure 2-13. Smad4 RNAi and TGF-pl treatment.
Cells were sub~ultured at 10% confluency in the normal growth medium without antibiotics. After 24 h, 50 nM siRNA and/or 2.5 ,.d/ml Lipofectamine TM2000were introduced, and the normal growth medium was added after 4 h. Next day, the medium was changed to the serum-free medium, and the incubation was continued one more day. The indicated samples were treated with 3 ng/ml TGF -p 1 for 30 min, while the others were incubated with serum-free medium.
Cells were lysed with the sample buffer containing 2-mercaptoethanol for SDS-P AGE, and each protein level was detected by Western blot. Samples The experiments were repeated three times, all resulting in the similar results.
Next, we examined whether the knock-down ofSmad4 had any effect on the other aspects ofTGF-p/Smad signaling pathway, namely, the phosphorylation ofSmad2 and the Smad7 level. When cells were treated with TGF -p 1 for 30 min, Smad4 depleted cells had the same level of phophorylated Smad2 levels as the control cells without siRNA or
Lipofectamine (Fig. 2-13). Smad7 protein level also did not change by either the RNAi treatment or TGF-pl. These results indicated that TGF-pl initiated signaling via the
Smad pathway by phosphorylation of Smad2 and that the RNAi treatment did not alter the inhibitory effect of Smad7 in the signaling processes. Therefore, we assumed that this
88

level of RNAi treatment (- 75% Smad4 knock-down, measured by densitometry) would effectively inhibit the further downstream of the Smad signaling pathways, and investigated whether TE mRNA were induced by TGF-PI 1 in the absence of Smad signaling pathway.
The cells were transfected with Smad4 siRNA (ID# 115649), and treated with
TGF-[ 1 48 after the transfection for 8 h, and the TE mRNA level was compared with the control cells without siRNA transfection (Fig. 2-14). The transfected cells showed more than 90% decrease in the TE mRNA expression, suggesting that Smad pathways are essential in TGF-P 1- induced TE mRNA up-regulation in human skin fibroblast.
0.03
__I_______________
___
0.025
0.02
a.
I
(U 0.015
.2
C2
0.01
T
T
T
0.005
0
Control RNAi
(no TGF-b) (no TGF-b) l r m
Control + siRNA only Lipo only +
TGF-b + TGF-b TGF-b
RNAi +
TGF-b
Figure 2-14. TGF-p1-induced TE level after Smad4 RNAi treatment. Cells were subcultured at 10% confluency in the normal growth medium without antibiotics. After
24 h, 50 nM siRNA (ID# 115649) and/or 2.5 tpl/ml Lipofectamine
T M
2000 ("Lipo") were introduced, and the normal growth medium was added after 4 h. Next day, the medium was changed to the serum-free medium, and the incubation was continued one more day.
Then, cells were treated with 3 ng/ml TGF-31 for 8 h, and relative TE mRNA levels were assessed by Real-time PCR using HPRT as the control gene. Samples were triplicate for the each time point and the experiments were repeated twice, all resulting in the similar results.
89

+
+
+
+
+ +
Figure 2-15. Smad4 RNAi and TGF-(31 treatment. Cells were subcultured at 10% confluency in the normal growth medium without antibiotics. After 24 h, 50 oM siRNA and/or 2.5 J.1l1mlLipofectamine™2000 were introduced, and the normal growth medium was added after 4 h. Next day, the medium was changed to serum-free medium, and the incubation was continued one more day. The indicated samples were treated with 3 ng/ml
TGF-p1 for 30 min, while the others were incubated with serum-free medium. Cells were lysed with sample buffer containing 2-mercaptoethanol for SDS-P AGE, and each protein level was detected by Western blot. The experiments were repeated three times, all resulting in the similar results.
2.3.8. Crosstalk between Smad and non-Smad pathways
So far, the results indicate that not only the Smad pathway but also non-Smad pathways such as p38, ERK, JNK, and PKC pathways are required for up-regulation of
TE mRNA level by TGF-p1, but the relationship between Smad and non-Smad pathways is not clear. We tested whether p38 signal transduction is affected by the Smad pathway by employing Smad4 RNAi. With Smad4 knockdown (> 90% protein level),
90

phosphorylation of p38 was entirely inhibited after TGF-3 1 treatment (Fig. 2-1 5), suggesting that the Smad pathway and p38 pathway might be linked sequentially. To exclude the possibility of non specific inhibition of phosphorylation of p38 by RNAi treatment itself, instead of TGF-3 1 some other known stimuli for p38 phosphorylation can be introduced to Smad4 depleted cells, and check the level of phosphorylated p38.
Influence on ERK phosphorylation by Smad4 knockdown was also explored, but results were not very clear and need to be confirmed later.
91

2.4. Discussion
Chronic exposure of skin to UVR causes significant changes in the dermal extracellular matrix, including solar elastosis (1, 2). Involvement of ROS in the development of solar elastosis has been demonstrated by many studies. Solar elastosis was inhibited by antioxidants during the course of chronic UVB exposure in murine skin
(40-43). Also, a green tea constituent which possesses antioxidant activity reduced acute and chronic UVB-induced skin damage (42, 43). It was reported that the topical application of benzoyl peroxide produced skin changes similar to photoaging including increase in elastin content in murine skin (44). Results of recent studies demonstrating that externally supplied hydrogen peroxide increased the TE mRNA or activity of the TE promoter in dermal fibroblasts also suggest that ROS may be involved in development of solar elastosis (5, 45). TGF-PI is one of the cytokines induced by UVR (15, 16, 46). Also, several studies have shown that TGF-P 1 was able to induce TE expression in dermal fibroblasts (14, 30, 47). In this study, we showed that ROS are essential components in the TGF-1 1-induced TE mRNA expression, and the mechanism involves both Smad and non-Smad pathways.
We have previously shown that intracellular ROS formed in response to TGF-1 are involved in TE mRNA expression (29). TGF- 1 stimulates production of ROS in a variety of cell types including fibroblasts (20-23). Here, we examined NADPH oxidase and mitochondria as potential sources for ROS production. Our results show that the ROS produced in the first 1-2 h after TGF-,B 1 addition are important in the mechanism for the induction of TE mRNA. Also, ROS produced by NADPH are involved only in early time period (1 h and shorter), and those from mitochondria may act for longer period of time
(Fig. 2-2, 2-3). The importance of NADPH oxidase for the production of ROS in response to various cytokines including TGF-[1 in fibroblasts has been addressed in many studies (20, 23, 24, 48). Most of these studies have shown very rapid and transient
ROS formation by TGF-P1 (5-15 min). However, delayed and continuous ROS production was also reported, and sources were thought to be mitochondia, cytochrome p450, cyclooxygenase, xanthine oxidase and NADH oxidase (21, 22, 28, 49). Direct
92

measurement of ROS produced in the dermal fibroblasts by TGF-3 1 showed rapid formation of ROS during 15-30 min after TGF-P 1 addition (Fig. 2-5). ROS production during this early period time period seems critical for the induction of TE mRNA expression, supported by the fact that 30 min pulse treatment with TGF-[ 1 not only induced the same level of TE mRNA, but also followed the same time course (Fig. 2-4, also see Fig. 2-1). Why were antioxidants effective up to 2 h after TGF-P 1 addition when
ROS formation stops within 30 min? It can postulated that TGF-3 1 may down-regulate the endogenous antioxidant system which lasts up to 2 h, in addition to the induction of oxidative stress. It was reported that TGF-p 1-suppressed of glutathione antioxidant defenses in hepatocytes (50), even though this suppression occurred after longer incubation (-48 h) with TGF-3.
Involvement of both Smad and non-Smad pathways has been described for various target gene regulation by TGF-P in many cell types. The TGF-3-induced non-
Smad pathways involve protein kinase C (PKC), MAP kinase pathways (ERK, JNK, and p38) and PI3K (25, 36). We investigated whether any of these pathways are involved in the TGF-P 1 induced TE mRNA up-regulation in human dermal fibroblasts. Indeed, PKC,
ERK and p38 MAP kinase pathways are indispensable in this mechanism, and JNK pathway also seems partially involved (Fig. 2-7). Involvement of ROS in TGF-P induced
MAP kinase pathways are described in many other cell types (20, 51, 52). TGF-[induced p38 MAPK phosphorylation was inhibited by antioxidants in human keratinocytes (20) and rat hepatocytes (51). Also, TGF-p-stimulated ERK and JNK phosphorylation was inhibited by an antioxidant in articular chondrocytes (52). Both exogenous treatment and endogenous production of hydrogen peroxide have been suggested to contribute to cellular signaling by inhibiting protein tyrosine phosphatases
(PTPs), and the interplay between the inhibition of PTPs and the activation of MAPK by hydrogen peroxide was described in Jurkat T cells (53). Surprisingly, we found that ROS are not involved either in p38 or in ERK phosphorylation in our condition (Figs. 2-8, 2-9).
We have not fully explored involvement of different isoforms of PKC in this study. Also, possible involvement of ROS in the phosphorylation of PKC was not studies here.
However, it was already shown that various isoforms of PKC were phosphorylated in
93

response to ROS in various cell types (54, 55). Future study will be necessary regarding
ROS involvement in PKC pathway. On the other hand, ROS production can be mediated by various Smad or non-Smad pathways. In fact, activation of NADPH oxidase by PKCr,
ERK2 and p38MAPK were described (56, 57). These possibilities have not been investigated in this study.
Although some genes are inducible by non-Smad pathway only (58, 59), Smad and non-Smad pathways are often work together at various levels (25, 60-63). Although our preliminary study has shown that ROS are not involved in the phosphorylation of
Smad2 in dermal fibroblast (Fig. 2-10) in contrast to other cell types (52), possibility of involvement of Smad pathway was an open question. We were able to successfully knock down Smad4 levels using the RNA interference technique, and found that TE mRNA induction by TGF-P1 was almost completely inhibited in this system (Fig. 2-14).
Therefore, it seems that both Smad and non-Smad pathways are essential for the TGF-pinduced TE mRNA up-regulation in human dermal fibroblasts. Crosstalk between Smad and p38 pathways was examined as an example of possible crosstalk between Smad and non-Smad pathways. The result showed that phosphorylation of p38 MAPK by TGF- is inhibited by Smad4 knock-down, suggesting a sequential link between the Smad pathway and p38 MAPK pathway. Engel et al. (60) suggested phosphorylation of Smad3 by JNK might facilitate nuclear translocation. Another study showed that both Smad and p38
MAPK were required for the regulation of biglycan gene expression by TGF-[, but p38
MAPK activation was abolished by overexpression of Smad7, which demonstrated the serial connection between Smad and p38 pathways (64). However, in their system, phosphorylation of p38 was first noticed 1 h after TGF-P addition. Considering the rapid phosphorylation (within 10 min) of p38 MAPK by TGF-P1 in dermal fibroblasts, another possible explanation of our result is that the decrease of endogenous level of Smad2/3-
Smad4 transcription factor might have affected the basal level of some kinases or phosphatases that are crucial for the phosphorylation of p38 MAPK.
TGF-P 1 binds rapidly to its receptors and is internalized and degraded by lysosomal enzymes within 4 h at 37 C (65). Also, TGF-p receptors remain active for at least 2-3 h after ligand binding in fibroblasts (66), and almost complete Smad2/3 nuclear translocation occurs in 30 min (66, 67). Nevertheless, our result shows that it takes 4-6 h
94

for TE mRNA level to begin to increase with the maximal increase at 8 h post incubation in human dermal fibroblasts (Fig. 2-1). Same 4-6 h lag time was observed in lung fibroblast (36), although the maximum time point for TE mRNA was different (24 h in lung fibroblasts). Therefore, up-regulation of TE mRNA may not be the direct target of transcriptional regulation by the Smad pathway. Both transcriptional and posttranscriptional regulation of TE mRNA by TGF-P 1 has been described (see chapter
1.5.4.2). In lung fibroblasts, it was shown that TGF-p 1 had no effect on transcription of the elastin gene, but did stabilize elastin mRNA (36, 38, 68). In those studies, it was shown that both Smad and non-Smad pathways (including PKC and p38) contributed to
TE mRNA stabilization. Also, when cycloheximide was added to the cell culture, TE mRNA induction was significantly inhibited (Fig. 2-6), suggesting that synthesis of new proteins (e.g. transcription factors) may be required for this mechanism. Therefore, we postulate that ROS may be involved in synthesis or activation of transcription factors that can affect the stability of TE mRNA. For example, CREB binding protein (CBP)/p300 can form a complex with Smad proteins, and ROS were shown to increase complex formation between CBP/p300 and other transcriptional factors such as Nuclear factor-KB
(NF-KB) (69). NF-KB is an inducible transcription factor that is a likely target for ROS signal transduction (70). NF-KB was reported to be involved in the anti-apoptotic mechanism by TGF-[ in hepatic stellate cells (71). Also, a crosstalk pathway between
Smad7 and NF-KB was proposed in a study about anti-inflammatory mechanism by TGF-
3 in a rat model (72). There are two forms of NF- KB in the cell, an inactive form in the cytosol and an active form in the nucleus. Cytosolic NF-KB can be activated by a variety of stimuli including cytokines, physical stress such as UV and ionizing radiation, and
ROS, such as H
2
0
2
.
Activator protein-i (AP-1) also appears to be activated by ROS. The
AP-1 element binds the protooncogene products jun and fos (73), and it is well known that ROS activates the genes forjun andfos, elements (74). Also, estrogen-induced ROS increased phosphorylation of c-jun as well as the binding of AP-1 (75). AP-1 and Smad proteins can work together resulting in TGF-p-induced transcription (76).
95

~
..
1 ~ ...
Cytoplasm
~~ Nucleus
TE ~~~A ....
stablllzmg proteins
Tropoelastin mRNA increase
.
In dermal fibroblasts
Figure 2-16. Overall schematic diagram.
ROS are produced from NADPH oxidase and mitochondria upon the TOF-~ 1 ligand binding to its receptors. ROS are essential to induce TE mRNA expression in human dermal fibroblasts. Both Smad and some non-
Smad pathways are required for this mechanism. However, ROS are not involved in the phosphorylastion ofSmad2 or ERK or p38 (designated by X).
Overall mechanism is summarized in Figure 2-16. In this study, we have demonstrated the involvement of both NADPH oxidase and mitochondria in the TOF-~linduced TE mRNA up-regulation in human dermal fibroblasts and the importance of the early production of ROS by TO F-~ 1 in this mechanism. Upon TOF -~ 1 ligand binding to its receptors, an increase of ROS level in the cells « 30 min) produced by NADPH oxidase and mitochondria triggers the initial step of TE mRNA up-regulation. ROS produced from NADPH oxidase within 1 h influence TE mRNA up-regulation. ROS from NADPH oxidase seem to affect the production of ROS from mitochondria, and
ROS from mitochondria make contribution to TE mRNA up-regulation for longer period of time (up to 2 h). Also, we showed that both Smad and non-Smad pathways including
96

p38 and ERK MAPK pathways are important in the mechanism, however, ROS are not involved in the phosphorlation of Smad2 or p38 or ERK. Interestingly, phosphorylation of p38 seems to be mediated by Smad4. Further research will be required to figure out where in these pathways ROS are involved, and how Smad and non-Smad pathways are connected to each other.
97

References
1.
2.
3.
4.
5.
6.
7.
8.
9.
El-Domyati, M., Attia, S., Saleh, F., Brown, D., Birk, D. E., Gasparro, F., Ahmad,
H., and Uitto, J. (2002) Intrinsic aging vs. photoaging: a comparative histopathological, immunohistochemical, and ultrastructural study of skin. Exp
Dermatol 11, 398-405
Lavker, R. M., and Kligman, A. M. (1988) Chronic heliodermatitis: a morphologic evaluation of chronic actinic dermal damage with emphasis on the role of mast cells. J. Invest. Dermatol. 90, 325-330
Kielty, C. M., Sherratt, M. J., and Shuttleworth, C. A. (2002) Elastic fibres. J Cell
Sci 115, 2817-2828
Bernstein, E. F., Chen, Y. Q., Tamai, K., Shepley, K. J., Resnik, K. S., Zhang, H.,
Tuan, R., Mauviel, A., and Uitto, J. (1994) Enhanced elastin and fibrillin gene expression in chronically photodamaged skin. J. Invest. Dermatol. 103, 182-186
Bernstein, E. F., Brown, D. B., Urbach, F., Forbes, D., Del Monaco, M., Wu, M.,
Katchman, S. D., and Uitto, J. (1995) Ultraviolet radiation activates the human elastin promoter in transgenic mice: a novel in vivo and in vitro model of cutaneous photoaging. J Invest. Dermatol. 105, 269-273
Seo, J. Y., Lee, S. H., Youn, C. S., Choi, H. R., Rhie, G. E., Cho, K. H., Kim, K.
H., Park, K. C., Eun, H. C., and Chung, J. H. (2001) Ultraviolet radiation increases tropoelastin mRNA expression in the epidermis of human skin in vivo. J
Invest Dermatol 116, 915-919
Starcher, B., Pierce, R., and Hinek, A. (1999) UVB irradiation stimulates deposition of new elastic fibers by modified epithelial cells surrounding the hair follicles and sebaceous glands in mice. JInvest Dermatol 112, 450-455
Sephel, G. C., Buckley, A., and Davidson, J. M. (1987) Developmental initiation of elastin gene expression by human fetal skin fibroblasts. J Invest Dermatol 88,
732-735
Parks, W. C. (1997) Posttranscriptional regulation of lung elastin production. Am
JRespir Cell Mol Biol 17, 1-2
10. Ritz-Timme, S., Laumeier, I., and Collins, M. J. (2003) Aspartic acid racemization: evidence for marked longevity of elastin in human skin. Br J
Dermatol 149, 951-959
11. Davison, J. M., Zang, M.-C., Zoia, O and Giro, M.G. (1995) Regulation of elastin synthesis in pathological states. In The molecular biology abnd pathology of
98

elastic tissues Vol. 192 pp. 81-99, Ciba Foundation Symposium, Wiley,
Chichester
12. Kondo, S. (2000) The roles of cytokines in photoaging. J. Dermatol. Sci. 23(1),
S30-S36
13. Roberts, A. B., and Sporn, M. B. (1992) Differential expression of the TGF-beta isoforms in embryogenesis suggests specific roles in developing and adult tissues.
Mol. Reprod. Dev. 32, 91-98
14. Kossodo, S., Wong, W. R., Simon, G., and Kochevar, I. E. (2004) Effects of UVR and UVR-induced cytokines on production of extracellular matrix proteins and proteases by dermal fibroblasts cultured in collagen gels%. Photochem Photobiol
79, 86-93
15. Wang, H., and Kochevar, I. E. (2005) Involvement of UVB-induced reactive oxygen species in TGF-beta biosynthesis and activation in keratinocytes. Free
Radic Biol Med 38, 890-897
16. Scordi, I. A., and Vincek, V. (2000) Timecourse study of UVB-induced cytokine induction in whole mouse skin. Photodermatol Photoimmunol Photomed 16, 67-
73
17. Katchman, S. D., Hsu-Wong, S., Ledo, I., Wu, M., and Uitto, J. (1994)
Transforming growth factor-beta up-regulates human elastin promoter activity in transgenic mice. Biochem Biophys Res Commun 203, 485-490
18. Lindstedt, K. A., Wang, Y., Shiota, N., Saarinen, J., Hyytiainen, M., Kokkonen, J.
O., Keski-Oja, J., and Kovanen, P. T. (2001) Activation of paracrine TGF-betal signaling upon stimulation and degranulation of rat serosal mast cells: a novel function for chymase. Faseb J. 15, 1377-1388
19. Taipale, J., Saharinen, J., and Keski-Oja, J. (1998) Extracellular matrix-associated transforming growth factor-beta: role in cancer cell growth and invasion. Adv
Cancer Res 75, 87-134
20. Chiu, C., Maddock, D. A., Zhang, Q., Souza, K. P., Townsend, A. R., and Wan,
Y. (2001) TGF-beta-induced p38 activation is mediated by Rac -regulated generation of reactive oxygen species in cultured human keratinocytes. Int J Mol
Med 8, 251-255
21. Herrera, B., Murillo, M. M., Alvarez-Barrientos, A., Beltran, J., Fernandez, M., and Fabregat, I. (2004) Source of early reactive oxygen species in the apoptosis induced by transforming growth factor-beta in fetal rat hepatocytes. Free Radic
Biol Med 36, 16-26
22. Jiang, Z., Seo, J. Y., Ha, H., Lee, E. A., Kim, Y. S., Han, D. C., Uh, S. T., Park,
C. S., and Lee, H. B. (2003) Reactive oxygen species mediate TGF-betal-induced
99

plasminogen activator inhibitor-i upregulation in mesangial cells. Biochem
Biophys Res Commun 309, 961-966
23. Junn, E., Lee, K. N., Ju, H. R., Han, S. H., Im, J. Y., Kang, H. S., Lee, T. H., Bae,
Y. S., Ha, K. S., Lee, Z. W., Rhee, S. G., and Choi, I. (2000) Requirement of hydrogen peroxide generation in TGF-beta 1 signal transduction in human lung fibroblast cells: involvement of hydrogen peroxide and Ca2+ in TGF-beta 1induced IL-6 expression. JlImmunol 165, 2190-2197
24. Lee, Z. W., Kwon, S. M., Kim, S. W., Yi, S. J., Kim, Y. M., and Ha, K. S. (2003)
Activation of in situ tissue transglutaminase by intracellular reactive oxygen species. Biochem Biophys Res Commun 305, 633-640
25. Derynck, R., and Zhang, Y. E. (2003) Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 425, 577-584
26. Gooch, J. L., Gorin, Y., Zhang, B. X., and Abboud, H. E. (2004) Involvement of calcineurin in transforming growth factor-beta-mediated regulation of extracellular matrix accumulation. JBiol Chem 279, 15561-15570
27. Lambeth, J. D. (2004) NOX enzymes and the biology of reactive oxygen. Nat Rev
Immunol 4, 181-189
28. Albright, C. D., Salganik, R. I., Craciunescu, C. N., Mar, M. H., and Zeisel, S. H.
(2003) Mitochondrial and microsomal derived reactive oxygen species mediate apoptosis induced by transforming growth factor-betal in immortalized rat hepatocytes. J Cell Biochem 89, 254-261
29. Mitsumoto, A., Choi, W., and Kochevar, I. E. (submitted) Involvement of
Reactive Oxygen Species in Tropoelastin mRNA Induced in Human Dermal
Fibroblasts. Free Radic. Biol. Med.
30. Kahari, V. M., Olsen, D. R., Rhudy, R. W., Carrillo, P., Chen, Y. Q., and Uitto, J.
(1992) Transforming growth factor-beta up-regulates elastin gene expression in human skin fibroblasts. Evidence for post-transcriptional modulation. Lab Invest
66, 580-588
31. Tajima, S., and Izumi, T. (1996) Differential in vitro responses of elastin expression to basic fibroblast growth factor and transforming growth factor beta 1 in upper, middle and lower dermal fibroblasts. Arch Dermatol Res 288, 753-756
32. Thannickal, V. J., Day, R. M., Klinz, S. G., Bastien, M. C., Larios, J. M., and
Fanburg, B. L. (2000) Ras-dependent and -independent regulation of reactive oxygen species by mitogenic growth factors and TGF-betal. Faseb J 14, 1741-
1748
33. Thannickal, V. J., and Fanburg, B. L. (2000) Reactive oxygen species in cell signaling. Am JPhysiol Lung Cell Mol Physiol 279, L1005-1028
100

34. Jauslin, M. L., Meier, T., Smith, R. A., and Murphy, M. P. (2003) Mitochondriatargeted antioxidants protect Friedreich Ataxia fibroblasts from endogenous oxidative stress more effectively than untargeted antioxidants. Faseb J 17, 1972-
1974
35. Thannickal, V. J., Aldweib, K. D., and Fanburg, B. L. (1998) Tyrosine phosphorylation regulates H202 production in lung fibroblasts stimulated by transforming growth factor betal. JBiol Chem 273, 23611-23615
36. Kucich, U., Rosenbloom, J. C., Abrams, W. R., and Rosenbloom, J. (2002)
Transforming growth factor-beta stabilizes elastin mRNA by a pathway requiring active Smads, protein kinase C-delta, and p38. Am JRespir Cell Mol Biol 26, 183-
188
37. Kucich, U., Rosenbloom, J. C., Abrams, W. R., and Rosenbloom, J. (2002)
Transforming growth factor-beta stablizes elastin mRNA by a pathway requiring active Smads, protein kinase C-delta, and p38. Am. J Respir. Cell Mol. Biol. 26,
183-188
38. Kucich, U., Rosenbloom, J. C., Abrams, W. R., Bashir, M. M., and Rosenbloom,
J. (1997) Stabilization of elastin mRNA by TGF-beta: initial characterization of signaling pathway. Am J Respir Cell Mol Biol 17, 10-16
39. Martindale, J. L., and Holbrook, N. J. (2002) Cellular response to oxidative stress: signaling for suicide and survival. J Cell Physiol 192, 1-15
40. Bissett, D. L., Chatterjee, R., and Hannon, D. P. (1990) Photoprotective effect of superoxide-scavenging antioxidants against ultraviolet radiation-induced chronic skin damage in the hairless mouse. Photodermatol Photoimmunol Photomed 7,
56-62
41. Bissett, D. L., Majeti, S., Fu, J. J., McBride, J. F., and Wyder, W. E. (1990)
Protective effect of topically applied conjugated hexadienes against ultraviolet radiation-induced chronic skin damage in the hairless mouse. Photodermatol
Photoimmunol Photomed 7, 63-67
42. Vayalil, P. K., Mittal, A., Hara, Y., Elmets, C. A., and Katiyar, S. K. (2004)
Green tea polyphenols prevent ultraviolet light-induced oxidative damage and matrix metalloproteinases expression in mouse skin. JInvest Dermatol 122, 1480-
1487
43. Katiyar, S. K., Afaq, F., Perez, A., and Mukhtar, H. (2001) Green tea polyphenol
(-)-epigallocatechin-3-gallate treatment of human skin inhibits ultraviolet radiation-induced oxidative stress. Carcinogenesis 22, 287-294
44. Ibbotson, S. H., Moran, M. N., Nash, J. F., and Kochevar, I. E. (1999) The effects of radicals compared with UVB as initiating species for the induction of chronic cutaneous photodamage. JInvest Dermatol 112, 933-938
101

45. Kawaguchi, Y., Tanaka, H., Okada, T., Konishi, H., Takahashi, M., Ito, M., and
Asai, M. (1997) Effect of reactive oxygen species on the elastin mRNA expresssion in cultured human dermal fibroblasts. Free Radic. Biol. Med. 23, 162-
165
46. Lee, H. S., Kooshesh, F., Sauder, D. N., and Kondo, S. (1997) Modulation of
TGF-beta 1 production from human keratinocytes by UVB. Exp. Dermatol. 6,
105-110
47. Mauviel, A., Chen, Y. Q., Kahari, V. M., Ledo, I., Wu, M., Rudnicka, L., and
Uitto, J. (1993) Human recombinant interleukin-1 beta up-regulates elastin gene expression in dermal fibroblasts. Evidence for transcriptional regulation in vitro and in vivo. JBiol Chem 268, 6520-6524
48. Meier, B., Radeke, H. H., Selle, S., Younes, M., Sies, H., Resch, K., and
Habermehl, G. G. (1989) Human fibroblasts release reactive oxygen species in response to interleukin-1 or tumour necrosis factor-alpha. Biochem J 263, 539-
545
49. Thannickal, V. J., and Fanburg, B. L. (1995) Activation of an H202-generating
NADH oxidase in human lung fibroblasts by transforming growth factor beta 1. J
Biol Chem 270, 30334-30338
50. Franklin, C. C., Rosenfeld-Franklin, M. E., White, C., Kavanagh, T. J., and
Fausto, N. (2003) TGFbetal-induced suppression of glutathione antioxidant defenses in hepatocytes: caspase-dependent post-translational and caspaseindependent transcriptional regulatory mechanisms. Faseb J 17, 1535-1537
51. Herrera, B., Fernandez, M., Roncero, C., Ventura, J. J., Porras, A., Valladares, A.,
Benito, M., and Fabregat, I. (2001) Activation of p38MAPK by TGF-beta in fetal rat hepatocytes requires radical oxygen production, but is dispensable for cell death. FEBS Lett 499, 225-229
52. Li, W. Q., Qureshi, H. Y., Liacini, A., Dehnade, F., and Zafarullah, M. (2004)
Transforming growth factor Betal induction of tissue inhibitor of metalloproteinases 3 in articular chondrocytes is mediated by reactive oxygen species. Free Radic Biol Med 37, 196-207
53. Lee, K., and Esselman, W. J. (2002) Inhibition of PTPs by H(2)0(2) regulates the activation of distinct MAPK pathways. Free Radic Biol Med 33, 1121-1132
54. Konishi, H., Tanaka, M., Takemura, Y., Matsuzaki, H., Ono, Y., Kikkawa, U., and Nishizuka, Y. (1997) Activation of protein kinase C by tyrosine phosphorylation in response to H202. Proc Natl Acad Sci USA 94, 11233-11237
55. Talior, I., Yarkoni, M., Bashan, N., and Eldar-Finkelman, H. (2003) Increased glucose uptake promotes oxidative stress and PKC-delta activation in adipocytes of obese, insulin-resistant mice. Am JPhysiol Endocrinol Metab 285, E295-302
102

56. Frey, R. S., Rahman, A., Kefer, J. C., Minshall, R. D., and Malik, A. B. (2002)
PKCzeta regulates TNF-alpha-induced activation of NADPH oxidase in endothelial cells. Circ Res 90, 1012-1019
57. Dang, P. M., Morel, F., Gougerot-Pocidalo, M. A., and Benna, J. E. (2003)
Phosphorylation of the NADPH oxidase component p67(PHOX) by ERK2 and
P38MAPK: selectivity of phosphorylated sites and existence of an intramolecular regulatory domain in the tetratricopeptide-rich region. Biochemistry 42, 4520-
4526
58. Sirard, C., Kim, S., Mirtsos, C., Tadich, P., Hoodless, P. A., Itie, A., Maxson, R.,
Wrana, J. L., and Mak, T. W. (2000) Targeted disruption in murine cells reveals variable requirement for Smad4 in transforming growth factor beta-related signaling. JBiol Chem 275, 2063-2070
59. Hocevar, B. A., Brown, T. L., and Howe, P. H. (1999) TGF-beta induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4independent pathway. Embo J 18, 1345-1356
60. Engel, M. E., McDonnell, M. A., Law, B. K., and Moses, H. L. (1999)
Interdependent SMAD and JNK signaling in transforming growth factor-betamediated transcription. JBiol Chem 274, 37413-37420
61. Hall, M. C., Young, D. A., Waters, J. G., Rowan, A. D., Chantry, A., Edwards, D.
R., and Clark, I. M. (2003) The comparative role of activator protein 1 and Smad factors in the regulation of Timp- 1 and MMP- 1 gene expression by transforming growth factor-beta 1. JBiol Chem 278, 10304-10313
62. Selvamurugan, N., Kwok, S., Alliston, T., Reiss, M., and Partridge, N. C. (2004)
Transforming growth factor-beta 1 regulation of collagenase-3 expression in osteoblastic cells by cross-talk between the Smad and MAPK signaling pathways and their components, Smad2 and Runx2. JBiol Chem 279, 19327-19334
63. Abecassis, L., Rogier, E., Vazquez, A., Atfi, A., and Bourgeade, M. F. (2004)
Evidence for a role of MSK1 in transforming growth factor-beta-mediated responses through p38alpha and Smad signaling pathways. JBiol Chem 279,
30474-30479
64. Ungefroren, H., Lenschow, W., Chen, W. B., Faendrich, F., and Kalthoff, H.
(2003) Regulation of biglycan gene expression by transforming growth factorbeta requires MKK6-p38 mitogen-activated protein Kinase signaling downstream of Smad signaling. JBiol Chem 278, 11041-11049
65. Wakefield, L. M., Smith, D. M., Masui, T., Harris, C. C., and Sporn, M. B. (1987)
Distribution and modulation of the cellular receptor for transforming growth factor-beta. J Cell Biol 105, 965-975
103

66. Inman, G. J., Nicolas, F. J., and Hill, C. S. (2002) Nucleocytoplasmic shuttling of
Smads 2, 3, and 4 permits sensing of TGF-beta receptor activity. Mol Cell 10,
283-294
67. Lo, R. S., and Massague, J. (1999) Ubiquitin-dependent degradation of TGF-betaactivated smad2. Nat Cell Biol 1, 472-478
68. Kucich, U., Rosenbloom, J. C., Shen, G., Abrams, W. R., Blaskovich, M. A.,
Hamilton, A. D., Ohkanda, J., Sebti, S. M., and Rosenbloom, J. (1998)
Requirement for geranylgeranyl transferase I and acyl transferase in the TGFbeta-stimulated pathway leading to elastin mRNA stabilization. Biochem Biophys
Res Commun 252, 111-116
69. Rahman, I., Marwick, J., and Kirkham, P. (2004) Redox modulation of chromatin remodeling: impact on histone acetylation and deacetylation, NF-kappaB and proinflammatory gene expression. Biochem Pharmacol 68, 1255-1267
70. Flohe, L., Brigelius-Flohe, R., Saliou, C., Traber, M. G., and Packer, L. (1997)
Redox regulation of NF-kappa B activation. Free Radic Biol Med 22, 1115-1126
71. Saile, B., Matthes, N., El Armouche, H., Neubauer, K., and Ramadori, G. (2001)
The bcl, NFkappaB and p53/p21WAF1 systems are involved in spontaneous apoptosis and in the anti-apoptotic effect of TGF-beta or TNF-alpha on activated hepatic stellate cells. Eur J Cell Biol 80, 554-561
72. Ng, Y. Y., Hou, C. C., Wang, W., Huang, X. R., and Lan, H. Y. (2005) Blockade of NFkappaB activation and renal inflammation by ultrasound-mediated gene transfer of Smad7 in rat remnant kidney. Kidney Int Suppl, S83-91
73. Paul, M., Zintz, M., Bocker, W., and Dyer, M. (1995) Characterization and functional analysis of the rat endothelin-1 promoter. Hypertension 25, 683-693
74. Cheng, T. H., Shih, N. L., Chen, S. Y., Wang, D. L., and Chen, J. J. (1999)
Reactive oxygen species modulate endothelin-I-induced c-fos gene expression in cardiomyocytes. Cardiovasc Res 41, 654-662
75. Felty, Q., Xiong, W. C., Sun, D., Sarkar, S., Singh, K. P., Parkash, J., and Roy, D.
(2005) Estrogen-induced mitochondrial reactive oxygen species as signaltransducing messengers. Biochemistry 44, 6900-6909
76. Zhang, Y., and Derynck, R. (1999) Regulation of Smad signalling by protein associations and signalling crosstalk. Trends Cell Biol 9, 274-279
104

105

3.1. Introduction
Chronic exposure of human skin to solar ultraviolet radiation (UVR) causes marked morphological, structural and biochemical changes that are collectively termed photoaging. The visible manifestations of photoaging include leathery dryness, skin laxity, fine and course deep wrinkles, hypo- and hyperpigmentation, and premalignant and malignant neoplasms (1). Many of the changes responsible for these signs of photoaging occur in the dermal connective tissue. Major alterations include increased elastin content with an amorphous appearance, collagen remodeling, various kinds of inflammatory cell infiltration, and increased level of ground substances, such as proteoglycans (PGs) and glycosaminoglycans (GAGs) (1-3).
The deposition of massive amounts of abnormal elastic material, termed solar elastosis, is a hallmark of photoaged skin. Elastin, the major protein of elastic fibers, is produced from a soluble precursor, tropoelastin (TE), that undergoes oxidation by lysyl oxidase. The oxidized lysines then participate in reactions to form intermolecular and intramolecular crosslinks (desmosine, isodesmosine, and others) (4). Synthesis of TE, a
68-kDa protein, by dermal fibroblasts occurs mainly during development and early childhood although TE gene expression is reactivated in pathological conditions (4). The
TE mRNA level has been reported to be higher in photoaged skin than age-matched nonsun-exposed skin (5-7) and in experimentally photoaged mice (8). A strong correlation exists between tropoelastin mRNA levels and the protein synthesis indicating elastin synthesis is mainly under pre-translational control with both pre-and post-transcriptional control mechanisms described (9, 10). Also, the increase in elastin is attributed to increased synthesis rather than decreased degradation because the crosslinked elastin protein is extremely stable with virtually no turnover in undamaged skin (11, 12). Despite this dramatic alteration in elastin in photoaged skin, the underlying mechanisms are only poorly understood.
UV irradiation stimulates and activates various skin cells to produce and release cytokines that may play a significant role in the process of photoaging (13). In particular,
TGF-,B increases synthesis and secretion of a wide variety of matrix proteins, decreases degradation of matrix proteins both by decreasing protease synthesis and increasing the
106

synthesis of protease inhibitors (14). So far, the involvement of TGF-3 in skin photoaging has been explored mostly in terms of collagen synthesis (15, 16). It has been shown that a single exposure to UVR inhibits TGF-f3-induced type I procollagen mRNA expression by down-regulation of TPRII in human skin fibroblasts (15). Down-regulation of T[3RII mRNA expression was also observed in human skin in vivo after an acute irradiation of
UVR, although the T3RI mRNA level was increased (15). A single UV irradiation also increased inhibitory Smad7 mRNA and protein levels (16). However, there are some limitations to these studies. First of all, very little UVB penetrates in to dermis in human skin (17). Consequently, the effect of UVB on human dermal fibroblasts is mostly caused by the indirect effect of cytokines or mediator produced by inflammatory cells, keratinocytes or fibroblasts themselves. Thus, a direct effect of UVB on fibroblasts in
vitro may not be a relevant model. Also, the relationship between responses to chronic sun exposure of skin and responses to a single UV exposure of sun-protected skin is unclear. In fact, the UVB-induced decrease in TPRII and the increase of Smad7 returned to normal levels after 24 h, and the long-term effect of chronic UV irradiation on the
TGF-3/Smad pathway is not known. (15).
A role of TGF-P in development of solar elastosis is supported by the observations that the synthesis of TE by dermal fibroblasts in monolayer culture is increased by TGF-P 1, IL-1p, and decreased by TNF-a (18, 19). Studies from our group using dermal fibroblasts grown in contracted collagen gels, which more closely simulate the environment of dermal fibroblasts, showed that TGF-[ 1 increased and TNF-ac decreased TE protein synthesis but IL- 3 had no effect (20). Also, it was observed that
UVB irradiation induces TGF-3 mRNA in murine skin (21) as well as in keratinocytes in
vitro (22). It was demonstrated that the injection TGF-p increased human elastin promoter activity in transgenic mice (23). TGF-f3, latent TGF-P binding protein-i and elastic fibers co-localize in human skin and their levels correlate with solar elastosis (24).
Therefore, we hypothesized that TGF-3 may be involved in the mechanism that leads to the solar elastosis.
Selective small molecule inhibitors of TGF-P signaling pathway developed for therapeutics are potentially powerful tools in experimentally dissecting this complex
107

pathway. Many types of activin receptor-like kinase (ALK) 5 receptor (TGF-3-specific type I receptor) inhibitors have been developed, and some of them were tested for various fibrotic diseases in vivo (25-27). 2-(5-Benzo[1,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4yl)-6-methylpyridine hydrochloride (SB-505124) is a member of a new class of small
(a.k.a. ALK5). This compound selectively and concentration-dependently inhibits ALK4-
, ALK5-, and ALK 7-dependent activation of downstream cytoplasmic signal transducers, Smad2 and Smad3, and of TGF-3-induced MAPK pathway components
(p38MAPKca) (28).
The albino hairless mouse (Skh-1 hairless) is the most widely used animal model to study photoaging (1, 29). They are immunocompetent with a mutation in hr gene. The
UV-induced changes in these mice are similar to those in sun-exposed human skin, such as the action spectra and the time courses for the acute responses to UVR (1). After chronic UV exposures, the increases in elastin, GAG, and mast cells, and the appearance of activated fibroblasts and an inflammatory infiltrate are observed in this mouse model, similar to the changes seen in human photoaging (1, 29-31). One of the most desirable features of this mouse model is the rapid wrinkle development in response to chronic exposure to UV radiation, however, there is a controversy whether the onset of UVBinduced skin wrinkling in Skh-1 mice correlates with changes in dermal elastin and collagen in their skin (32, 33). Structurally, mouse skin is 20-70 times thinner than human skin (depending on the area) with epidermal thickness of about 20 jLm and dermal thickness of about 500 [tm. Mouse elastic fibers are an order of magnitude smaller than those of humans and the solar elastosis is often of a focal nature, unlike the photoaged human skin where the diffuse deposition of the elastotic material is prominent in dermis
(2, 34).
In this study, we used the Skhl hairless mouse as an animal model and used
TGF-3 type I receptor inhibitor, SB-505124, to test the hypothesis that TGF-P mediates skin photoaging, especially solar elastosis.
108

3.2.1. Animals
Female, albino hairless mice (Crl:Skhl-hr) were obtained from Charles River
Laboratories (Wilmington, MA). The animals were 7 weeks old at the beginning of the experiment. Mice were housed in groups of four or five. Animals were distributed into four groups: (-)UV(-)inh group with regular drinking water without UVB treatment, (-
)UV(+)inh group with SB-505124 in water without UVB treatment, (+)UV(-)inh group with regular drinking water with UVB treatment, and (+)UV(+)inh group with SB-
505124 in water with UVB treatment.
3.2.2. Materials
TGF-P type I receptor inhibitor (SB-505124) was a gift from Dr. Nicholas J. Laping at
GlaxoSmithKlein (King of Prussia, PA).
3.2.3. Inhibitor protocols
The dose of 10 mg SB-505124/kg animal/day was chosen based on previous experience with this inhibitor (Nicholas J. Laping, GlaxoSmithKlein). The amount of water consumed per animal was measured in advance, and was about 6 ml/animal/day. Based on this data, SB-505124 was dissolved in the regular drinking water at the appropriate concentration (41.7 mg/l) and was given to the animals in the (-)UV(+)inh and
(+)UV(+)inh groups so that it would be taken ad libitum. SB-505124 solution was made new in fresh water every week. At the end of the treatment period, blood was drawn by cardiac puncture from 4 animals each from the (-)UV(+)inh and (+)UV(+)inh groups, and
2 animals from the (-)UV(-)inh group under anesthesia, and was analyzed by
GlaxoSmithKlein for the inhibitor level in the plasma.
109

3.2.4. Irradiation protocols
After 1 week of pretreatment with or without the inhibitor dissolved in the drinking water,
UVB treatments were begun. Mice were irradiated under a bank of 12 UVB-Ho-90 ° fluorescence tubes (Elder Pharmaceuticals Inc.) equipped with a Kodacel TA 401/407 filter (Eastman Kodak, Rochester, NY) to remove UVC radiation emitted by the lamp.
The irradiance for each treatment was measured with an IL-700 radiometer equipped with an SED 240 UVB detector (International Light Inc., Newburyport, MA). The spectrum of the bulbs was measured periodically with a spectroradiometer (Model 742, Optronix
Laboratories Inc.). The spectral output was maximal at 312 nm with 43% emitted at UVB
(290-320 nm) range and 57% emitted at UVA (320- 400 nm) range (Fig. 3-1).
d n A
I .VVu --- Vt
1.OOE-05
_ 1.00E-06
e 1.00E-07
G 1.00E-08
-w 1.00E-09
1.OOE-10
1.OOE-1 1
1 .OOE-1 2
250 300
Wavelength
350 400
Figure 3-1. Spectrum of the light source. UVC radiation was removed by a Kodacel filter.
For the acute UVB treatment, the mice in the (-)UV(+)inh and (+)UV(+)inh groups (total 16 animals) were given the inhibitor for a week before the experiment while those in the (-)UV(-)inh and (+)UV(-)inh groups were given regular drinking water. The animals were anesthetized with an intraperitoneal injection of 50 jld of ketamine and
110

xylazine mixture per each animal. The dorsal surface of the mouse was divided along the axis of the body, and a single dose of 250 or 400 mJ/cm
2 was administered on each half, while the rest of the exposed skin was covered with aluminum foil. The exposure time was 5 min 25 sec or 8 min 40 sec, respectively. The lamp provided 0.77 mW/cm
2 at the dorsal surface of the skin. Four mice were sacrificed after 8, 24, or 48 h after irradiation by an overdose of inhalation anesthetics (isoflurane) followed by cervical dislocation.
The skin was removed from the back, part of which (about 5 mm x 5 mm) was fixed in
10% formalin in PBS overnight for histological analysis. The rest of each skin was quickly frozen in liquid nitrogen and stored at -80 °C.
300
250
E
U
200
E
0
U)
0
150
100
50
0
25-Oct 8-Nov 22-Nov 6-Dec 20-Dec
Date
3-Jan 17-Jan
Figure 3-2. Irradiation schedule. The dose was adjuisted so that maintained minimal erythema.
the animals
For the chronic UVB treatment, each group consisted of ten mice. Mice in the (-
)UV(+)inh and (+)UV(+)inh groups were given SB-505124 in their drinking water for a week before the experiment while those in the (-)UV(-)inh and (+)UV(-)inh groups were given the regular drinking water. For irradiations, 4 mice were put in a plastic cage with dividers, so that an animal could freely move in its own compartment. The mouse cage
111

was covered with a half-inch metal mesh cover to prevent their escape. Under these experimental conditions, 0.2-0.4 mW/cm 2 was delivered to the dorsal surface of the skin.
The daily fluence (mJ/cm
2
) was chosen to maintain mild erythema and edema by visual observation without severe damage on the skin surface. Figure 2 shows the daily fluence
(dose), which increased gradually as the skin became more tolerant. The dose was decreased when the animal showed too severe erythema and edema by visual observation. Mice were irradiated on alternate days, three times a week, for 13 weeks and the total cumulative dose was 6.1 J/cm
2
(Fig. 3-2). Mice were sacrificed 3 days after the last irradiation by an overdose of inhalation anesthetics (isoflurane) followed by cervical dislocation. We expected the acute responses from the last irradiation have subsided at this time point, presumably carrying only the chronic effects of the UVB irradiation. The skin was removed from the back, part of which (about 5 mm x 5 mm) was fixed for histological analysis (frozen sections and paraffin sections). The rest of each skin was quickly frozen in the liquid nitrogen and stored at -80 °C.
3.2.5. Histology
Paraffin sections (5 ptm) of biopsies were stained with hematoxylin and eosin for evaluation of the epidermal and dermal thickness. The thicknesses were measured under
40x or 20x magnification with a light microscope. Resorcin-fuchsin-stained sections and
Verhoeff-van Gieson stained sections were utilized for evaluation of elastic fibers.
Toluidine blue staining was used for mast cell counting. An example is shown in Figure
3-3. Total length (mm) of each tissue section was measured using a Ox objective lens and an eyepiece micrometer. All the mast cells within the papillary and all the reticular dermis were counted. Neutrophils and macrophages were counted in a similar manner on
5 pim paraffin sections stained using the simplified myeloperoxidase staining method
(35). Briefly, benzidine dihydrochloride solution was made by mixing the following reagents in order: 30% ethanol, 0.3% benzidine dihydrochloride, 1% sodium acetate, and
3% H
2
0
2
, adjusted pH to 6.0 and filtered. Deparaffinized slides were incubation in the solution for 30 min, and washed with water. Nuclear Fast Red (Kemechtrot 0.1%
112

solution, Polyscientitic, Bay Shore, NY) was used for nuclear counterstaining, and the counting was done on the same day.
Figure 3-3.
Toluidine Blue staining for mast ceDs.
Hairless mouse skin after 13 weeks of chronic UVB irradiation (lOx). Arrows indicate several examples of mast cells.
3.2.6. Immunohistochemisty
Skin tissue sections were fixed in 10% Formalin for 24 h and then postfixed in Bouin's fixative for 6 h, extensively washed in 70% ethanol, and embedded in paraffin. Sections were made 5 J.!mthick.
The principle of the staining protocol for a TGF-131 isoform was taken from
Limper (36) with appropriate modifications. Tissue sections were stained using an affinity-purified anti-TGF-131 polyclonal IgY raised in chicken (catalog # AF-I0I-NA,
R&D systems). Sections were deparaffinized by soaking in two exchanges of xylene (20
113

min each). They were subsequently rehydrated through a graded series of alcohol washes
(100% ethanol, 100%, 95%, 70%, 50%, and 30% ethanol, deionized water, and deionized water again; 10 min for each exchanges). The deparaffinized tissue sections were digested with hyaluronidase (1 mg/ml in 0.1 M sodium acetate and 150 mM sodium chloride, pH 5.5) for 30 min at 37 C to expose antigenic epitopes. After washing the sections three times for 10 min each in phosphate-buffered saline (PBS), the sections were incubated for 30 min in methanol containing 1% hydrogen peroxide to quench endogenous peroxidase activity. Sections were washed three times for 10 min each in
PBS, and then Universal blocking reagent (Power Block, Biogenex) as well as
Avidin/Biotin blocking reagents (BioGenex) were subsequently applied to reduce nonspecific binding of antibodies. After washing again, the sections were next incubated with the primary antibody (0.5 ptg/ml) overnight at 4
0
C. Next day, the sections were rinsed, and the primary antibodies were localized by sequential incubation with biotinylated goat anti-chicken IgG (7.5 tg/ml, Vector Laboratories) for 30 min at room temperature and an ABC Vectastain kit (Vector Laboratories). Peroxidase activity was detected using DAB as a substrate with a development time of 5 min. Sections were counterstained with hematoxylin. Sections incubated with normal chicken IgY (0.5
ptg/ml) were used as nonimmune control.
3.2.7. Biochemical assays
Preparation of skin samples and assessing skin content of collagen and elastin were performed by Prof. Barry Starcher (University of Texas, Tyler, TX). Briefly, three 3 mm skin punch biopsies were hydrolyzed in 6 N HC1 at 11 0 °
C for 24 h and then evaporated to dryness at 55°C under nitrogen and dried in a vacuum overnight.
For elastin content, desmosine was measured by a modification of the radioimmunoassay method of Starcher (37). After incubation overnight of the redissolved hydrolysate with probe and antibody solution, 100 ml of goat antirabbit antiserum was added and incubated at 4°C for 2 h. Polyethyleneglycol (MW 8000, 15%,
100 ml) was added and the mixture was centrifuged at 2000 X g for 1 g. The radioactivity of the pellets was measured in a LKB 1272 gamma counter.
114

For collagen content, hydroxyproline was assayed by a modification of the method of Stegemann and Stalder (38). Five hundred milliliters of chloramines T (1.41%) was added to hydrolysate in 0.2 M sodium acetate buffer (pH 6) with n-propanol (1:3 v/v). The mixture was incubated at room temperature for 20 min, 500 ml pdimethylaminobenzaldehyde in n-propanol (1:4 w/v) with perchloric acid, was added, mixed, and incubated at 60°C for 15 min. Absorbance at 550 nm was measured. All measurements were done per area of skin as described previously (39).
3.2.8. Bioassay for TGF-3
Active and total TGF-P levels in the skin tissue were measured by Dr. Hongjun Wang
(Harvard Medical School, Boston, MA) using the mink lung epithelial cell (MLEC) plasminogen activator inhibitor-i (PAI-1)/luciferase assay (40). Five 3 mm skin punch biopsies were incubated in 500 pl DMEM/F12, containing 0.01% 2-mercaptoethanol for
24 h at 37°C. After a short centrifugation with a table-top centrifuge (30 sec at 10,000 rpm), 250 pl of the supernatant was collected and stored at 4
0
C. The TGF-[ measured in this first supernatant was considered active TGF-3. The remaining supernatant together with the tissue punches were homogenized at 4
0
C with a tissue tearor (Biospec Products
Inc., Bartlesville, OK). Latent TGF-[ in the homogenate was activated by mixing with
12.5 ptl 1N HC (pH 2.0) and incubating at 4°C for 2 h. To neutralize the acidified homogenate, 12.5 tl 1N NaOH was added and followed with 12.5 tl HEPES buffer.
After centrifugation at 10,000 rpm for 30 sec, the second supernatant was collected for total TGF-P measurement.
To measure the total TGF-P, MLEC transfected with the PAI-1/luciferase construct were plated into 96-well tissue culture plates (CulturPlateTM-96, Packard
Bioscience) at 1.6 x 105 cells/ml and incubated for 3-4 h for optimal attachment. 100 ptL aliquots of the first supernatant were added to the attached MLEC for active TGF-P used for total TGF-3 measurement. Cultures treated with samples and TGF-P standards were incubated overnight at 37°C. After incubation, the medium was replaced with 100
115

kit, Perkin Elmer, Groningen, Netherlands). Following a 10 min incubation in the dark, the relative light units (RLU) were recorded using a Wallac-Microbeta luminometer
(Perkin Elmer). The mean values of samples were converted into concentrations of TGFp using a standard curve obtained with human recombinant TGF- 1.
3.2.9. Real-time reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA from the mouse tissue was extracted using the RNeasy fibrous tissue Mini Kit
(Qiagen, Chatsworth, CA) according to the manufacturer's protocol. Total RNA (2 [pg) was reverse transcribed with Oligo(dT)18 primers. The RT reaction was incubated in a thermal cycler at 25°C for 10 min to extend the primers, and 42°C for 30 min, 95°C for 5 min and then cooled on ice. PCR primers were synthesized by Invitrogen (Carlsbad, CA) based on the unique sequences in the mouse TE gene (GI: 473273), the mouse hypoxanthine phosphoribosyltransferase (HPRT) gene (GI: 7305154), the mouse MMP-2 gene (GI: 47271505), and the mouse MMP-9 gene (GI: 28461346). The 5' forward and
3' reverse-complement primers for amplification of each mRNA are as follows: for TE;
5'-GGAGTTGGCATCCCGACATAT-3' and 5'-TTAGCAGCAGATTTAGCGGCA-3', for HPRT; 5'-TGATTATGGACAGGACTGAAAGACTTG-3' and 5'-
TCCTGAAGTACTCATTATAGTCAAGGG-3', for MMP-2; 5'-
AGGACAAGTGGTCCGCGTAAA-3' and 5'-TGTCATCATGGGATAATCGGAAGT-
3', for MMP-9; 5'-CTCTGAATAAAGACGACATAGACGGC-3' AND 5'-
AGAGAACTCCTTATCCACGCGAAT-3', respectively. The PCR products for TE,
HPRT, MMP-2 and MMP-9 were 476, 480, 664 and 733 bp, respectively.
For real-time PCR reaction a master mix of the following reaction components was prepared to the indicated final concentration: 1.5 mM MgCl
2
, 150 nM forward and
SYBR® Green
(Stratagene, La Jolla, CA). Real-time PCR was subsequently done with 1 ptl cDNA
(equivalent to 100 ng reverse transcribed total RNA) mixed with 49 ptl master mix using mixtures with appropriate combination of specific primers were incubated for 10 min at
116

95°C. The PCR cycle consisted of denaturation for 30 sec at 95°C, annealing for 1.0 min at 55°C, and extending for 1.5 min at 72°C. After the last cycle, the dissociation curve was performed to check the non-specific products. The amplified products were incubated for 1 min at 95°C followed by 81 cycles of incubation with the heating rate of
0.5°C/cycle and 30 sec/cycle, beginning at 55°C and ending at 95°C.
The mRNA level of each gene was normalized using HPRT as the control gene, and adjusted by the total DNA amount per area of tissue.
Real-time PCR reactions for PAI-1, collagen Il , collagen III, collagen IV and fibronectin were done at GlaxoSmithKlein using 7900 SDS machine from Applied
Biosystems. Each mRNA level was normalized by the total RNA concentrations and adjusted by the total DNA amount per are of tissue.
3.2.10. Statistical Analysis
Results are expressed as the mean + SD. The two-tailed, non-paired Student's t-test was used to evaluate the differences between the experimental groups. P<0.05 was considered a significant difference.
117

3.3. Results
3.3.1. Acute UVB irradiation
The responses to a single UVB treatment were evaluated prior to initiation of the chronic irradiation protocol to determine whether the dose of SB-505124 given to animals was enough to inhibit UVB-induced responses from the animals. Sixteen mice were given the inhibitor for 1 week prior to the irradiation. Except for the 4 mice in each group for the time zero point, the dorsal skin of all the rest of mice was divided in half along the axis of the body and each side was given 250 mJ/cm
2 or 400 mJ/cm
2 of UVB, respectively.
Examination of the gross appearance of the skin showed significant erythema for all the UVB-treated animals after 8 h. After 24 h, there was no erythema left in any of the animals but significant edema was observed in all irradiated animals. Neutrophil infiltration was significant after 24 h (Fig. 3-4). The scaling of the stratum corneum was quite severe for the animals irradiated with 400 mJ/cm
2 after 48 h. However, there was no visible difference between the two UVB-treated groups (+/- SB-505124).
The mRNA levels of selected TGF-[ responsive genes (TIMP2, TPRII, CTGF, and Collagen al 1(I)) were measured compared to the housekeeping gene GAPDH for the whole skin at 0, 8, 24, and 48 h after the irradiation. Figure 3-5 shows the change of the level of each mRNA for the samples irradiated with a single 250 mJ/cm
2 of UVB. The mRNA levels of the specific TGF-3 responsive genes increased at 8 h after the irradiation and decreased to basal level by 24 h. For all the genes, this UVB effect was abrogated by inhibitor administration. Therefore, we conclude that the inhibitor level given to the animals (10 mg/kg/day) is enough to block the TGF-P signaling processes in the skin.
The samples irradiated with 400 mJ/cm
2 of UVB also gave the similar trend.
118

Figure 3-4. NeutrophU infiltration after a single UVB irndlation._A: Without UVB irradiation B: 24 h after 250 mJ/cm2 UVB irradiation. Simplified myeloperoxidase staining (2Ox).
Arrows indicate several examples of neutrophils or macrophages.
119

I
5.0
4.0
a
3.0 <
1.
10
2.0
.0
0.5
1.0
0.0
Time
24 after irradiation
(h)
36
48
.0
"1/Anf30
I VUV
1600
80.
a
< 60.(
1200' a a-
.0
° 40.0
20.0
300 T o
00
0
0.0
' -4
Time after irradiation (h)
36
48
Figure 3-5. Effect of the inhibitor on TGF-]3 regulated genes after acute
UVB of UVB, and 0 (no irradiation) isolated. Relative mRNA level of the show SD.
each gene was assessed by Real-time were included in each group, and the error bars
8,
120

3.3.2. Chronic UVB irradiation
3.3.2.1. Plasma level of SB-505124
The inhibitor SB505124 was dissolved in the drinking water and administered ad libitum.
We checked the amount of inhibitor taken by the animals by measuring the concentration of SB-505124 in the blood plasma. Ten animals were examined: 4 animals from the (-
)UV(+)inh group ("B"), 4 animals from the (+)UV(+)inh group ("D"), and 2 animals from (-)UV(-)inh group ("A"), with a random selection within each group. The effective level of SB505124 is 50 nM and above (28). All the selected animals in the inhibitor groups had the levels well above the effective level (Table 3-1).
D5
D6
Al
A2
Mouse#
B3
B4
B5
B6
D3
D4
SB-505124 (nM)
95
87
341
169
401
940
434
172
N.Q. (<30 nM)
N.Q. (<30 nM)
Table 3-1. Inhibitor (SB-505124) level in the mouse plasma. Note than the effective level is > 50 nM for this inhibitor.
121

3.3.2.2. Gross appearance
The (+)UV(-)inh group and (+)UV(+)inh groups showed similar inflammatory reactions to UVB during the course of irradiation. Wrinkles became visible from about 9 weeks of irradiation for both groups, and by the
1 3t h week, deep wrinkles perpendicular to the axis of the body were prominent, but there was no obvious difference between the group receiving UVB only and the group receiving UVB and SB-505124.
The mice were sacrificed 3 days after the last irradiation. Some erythema and edema were remained in 2 animals in (+)UV(-)inh group and in 1 animal from
(+)UV(+)inh group at this time. The area with inflammation was excluded from all the following analyses.
3.3.2.3. Histology
One animal each from the (-)UV(-)inh group and from the (-)UV(+)inh group showed abnormally thick epidermis (about 4-fold of thicker than the rest of the animals in the same group) and massive inflammatory cell infiltration. Also the skin showed redness and was very thick with dry texture over the whole body. Those animals were excluded from all the following analysis.
Epidermal and dermal thicknesses were measured on the H&E stained slides. The epidermal thickness was increased about 3-fold after the chronic UVB irradiation compared to the age-matched controls (Fig. 3-6A), however, there was no difference between the inhibitor group and the non-inhibitor groups. Dermal thickness was increased about 10% both in inhibitor group and the non-inhibitor group (Fig. 3-6B).
122

140
I_
120
E
100 -
0
_ _
T
T
60
0 40
"c
¢3
O 20 sO
T T
(-)UV(-)inh
I
(-)UV(+)inh
I
(+)UV(-)inh
I
(+)UV(+)inh
_____ 350 _·
300
E
0 250
B
T
I 200
0
'o 150
E 100
50 v n '
(-)UV(-)inh
T
T
I
(-)UV(+)inh
'T
(+)UV(-)inh
1
(+)UV(+)inh
Figure 3-6. Effects of chronic UVB treatments on thickness of Skh-1 hairless mouse
skin. Mice were treated three times per week for 13 weeks with UVB radiation as described in the Materials and Methods. A: Epidermal thickness measured on H&E stained sections (*p<0.001 vs. unirradiated groups). B: Dermal thickness measured on
H&E stained sections (**p<0.05 vs. unirradiated groups). Error bars show SD.
123

0
E th
0
M 60
E
-
0
.tu
.0
E
80
' 20
:
-
T
(-)UV(-)inh
I
(-)UV(+)inh
T
I
(+)UV(-)inh
**
T
I
(+)UV(+)inh
Figure 3-7. Effects of chronic UVB treatments on the number of mast cells. Mice were treated three times per week for 13 weeks with UVB radiation as described in the
Materials and Methods. Mast cells were counted on Toluidine Blue-stained sections
(*p<0.05 vs. (-)UV(-)inh, **p<0.001 vs. (-)UV(-)inh, ***p<0.05 vs. (+)UV(-)inh). Error bars show SD.
It has been shown that photoaging is associated with an increase in the number of mast cells in both human and mouse skin (3, 41, 42). We also found that the mast cell number increased 2-fold after the chronic UVB irradiation compared with age-matched control animals (Fig. 3-7). The groups receiving inhibitor also showed about 20% more mast cells than the group without inhibitor in both non-irradiated and irradiated groups. It suggests that TGF-[3 signaling process might have an effect on mast cell recruitment or maturation.
Massive deposition of amorphous elastic fibers in the papillary dermis and the upper reticular dermis is a hallmark of severely photoaged skin (1-3). Typically, chronically UVB irradiated hairless mouse skin shows amorphous elastin deposition in papillary and upper reticular dermis (Fig. 3-8A). Surprisingly, none of the irradiated mice in the (+)UV(-)inh group or (+)UV(+)inh group showed elastin fiber deposition (Fig.3-
8B).
124

Figure 3-8. Resorein-fuehsin staining for elastin fibers. A.
Hairless mouse skin from the previous study after 12 weeks of chronic UVB irradiation (x 20). Note the elastin fibers (arrows) in the papillary dennis as well as the mast cells in the reticular dermis. B.
Hairless mouse skin from this study after 13 weeks of chronic UVB irradiation (x 20). No thick and wavy elastic fibers are present.
125

3.3.2.4. Biochemical changes
Total protein content per area was increased about 25% in the irradiated groups compared to the non-irradiated groups (Fig. 3-9). It may be due to the increase of the number of epidermal cells and inflammatory cells as well as the increase of the size and the number of the dermal cysts that are the unique feature of the hairless mice after chronic UV irradiation. However, the treatment with SB-505124 did not influence the UVB-induced protein increase.
20
E
15 -
2
I.
E
10 -
5
T
I
T
T
T
0 -
I I I
(-)UV(-)inh (-)UV(+)inh (+)UV(-)inh (+)UV(+)inh
Figure 3-9. Effects of chronic UVB treatments on the protein levels. Mice were treated three times per week for 13 weeks with UVB radiation as described in the
Materials and Methods. (*p<0.005 vs. unirradiated groups). Error bars show SD.
126

E
E
E
0.
1400
1200 -
c4
E 1000
., 0 800
T
600
400
200
0O
T
T
T
(-)UV(-)inh (-)UV(+)inh (+)UV(-)inh (+)UV(+)inh
4000 r
E
0o
0
3000 -
B
T
NS
T
NS
T
NS
T
2000
I
E
C x
0
1000
0O
(-)UV(-)inh (-)UV(+)inh (+)UV(-)inh (+)UV(+)inh
Figure 3-10. Effects of chronic UVB treatments on elastin and collagen protein
levels. Mice were treated three times per week for 13 weeks with UVB radiation as described in the Materials and Methods. A: Desmosine measured to indicate elastin content (*p<0.05 vs. unirradiated groups). B: Hydroxyproline measured to indicate collagen content (NS: not significant, p=0.07). Error bars show SD.
127

Elastin protein levels measured by demosine content in the irradiated groups showed only about 15% increase (p<0.05) compared to the non-irradiated groups (Fig. 3-
1 OA). This result correlates with the elastin histology results where we could not find any abnormally deposited elastin fibers (Fig. 3-8B). Typically a 2- to 4-fold increase of desmosine content is observed in the UVB hairless mice treated with UVB for 12 weeks or more (8, 30, 39). Importantly for our hypothesis, treatment with SB-505124 did not influence the UVB-induced increase in elastin.
The total collagen content was not significantly different among the different groups (Fig. 1 OB). This result is consistent with our previous chronic UVB irradiation studies using both Skhl hairless and Balb/c mouse models.
3.3.2.5. Total and active TGF-31 levels
UVB irradiation up-regulates TGF-[3 protein levels by keratinocytes both in active and latent forms (43), and induces an increase in TGF-P mRNA in murine skin (21) as well as in keratinocytes in vitro (22). Total TGF-P levels were increased by about 50% after chronic UVB irradiation, however, there was no difference between the (+)UV(-)inh group and the (+)UV(+)inh group (Fig. 3-11 A). Active TGF-P level also increased about
50% after the chronic irradiation and the treatment with SB-505124 decreased this value to the basal level (Fig. 3-1 B), indicating involvement of TGF-P signaling processes in the activation of latent TGF-P.
128

2
1.8
1.6
A o
1.4
1.2
T
0.8
0
0.6
1
0.4
0.2 -
0-
_ ...
(-)UV(-)inh
T
(-)UV(+)inh
11
I-
1.8
l
1.6
-
1 1.4
B cm 1.2
U-
1
O 1
0
0.8
" 0.6
0.4
0.2
0 at -
T
(-)UV(-)inh
-
T
(-)UV(+)inh
I
T
T
(+)UV(-)inh
-
*1f l
--
(+)UV(-)inh
T
(+)UV(+)inh
*0
I
(+)UV(+)inh
Figure 3-11. Effects of chronic UVB treatments on total and active TGF-P1 levels.
Mice were treated three times per week for 13 weeks with UVB radiation as described in the Materials and Methods. A: Total TGF-31 level (*p<0.001 vs. (-)UV(-)inh, **p<0.05
*p<0.05 vs. (-)UV(-)inh). B: Active TGF-P level (p<0.02 vs. (-)UV(-)inh, .*p<0.01
vs.(-)UV(-)inh, .*.p<0.005 vs. (+)UV(-)inh). Error bars show SD. Note that the active
TGF-p 1 level is only about 10% of the total TGF-p 1 from this measurement. (by the courtesy of Dr. Hongjun Wang)
129

3.3.2.6. mRNA levels of TGF-[-regulated genes
The effects of chronic UVB exposure of the skin on TGF-P-regulated genes are of great interest. In particular, it is important to know how the TGF-3 receptor inhibitor affected mRNA levels of the extracellular matrix proteins, because we did not observe significant change in the protein levels of collagen and elastin, the major constituents of the extracellular matrix.
The interpretation of the PCR results obtained using the whole skin RNA in this study is complicated by the fact that there is a mixed population of cells in whole skin and the different cell types express different levels of response genes (keratinocytes, fibroblasts, inflammatory cells, dermal cysts, etc.). As described above, after the chronic irradiation, there is a significant increase in the number of keratinocytes and the inflammatory cells, as well as the size and the number of dermal cysts. Dermal cysts are composed of epithelial cells that originate in part from sebaceous glands and in part from outer root sheath of hair follicles (44). However, it is mostly fibroblasts that produce collagen and elastin in skin. Therefore, the mRNA level of collagen or elastin measured by PCR is only from fibroblasts, whereas the mRNA level of HPRT measured by PCR is from the all the cells in skin.
In order to obtain the change of mRNA of collagen or elastin per fibroblast, we made an assumption that all the cells in the skin would produce same amount of HPRT mRNA, and total HPRT mRNA amount per area of skin would be proportional to the total cell number per area of skin. Then,
Adjusted X mRNA level =-
X mRNA level per fibroblast
HPRT mRNA level per fibroblast
X mRNA (measured)
-----------
HPRT mRNA (measured) xtotal number of cells per area total number of fibroblasts per area
Where, X = gene of interest, expressed only in fibroblasts
130

Also, we made an assumption that total DNA amount per area of tissue would be proportional to the total cell number per area. Total DNA was extracted from the same size of skin punch biopsy for all the animals. Therefore,
Adjusted mRNA level
X mRNA (measured)
------------------- -
HPRT mRNA (measured) xtotal DNA amount per area total number of fibroblasts per area
Finally, we made an assumption that total number of fibroblasts per area of skin would be same for each of the experimental group, and the following formula was used for the correction.
Adjusted mRNA level (per area)
X mRNA (measured)
-------------------------------- x total DNA amount per area
HPRT mRNA (measured)
This adjusted level represents the mRNA level of the gene of interest per area of skin. It still needs to be validated in the future whether the number of total fibroblasts per area changes after the chronic UVB treatments in order to obtain the mRNA level per fibroblast.
The graphs showing the TE mRNA level of each group before (Fig. 3-12A) and after the correction with total DNA amount per area (Fig. 3-12B) are presented in the following figure. DNA level correction resulted in more than 2-fold increase in the groups with chronic UVB treatments.
131

I.
I
4
6
2
8
1
T
T
T
0
(-)UV(-)inh
I
(-)UV(+)inh
I
(+)UV(-)inh
... I . .
(+)UV(+)inh
80
3
-J
LU
60
'0
40
(a{
20
B
T
T
*
**
T
0 f ....
(-)UV(-)inh
-
---
(-)UV(+)inh i
(+)UV(-)inh
I
(+)UV(+)inh
Figure 3-12. Effects of chronic UVB treatments on TE mRNA levels. Mice were treated three times per week for 13 weeks with UVB radiation as described in the
Materials and Methods. The whole skin was harvested and the total RNA was isolated.
Relative mRNA level of the each gene was assessed by Real-time PCR HPRT as the control gene. A. Before the adjustment by the DNA level per area of skin. B. After the adjustment by the DNA level per area of tissue (*p<0.001 vs. (-)UV(-)inh, **p<0.01 vs.
(+)UV(-)inh). 7-8 animals were included in each group, and the error bars show SD.
132

As mentioned above, the elastin protein level after chronic UVB treatments did not change significantly from the control level (Fig 3-10A), and also there was no thick and tortuous abnormal elastin fiber deposition found in the histological sections (Fig. 3-
8B). However, the TE mRNA level showed a 2-fold increase in the (+)UV(-)inh group compared to the (-)UV(-) inh group (Fig. 3-12B). Therefore, we suspected that the high
UVB dose (cumulative dose of 6.1 J/cm
2 ) might have degraded the newly synthesized elastin fibers and measurement of the TE mRNA might give a clearer picture of TE synthesis in chronic UVB-treated skin. The TE mRNA level showed about 20% decrease in the (+)UV(+)inh group compared to the (+)UV(-)inh group suggesting that TGF-p signaling pathway may have an effect on the TE mRNA level.
Collagen is the most abundant structural component of ECM, and the dermis mainly consists of type I and type III collagens (-75% of dry weight), but also contains other types of collagen (IV, V, VII). Approximately 80 to 90 percent of the collagen is type I collagen and 8 to 12 percent is type III collagen (45). Interestingly, after 13 weeks of UVB irradiation, the collagen al(I) mRNA level increased about 50% (Fig. 3-13A).
The inhibitor had no effect on the collagen al (I) mRNA level, either in the non-irradiated groups or in the irradiated groups, suggesting that the collagen Iac 1 may be regulated by some other factors than TGF-P in vivo. On the other hand, collagen III mRNA level was
35% lower in the inhibitor-treated non-irradiated group, clearly demonstrating the TGF-
[-dependent transcription of collagen III (Fig. 3-13B). Collagen III mRNA level also seemed to increase about 50% after the chronic irradiation without treatment with SB-
505124. This UVB-induced increase was blocked by treatment with SB-505124 resulting in no collagen III mRNA increase in the (+)UV(+)inh group.
133

20
16
co c o0
12
8
0
4
T
0
(-)UV(-)inh
--- -------- - - -------
T
(-)UV(+)inh
T
__ j
(+)UV(-)inh (+)UV(+)inh
24
20
B
0
4
(0
16
0
0)
12
8-
4
T
0o --
(-)UV(-)inh
_ _ __ __
(-)UV(+)inh
I
### l'
(+)UV(-)inh (+)UV(+)inh
25
0
20
C
0)
15
0) m
10
0
5
:5,
T
T
T 00
I~
(-)UV(-)inh (-)UV(+)inh (+)UV(-)inh (+)UV(+)inh
134

Figure 3-13. Effects of chronic UVB treatments on collagen mRNA levels. Mice were treated three times per week for 13 weeks with UVB radiation as described in the
Materials and Methods. The whole skin was harvested and the total RNA was isolated.
Relative mRNA level of each gene was assessed by Real-time PCR normalized by the
RNA level and the DNA level per area of tissue. A. Collagen Ial level (*p<0.005 vs. (-
)UV(-)inh, **p<0.01 vs. (-)UV(+)inh). B. Collagen III level (#p<0.01 vs. (-)UV(-)inh,
##p<0.05 vs. (-)UV(-)inh, ###p<0.05 vs. (+)UV(-)inh). C. Collagen IV level (p<0.001
vs. (-)UV(-)inh, *Op<0.001 vs. (+)UV(-)inh). 7-8 animals were included in each group, and the error bars show SD.
Type IV collagen is the major component of the basement membrane of the skin
(45), and flattening of the dermal-epidermal junction is one of the prominent features of photoaged skin (46). After chronic irradiation, the type IV collagen mRNA level increased about 2-fold in animals not treated with SB-505124 (Fig. 13C), indicating extensive remodeling of type IV collagen. Interestingly, the inhibitor decreased this
UVB-induced effect by 60%, suggesting that TGF-P signaling processes may be a major player of the remodeling of the basement membrane of the skin.
Matrix metalloproteases (MMPs) are zinc-dependent endopeptidases involved in the remodeling of the extracellular matrix (47). Among them, gelatinases A (MMP-2 or
72 kDa type IV collagenase) and gelatinases B (MMP-9 or 92 kDa type IV collagenase) digest type IV and VII collagens, which are components of the basement membrane.
Interpretation of the PCR result of the genes that are expressed by different cell types are difficult at this point, because we do not know the contribution of the each cell type to the overall mRNA level of a specific mRNA. However, the significant finding is that TGF-3 receptor inhibitor significantly decreased UVB-induced MMP-2 and MMP-9 levels by about 80%. Also, administration of SB-505124 decreased the MMP-9 mRNA level about
30% compared to the non-inhibitor animals (Figs. 3-14A and 3-14B).
135

0.8
>
J
0.6
a.
2 0.4
'O la
·- 0.2
T
_____
T
I __
T
_
*
O -
(-)UV(-)inh
I
(-)UV(+)inh
I
(+)UV(-)inh
I
(+)UV(+)inh
5 i a)
,-I
0.
]E
4
3
0
0,
2
6 i
1_1
B
T
1
0
T
*0
(-)UV(-)inh
I
(-)UV(+)inh l
(+)UV(-)inh i
(+)UV(+)inh
Figure 3-14. Effects of chronic UVB treatments on MMP mRNA levels. Mice were treated three times per week for 13 weeks with UVB radiation as described in the
Materials and Methods. The whole skin was harvested and the total RNA was isolated.
Relative mRNA level of the each gene was assessed by Real-time PCR normalized by the
RNA level and the DNA level per area of tissue. A. MMP-2 level (*p<0.001 vs.
(+)UV(+)inh). B. MMP-9 level (p<0.001 vs. (-)UV(-)inh, *p<0.001 vs. (+)UV(-)inh).
7-8 animals were included in each group, and the error bars show SD.
136

20
16 -
A
12 u)
U)
8-
4-
T
T
0
_
(-)UV(-)inh
.
(-)UV(+)inh
T
T
(+)UV(-)inh
I
(+)UV(+)inh
16
B
12
.0
8
.o
U.
la
0
4
I
T
T
V
0
(-)UV(-)inh
I
(-)UV(+)inh
I
(+)UV(-)inh
I1
(+)UV(+)inh
Figure 3-15. Effects of chronic UVB treatments on PAI-1 and fibronectin mRNA
levels. Mice were treated three times per week for 13 weeks with UVB radiation as described in the Materials and Methods. The whole skin was harvested and the total RNA was isolated. Relative mRNA level of the each gene was assessed by Real-time PCR normalized by the RNA level and the DNA level per area of tissue. A. PAI-1 level. B.
fibronectin. 7-8 animals were included in each group, and the error bars show SD.
PAI-1 and fibronectin are of interest because both genes are known to be induced by TGF-3. TGF-3-induced PAI-1 promoter activity is utilized in the bioassay of TGF-P3
(40). It was reported that fibronectin synthesis was mediated by TGF-P through non-
137

Smad pathway (48). However, since PAI-1 and fibronectin are also proteins produced by many different types of cells in skin, it is difficult to draw any conclusion about these mRNA levels at this point (Figs. 3-15A and 3-15B).
138

3.4. Discussion
TGF-[3 has been implicated as a modulator for dermal remodeling observed in photoaged skin because of its role in regulation of extracellular matrix synthesis and degradation. However, clear demonstration of the role of TGF-[3 in photoaging is lacking.
UVB irradiation induces an increase in TGF-p mRNA in murine skin (21) as well as in keratinocytes in vitro (22). Increased levels of both active and latent TGF-P after UVB irradiation were also observed in keratinocytes in vitro (43).
Some reports support a role for TGF-3 in development of solar elastosis.
Induction of tropoelastin (TE) mRNA by TGF-3 1 in vitro was described in the Chapter 2 in this thesis as well as in the other studies (18-20). TGF-P is also involved in a variety of fibrotic diseases, where the major problem is the overproduction of the collagen (49). In this study, we employed the TGF-[ type I receptor inhibitor, SB505124, to block the
TGF-3 signaling processes in order to test the hypothesis that TGF-P mediates chronic
UVB-induced skin changes. TGF-P/Smad pathway is always initiated by TGF-P type I/II receptors, however, receptors involved in non-Smad pathways such as MAPK and PKC pathways can be more diverse. Although, this inhibitor potentially blocks some of the non-Smad pathways (i.e. MAPK) as well as Smad pathway (28), blocking of Smad pathway alone should be enough to inhibit TGF-P induced TE mRNA induction (see chapter 2.3.7.).
Our major hypothesis was that TGF-P mediates development of solar elastosis after chronic UVB irradiation. Typically in the mouse skin with solar elastosis, thick and tortous elastic fiber deposition is observed in upper dermis (Fig. 8A), and 2-4 fold increase of elastin protein content is measured (30, 39, 50). However, none of the mice with chronic UVB irradiation showed the features of solar elastosis regardless of TGF-p receptor inhibitor administration (Fig. 8B and Fig. 10A), even though we administered very high dose of UVB to the mice, assuming that higher UVB dose would result in more drastic photoaging responses. Those mice developed all the other typical features of photoaging caused by chronic UVB exposures, such as increase of epidermal thickness
(Fig. 3-6A), increase of mast cells (Fig. 3-7), and wrinkle formation (data not shown).
139

Interestingly, one of our previous studies showed that when the low, medium, and high dose of chronic UVB irradiations were compared for the elastin protein content increase, the medium dose resulted in the highest increase in the desmosine content (about 4-fold) whereas the high dose gave less than 2-fold increase (30). Our cumulative dose (6.1
J/cm
2
) was even higher than that of the aforementioned study (5.1 J/cm
2
). Therefore, we speculate that the high dose of UVB administered to these mice may have led to the UVB induced increased proteolytic degradation of the elastic fibers or inhibition of the crosslinking of the fibers by lysyl oxidase. It was reported that elastase activity is increased in chronically UVB irradiated skin (51). The effect of UVB on lysyl oxidase is currently unknown.
Increased TE mRNA level was also observed in the sun-exposed skin of elderly persons, compared with sun-protected skin of the same individuals, suggesting not only the elastin protein content but also the elastin mRNA level are increased in solar elastosis
(7). Since usually a strong correlation exists between tropoelastin mRNA levels and the protein synthesis (see chapter 1.4.1.), we examined TE mRNA level as an alternative indication of solar elastosis. The results showed that the TE mRNA level increased 2-fold after 13 weeks chronic UVB irradiation and this effect was decreased about 20% in the presence of the TGF-3 receptor inhibitor (Fig. 3-12B). The lower level of active TGF-3 in the inhibitor-treated irradiated group may also have had an effect on this decrease of
TE mRNA level (Fig. 3-1 lB). TGF-P is synthesized as a latent form in many cell types, and can be activated by numerous stimuli (see chapter 1.5.2.), including MMP-2 and 9
(52). Our results showed that MMP-2 and 9 mRNA levels were significantly lower in the inhibitor-treated UVB irradiated animals (Fig. 3-14). Even though it is not known what the major regulators of TGF-p activation in vivo after chronic UVB irradiation are, it can be speculated that lower MMP-2 and 9 levels may have reduced the active TGF-P level in the skin.
It was reported that there was an increase in the ratio of the type III collagen to total collagen in chronically UVB irradiated hairless mouse skin (53). TGF-,3 is known to positively regulate type I and III procollagen production by fibroblasts. A series of in
vitro studies have shown that a single UVB irradiation impairs the TGF-3 signaling pathway by reducing TPRII expression and increasing Smad7 in human skin fibroblasts
140

as well as the mink lung epithelial cells (15, 16, 54). Also, in human skin in vivo, decreased mRNA expression of T[RII was observed after a single irradiation of solarsimulated UV irradiation (15). In those studies, it was suggested that this impairment of
TGF-[ signaling pathways as well as the activation of transcription factor AP- 1 may result in decreased synthesis of procollagen I. However, our results showed that both acute and chronic UVB irradiation increased collagen al(I) mRNA level (Figs. 3-5 and
3-13A), as well as mRNA levels of collagen III and IV (Figs.3-13B and 3-13C). Also, in case of collagen III and IV, the increases of mRNA levels by chronic UVB irradiation were significantly inhibited by TGF-3 receptor inhibitor. It may suggest that TGF- is one of key factors of collagen regulation in photoaged skin.
Previously, it was reported that type IV collagen degradation is enhanced in the chronically UVB irradiated hairless mouse skin (55). Interestingly, an increase of type IV collagen mRNA level was observed in this study, suggesting that the type IV collagen remodeling may be the reason for the changes in the basement membrane. MMPs are considered to be involved in photoaging as MMP-1, 2, 3, and 9 were increased by a single UV irradiation in experiments using human fibroblasts and human skin (56, 57). A variety of cells, such as fibroblasts, keratinocytes, and inflammatory cells, can produce
MMPs in the skin. Also, it has been reported that various MMPs including MMP-2 and 9 are up-regulated by TGF-p in a variety of cell types including epithelial cells and fibroblasts (58, 59). Blocking of TGF-[ pathway significantly reduced the increase of type IV collagen mRNA level by chronic UVB irradiation (Fig. 3-13C), and also decreased the mRNA levels of MMP-2 and 9 which are known to degrade collagen IV
(Fig. 3-14). However, these message level changes were not reflected in the histological appearance of basement membrane or wrinkle formation. MMPs are secreted as inactive zymogens (pro-MMPs), and stimulation or repression of pro-MMP synthesis is mostly regulated at the transcriptional level by growth factors or cytokines (60). The activation of MMPs is another major regulatory step, and the activity of these enzymes needs to be assessed for better interpretation of the result.
We did not see any visible differences between the (+)UV(-)inh group the
(+)UV(+)inh group after 13 weeks of chronic UVB irradiation on the mouse skin. Both groups showed a significant amount of deep wrinkles on the dorsal surface after the
141

chronic UVB irradiation. It is notable that the deep wrinkles were formed in spite of no abnormal elastin deposition in dermis. Also, in our previous studies with haired mice, we observed solar elastosis after chronic UVB irradiation even though we could not see any any wrinkle in those mice. It may suggest that the solar elastosis may not the reason for wrinkle formation at least in mice, and also wrinkle formation may not be an appropriate end point of photoaging in mice. Furthermore, it is not known whether the mechanisms of wrinkle formation of human skin and the mouse skin are the same.
In summary, this study showed that the active TGF-P protein level, and mRNA for collagen III and IV, MMP-2 and 9, and TE mRNA levels might be regulated by TGF-
[ signaling pathways in the chronically UVB irradiated mouse skin. Because of the failure of generating solar elastosis on protein level, it is difficult to draw any conclusion at this point whether TGF-P is critical for the development of solar elastosis. In future studies, it will be important to use the appropriate UVB dose for the maximal generation of solar elastosis. Also, various other approaches to eliminate or enhance the TGF-P function such as conditional KO or overexpression of TGF-P in specific cell types should be tried to accurately evaluate the role of TGF-3 in photoaging.
142

References
1. Kligman, L. H. (1989) The ultraviolet-irradiated hairless mouse: a model for photoaging. J. Am. Acad Dermatol. 21, 623-631
2. El-Domyati, M., Attia, S., Saleh, F., Brown, D., Birk, D. E., Gasparro, F., Ahmad,
H., and Uitto, J. (2002) Intrinsic aging vs. photoaging: a comparative histopathological, immunohistochemical, and ultrastructural study of skin. Exp
Dermatol 11, 398-405
3.
4.
Lavker, R. M., and Kligman, A. M. (1988) Chronic heliodermatitis: a morphologic evaluation of chronic actinic dermal damage with emphasis on the role of mast cells. J Invest. Dermatol. 90, 325-330
Kielty, C. M., Sherratt, M. J., and Shuttleworth, C. A. (2002) Elastic fibres. J Cell
Sci 115, 2817-2828
5.
6.
Bernstein, E. F., Chen, Y. Q., Tamai, K., Shepley, K. J., Resnik, K. S., Zhang, H.,
Tuan, R., Mauviel, A., and Uitto, J. (1994) Enhanced elastin and fibrillin gene expression in chronically photodamaged skin. J. Invest. Dermatol. 103, 182-186
Bernstein, E. F., Brown, D. B., Urbach, F., Forbes, D., Del Monaco, M., Wu, M.,
Katchman, S. D., and Uitto, J. (1995) Ultraviolet radiation activates the human elastin promoter in transgenic mice: a novel in vivo and in vitro model of cutaneous photoaging. J. Invest. Dermatol. 105, 269-273
7.
8.
Seo, J. Y., Lee, S. H., Youn, C. S., Choi, H. R., Rhie, G. E., Cho, K. H., Kim, K.
H., Park, K. C., Eun, H. C., and Chung, J. H. (2001) Ultraviolet radiation increases tropoelastin mRNA expression in the epidermis of human skin in vivo. J
Invest Dermatol 116, 915-919
Starcher, B., Pierce, R., and Hinek, A. (1999) UVB irradiation stimulates deposition of new elastic fibers by modified epithelial cells surrounding the hair follicles and sebaceous glands in mice. JInvest Dermatol 112, 450-455
9. Sephel, G. C., Buckley, A., and Davidson, J. M. (1987) Developmental initiation of elastin gene expression by human fetal skin fibroblasts. JInvest Dermatol 88,
732-735
10. Parks, W. C. (1997) Posttranscriptional regulation of lung elastin production. Am
JRespir Cell Mol Biol 17, 1-2
11. Ritz-Timme, S., Laumeier, I., and Collins, M. J. (2003) Aspartic acid racemization: evidence for marked longevity of elastin in human skin. Br J
Dermatol 149, 951-959
143

12. Davison, J. M., Zang, M.-C., Zoia, O and Giro, M.G. (1995) Regulation of elastin synthesis in pathological states. In The molecular biology abnd pathology of
elastic tissues Vol. 192 pp. 81-99, Ciba Foundation Symposium, Wiley,
Chichester
13. Kondo, S. (2000) The roles of cytokines in photoaging. J. Dermatol. Sci. 23(1),
S30-S36
14. Roberts, A. B., and Sporn, M. B. (1992) Differential expression of the TGF-beta isoforms in embryogenesis suggests specific roles in developing and adult tissues.
Mol. Reprod. Dev. 32, 91-98
15. Quan, T., He, T., Kang, S., Voorhees, J. J., and Fisher, G. J. (2004) Solar ultraviolet irradiation reduces collagen in photoaged human skin by blocking transforming growth factor-beta type II receptor/Smad signaling. Am J Pathol
165, 741-751
16. Quan, T., He, T., Voorhees, J. J., and Fisher, G. J. (2005) Ultraviolet irradiation induces Smad7 via induction of transcription factor AP-1 in human skin fibroblasts. JBiol Chem 280, 8079-8085
17. Scharffetter-Kochanek, K. (1997) Photoaging of the connective tissue of skin: its prevention and therapy. Adv Pharmacol 38, 639-655
18. Kahari, V. M., Olsen, D. R., Rhudy, R. W., Carrillo, P., Chen, Y. Q., and Uitto, J.
(1992) Transforming growth factor-beta up-regulates elastin gene expression in human skin fibroblasts. Evidence for post-transcriptional modulation. Lab Invest
66, 580-588
19. Mauviel, A., Chen, Y. Q., Kahari, V. M., Ledo, I., Wu, M., Rudnicka, L., and
Uitto, J. (1993) Human recombinant interleukin-1 beta up-regulates elastin gene expression in dermal fibroblasts. Evidence for transcriptional regulation in vitro and in vivo. JBiol Chem 268, 6520-6524
20. Kossodo, S., Wong, W. R., Simon, G., and Kochevar, I. E. (2004) Effects of UVR and UVR-induced cytokines on production of extracellular matrix proteins and proteases by dermal fibroblasts cultured in collagen gels%. Photochem Photobiol
79, 86-93
21. Scordi, I. A., and Vincek, V. (2000) Timecourse study of UVB-induced cytokine induction in whole mouse skin. Photodermatol Photoimmunol Photomed 16, 67-
73
22. Lee, H. S., Kooshesh, F., Sauder, D. N., and Kondo, S. (1997) Modulation of
TGF-beta 1 production from human keratinocytes by UVB. Exp. Dermatol. 6,
105-110
144

23. Katchman, S. D., Hsu-Wong, S., Ledo, I., Wu, M., and Uitto, J. (1994)
Transforming growth factor-beta up-regulates human elastin promoter activity in transgenic mice. Biochem. Biophys. Res. Commun. 203, 485-490
24. Karonen, T., Jeskanen, L., and Keski-Oja, J. (1997) Transforming growth factor beta 1 and its latent form binding protein-i associate with elastic fibres in human dermis: accumulation in actinic damage and absence in anetoderma. Br J
Dermatol 137, 51-58
25. Grygielko, E. T., Martin, W. M., Tweed, C., Thornton, P., Harling, J., Brooks, D.
P., and Laping, N. J. (2005) Inhibition of Gene Markers of Fibrosis with a Novel
Inhibitor of Transforming Growth Factor- {beta} Type I Receptor Kinase in
Puromycin-Induced Nephritis. J Pharmacol Exp Ther 313, 943-951
26. de Gouville, A. C., Boullay, V., Krysa, G., Pilot, J., Brusq, J. M., Loriolle, F.,
Gauthier, J. M., Papworth, S. A., Laroze, A., Gellibert, F., and Huet, S. (2005)
Inhibition of TGF-beta signaling by an ALK5 inhibitor protects rats from dimethylnitrosamine-induced liver fibrosis. Br JPharmacol 145, 166-177
27. Bonniaud, P., Margetts, P. J., Kolb, M., Schroeder, J. A., Kapoun, A. M., Damm,
D., Murphy, A., Chakravarty, S., Dugar, S., Higgins, L., Protter, A. A., and
Gauldie, J. (2005) Progressive Transforming Growth Factor {beta} 1-induced
Lung Fibrosis Is Blocked by an Orally Active ALK5 Kinase Inhibitor. Am J
Respir Crit Care Med 171, 889-898
28. DaCosta Byfield, S., Major, C., Laping, N. J., and Roberts, A. B. (2004) SB-
505124 is a selective inhibitor of transforming growth factor-beta type I receptors
ALK4, ALK5, and ALK7. Mol Pharmacol 65, 744-752
29. Bissett, D. L., Hannon, D. P., and Orr, T. V. (1987) An animal model of solaraged skin: histological, physical, and visible changes in UV-irradiated hairless mouse skin. Photochem. Photobiol. 46, 367-378
30. Ibbotson, S. H., Moran, M. N., Nash, J. F., and Kochevar, I. E. (1999) The effects of radicals compared with UVB as initiating species for the induction of chronic cutaneous photodamage. JInvest Dermatol 112, 933-938
31. Bissett, D. L., Hillebrand, G. G., and Hannon, D. P. (1989) The hairless mouse as a model of skin photoaging: its use to evaluate photoprotective materials.
Photodermatol 6, 228-233
32. Moloney, S. J., and Learn, D. B. (1992) The effect of systemic cyclosporin A on a hairless mouse model of photoaging. Photochem Photobiol 56, 495-504
33. Kiss, I., Chen, S., and Tramposch, K. M. (1991) The effect of high and low ultraviolet-B dose exposure on the degree of hairless mouse skin wrinkling.
Photochem Photobiol 53, 109-112
145

34. Hirose, R., and Kligman, L. H. (1988) An ultrastructural study of ultravioletinduced elastic fiber damage in hairless mouse skin. JlInvest Dermatol 90, 697-
702
35. Kaplow, L. S. (1965) Simplified myeloperoxidase stain using benzidine dihydrochloride. Blood 26, 215-219
36. Limper, A. H. (2000) Methods in Molecular Biology Vol. 142, Humana Press,
Clifton, N.J.
37. Starcher, B. C. (1977) Determination of the elastin content of tissues by measuring desmosine and isodesmosine. Anal Biochem 79, 11-15
38. Stegemann, H., and Stalder, K. (1967) Determination of hydroxyproline. Clin
Chim Acta 18, 267-273
39. Kochevar, I. E., Moran, M., Lyon, N., Flotte, T., Siebert, E., and Gange, R. W.
(1993) Effects of systemic indomethacin, meclizine, and BW755C on chronic ultraviolet B-induced effects in hairless mouse skin. J Invest Dermatol 100, 186-
193
40. Abe, M., Harpel, J. G., Metz, C. N., Nunes, I., Loskutoff, D. J., and Rifkin, D. B.
(1994) An assay for transforming growth factor-beta using cells transfected with a plasminogen activator inhibitor-i promoter-luciferase construct. Anal Biochem
216, 276-284
41. Kochevar, I. E., Moran, M., Lyon, N., Flotte, T., Siebert, E., and Gange, R. W.
(1993) Effects of systemic indomethacin, meclizine, and BW755C on chronic untraviolet B-induced effects in hairless mouse skin. J. Invest. Dermatol. 100,
186-193
42. Kochevar, I. E., Moran, M., and Granstein, R. D. (1994) Experimental photoaging in C3H/HeN, C3H/HeJ, and Balb/c mice: comparison of changes in extracellular matrix components and mast cell numbers. JInvest Dermatol 103, 797-800
43. Wang, H., and Kochevar, I. E. (2005) Involvement of UVB-induced reactive oxygen species in TGF-beta biosynthesis and activation in keratinocytes. Free
Radic Biol Med 38, 890-897
44. Panteleyev, A. A., van der Veen, C., Rosenbach, T., Muller-Rover, S., Sokolov,
V. E., and Paus, R. (1998) Towards Defining the Pathogenesis of the Hairless
Phenotype. JInvest Dermatol 110, 902-907
45. Chu, D. H., Haake, A. R., Holbrook, K., and Loomis, C. A. (2003) The structure and development of skin. In Fitzpatrick's dermatology in general medicine (Katz,
S. I., ed) Vol. I pp. 58-88, McGraw-Hill, New York
146

46. Kaminer, M. S. (1995) Photodamage: magnitude of the problem. In Photodamage
(Gilchrest, B. A., ed) pp. 1-25, Blackwell science, Cambridge
47. Inomata, S., Matsunaga, Y., Amano, S., Takada, K., Kobayashi, K., M., T.,
Nishiyana, T., Kohno, Y., and Fukuda, M. (2003) Possible involvement of gelatinases in basement membrane damage and wrinkle formation in chronically ultraviolet B-exposed hairless mouse. J Invest Dermatol 120, 1-7
48. Hocevar, B. A., Brown, T. L., and Howe, P. H. (1999) TGF-beta induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4independent pathway. Embo J 18, 1345-1356
49. Eickelberg, 0. (2001) Endless healing: TGF-beta, SMADs, and fibrosis. FEBS
Lett. 506, 11-14
50. Gonzalez, S., Moran, M., and Kochevar, I. E. (1999) Chronic photodamage in skin of mast cell-deficient mice. Photochem. Photobiol. 70, 248-253
51. Tsukahara, K., Takema, Y., Moriwaki, S., Tsuji, N., Suzuki, Y., Fujimura, T., and
Imokawa, G. (2001) Selective inhibition of skin fibroblast elastase elicits a concentration dependent prevention of ultraviolet induced wrinkle formation. J
Invest Dermatol 117, 671-677
52. Khalil, N. (1999) TGF-beta: from latent to active. Microbes. Infect. 1, 1255-1263
53. Kligman, L. H., Gebre, M., Alper, R., and Kefalides, N. A. (1989) Collagen metabolism in ultraviolet irradiated hairless mouse skin and its correlation to histochemical observations. JInvest Dermatol 93, 210-214
54. Quan, T., He, T., Voorhees, J. J., and Fisher, G. J. (2001) Ultraviolet irradiation blocks cellular responses to transforming growth factor-beta by down-regulating its type-II receptor and inducing Smad7. JBiol Chem 276, 26349-26356
55. Inomata, S., Matsunanga, Y., Amano, S., Takada, K., Kobayashi, K., Tsunenaga,
M., Nishiyama, T., Kohno, Y., and Fukuda, M. (2003) Possible involvement of gelatinases in basement membrane damage and wrinkle formation in chronically ultraviolet B-exposed hairless mouse. J Invest Dermatol 120, 1-7
56. Fisher, G. J., Datta, S. C., Talwar, H. S., Wang, Z. Q., Varani, J., Kang, S., and
Voorhees, J. J. (1996) Molecular basis of sun-induced premature skin ageing and retinoid antagonism. Nature 379, 335-339
57. Fisher, G. J., Wang, Z. Q., Datta, S. C., Varani, J., Kang, S., and Voorhees, J. J.
(1997) Pathophysiology of premature skin aging induced by ultraviolet light. N
Engl JMed 337, 1419-1428
147

58. Kim, E. S., Kim, M. S., and Moon, A. (2004) TGF-beta-induced upregulation of
MMP-2 and MMP-9 depends on p38 MAPK, but not ERK signaling in MCF1OA human breast epithelial cells. Int J Oncol 25, 1375-1382
59. Leivonen, S. K., Chantry, A., Hakkinen, L., Han, J., and Kahari, V. M. (2002)
Smad3 mediates TGF-beta-induced collagenases-3 (MMP-13) expression in human gingical fibroblasts. Evidnce for cross-talk between Smad3 and p38 signaling pathways. JBiol Chem 277, 46338-46346
60. Reynolds, J. J. (1996) Collagenases and tissue inhibitor of metalloproteinases: a functional balance in tissue degradation. Oral Dis 2, 70-76
148

149

The goal of this thesis study was to understand the role of TGF-[ in skin photoaging, a premature skin aging caused by chronic exposure of skin to UVR. Solar elastosis, the accumulation of elastotic material in the dermis, is a hallmark of photoaging. TGF-P 1 is one of the cytokines induced by UVR, and involved in the synthesis of the major extracellular matrix proteins, collagen and elastin. It has been previously shown that TGF-P 1 was able to induce TE expression in dermal fibroblasts.
Two major hypotheses tested in this thesis were: I) up-regulation of TE by TGF- 1 is mediated by ROS, and II) TGF-P mediates skin photoaging, especially, solar elastosis.
Hypothesis I was evaluated in a study using human dermal fibroblasts in vitro.
Up-regulation of TE mRNA by TGF-[ and the involvement of ROS in the mechanism were investigated (Chapter II). Involvement of ROS in the development of solar elastosis has been demonstrated by many studies using antioxidants and anti-inflammatory agents in the mouse skin in vivo. We hypothesized that ROS produced from different intracellular sources by TGF-3 would be involved in TE up-regulation, and also different sources might be engaged at different time points. We have demonstrated the involvement of ROS produced from both NADPH oxidase and mitochondria in the TGFinhibitors, namely, DPI and mitoQ, for each source. DPI is the most commonly used inhibitor for NADPH oxidase, however, it also inhibits ROS production from other flavoenzymes. RNAi technology can be utilized in the future to specifically knockdown a subunit of NADPH oxidase of fibroblasts to confirm the data. The time course studies showed that the ROS produced < 2 h after TGF-P1 addition were important in TE induction. NADPH oxidase seems to be involved only in the early time period (< 1 h), whereas the mitochondria seem to be involved for a longer time period (up to 2 h). Also, the fact that DPI is able to block TE induction completely when it was added less than 1 h after TGF-3 1 suggests that ROS from NADPH may affect ROS production from mitochondria. Direct measurement of ROS time course with DPI or with the knockdown of a NADPH oxidase subunit will be able to confirm this result.
We have to keep in mind that UVR stimulates ROS generation from multiple sources. In fact, photoaging can be considered as a chronic inflammatory condition,
150

because of the significant infiltration of the inflammatory cells recruited in dermis after chronic UV exposures. Inflammatory cells, such as neutrophils and macrophages, are the major sources for the production of ROS in the skin. UVB is also directly absorbed by epidermal keratinocytes that can also produce ROS. Therefore, the effects of exogenous
ROS on TE production by fibroblasts can not be ignored. In fact, exogenous ROS in the absence of TGF-P were reported to increase the TE mRNA level in dermal fibroblasts, although attempts to reproduce that result by this lab were not successful. Also, it is not clear whether exogenous ROS triggers endogenous ROS production, which then induces increase of TE mRNA. We hypothesize that administration of exogenous ROS with knockdown of endogeous sources of ROS (i.e. NADPH oxidase) using RNAi will inhibit
TE mRNA increase. We do not know how ROS and TGF-p are connected in vivo to generate solar elastosis. As shown in dermal fibroblasts in vitro, ROS generated in fibroblasts by TGF-P may induce the up-regulation of TE mRNA. Also, ROS generated by the inflammatory cells may mediate TGF-3 action through the TGF-3 activation.
Studies from our group using gp91P ph ° gene KO mice devoid of NADPH oxidase activity showed significant inhibition of solar elastosis after chronic UVB irradiation, indicating the importance of ROS from NADPH oxidase in neutrophils and macrophages in the development of solar elastosis. It will be interesting to know whether elimination of ROS those mice result in reduced TGF-[ activity.
Understanding the mechanisms that lead to TE up-regulation is critical to ultimately find ways to intervene or reverse the photoaging after UV exposure. We showed that both Smad and non-Smad pathways, e.g. MAPK and PKC pathways, are required for TE mRNA up-regulation by TGF-P. However, we found that in our conditions, ROS are not involved in some of the important initial steps in these pathways, such as phosphorylations of p38 or ERK or Smad2. Also, we confirmed that de novo synthesis of proteins is important in the mechanism, opening the possibilities for the ROS involvement in the synthesis of any of those proteins. ROS may be involved in synthesis or activation of some transcriptional factors, such as AP-1, which is known to be activated by MAPK pathways after UV irradiation. Alternatively, ROS may be involved in translocation of Smad2/3-Smad4 complexes or p38 or ERK, although there is nothing known about this pathway.
151

We have shown so far that TE mRNA levels are up-regulated by TGF-3 in vitro.
Does this mean that we will not see either solar elastosis or wrinkle formation in the photoaged skin without any TGF-P action? The second hypothesis that TGF-P mediates skin photoaging, especially, solar elastosis, was tested in a study with the TGF-P receptor inhibitor in a hairless mouse in vivo. The results showed that the absence of TGF-3 signal transduction decreased the levels of active TGF-3 protein, and mRNA levels for collagen
III and IV, MMP-2 and 9, and TE in the chronically UVB irradiated mouse skin (Chapter
3). As explained in the results section in chapter 3.3.2.6, the interpretation of the PCR results obtained using the whole skin RNA in this study is complicated by the fact that there is a mixed population of cells in whole skin, and after the chronic irradiation, there is a significant increase in the number of keratinocytes and the inflammatory cells, as well as the size and the number of dermal cysts. Our modification of data is based on the several assumptions including that all the cells produce the same mRNA level of the housekeeping gene, HPRT, and the number of fibroblasts does not change after the chronic UVB treatment. The mRNA level of other housekeeping gene may be measured to test the first assumption. Also, the number of fibroblasts can be counted on the histology section to test the second assumption. Alternative approach to avoid all these complications is to use the laser capture microdissection (LCM) technique. It allows to select only the specific cell types, such as fibroblasts, and to extract RNA from only those cells.
Our study had an unexpected problem that we could not observe the increase in elastin protein content after the 13 weeks of chronic UVB irradiation. Histologically, the abnormal elastin fiber deposition was not found, either. We suspect that it may due to too high UVB dose. One possible effect of UVB is degradation of elastin fibers by direct absorption of UVB. UVB mostly does not penetrate into dermis in human skin. However, considering the epidermal thickness of mouse skin is about 5 times thinner than that of human skin, direct absorbtion of UVB by elastin protein in dermis is quite feasible in mouse skin. It may be tested in ex vivo mouse skin with known elastin content using different doses of UVB irradiation. Alternatively, a decreased activity of the lysyl oxidase or an increased level of elastase or other elastin-degrading enzymes after high dose of
UVB irradiation may have caused no change in elastin content. Also, elastic fiber is a
152

complex structure composed of other proteins such as fibrillins, fibulins and glycoproteins as well as elastin. Abnormal elastic fibers may have different composition of these various proteins, and maybe it is the imbalance of production of elastin and other proteins that causes abnormal structure of elastin fibers. To undertand the better picture of solar elastosis, studies on these other components of elastic fiber should be accompanied.
To investigate the role of TGF-P in photoaging in vivo, potentially both genetic approaches and pharmacological approaches are available. Unfortunately, TGF-3 1 homozygous knockout mice have no gross developmental abnormalities at birth but succumb to multifocal inflammatory lesions that lead to organ failure and death about 20 days after birth (1). TGF-P heterozygous KO mice have a normal life span, but have 60-
65% of normal TGF-3 level (2) which may be enough to induce the effects needed for the photoaging processes. Conditional KO of TGF-p in a specific cell type such as neutrophils, macrophages, or dermal fibroblasts would be another interesting approach.
On the other hand, overexpression of TGF-3 can also be useful. However, mice are not always viable for a long time in this case. For example, mice overexpressing active TGF-
31 restricted to the epidermis exhibit abnormal development of the skin and die within 24 h of birth (3). In these mice epidermal cell proliferation was suppressed, presumably as early as day 15 of embryogenesis when the keratin promoter becomes active and when embryonic skin initially stratifies. Interestingly, TGF-p 1 null mice display no gross epithelial abnormalities, although a somewhat elevated proliferative index of the epidermis has been reported (4). Pharmacologically, TGF-P neutralizing antibody can be used to eliminate any effect of TGF-[ systemically, however, this approach could be extremely expensive for a chronic 13-week experiment. New RNAi technology to specifically knockdown various proteins along the TGF-P signal transduction pathways is a very appealing approach. In the mouse model, introduction of TPRII specific siRNA significantly reduced the inflammatory response and matrix deposition (5). However, this approach also costs very much for in vivo studies at the current stage.
153

Overall, this work indicates that TGF-P contributes to the solar elastosis, through the effects on the TE mRNA level in skin. Implication of this role of TGF-3 in the elastin fiber deposition or visible changes of photoaged skin requires further investigation.
154

References
1.
2.
3.
4.
5.
Williams, A. O., Knapton, A. D., Geiser, A., Letterio, J. J., and Roberts, A. B.
(1996) The liver in transforming growth factor-Beta-i (TGF-beta 1) null mutant mice. Ultrastruct Pathol 20, 477-490
Von Pfeil, A., Hakenjos, L., Herskind, C., Dittmann, K., Weller, M., and
Rodemann, H. P. (2002) Irradiated homozygous TGF-betal knockout fibroblasts show enhanced clonogenic survival as compared with TGF-betal wild-type fibroblasts. Int. J Radiat. Biol. 78, 331-339
Sellheyer, K., Bickenbach, J. R., Rothnagel, J. A., Bundman, D., Longley, M. A.,
Krieg, T., Roche, N. S., Roberts, A. B., and Roop, D. R. (1993) Inhibition of skin development by overexpression of transforming growth factor beta 1 in the epidermis of transgenic mice. Proc Natl Acad Sci USA 90, 5237-5241
Glick, A. B., Kulkami, A. B., Tennenbaum, T., Hennings, H., Flanders, K. C.,
O'Reilly, M., Sporn, M. B., Karlsson, S., and Yuspa, S. H. (1993) Loss of expression of transforming growth factor beta in skin and skin tumors is associated with hyperproliferation and a high risk for malignant conversion. Proc
Natl Acad Sci USA 90, 6076-6080
Nakamura, H., Siddiqui, S. S., Shen, X., Malik, A. B., Pulido, J. S., Kumar, N.
M., and Yue, B. Y. (2004) RNA interference targeting transforming growth factor-beta type II receptor suppresses ocular inflammation and fibrosis. Mol Vis
10, 703-711
155

Education Massachusetts Institute of Technology Cambridge, MA
Ph.D. in Medical Engineering Medical Physics program at Harvard-MIT
Division of Health Sciences and Technology, 2005.
Advisor: Irene E. Kochevar
Thesis: Involvement of TGF-P in Skin Photoaging
Massachusetts Institute of Technology Cambridge, MA
M.S. in Chemical Engineering, September, 2001.
Advisors: Robert S. Langer and Alexander M. Klibanov
Thesis: Nonaqueous Suspensions of Pharmaceutical Macromolecules for
Pulmonary Delivery
Seoul National University
B.S. in Chemical Engineering, February, 1997.
Advisor. Kookheon Char
Thesis. Experimental Studies on the Block Copolymer Adsorption at
Seoul, Korea
Liquid/Solid Interface Using Photophysical Technique
Magna cum laude. Recipient, Dean's Fellowship Award for academic excellence.
A full scholarship student for 4 years.
Experience Massachusetts General Hospital
Wellman Center for Photomedicine.
January 2002- current
Boston, MA
Research Assistant. In vivo and in vitro studies of the involvement of TGF-P in solar elastosis and the mechanism of skin photoaging.
Massachusetts Institute of Technology
September, 2001 - January, 2002.
Teaching Assistant for Integrated Chemical Engineering course.
Cambridge, MA
Mt. Auburn Hospital
June, 2001- July, 2001.
Cambridge, MA
Clerkship. Served as a full-time member of a ward team and participate in longitudinal patient care.
Massachusetts Institute of Technology
June, 1998 - May, 2001.
Cambridge, MA
Research Assistant. Development of a novel inhalation drug delivery technology based on non-toxic organic suspensions of various enzymes and protein hormones. Conducting in vitro studies as well as in vivo studies in collaboration with Inhalation Toxicology Laboratory at Harvard School of Public Health.
Seoul National University Seoul, Korea
June, 1996-May, 1997.
Undergraduate Researcher. Polymer & Colloid Engineering Laboratory.
Experimental studies on the amphiphilic block copolymer adsorption on colloidal silica sols using fluorescence technique.
156

Publication/ Presentations
Choi, W. S., Mitsumoto, A., and Kochevar, I. E., "Involvement of Reactive
Expression in Human Dermal Fibroblasts", poster presentation at the 14 th
International Congress on Photobiology, June 2004, Jeju, Korea.
Mitsumoto, A., Choi, W., Rajadurai, C., and Kochevar, I. E., "Involvement of
Reactive Oxygen Species in Tropoelastin mRNA Induced in Human Dermal
Fibroblasts by Transforming Growth Factor-1", Free Radic. Biol. Med., submitted.
Choi, W. S., Murthy, G. G. K., Edwards, D. A., Langer, R., and Klibanov, A. M.,
"Inhalation Delivery of Proteins from Ethanol Suspensions," Proc. Natl. Acad.
Sci. USA, 98(20), 11103-11107, 2001.
Choi, W. S., Langer, R. S. and Klibanov, A. M., "Nonaqueous Suspensions of
Pharmaceutical Macromolecules for Pulmonary Delivery, " poster presentation at
The MIT Conference on Bioengineering & Health in the 21st Century, November
2000, Cambridge, MA.
Technical Skills
Cell culture
Histology, Immunohistochemistry, Immunofluorescence
RNA & DNA extraction from cells and tissues
RT-PCT (conventional), Real-time PCR
Western-blot
ELISA
Transfection, RNAi
Animal handling
Languages
Service
English (fluent), Korean (native), French (intermediate), Japanese (beginner)
Treasurer in the Korean Graduate Student Association at MIT (2001-2002)
157

MITLibraries
Document Services
Room 14-0551
77 Massachusetts Avenue
Cambridge, MA 02139
Ph: 617.253.5668 Fax: 617.253.1690
Email: docs@mit.edu
http: //libraries. mit. edu/docs
Due to the
of
original material, there are unavoidable flaws in this reproduction. We have made every effort possible to provide you with the best copy available. If you are dissatisfied with this product and find it unusable, please contact Document Services as soon as possible.
Thank you.
will