? )
/
Functional Analysis of K-ras in the Mouse by Gene Targeting
by
Leisa Kay Johnson
B.A., Chemistry
Hastings College, 1989
Submitted to the Department of Biology
in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
at the
Massachusetts Institute of Technology
May 1996
©
1996 Leisa K. Johnson
All rights reserved
The author hereby grants to MIT permission to reproduce and to distribute
publicly copies of this thesis document in whole or in part.
Signature of Author:
':"~~
"
~
rt
'
;.::r-o~ •.~ .. Y..~.Y..x;I.'w'" •• ~•••••••••••••••
Department of Biology
May 20,1996
Certified by:
*••••••••••••••••• .,
.,•••••,. •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••
Tyler E. Jacks
Assistant Professor of Biology
Thesis Supervisor
/
Accepted by:
-.;•..
1."'.; •••••••••••••••••••••••••••••••••••••••••••••••• ••••••••••••••••••••••••
Frank Solomon
Chairman of the Biology Graduate Committee
r ARCHIVES
iw'IASSACHUSETTS INSTITUTE ,
OF TECHNOLOGY
:r,,~
JUL 0 81996
LIBRARIES
1
FUNCTIONAL ANALYSIS OF K-RAS IN THE MOUSE BY GENE TARGETING
by
Leisa Kay Johnson
Submitted to the Department of Biology
on May 28, 1996 in Partial Fulfillment of the
Requirements for the Degree of
Doctor of Philosophy
ABSTRACT
Mutations in the ras oncogenes are one of the most frequent alterations in human cancer. It is
estimated that approximately 30% of all human tumors carry mutations in one of the three ras
genes, H-, N-, and K-ras. As such, pharmaceutical companies have focused on activated Ras as a
potential chemotherapeutic target.
To characterize the normal role of K-ras in growth and development, I have mutated it through
gene targeting in the mouse. I now show that K-ras is the only essential member of this gene
family for mouse embryogenesis. Embryos homozygous for the null mutation die between days
12 and 14 of gestation, with defects in the fetal liver and evidence of anemia. In addition, I have
demonstrated partial functional compensation between the ras genes as multiple mutations within
the ras gene family can affect phenotype. Most embryos lacking N-ras function and heterozygous
for the K-ras mutation exhibit abnormal hematopoietic development and die between days 10 and
12 of embryogenesis. Embryos lacking both K-ras and N-ras function fail yet earlier in
development. Thus, a critical threshold level of overall Ras activity must be achieved during early
murine development, with a unique requirement for K-ras function arising still later in
embryogenesis.
In human tumors, K-ras is the most frequently mutated member of the ras gene family.
Therefore, an accurate animal model to study the role of oncogenic K-ras in tumorigenesis is
important. I now demonstrate a novel method of activation of an oncogene in vivo. Using a
variation of the hit-and-run gene targeting strategy, I have created a strain of mice carrying a
spontaneously activatable allele of the K-ras oncogene. As expected, these animals exhibit
multiple lesions. In particular, they are highly susceptible to lung tumors and lymphomas. I
believe that this K-ras mutant strain will prove invaluable in the study of K-ras activation in
tumorigenesis as well as in evaluating the efficacy of chemotherapeutic drugs. In addition, this
innovative approach of oncogene activation may be used to generate other improved animal
models of cancer.
Thesis Supervisor: Tyler Jacks
Title: Assistant Professor of Biology
Acknowledgements
First and foremost, I would like to thank my adviser, Tyler. Thanks for adopting this orphan and
allowing me to re-discover the joys and excitement that science can offer. Thanks for countless
hours of advice, support, and for being laid back and easy to approach. Thanks for respecting my
opinion and for providing such a great place to work. I hope you never lose that great sense of
humor! Thanks for being such a good sport at quarters and don't ever forget what a great place
Nebraska is (Lincoln-Omaha, what's the dif?) or those Cornhuskers! Maybe we'll cross paths
again some day in SF!
A very special thanks to my mom! Thanks for instilling in me my values and the courage to go
after my dreams. Thanks for being my friend and for always being there for me, through all the
good and bad times. You've been the best role model that a person could ever have.
Thanks to my sister and very best friend, Ellen! I feel as though you're like a twin and can share
anything with you. You're the true picture of a "big sister" and have always guided me down the
right path. Thanks for giving me a little Godchild and a great brother-in-law, Darryn. I only hope
that you guys have used that can of whipped cream by now (from one ---less wonder to another!).
To my brother, David, thanks for everything over the years.
Thanks to my old roommate and fellow orphan, Christina Scherer. Thanks for being my second
mom and sending me care packages while writing this thesis! You've been a great friend and I
can't wait until we're back together again on the West Coast. T and L-here we come! I just hope
they're ready for us, girl.
To my friend and baymate, Kay Macleod-thanks for being a great friend, for your help and advice,
both personal and scientific. We will always have Patty Burke's, and we can never forget CSH
and GE and JR! We will definitely have to hook up at another meeting and share the good life that
Scotland has to offer.
To Doron Greenbaum, thanks for putting up with my anal retentiveness and moods. You've been
an immense help to me over the past two years and I will always being thankful for that.
Thanks to Andi McClatchey, Laura Attardi and Lee Remington for friendship, support, and advice.
Laura you've been a great friend and someone that I can easily share common hardships with. I'll
miss our shopping excursions and seminar art classes!
To the only other hick in the lab, Bart (Barto) Williams--thanks for the advice and help with the ole
mice! Just remember--NEBRASKA rules and the Cornhuskers are #1!! Thanks to all of the
other members of the lab, past and present, for being great friends and people to work with and
making our second home such a great place to work!
And to Rod Bronson, the pathologist of the hour! The only person I know who can bring such a
humerous light to tumors! I've learned a lot from you. Thanks for taking the time to teach me
and for listening to me when I was at my wits end!
A special thanks to all of my friends over the years on the fifth floor, especially the Sharpies and
Housmanites of old! Our 5th floor beer hours were famous! And to Margarita, thanks for always
being there to help and for always having that kind smile on your face.
Thanks to Neptune Mizrahi (what a great name!) for becoming such a special friend over the
years. We can always thank Tufts for allowing us to cross paths in this world.
To the men of our bay--Brad and Mel!! What would we have done without them?
To Melrose Place, for providing endless hours of amusement for Laura, Reuben, and myself and
always giving us something to look forward to on Monday nights and give George a hard time
about!
A very warm and special thanks to Neal, a friend and confidant of old. You gave me years of joy,
laughter, love and support.
And most importantly, I want to thank Devin. Thanks for giving me the time of my life and for
being the pot of gold at the end of my rainbow. Thanks for brightening my days just by hearing
your voice thousands of miles away. And thanks for keeping the dream alive-our time has finally
come!
Table of Contents
Title page
1
Abstract
2
Acknowledgements
3
Table of Contents
5
List of Figures and Tables
8
Chaper 1: Overview of Ras Function and Signaling
10
I. Primary Structure
Mammalian ras Genes and their Evolutionary Conservation
ras-Related Genes
11
11
12
II. Biochemical Properties of Ras
Guanine Nucleotide Binding
Post-translational Modifications and Membrane Association
The Effector Domain
14
14
16
20
III. Functions of ras Genes
Non-mammalian Systems
Mammalian Systems
A Causative Role for Oncogenic ras in Tumorigenesis
Oncogenic ras and Multistep Tumorigenesis
21
21
22
24
26
IV. Regulators of the Ras GTP/GDP Cycle
Guanine Nucleotide Exchange Factors
GTPase Activating Proteins
Guanine Nucleotide Dissociation Inhibitors
Ras Regulators as Targets for Tumorigenesis
29
30
32
37
38
V. The Ras Signal Transduction Pathway
Regulation of the Ras GDP/GTP Cycle by Mitogenic Stimuli
Ras Transmits a Signal to the Nucleus via a Cascade of
Serine/Threonine Kinases
The Rho-subfamily of Small GTP-binding Proteins: Their
Signaling Pathways and Requirement for Ras-mediated
Transformation
39
39
43
VI. Ras Signaling as a Target for Drug Therapy
Famesyltransferase Inhibitors
The FTase Inhibitor Paradox: Efficacy without Cytotoxicity
51
51
53
References:
57
46
Chapter 2: K-ras is an Essential Gene in Mouse Embryogenesis with Partial
Functional Overlap with N-ras
Abstract
Introduction
Results:
Disruption of the Murine K-ras Gene
K-ras is an Essential Gene
Fetal Liver Defect in K-ras-1 - Embryos
Functional Analysis of K-ras-/ - Hematopoiesis
K-ras-/- ES Cells have Reduced Contribution to
Hematopoietic Compartments
No Upregulation of Ras Family Members in K-ras-1-Embryos
Genetic Interaction Between K-ras and N-ras
N-ras-/-; K-ras+/-Embryos Die with Severe Anemia
Hematopoietic Colony Formation in Cultures of
N-ras-/-; K-ras+l- Yolk Sacs
N-ras-l-; K-ras+l-Embryos Die Between E3.5 and E9.5
85
89
91
94
96
99
102
104
114
116
Discussion: K-ras is an Essential Gene in the Mouse
K-ras and N-ras Interact Genetically
Functional Requirement for Ras in Hematopoiesis
Implications for Oncogenesis and Therapy
118
120
121
122
Experimental Procedures
124
References
131
Chapter 3: Analysis of an Oncogenic Allele of K-ras in the Initiation and Progression
of Tumorigenesis in the Mouse via a Novel Approach
137
Abstract
138
Introduction
139
Results:
Generation of ES Cells carrying a Spontaneously
Activatable Allele of K-ras
Creation of ES Cells Heterozygous for an Oncogenic Allele
of K-ras Through Intrachromosomal Recombination of the
K-rasD12 -A Allele in vitro
Generation of Mice Carrying a Latent Oncogenic K-ras Allele,
K-rasD12 -L, and its Tumorigenic Consequences
144
152
159
Discussion: Strategies for Analyzing Functional Mutations in the Mouse
Examining the Multistep Nature of Cancer in the Mouse
165
169
Experimental Procedures
173
Chapter 4:
References
177
Overview and Future Directions
182
Appendix 1: The PDGF Inducible Factor SIF is Related to the Interferon Activated
p91 Transcription Factor
187
Abstract
188
Introduction/Results/Discussion
189
Experimental Procedures
199
References
202
Biographical Sketch
205
List of Figures and Tables
The Ras Superfamily
Post-translational processing of Ras proteins
Conservation of the Ras signal transduction pathway
Ras signaling pathways
Effectors of Ras
13
18
23
40
44
Chapter 1:
Table 1.1.
Figure 1.1.
Table 1.2.
Figure 1.2.
Table 1.3
Chapter 2:
Figure 2.1. Disruption of K-ras in ES cells
Figure 2.2. Viability plot for K-ras-1- embryos
Figure 2.3. Phenotypic comparison of K-ras-1- embryos and
control littermates
Figure 2.4. GPI isoenzyme analysis on K-ras+l- and K-ras-l chimeras
Figure 2.5. N-ras and H-ras are not upregulated in response to the
loss of K-ras
Table 2.1.
Summary of dissection analysis for N-ras-l-; K-ras+lembryos
Figure 2.6. Comparison of N-ras-l-; K-ras+/-and control
littermates at E10.5
Figure 2.7. Histology of E9.5 and E10.5 N-ras-/-; K-ras+/ - and
control embryos
Figure 2.8. N-ras-1 -; K-ras+/ - embryos exhibit morphological
abnormalities late in gestation
Figure 2.9. Histology of E15.5-16.5 N-ras--'; K-ras+l- fetal livers
Table 2.2. Summary of dissection analysis for N-ras-/-; K-ras-1embryos
86-88
90
92-93
Figure 3.1.
Figure 3.2.
145-146
148-149
Chapter 3:
Strategy for creating activatable alleles of K-ras
Genomic configurations of the K-rasD12 -L and
K-rasD12-A alleles following insertional recombination
Table 3.1.
Summary of targeting frequencies and integration
patterns
Figure 3.3. Observed integration patterns in targeted K-ras clones
Figure 3.4. The aspartic acid and HindIII mutations appear to
co-integrate
Table 3.2. Summary of in vitro run step on K-rasD12 -A allele
Figure 3.5. Functional intrachromosomal recombination in the
K-rasD12-A allele
Figure 3.6. Generation of ES cells carrying a functional oncogenic
allele of K-ras
Figure 3.7. Germ line transmission of the K-rasD12 -L allele
Figure 3.8. Histopathology of Tumors in K-rasD12 -L allele mice
97-98
100-101
103
105-106
107-108
110-111
112-113
115
150
151
153
155
156
158
160
163-164
Appendix 1: Figure 1.1.
Specific crosslinking of a 91 kD protein to the SIE in
extracts of v-sis conditioned media treated cells
Figure 1.2. Antisera to the ISGF3 p91 supershifts SIF complexes
Table 1.1.
Comparison of the sequences of the c-fos SIE and
interferon responsive elements
Figure 1.3. The c-fos SIE and IFN-y responsive elements cross
compete for binding to IFN-y and PDGF induced
complexes
Figure 1.4. Inducible binding to the SIE is diminished in cell lines
deficient in ISGF3-p91
190
192
194
195
197
Chapter 1
Overview of Ras Function and Signaling
10
The ras oncogenes were first identified as the transforming principle of the Harvey and Kirsten rat
sarcoma viruses (1). Scientists rediscovered these genes while characterizing the existence of
dominant oncogenes in human and animal tumors through the use of gene transfer assays (2-8).
Most of these transforming genes were later identified as mutated alleles of cellular ras protooncogenes (3, 7-12). Ever since their discovery and association with human tumors, the ras genes
have been the focus of intense research trying to understand the role that they play in neoplastic
development. In addition, a large and ever expanding family of ras-related genes have been
identified (13). Interestingly, none of these other members has been shown to be mutated in
human cancers and only recently has it been demonstrated that some of these genes possess
transforming ability in vitro (14, 15). This introduction will give an overview on the structural and
biochemical properties of ras genes, the proteins regulating Ras activity, the function of Ras and its
signaling pathway in normal and neoplastic cell growth, and finally, the implications of Ras as a
target for chemotherapeutic drug strategies.
I. Primary Structure
Mammalian ras Genes and their Evolutionary Conservation
Three closely related ras gene have been identified in the mammalian genome, H-, N-, and K-ras,
with all three genes residing on separate chromosomes (1). The ras proto-oncogenes encode
highly related proteins with a molecular weight of 21 kD. The coding sequences for each of these
genes are equally distributed among four exons except for K-ras, which possesses two alternative
fourth coding exons (exon 4A and 4B) (16-18). K-ras4B is the predominant form of K-ras in all
tissues examined (19). Mammalian ras genes also contain a 5' noncoding exon, termed exon 0,
which is located immediately downstream of their respective promoters (16, 17, 20, 21). In
addition, the splice junctions for each member are highly conserved, suggesting that they arose
from a common ancestral origin. However, their intronic structures vary substantially, with K-ras
exhibiting the greatest complexity.
The Ras proteins can be divided into four domains. The first domain encompasses the
amino-terminal 86 amino acids of the proteins and is identical among all three genes in both
humans and rodents (1). The next 80 amino acids comprise a second domain which is 85%
conserved between each member. The region of greatest divergence defines a third domain and is
commonly referred to as the hypervariable domain. This region ends with a conserved CAAX
motif (C, cysteine; A, aliphatic; X, any amino acid) at the carboxy terminus and is present in all
members of the Ras - and Rho-related subfamilies (see below).
ras genes are highly conserved throughout evolution and have been identified in a number
of eukaryotic organisms including fruit flies, plants, and yeasts (22-27). Comparatively, these
genes exhibit a high degree of similarity at the protein level in both their structural domains and
sequence (1). The highest degree of conservation lies within the amino terminal domain (not less
than 84%) and CAAX motif. The most important feature of this evolutionary conservation of ras
genes is their ability to function in heterologous systems. For example, mammalian ras genes can
restore viability to rasl ras2 yeast mutants and can induce phenotypic alterations in yeast cells (19,
28-30). Similarly, a yeast RAS gene (carrying a deletion in the long hypervariable domain) as well
as chimeric yeast-mammalian ras genes are able to efficiently transform NIH/3T3 cells (28).
These studies provided the first example of the interchangeability between functional genes of
yeast and mammalian systems.
ras-Related Genes
In the last decade, a number of Ras-related proteins have been identified and are collectively
referred to as the Ras superfamily (13).
Over 50 mammalian Ras-related proteins have been
described so far and are an ever-expanding family. Based on sequence homologies, they can be
grouped into five subfamilies: Ras, Rho, Rab, Ran, and ARF (Table 1.1). These genes are 50% or
less similar to ras genes, with the highest conservation again occurring at the protein level in the
12
Table 1.1. The Ras Superfamily a
Subfamily
Members
Biological Functions
Ras
H-ras, K-ras4A/4B, N-ras,
R-ras, Rap lA/B, Rap2A/B,
RalA/B, TC21
growth, survival,
differentiation
Rho
RhoA/RhoB/RhoC,
Rac 1/2, Cdc42/G25K,
RhoG, TC10
actin cytoskeleton, integrin
activity, stress response,
NADPH oxidase
Rab
Rabl to Rab26
vesicle transport
ARF
ARF1 to ARF6
vesicle transport
stimulation of PLD
Ran
Ranl
nuclear import
Table lists the members of the mammalian Ras superfamily of small GTP
binding proteins.
aAdapted from Hall, A. (1994). Small GTP-binding proteins and the regulation
of the actin cytoskeleton. Annu. Rev. Cell Biol. 10:31-54
13
amino terminal and CAAX domains (1). In addition, some members (e.g., rho and rac) have
been demonstrated to be as well conserved as the ras genes in the phylogenetic scale. The Ran
subfamily has evolved to function in nuclear import, while the Rab and ARF subfamilies control
various aspects of vesicular transport. The Ras- and Rho-related proteins, on the other hand,
regulate signal transduction pathways coupling plasma membrane receptors to various biological
responses (13). While most research has centered around Ras because of its role in growth control
and tumorigenesis, this is rapidly changing. Recent studies have demonstrated a role for Rhorelated proteins in controlling the organization of the actin cytoskeleton, and more importantly, a
link between these processes and ras-associatedtransformation (31-34). A more thorough
analysis of the Ras and Rho-mediated signal transduction pathways is discussed below (see The
Ras Signal Transduction Pathway).
H. Biochemical Properties of Ras
Guanine Nucleotide Binding
Members of the Ras superfamily belong to a class of proteins that bind guanine nucleotides (GTP
and GDP) and exhibit intrinsic GTPase activity. The essential feature of these proteins is their
ability to function as a molecular switch that is turned on and off by the regulated cycle of bound
GTP and GDP, respectively (1, 35). In this sense, the Ras proteins are similar to other two major
families of GTP binding proteins, the elongation and initiation factors involved in protein synthesis
and the heterotrimeric G proteins (35-37). The relevance of this activity to Ras biological function
has been demonstrated by the following lines of evidence: 1) Ras mutants that fail to bind guanine
nucleotides are no longer transforming in NIH/3T3 assays (38, 39); 2) the malignant phenotype of
NIH/3T3 cells transformed by oncogenic ras can be reversed by microinjecting antibodies that
inhibit guanine nucleotide binding or GDP to GTP exchange (40, 41); and 3) oncogenic mutants of
Ras are severely impaired in their ability to hydrolyze GTP (42-46).
14
Through a combination of mutagenesis and X-ray crystallography studies as well as
sequence comparison to other G proteins, the amino acids in Ras critical for guanine nucleotide
binding and hydrolysis have been deciphered (1, 47, 48). Oncogenic mutations at positions 12,
13, 59, 61, and 117 result in impaired GTPase activity (both intrinsic and stimulated), thereby
resulting in the accumulation of Ras in the GTP-bound or active state. In contrast, altered guanine
nucleotide exchange rates result from mutations in residues 16, 17, 116, 117, 119, 144, and 146.
These transforming mutations increase the rate at which Ras exchanges guanine nucleotide with
the surrounding medium due to an increased dissociation constant for GDP. Since the intracellular
concentration of GTP is much higher than GDP, this too, results in an increase in the amount of
Ras bound to GTP (47).
The three-dimensional structures of Ras-GDP and Ras-GTP have provided significant
understanding of the effects of Ras mutations and the mechanisms of action of Ras regulatory
proteins (47). There are five regions of the Ras polypeptide that are associated with loops on one
side of the protein. These regions are designated as G-1 to G-5 and are critical in GDP/GTP
exchange, the GTP-induced conformational changes, and GTP hydrolysis. Comparison of the
GDP- and GTP- bound forms revealed prominent GTP-induced changes in two regions of the
protein: the G-2 loop (amino acids 30-38) which is implicated in effector interaction, and the G-3
loop together with the adjacent a-helix (specifically, residues 60-76) (49-51). These two regions
are commonly referred to as Switch I and Switch II, respectively. Furthermore, it is these two
loops that are most strongly affected by oncogenic mutations (52, 53).
Analysis of the active site has yielded insight into the mechanistic action of oncogenic
mutations on GTP hydrolysis. The side chain carbonyl of Gln 6 1 is postulated to activate a water
molecule which mounts a nucleophilic attack on the y-phosphate of GTP (47). Importantly, the
side chain of Gln 6 1 must be in the proper orientation to facilitate this process. Substitution of this
residue by most all other amino acids is believed to impair activation of the attacking water
molecule and subsequent nucleophilic attack. In contrast, oncogenic Ras mutants derived by
substitution of Gly 1 2 or Gly 13 with any other amino acid besides Pro are believed to block the
15
entrance of the guanine nucleotide pocket through steric hindrance (via their side chains) or loop
distortion, respectively. In either case, the entry of a nucleophilic attacking group is prevented.
The end result of all three mutations is the impairment of GTPase activity, and hence, constitutive
activation of the Ras protein.
Two inhibitory molecules have been widely used to block normal Ras activation in cells in
an effort to determine the role of normal Ras in signaling pathways. Therefore, their mechanism
of action deserves special mention. The first inhibitor contains a single amino acid substitution at
position 17 (N17) in Ras. This protein is thought to bind normally to guanine nucleotide exchange
factors (see Regulators of the Ras GTP/GDP Cycle) and promote GDP dissociation; however, due
to a reduced affinity for GTP, this mutant remains bound to the exchange factor (54-56). Thus,
this sequestration of Ras activators will prevent the activation of normal Ras proteins and
effectively inhibit their signaling. The second inhibitor is an anti-Ras monoclonal antibody, Y13259, that binds to residues 63-73 in the Switch II region (57). This antibody does not inhibit
guanine nucleotide binding or GTP hydrolysis, but rather has been proposed to neutralize Ras
function by preventing a conformational change in Switch II that is necesssary for GDP to GTP
exchange (49). Binding of the antibody to Ras proteins is believed to freeze the conformation of
this region such that the release of bound GDP or the exchange to bound GTP can not proceed,
thereby impairing Ras activation and signaling.
Post-translational Modifications and Membrane Association
A substantial amount of experimentation has demonstrated that Ras proteins are
translocated to the inner face of the plasma membrane (58). This localization is critical for Ras
biological activity and is mediated through a series of closely linked post-translational
modifications at the carboxy terminus (C-terminus) (58-60). The first modification is the addition
of an isoprenoid moiety to the cysteine residue of the CAAX motif. Subsequently, the three
teminal AAX residues are removed by proteolytic cleavage, and carboxyl methylation of the now
C-terminal cysteine residue occurs. Mutant Ras proteins that lack either the cysteine or AAX
16
residues of the CAAX motif fail to undergo these processing steps and, as a result, are not
associated with the plasma membrane and are biologically inactive. These modifications impart a
hydrophobic nature to Ras; however, the exact contribution and functional role of each event has
been difficult to assess. Utizilizing mutants that were blocked in one or more steps, researchers
concluded that isoprenylation was sufficient to promote plasma membrane association and
biological activity of both normal and oncogenic Ras proteins, although at significantly reduced
levels (-50%) (61-63). Thus, all three processing events are necessary for optimal membrane
association and activity.
Although these CAAX-signaled modifications are critical for plasma membrane
association, studies of Ras mutants and other similarly modified proteins suggested that additional
modifications were necessary to confer both optimal avidity and specificity for the plasma
membrane. First, a number of other proteins containing a CAAX motif are also isoprenylated, yet
either localize to the nuclear membrane or remain cytosolic (58). Second, mutational analysis
demonstrated that sequences directly upstream of the CAAX motif provide an additional
membrane targeting signal that complements the CAAX modifications to promote avid and
specific plasma membrane binding (64-66). In the cases of H-, N-, and K-ras4A, these proteins
are subsequently palmitoylated at an upstream cysteine residue(s) (Figure 1.1).
K-ras4B,
however, has substituted this palmitylation site with a polylysine domain that serves an analogous
function (65). This positively charged polylysine domain is believed to promote interaction with
negatively charged phospholipid head groups, as it can be substituted with similarly charged
arganine residues but not with neutral glutamines. Mutant Ras proteins that lack either these
upstream cysteine residues or the polylysine domain are rendered cytosolic, despite retaining the
modifications at the CAAX motif. Moreover, only the addition of the carboxy terminal residues
from either H-ras or K-ras4B which included either the palmitoylated cysteines or lysine-rich
domain, respectively, was capable of promoting efficient plasma membrane association to Protein
A (64, 66). In summary, all of the above modifications are both necessary and sufficient to
promote full and specific association to the plasma membrane. In addition, K-ras4B can be
17
1
Q)
1
C~JD
_IL
I
.......c...~....~
0
c
t-(
0
I
0
0
..... ... . ..·
. . ..
0~
II
0
z
Z
0
C
C
4"
C
E
0
0
w
Lu
II
El
x
II
U~
C
oE
0
Q)
(TJ
L.
Q.
I
C
m
Em
a.
0
0
E
o
0
III
II
o
II
II
"O
E
p
r
II
IL
c\i
0
0u
06
2
0,
co
r
cu
coJ
U-
(D
0
E
0ca
Cu
v,
phosphorylated by protein kinase A or protein kinase C at a serine residue located between the
polylysine domain and the CAAX motif (67). The significance of this is not clear, but may be
involved in mediating the interaction with a specific regulatory exchange factor (see Guanine
Nucleotide Dissociation Stimulators).
Interestingly, oncogenic Ras proteins that lack palmitoylated cysteines or the polylysine
domain but retain the CAAX-signaled modifications still retain strong transforming activity in
NIH/3T3 cells despite the absence of observable plasma membrane association (64, 65).
Therefore, this suggests that plasma membrane association may not be critical in mediating the
transforming function of Ras, and that the required CAAX modifications facilitate transformation
through a role unrelated to promoting plasma membrane association.
Protein prenylation is currently known to be signaled by at least three distinct carboxyterminal motifs, CAAX, CC, or CXC (60, 68). Proteins terminating in a CAAX sequence are
modified by the addition of either a farnesyl or geranylgeranyl group, through the enzymatic
activities of farnesyltransferase (FTase) and geranylgeranyltransferases I (GGTase I), respectively.
In contrast, CC and CXC motifs are specifically geranylgeranylated by yet a third enzyme,
geranylgeranyltransferase II (GGTase II). The variable amino acid (X) of the CAAX motif was
originally thought to be the sole determinant of the relative specificity for FTase and GGTase I. A
number of studies examining the substrate specificity of prenyltransferases used either short
peptides corresponding to various CAAX sequences or Ras proteins mutagenized at this motif
(69-72). These studies concluded that FTase strongly preferred a methionine or serine residue at
the X position, whereas geranylgeranylated proteins typically ended in leucine. Since all four Ras
proteins end in either serine or methionine, it was inferred that they only underwent farnesylation
in vivo. However, it has recently been demonstrated that K-ras4B is geranylgeranylated as well as
farnesylated both in vitro and in vivo (73, 74). This dual substrate property of K-ras4B has been
attributed to the combined effects of the CAAX (CVIM) motif and the polylysine domain (74).
Since all of the initial studies focused exclusively on the CAAX sequence and did not examine
authentic K-ras4B, this geranylgeranylation of K-ras4B had previously been unnoticed. At least
19
two other Ras-related proteins, R-ras2/TC21 and RhoB, have been shown to be modified in vitro
by both farnesyl and geranylgeranyl isoprenoids, and RhoB has been shown to incorporate both
moieties in vivo as well (75, 76). The significance of this alternative processing for K-ras4B is
discussed below (see sections Guanine Nucleotide Exchange Factors and The FTase Inhibitor
Paradox: Efficacy without Cytotoxicity).
The Effector Domain
Deletion mutants of mammalian ras genes have defined five independent domains that are
absolutely required for Ras function: residues 5-63, 77-92, 109-119, 139-165, and the C-terminal
CAAX motif (39). While it was clear that some of these residues possessed roles in guanine
nucleotide binding or membrane localization, extensive mutational analysis also revealed the
presence of residues critical in mediating the effector activity of Ras proteins. Thus, certain
mutations destroyed the ability of oncogenic Ras to signal, and yet did not compromise their ability
to bind to either GTP or the plasma membrane (57). Most of these mutations map to the Switch I
domain (residues 30-38), thus supporting a regulated effector interaction based on the
conformational change associated with this region upon GTP binding (47, 49). In addition, the
accessibility of this domain on the external surface of the molecule supported its involvement in
the interaction with putative cellular targets.
The recent identification and characterization of Ras effector molecules has confirmed and
extended this analysis. Both biochemical and genetic studies employing allele-specific suppressors
have defined interacting residues in Ras as well as in the Ras-binding domain (RBD) of effector
molecules (77). Interestingly, residues 32-38 are conserved among all members of the Rassubfamily, indicating that determinants controlling specificity must lie outside of these core
conserved residues.
Due to its flexibility, the SwitchlI region (residues 60-76) can exist in multiple
conformations (50). Because of this, it has been suggested that this region may be involved in
mediating specificity through these different conformations. This idea was recently supported
20
through the demonstration that mutations within SwitchlI can compromise Ras function and
selectively disrupt the interactions with a subset of known effectors (Table 1.3), including
phosphatidylinositol 3-kinase (PI3K), neurofibromin (NF1), and the cysteine-rich domain of Raf1 (78-80).
III. Functions of ras Genes
Non-Mammalian Systems
Due largely to the power of genetics, the Ras pathways in Saccaromyces cerevisiae,
Caenorhabditiselegans, and Drosophila melanogasterhave yielded significant insight into the
mechanism of Ras regulation and signaling (81-84). The Ras genes identified in these organisms
show high sequence conservation with one another as well as with mammalian ras genes (1).
This structural conservation underscores their ability to function in heterologous systems. In
addition, many of the regulatory proteins and downstream signaling molecules that comprise the
signaling pathway are highly conserved and will be discussed in more detail below (see The Ras
Signal Transduction Pathway).
In D. melanogaster and C. elegans, Ras proteins serve essential roles and mediate
signaling cascades downstream of a number of receptor tyrosine kinases (RTKs) (82-84). In D.
melanogaster, the Ras genes are ubiquitously expressed as they are in mammalian systems, but
are predominantly expressed in neural cells. These RTK-Ras mediated signal transduction
pathways are important in patterning, segmentation, and photoreceptor development. The best
characterized pathway has demonstrated a critical role for Ras downstream of the Sevenless RTK
in determining the cell fate of the R7 photoreceptor cell in the Drosophilaeye (83, 84). In C.
elegans, the let-60 gene encodes a Ras homologue that participates in several developmental
pathways. Loss-of-function of let-60 results in larval lethality, aberrant vulval development in
hermaphrodites, abnormal male spicule development, sterility, and mis-specification of a cell type
in the posterior ectoderm (82, 85). Extensive genetic analysis of let-60 function in vulval
21
development has lead to the identification of critical mediators in this pathway and has revealed its
conservation with the RTK-Ras signaling pathway critical for specification of the R7 photoreceptor
cell in Drosophila (Table 1.2).
In S. cerevisiae,two RAS genes have been identified, RAS1 and RAS2 (25, 27). Mutation
in either gene individually is compatible with growth, however, raslras2double mutations are
lethal (86). These genes are essential for stimulating production of cAMP via adenylate cyclase in
a nutrient-response pathway. This signaling pathway is distinct from the RTK pathways used in
other organisms (Table 1.2). However, many of the kinases downstream of Ras in worms and
flies are still present in S. cerevisiae, but appear to serve a critical function that is RAS-independent
in the pheromone-response pathway (81). In addition to these systems, ras genes also serve
critical roles in Xenopus laevis, Schizosaccharomyces pombe, and Dictyostelium discoideum (1,
48).
Mammalian Systems
The prevalence of oncogenic ras mutations in human cancers signifies the important role that Ras
proteins play in regulating normal cell growth (87, 88). The phenotypic effects of Ras range from
the transformation of fibroblasts to the differentiation of neural cells (1). The mitogenic response
of NIH/3T3 cells to serum growth factors can be blocked by microinjection of the Ras monoclonal
antibody Y13-259 or by the expression of dominant inhibitory ras mutants, thus demonstrating a
critical requirement for Ras activity in normal cell growth and proliferation (89, 90). The
constitutive output of this growth-promoting signal by oncogenic ras mutants can induce
morphological transformation of fibroblasts, which is accompanied by membrane ruffling,
pinocytosis and the activation of immediate early (e.g., c-fos and c-jun) and other cellular genes
(48, 91). In other cell types, however, microinjection of oncogenic Ras can mimic the effects of
nerve growth factor (NGF) and induce neuronal differentiation, as has been demonstrated in the
PC12 pheochromocytoma cell line (1). Furthermore, the differentiation of neuronal cells in
22
Cu
cu
C)
0
Cu
I-.
Cu
0
0
Cu
cri
0=
qý
*o1ý
rz
q6)
o0
t_
3e
C)
Ic)
C)~o
OC)
-aa
bL~
S
0
ed
"-
"om"
C)
"X~a
C)o
as
Cu
'S~U
~
C))
~
c)
o
CO2c-
-e
4
IC2C)
i n"C
SSE
OC
c
Cu2.2
-ee
t~~
0I
U
U
c'-
a,
04
-~
F?'O
oe
~1
W
a+4'
0'"
OClb
obI~`
o0u
0a
C)
~a
Cd03
c
x
~00
C)
I·
-
ci
cc
c
Cu
"
o~
vl
2,
S1~~f~
C4c
-C
4C) C)
Vc
C a
.9
CISu
e*_
V)
,
v,
r
c
2<
co'-4
-
"
IC
d0
C·
2
C
.Ae
-~
'-4
)
C
25
<-e
0
'
ab
C,3
,
er
• 5
C) 0
.c,
4o' C
C)C)aj
response to NGF can be blocked by dominant inhibitory ras mutants or anti-Ras antibodies (92,
93).
A wide variety of extracellular stimuli have been shown to lead to a rapid and transient
increase in the amount of active GTP-bound Ras proteins (94, 95). These stimuli include factors
such as those which promote the growth of fibroblasts (e.g., PDGF, EGF), the proliferation and
differentiation of hematopoietic cells (e.g., IL-3, GM-CSF), and the differentiation of neuronal
cells (e.g., NGF). A key feature that many of these growth/survival factors have in common are
receptors that either act as tyrosine kinases themselves (e.g., PDGF and EGF receptors) and/or
associate non-receptor tyrosine kinases (e.g., IL-2 Receptor). In addition, transformation of
fibroblasts with a variety of tyrosine kinase oncogenes (e.g., src, fms, and fes) results in
chronically elevated levels of Ras-GTP. The transforming function of these oncogenes is
dependent upon Ras activity, as co-expression of dominant inhibitory ras mutants or
microinjection of anti-Ras monoclonal antibodies blocks their transforming potential (96). Thus,
as in flies and worms, Ras proteins are essential components of tyrosine kinase-mediated signaling
pathways that regulate cellular growth, survival, and differentiation.
A Causative Role for Oncogenic ras in Tumorigenesis
While the precise contribution of oncogenic Ras function to the initiation and progression of
tumorigenesis is not known, there is considerable epidemiological and experimental evidence that
has suggested an important role for oncogenic Ras in the development of human tumors (87, 88).
Oncogenic ras mutations have been identified in approximately 30% of all human tumors, with Kras mutations occurring most frequently. A number of tumor types have been associated with ras
mutations, although the incidence of mutation varies strongly among different tumor types. The
highest incidence occurs in pancreatic adenocarcinomas, where greater than 80% of tumors carry a
mutation in K-ras (97-99). Carcinomas associated with the colon and thyroid also exhibit frequent
alterations, with approximately 50% of these tumors harboring a mutant ras gene (100-102). In
contrast, a number of tumor types (e.g., neuroblastoma) have not been or are very rarely associated
24
with a mutated ras gene (88). Some correlation can be drawn between a given tumor type and the
ras gene that is mutated. For example, adenocarcinomas of the pancreas, colon, and lung
predominantly carry mutations in the K-ras gene, whereas myeloid disorders tend to selectively
carry N-ras mutations (88). However, some tumor types (e.g., thyroid tumors) seem to lack
specificity for a particular ras gene mutation. This observed specificity in ras mutation may be
associated with differences in Ras function, or alternatively, may simply reflect differences in the
level of expression. The ras genes have been shown to be ubiquitously expressed; however,
certain tissues preferentially overexpress one or two members of the family (88, 103-105). In the
colon and lung, for example, K-ras is abundantly expressed and is the most frequently mutated
member in carcinomas of these tissues. H-ras, on the other hand, is overexpressed in the skin and
is the only ras gene mutated in rodent skin carcinogenesis models (106). It is important to note
that all of the expression levels were measured in the whole tissue and, therefore, do not
necessarily reflect the level of ras expression in the target cell. However, the correlation drawn
between observed expression levels and the specificity of ras mutation may be very important as
the level of oncogenic Ras can influence its transforming potency and is often times augmented
during tumor progression (see below and Chapter 3).
Rodent carcinogenesis models have also underscored the importance of ras gene mutations
in tumorigenesis (106, 107). The frequent and reproducible activation of ras oncogenes in these
animal tumors supports the concept that ras mutation plays a causative role in neoplastic
development. In mice, for example, H-ras mutations are associated with 90% of skin papillomas
and carcinomas that have been initiated by treatment with demethylbenz(a)anthracene (DMBA)
and followed by promotion with the phorbol ester, TPA (8, 108). K-ras mutations, on the other
hand, are frequently associated (up to 100% in some studies) with lung tumors in mice that have
been induced with a variety of chemical mutagens (1, 106). This reproducible activation of the ras
genes has made it possible to correlate their activating mutation with the known mutagenic effects
of particular carcinogens. For example, the induction of rat mammary carcinomas by nitrosomethylurea (NMU), but not DMBA, treatment resulted in activation of the H-ras oncogene via a
25
G to A transition (109, 110). This transition results from the miscoding properties of 0 6methylguanosine, which is one of the adducts generated by the methylating activity of NMU. In
contrast, DMBA is known to form large adducts with both adenine and guanosine residues, but
the repair of these adducts very rarely leads to the generation of G to A transitions (111). This
concept that ras oncogenes can be the direct target of chemical mutagens is supported further by
observations drawn from skin carcinogenesis studies in mice. The induction of skin carcinomas
by treatment with DMBA and phorbol esters involved the specific activation of H-ras oncogenes
by A-to-T transitions at the second base of codon 61 (108). However, when the initiating mutagen
was replaced by an alkylating agent, this mutation was not observed. Taken together, these
findings indicate that the ras oncogenes can be a direct target of the mutagenic properties of
inititating carcinogens and support a causative role of ras activation in tumorigenesis.
The importance of oncogenic Ras in cancer has been supported further by the generation of
mice carrying mutated ras sequences either through retroviral infection or the creation of
transgenic mouse strains (112). These mouse strains display increased incidences of tumor
formation, which are generally associated with their tissue-specific expression. For example, mice
carrying a mutated H-ras gene whose expression is driven by the LTR of the mouse mammary
tumor virus (MMTV) are predisposed to the development of tumors in mammary, salivary, and
lymphoid tissues (113). Importantly, however, these tumors arise only after a relatively long
latency period and are focal in nature. Since the MMTV promoter directs expression of the H-ras
oncogene to every cell in the mammary gland, this suggests that secondary cooperating genetic
events are necessary for tumor development.
Oncogenic ras and Multistep Carcinogenesis
The idea that ras mutations cooperate with other genetic events in the initiation and progression of
tumorigenesis was first conceptualized by analyzing the in vitro transforming properties of ras
oncogenes in tissue culture. Cellular ras oncogenes can not transform primary rodent fibroblasts
alone (114-116). Instead, transformation of these cells requires the presence of cooperating genes,
26
such as myc, adenovirus E1A, SV40 TAg, or p53 (114, 116-121). Interestingly, ras oncogenes
were sufficient to transform primary rodent fibroblasts if the inhibitory effect of neighboring
normal cells was eliminated. This was achieved by cotransfection with the neomycin selectable
marker followed by selection with geneticin (122-124). The molecular basis of this inhibitory
effect remains to be elucidated, but does help to explain the observation that retroviruses carrying
oncogenic ras genes can transform primary rat fibroblasts but only at a high multiplicity of
infection (1).
These initial observations suggested that activation of ras oncogenes was insufficient to
trigger transformation and has since been supported in a number of animal and human tumor
models. The cooperation observed in tissue culture between the ras and myc oncogenes was very
elegantly demonstrated in vivo through the use of transgenic mice. Transgenic mice carrying either
the v-H-ras or c-myc gene driven by the MMTV promoter/enhancer were analyzed individually
and in combination (113). As discussed above, MMTV/v-H-ras transgenic mice develop focal
lesions in the mammary, salivary, and lymphoid tissues after a long latency period. When these
mice were crossed into the MMTV/c-myc strain, a dramatic and synergistic acceleration in tumor
formation was observed. However, these tumors still arose stochastically and suggesed that
additional somatic events were necessary for full malignant progression.
The mouse skin carcinogenesis model has provided an excellent system for dissecting the
role of Ras in the initiation and progression of skin carcinomas. Because these tumors evolve
through a series of well-defined pathological stages, it has been possible to establish an order in
which specific genetic alterations occur during the development of these tumors (125, 126). As
discussed earlier, H-ras mutations are associated with greater than 90% of mouse skin papillomas
and carcinomas (8, 108). DMBA treatment of the skin of mice is believed to result in mutational
activation of the H-ras gene. These "initiated" cells are known to remain dormant until they are
induced to proliferate by treatment with tumor promoters such as phorbol esters. Direct support of
this model came from the observation that mouse epidermal skin cells infected with Harvey-MSV
did not exhibit neoplastic properties unless they were treated with the phorbol ester, TPA (127). In
27
mice, the benign papillomas that result following promotion with TPA are known to regress to
small hyperkeriotic lesions, with only a small percentage progressing to a malignant carcinoma.
This suggests that ras activation is insufficient for the development of the full malignant phenotype
and that additional genetic events are required to cooperate with oncogenic H-ras for tumor
progression. Indeed, skin grafts of cultured keratinocytes infected with Harvey-MSV resulted in
the formation of papillomas but not carcinomas (128). Transgenic mice expressing oncogenic Hras from a suprabasal keratin promoter have demonstrated further a direct involvement of
oncogenic Ras in the development of skin papillomas (129). The genetic characterization of
papillomas and carcinomas has revealed a number of alterations associated with progression to a
malignant state. Interestingly, an increase in the copy number of the mutated H-ras allele or loss
of the wild-type H-ras allele is frequently associated with skin tumor progression (130). In
addition, it has recently been demonstrated that the c-fos proto-oncogene is required for
progression of papillomas to a malignant carcinoma (131).
This multistep pathway of tumorigenesis has also been demonstrated in human colorectal
cancer (132). In contrast to mouse skin carcinogenesis, colon cancer appears to be initiated by
mutations in the APC tumor suppressor gene, which are associated with more than 60% of
adenomas and carcinomas (133). Mutation of a ras oncogene (K-ras) also occurs early in the
development of colorectal neoplasia and is mutated in 50% of adenomas and carcinomas (100102). Extensive analysis of numerous benign lesions exhibiting varying degrees of dysplasia has
led to a model in which mutation of the APC gene leads to the formation of benign adenomas
(134). Mutation of a ras gene frequently occurs in one these benign tumor cells, leading to a
further clonal expansion. The order in which APC and ras mutations occurs appears to be a
critical determinant for the ability of these "initiated" tumor cells to progress (135).
Those
correctly "initiated" cells will subsequently acquire additional cooperating mutations (e.g.,
mutations in DCC and p53) which will lead to the clonal expansion of cells with an even greater
transforming potency and ultimately result in the progression from a benign to malignant state.
28
Importantly, the level of oncogenic Ras expression appears to modulate its transforming
ability. It has repeatedly been observed that the ratio between mutant and normal ras alleles is
frequently increased during tumor progression (1, 87). This can occur through either amplification
of the mutated allele or loss of the wild-type allele (101, 130, 136). Augmentation of oncogenic
ras expression has also been demonstrated to result from mutations in intronic regulatory
sequences that result in increased expression (137, 138). In addition, the expression of wild-type
ras genes at artificially high levels can lead to transformation (139-143). Because many tumors
contain a normal ras allele in addition to a mutated allele, oncogenic ras was believed to exert its
effect in a dominant fashion. However, the above observations have questioned this. To address
this issue directly, Finney and Bishop generated Ratl fibroblasts carrying an oncogenic allele of
H-ras through gene targeting (144). Their results demonstrated that cells heterozygous for an
activated H-ras allele were neither transformed nor tumorigenic.
predisposed to transformation at a low frequency.
Rather, these cells were
Interestingly, greater than 90% of the
transformed cell lines had amplified the mutant allele. Thus, these results confirm all of the above
observations that oncogenic ras is insufficient for transformation, and that at least one additional
event must occur, of which increasing the expression of a mutant ras allele may be one.
IV. Regulators of the Ras GTP/GDP Cycle
Although Ras proteins exhibit intrinsic GTPase and GDP/GTP exchange activities, these rates are
too low to account for the rapid and transient GDP/GTP cycling that occurs following mitogenic
stimulation (35). Rather, the interconversion of inactive GDP-bound and active GTP-bound Ras
proteins is modulated by the concerted action of guanine nucleotide exchange factors (GEFs) and
GTPase activating proteins (GAPs) (48, 145-147). GEFs bind to the GDP-bound form of the
GTPase and catalyze the dissociation of GDP and subsequent replacement with GTP, thereby
activating the G protein and its signaling cascade. In contrast, GAPs serve to downregulate the
GTPase signal by stimulating the intrinsic rate of hydrolysis of bound GTP to GDP.
29
GuanineNucleotide Exchange Factors
Regulatory factors that enhance and control the exchange of GDP to GTP on Ras would be
expected to function/act directly upstream of Ras in a signaling pathway. The first identification of
such factors came from genetic dissection of the Ras mediated adenylate cyclase pathway in
S. cerevisiae. CDC25 was isolated as an upstream activator of this pathway (148). A genetic
screen for suppressors of cdc25 mutations yielded a homologue known as SDC25 (149). Both
genes were later shown to promote GDP/GTP exchange on the yeast Ras proteins (150, 151).
Unlike SDC25, CDC25 is an essential gene in yeast (152). Since then, homologues of CDC25
have been identified in S. Pombe (Ste6) and D. melanogaster(Sos, for the Son-of-sevenless gene
product) (153, 154).
The first mammalian homologues of CDC25 were isolated from either rat, mouse or
human brain libraries using degenerate oligonucleotides and by functional complementation assays
of yeast cdc25 mutants with a mouse expression library (155-157). Ras-GRF (also known as
mCdc25) was isolated and shown to be specifically expressed in brain tissue (158). Moreover,
this GEF specifically catalyzed the GDP/GTP exchange on Ras, but not on other Ras-related
proteins. Similarly, two mammalian counterparts of the D. melanogasterSos gene were isolated
from human (hSOS1) and mouse (mSos-1 and mSos-2) libraries and shown to possess Ras
exchange activity (159, 160). In contrast to Ras-GRF, these exchange factors are widely expressed
during development and in adult tissues. Thus, at least three distinct CDC25-related Ras GRFs are
present in mammalian cells.
Over the past few years, a number of other GRFs have been isolated in various systems
and characterized with regard to their substrates (145, 161). In mammals, a subset of these
exchange factors, including Ras-GRF, Sos, Vav, Dbl, and Tiam- 1, all share a region of homology
known as the Dbl domain. Many proteins for which no GEF activity has been demonstrated also
contain a Dbl-homologous domain, such as the GTPase stimulating proteins Bcr and Abr.
Therefore, the presence of a Dbl-domain does not appear to equate with GEF activity.
Interestingly, several of these Dbl-like proteins (e.g., Vav, Dbl, Tiam-1, and Ect2) were originally
30
isolated by virtue of their oncogenic activity (162-164). Both Dbl and Tiam-1 have been shown to
function as GEFs for Rho-related GTPases (165, 166). In contrast, Ras-GRF, Vav, and Sos have
all been implicated as GEFs specifically for Ras and not Rho-related proteins (145, 167-169).
Thus, sequence relationship between given exchange factors does not allow one to predict their
substrate specificity.
Perhaps, the most interesting GEF with respect to this thesis, is Smg GDS. This exchange
factor does not share homology with other known GEFs and is the only exchange factor that has
been shown to distinguish among the Ras proteins (170, 171). Smg GDS is active on K-ras4B
and several Ras-related proteins (e.g., Rapla and Ib, RhoA and B, Racl and 2, and Cdc42) yet is
inactive on H- and N-ras (171). Interestingly, all of the known substrates for Smg GDS contain a
polylysine domain immediately upstream of the CAAX motif, and this result suggests that the
determinants for interaction are contained within these sequences.
Indeed, it has been
demonstrated that all post-translational processing steps as well as the presence of the polylysine
domain in the C-terminus of Rapl are important in mediating the interaction with Smg GDS (171,
172). In addition, many of these substrates contain a serine residue positioned between the
polylysine domain and the CAAX motif. Phosphorylation of this residue makes Rap sensitive to
the action of Smg GDS and is, therefore, believed to initiate Rap activation (173). It is tempting
to speculate that this mode of regulation also operates in K-ras4B, since it too, can be
phosphorylated at this residue (67).
Detailed kinetic analysis using K-ras4B as a substrate has demonstrated additional unique
properties of Smg GDS. First, Smg GDS specifically interacts with and stimulates the GDP/GTP
exchange reaction of only the lipid-modified form of K-ras (169). In contrast, mCdc25 (and its
homologues) is active on both the lipid-modified and unmodified forms of all Ras proteins.
Second, both Smg GDS and mCdc25 stimulate the dissociation of GDP from K-ras and form a
stable binary complex with K-ras. However, only Smg GDS forms a stable ternary complex with
K-ras-GTP (174).
Third, mCdc25 stimulates the GDP/GTP exchange reaction on both
membrane-bound and soluble forms of K-ras, whereas Smg GDS is far less active on the
31
membrane bound form (174). And finally, Smg GDS translocates membrane K-ras-GTP to the
cytoplasm as a stable ternary complex of Smg GDS-K-ras-GTP (174). The significance of this
translocation is that it may allow K-ras4B to interact with a subset of effector molecules distinct
from those of H- and N-ras.
The functional significance of multiple Ras GEFs is not fully understood. Because Ras
proteins mediate a signaling pathway downstream of a wide range of cell surface receptors (as
discussed above), this degree of complexity in Ras activators may provide the necessary
coordination of signals emanating from different activated receptors. Moreover, many of the
GEFs appear to be restricted in their expression profiles (e.g., mCDC25 in the brain, Vav in
hematopoietic cells), suggesting that additional Ras GEFs may exist in other tissues.
GTPase Activating Proteins
To date, four distinct mammalian GAPs specific for Ras proteins have been identified, these being
pl20-GAP, neurofibromin (NF1), and two members of the GAPI family (175-181). The first
GAP to be cloned and characterized was p120-GAP (175, 176, 182). This protein is ubiquitously
expressed, predominantly cytosolic, and stimulates Ras GTPase activity by more than 10,000 fold.
In addition, pl20-GAP is alternatively spliced at the N-terminus, resulting in the removal of
hydrophobic sequences (175, 183). The functional significance of this isoform (p100-GAP) is
unknown and it appears to exist only in the placenta. Based on sequence homologies, p120-GAP
can be divided into two functional domains. The catalytic domain is located at the C-terminus and
contains the Ras-binding domain. This domain interacts with the effector domain of Ras (AA 3240) to stimulate GTP hydrolysis (184, 185). The N-terminal domain contains many key structural
features, including one SH3 and two SH2 domains, a pleckstrin homology domain (PH), and a
calcium-dependent phospholipid-binding (CaLB) domain (145). The SH2, SH3 and PH domains
are common features of many signaling proteins and are believed to mediate molecular recognition
(186, 187). The target sequences of src-homology domains have been defined through rigorous
biochemical characterization.
SH2 domains recognize specific sequences containing
32
phosphorylated tyrosines residues, whereas SH3 domains interact with specific proline-rich
sequences. The binding sites of PH domains, on the other hand, are currently unknown (188,
189). Interestingly, though, other proteins in the Ras regulatory pathway contain PH domains,
including the guanine nucleotide exchange factors Ras-GRF, mSOS, and Vav.
The importance of Ras GAP activity in the regulation of cell growth has been underscored
by the discovery that the human neurofibromatosis type I (NFl) gene encodes a protein with
associated Ras GAP activity. Neurofibromatosis type I is a hereditary disease associated with
germline mutations in one allele of the NF1 gene and is one of the most common genetic diseases
that predisposes humans to cancer (1 in 3500 affected individuals worldwide) (190). Patients with
NF1 develop benign neurofibromas at a high frequency, have a greatly increased risk of malignant
tumors primarily of neural crest origin (e.g., neurofibrosarcomas and malignant Schwannomas),
and usually exhibit other abnormalities as well. The NF1 gene, like pl20-GAP, undergoes
alternative splicing (191).
The product of the NF1 gene, neurofibromin, shares sequence
homology with the catalytic domain of p120-GAP, but exhibits an even more extensive homology
overall with the IRA1 and IRA2 GAPs from S. cerevisiae(177, 192). Like pl20-GAP, NF1-GAP
also stimulates the intrinsic GTPase activity of Ras (178, 179, 193). Interestingly, NFl-GAP
binds to wild-type Ras proteins with a 30-fold higher affinity than does p120-GAP, yet the specific
activity of pl20-GAP is about 30-fold higher than that of NF1-GAP (178). Thus, the NF1-GAP
protein might be expected to inactivate Ras more effectively than pl20-GAP at lower
concentrations. The significance of this in the whole cell is not yet clear.
The negatively regulatory role for GAPs has been supported through numerous criteria.
The strongest evidence is the fact that they convert Ras into an inactive state by stimulating the
GTPase activity. In addition, oncogenic Ras mutations (primarily at residues 12, 13, and 61)
reduce or abolish GAP-stimulated GTPase activity and result in the accumulation of Ras in an
active GTP-bound form (53, 176, 194). This constitutive activation of Ras can ultimately lead to
unregulated cellular proliferation. Further evidence supporting a role in the downregulation of Ras
activity comes from the observation that overexpression of p 20-GAP can block transformation
33
by wild-type Ras (195-197). Finally, genetic analysis in numerous systems seems to indicate that
Ras GAPs negatively regulate Ras function by increasing the level of Ras-GDP. Various cell lines
obtained from human NF1 patients or mice deficient in either Nfl or pl20-GAP have been
examined for their sensitivity to growth factor-induced changes in Ras-GTP levels. NF1 mutant
Schwann cells, for example, respond normally to growth factor stimulation, yet they exhibit an
increased basal level of Ras.GTP (198). In contrast, pl20-GAP-deficient fibroblasts were more
sensitive to growth factor induced changes in Ras-GTP levels than were NFl-deficient or wild-type
fibroblasts (199). This type of analysis has suggested a model in which NFl-GAP may play a
more important role in regulating the basal level of Ras-GTP, whereas pl20-GAP functions to
downregulate Ras following the activation of receptor tryosine kinases. However, this may
depend on the cell type and/or specific growth factor, as the loss of NFI was recently shown to
sensitize cells to GM-CSF (200, 201).
In addition to their negative regulatory roles in Ras signaling, it is also believed that both
pl20-GAP and NF1 may possess a second role as downstream effectors of Ras activity (202,
203). This idea was first suggested by the observation that GAPs interacted with the effector
domain of Ras in a GTP-dependent manner. Furthermore, mutations in the Ras effector domain
that prevented transforming activity simultaneously prevented the association with GAP (176, 184,
185). In addition, oncogenic Ras mutants retain GAP binding activity even though they are
unresponsive to stimulation by GAPs. In fact, some oncogenic Ras mutants bind to GAP with a
higher affinity than do wild-type Ras proteins (53, 176, 194). Thus, GAP fulfills all of the
expected criteria of an effector, in that it binds well to activated Ras and poorly to proteins
exhibiting impaired signaling function.
Further support has come from the finding that pl20-GAP interacts with a suppressor of
Ras-induced transformation, Krev-1/Rapla. Krev-1 was isolated in a screen for proteins that
could revert the transformed phenotype of K-ras transformed cells (204). This protein belongs to
the Ras- subfamily and predominantly localizes to the Golgi apparatus (205). Interestingly, Krev1 binds to pl20-GAP with a higher affinity than does wild-type Ras, yet is insensitive to GTPase
34
stimulation by pl20-GAP (206, 207). Thus, it had been proposed that Krev-1 suppresses Ras
transformation by binding to and sequestering p 120-GAP. If the role of p120-GAP were to solely
downregulate Ras activity, then its inhibition would result in the accumulation of Ras-GTP, and
therefore, Ras proteins should be activated by Krev-1 overexpression.
Since the opposite
phenotype was observed, it was speculated that Krev-1 suppressed transformation through the
sequestration of an effector(s) of Ras activity. At the time this was proposed, pl20-GAP was the
only protein known to interact with the Ras effector domain and exhibit all of the criteria expected
of an effector molecule. Since then, numerous effectors have been identified and characterized,
and it is now postulated that members of the Raf protein kinase family are more likely to be the
critical targets of Krev-1 overexpression (208); however, this does not exclude the possibility that
GAP may still play an important role in the suppressive phenotype.
While all of the above observations provide indirect evidence for an effector function of
pl20-GAP, direct evidence has been obtained in guinea pig atrial membranes. In this system, Ras
and pl20-GAP collaborated to inhibit the G protein (Gk) mediated coupling of a muscarinic
receptor to a potassium channel (209). Oncogenic mutants of Ras were more effective inhibitors
and were dependent upon GAP for this function, as antibodies to GAP blocked the Ras effect.
Importantly, the N-terminal domain of pl20-GAP (i.e. a noncatalytic fragment) relieved the
requirement for Ras in this system (210).
Based on the above observations, the effector function of p120-GAP has been attributed to
its N-terminal domain. The SH2 and SH3 domains residing within this region mediate complex
formation with a number of receptor and non-receptor tyrosine kinases (e.g., PDGFR, EGFR,
CSF-1R, and v-src) (147). Many of these interactions result in the phosphorylation of pl20-GAP,
although at generally low stoichiometry and with no apparent alteration of its activity. Moreover,
the majority of pl20-GAP does not enter into these complexes. However, it has been speculated
that the amount that does interact with membrane-bound kinases will result in its translocation
from the cytosol to the plasma membrane, thereby increasing the effective concentration and ease
of interaction of p120-GAP with membrane-bound Ras.
35
Two other cellular phosphoproteins, p62 and p190, have been found associated with the
same N-terminal domain of p120-GAP. Both of these proteins were first identified as tyrosinephosphorylated, pl20-GAP associated proteins in v-src transformed or EGF treated fibroblasts
(211). Only a small portion of pl20-GAP associates with p62 and vice versa, whereas up to half
of cytoplasmic pl20-GAP is found in a complex with p1 9 0 (212). In contrast, very little of this
complex is found in normally proliferating fibroblasts. The association of p120-GAP with p190
attenuates its catalytic activity on Ras-GTP, suggesting that this complex might promote Ras
activation (212). The p190 protein has several key features including an N-terminal GTP-binding
domain, a C-terminal Rho-GAP domain, and a central domain related to a proposed transcriptional
repressor of the glucocorticoid receptor gene (213). The p190 protein has been demonstrated to
exhibit GAP activity on Rho-related proteins, including Rho, Rac, and Cdc42Hs, while in a
complex with the N-terminal domain of pl20-GAP (214, 215). This strongly suggests that the
interaction of pl20-GAP and p190 may serve to functionally link the Ras and Rho signaling
pathways.
Indeed, expression of the N-terminus of pl20-GAP in fibroblasts results in a
constitutive association with p190 and correlated with changes in the actin cytoskeleton and cell
adhesion that were similar to those observed following downregulation of Rho in Swiss 3T3 cells
(215). The importance of this link between the Ras and Rho pathways is discussed below (see
The Rho-subfamily of Small GTP-binding Proteins: Their Signaling Pathways and Requirement
for Ras-mediated Transformation). Further insight into the function of p62 awaits its cloning as
the cDNA originally isolated for p62 has since been shown to encode a different protein, called
Sam68 (216, 217).
Recently, a number of investigators have demonstrated critical roles for the N-terminal
domain of p120-GAP in Ras-dependent signaling. For example, Duchesne et al. have shown that
the SH3 domain of pl20-GAP is essential for Ras-mediated germinal vesicle breakdown in
Xenopus oocytes (218). It has also been demonstrated that the N-terminal SH2/SH3 domain of
pl20-GAP (nGAP), but not the full length protein, can induce transcription from afos promoter
(219). However, this was dependent upon Ras activity and suggests that additional signals from
36
Ras are required in order for nGAP to mediate this function. Similarly, as discussed above, the
ability of nGAP to inhibit muscarinic K+ channel activity in a Ras-independent manner suggests
that this domain of GAP transmits some type of signal (210). In addition, it has been shown that
the C-terminal catalytic domain of pl20-GAP (cGAP) can inhibit the transcriptional stimulation of
a polyoma enhancer produced by both normal and oncogenic Ras (220). Interestingly, while wildtype GAP did not affect oncogenic Ras signaling, it did reverse the inhibitory effect of cGAP on
transcription induced by oncogenic Ras. This suggests, therefore, that the N-terminal domain of
GAP is involved in mediating this particular Ras induced transcriptional stimulus. Taken together,
the above observations suggest a model in which the binding of Ras-GTP to pl20-GAP results in
a conformational change that exposes the N-terminal SH2 and SH3 domains, thereby promoting
their interaction with downstream target(s) to mediate Ras signaling. It is worth noting that
expression of nGAP suppresses the transforming potential of oncogenic Ras but not normal Ras
(221). Therefore, it is possible that the downstream targets of oncogenic and normal Ras may be
different and would have important ramifications on future drug strategies for inhibiting Ras
transformation.
Much less known about the putative effector function of NF1-GAP. Since the two GAPs
only share homology in the catalytic Ras-binding domain, it is reasonable to assume that they
mediate distinct pathways (177, 192). Tubulin has been demonstrated to interact with and inhibit
the catalytic activity of NF1-GAP on Ras (222). Thus, both GAPs share connections between Ras
function and cytoskeletal organization.
Guanine Nucleotide DissociationInhibitors
A third class of regulatory proteins that control the Ras GDP/GTP exchange cycle includes the
recently identified guanine nucleotide dissociation inhibitor, Ras GDI (95, 145). Ras GDI
negatively regulates Ras activity by inhibiting the dissociation of bound GDP, thereby antagonizing
the action of GEFs to stimulate GDP/GTP exchange on Ras.
37
Functionally related GDIs have been cloned and more extensively characterized for the
Ras-related Rab (Rab GDI) and Rho (Rho GDI) proteins (223). These GDIs have been shown to
inhibit the release of GDP and to antagonize the action of GEFs specific for Rab and Rho-related
proteins. In addition, Rab and Rho GDIs have been shown to inhibit the binding of their GDP
bound substrates to membranes as well as to induce their dissociation from the membrane (224).
Because the Rab and Rho GDIs only interact with the lipid modified forms of their respective
substrates, it has been proposed that these GDIs serve to mask the hydrophobic lipid groups in
order to promote membrane dissociation (225, 226). Therefore, these GDIs appear to play an
even more important role in regulating the cycling of Ras-related proteins between the membrane
and cytosol by promoting their release from membranes. This role is consistent with the apparent
need for Rab and Rho proteins to cycle between compartments in order to regulate vesicular
transport and organization of the actin cytoskeleton, respectively (35, 75).
Ras Regulators as Targets for Tumorigenesis
Analysis of tumors has clearly implicated an important role for Ras in oncogenesis. As discussed
earlier, numerous examples have demonstrated the presence of ras mutations in a variety of human
tumor types.
Since these mutations result in constitutive activation of Ras function, it is
conceivable that the inactivation of Ras GAPs or the chronic activation of Ras GEFs may also
trigger constitutive Ras activation. Hence, GEFs would be predicted to be oncogenes, whereas
GAPs may represent putative tumor suppressor genes. The loss of NF1-GAP activity in some
although not all human tumors has beeen shown to result in elevated Ras-GTP levels, thereby
providing support to this possibility (196, 197). In addition, somatic mutations in the NF1 gene
have been found in human tumors which reduce its GTPase stimulatory activity by up to 200-fold
(227). Targeted disruption of the Nfl gene in mice has also demonstrated that mice heterozygous
for the mutation are predisposed to tumors, with -50% of tumors showing loss of heterozygosity
at the Nfl locus (228). Interestingly, no mutations leading to the loss of p 20-GAP activity have
been identified in human tumors.
38
The mutation or overexpression of Ras GEFs has not yet been described in human tumors.
However, numerous experimental observations suggest that aberrant GEF activity can contribute
to transformation. Overexpression of truncated forms of many GEFs (e.g., mSOS and Cdc25)
caused morphological transformation of NIH/3T3 cells (229-231). In addition, smg GDS has also
been described to exhibit weak transforming potential on its own, but strongly cooperated with
wild-type K-ras to transform NIH/3T3 cells (232).
V. The Ras Signal Transduction Pathway
Although it has been known for some time that Ras proteins are critical in mediating a growth
regulatory signal, the precise biochemical pathways regulated by Ras activity have only recently
been identified (Figure 1.2). The combined knowledge gathered from biochemical studies in
mammalian cells and genetic studies from C.elegans, D. melanogaster, S. cerevisiae, and S.
pombe has revealed remarkable conservation of the signal transduction molecules and the
pathways that they mediate (Table 1.2) (81, 84). It is now clear that Ras proteins are critical in
eliciting a signal downstream of tyrosine kinases following mitogenic stimulation (233, 234). This
signal is then propagated, in part, through a series of dual specificity serine/threonine kinases,
which ultimately regulate the activities of nuclear transcription factors (235, 236). In addition, Ras
has recently been linked to the regulation of a cascade of small GTP-binding proteins critical in
regulating the organization of the actin cytoskeleton, thereby implicating an important role for Ras
function in cell growth, motility, adhesion, and cell-cell interactions (13).
Regulation of the Ras GDP/GTP Cycle by Mitogenic Stimuli
As discussed above, Ras proteins have been implicated in eliciting a signal downstream of a
number of receptor and non-receptor tyrosine kinases (see Mammalian Systems), as well as some
G protein-regulated serpentine receptors (94, 95). The rapid and transient elevation of Ras-GTP
levels is believed to occur through either stimulation of GEF activity or the inhibition of GAP
activity. The inhibition of GAP activity has been observed following phorbol ester induced T cell
39
Q)
1
· rl
E4
I
IO
I
Ia
I~eI
Zf
E0
I~w
--
1Kp
c'
P--_ oi
.
CA
C,,
5-i
n
Cu
~o
activation and in erythropoietin-treated erythroleukemic cells (237, 238). In contrast, fibroblasts
stimulated with epidermal growth factor (EGF) or insulin as well as NGF-stimulated PC12 cells
exhibit enhanced GEF activity (239, 240). Thus, the mode of regulation may depend upon either
the cell type and/or specific stimulus.
The precise mechanism governing GAP downregulation is not known. For example,
protein kinase C (PKC) stimulation in T cells following phorbol ester treatment did not result in
the phosphorylation of p120-GAP (237). An alternative target for PKC (a serine/threonine kinase)
may be the pl20-GAP associated protein, p190. Consistent with this possibility, p190 has been
shown to be predominantly phosphorylated on serine and threonine residues (211, 212). As
discussed above (see GTPase Activating Proteins), p190 association with pl20-GAP is induced
during tyrosine kinase-mediated transformation and cellular proliferation and attenuates the
GTPase stimulatory activity of pl20-GAP. Therefore, it is possible that downregulation of GAP
activity may be regulated through p190. Alternatively, GAP activity (both p120-GAP and NF1)
may be downregulated through the interaction with certain mitogenically-stimulated lipids (e.g.,
arachidonic acid, phosphatidic acid and phosphatidyl inositol phosphates) (194, 241-244).
However, this inhibitory effect has only been demonstrated in vitro and required such high
concentrations of lipids, that its physiological relevance is questionable.
Upregulation of GEF activity has recently been demonstrated to occur through at least two
distinct mechanisms following extracellular stimulation. First, it has been demonstrated that
tyrosine phosphorylation of the Vav GEF following T cell activation correlated with increased
exchange activity (167). However, this mechanism of activation appears to be unique to this GEF,
as the phosphorylation of other GEFs (e.g., CDC25 and mSos) has been postulated to serve in a
negative feedback regulatory loop (245, 246). The second mechanism of activation involves the
interaction of the Sos GEF with an "adapter" molecule called Grb2 (233, 234, 247). Grb2
contains SH2 and SH3 domains and directly couples activated tyrosine kinases with Ras activation
by triggering the translocation of Sos to the plasma membrane where Ras stimulation can then
occur.
41
The identification of this "adapter" component of the Ras signaling pathway came about
through a number of different approaches. Grb2 was first implicated in Ras signaling by genetic
analysis of vulval development in C. elegans. Genetic dissection of this RTK-mediated, Rasdependent pathway identified Sem-5 as a critical upstream activator of Let-60 (Ras homologue)
(248). The mammalian homologue of Sem-5, designated Grb2, was independently isolated by
virtue of its ability to bind to an activated (i.e., phosphorylated) EGF-R (249). A Grb-2
homologue, Drk, was simultaneously identified in D. melanogaster as an important upstream
regulator of Ras activation (250). The Grb2/Sem-5/Drk proteins consist only of an SH2 domain
and two SH3 domains and appear to lack any catalytic activity. Thus, Grb2 was believed to
function as an "adapter" molecule, with its SH2 domain binding to activated tyrosine
phosphoproteins and its SH3 domains binding to a Ras activator (i.e., Sos) (251).
This hypothesis was subsequently confirmed by a series of interrelated biochemical studies
from several groups (159, 231, 250, 252-256).
Grb2 and Sos were shown to exist in a
cytoplasmic complex. This interaction was mediated by the Grb2 SH3 domains, which were
shown to recognize proline-rich sequences (SH3 binding motif) at the C-terminus of Sos proteins.
Following ligand stimulation, this complex was shown to associate with autophosphorylated
RTKs via the SH2 domain of Grb2. Since the GDP/GTP exchange activity of Sos is not regulated
during this translocation step, the role of Grb2 is to mediate RTK activation of Ras by regulating
the association of Sos with plasma membrane-bound Ras.
A second SH2 domain containing protein, termed Shc, has also been implicated in linking
activated tyrosine kinases with Ras activation (251). This protein was originally identified as an
SH2-domain containing protein (257). Overexpression of Shc was sufficient to transform
NIH/3T3 cells as well as induce neurite outgrowth in PC12 cells in a manner that depended upon
Ras activity (251). Thus, She was implicated as an upstream regulator of Ras function. This was
confirmed by studies which showed that Shc was transiently phosphorylated following RTK
activation and constitutively in cells transformed by non-receptor tyrosine kinases such as src
(258) The binding of Shc to these activated tyrosine kinases resulted in tyrosine phosphorylation
42
of Shc, which in turn, promoted its association with the Grb2/Sos complex (231, 251). Thus, the
association of activated RTKs with Grb2, either directly or indirectly through Shc, results in the
translocation of Sos to the plasma membrane where it promotes activation of the Ras signaling
pathway.
Ras Transmits a Signal to the Nucleus via a Cascade of Serine/Threonine Kinases
In the past few years, a number of putative effector molecules for Ras have been identified (Table
1.3) (77). Several lines of evidence have now shown that Ras activates a series of serine/threonine
kinases following extracellular stimulation (Figure 1.2), that are a critical component of oncogenic
Ras-mediated transformation (236, 259). The first member of this kinase cascade is Raf and, as
discussed below, has now been demonstrated to directly interact with Ras-GTP.
Many
observations had positioned Raf downstream of Ras signaling. First, activated Ras results in
hyperphosphorylation of the Raf kinase in the absence of mitogenic stimuli (260). It was later
shown that Ras-mediated transformation could be inhibited by a dominant negative version of Raf1 (261). Conversely, dominant negative Ras (N17) could effectively block the ability of RTKs to
activate Raf kinase activity (262). In addition, genetic studies in D. melanogasterand C. elegans
implicated Raf homologues in Ras-dependent signaling cascades and positioned them downstream
of Ras (263, 264).
Evidence for a direct interaction between Ras and Raf was revealed through a series of
independent lines of investigation. The first suggestion of a direct physical association came from
the observation that recombinant Ras and Raf proteins were able to interact in a GTP-dependent
manner in vitro (265, 266). This was subsequently confirmed through the yeast two-hybrid
system (267), which revealed an association between the Ras effector domain and the N-terminal
regulatory domain of Raf- 1 (268). Simultaneously, Raf was isolated independently using the yeast
two-hybrid system to screen expression libraries for proteins that bound to Ras (269). The
converse experiment, in which Raf was used as the bait, resulted in the identification of the Rasrelated Rapl GTP-binding protein (270).
43
Table 1.3. Effectors of Rasa
Organism
Effector Molecule
Function
Vertebrates
pl120-GAP
Neurofibromin
Raf-1, A-Raf,
and B-Raf
p110PI3K
Ral-GDS
RGL (or Rsb3)
Rin
Rsbl (or AF6)
Ras-GAP
Ras-GAP
MAPKKKs in ERK-dependent
signaling from RTKs
3' phosphoinositol-lipid kinase
GEF for p27Ral GTPase
Ral-GDS-like GEF
Unknown
Unknown
Protein kinase C family member
MAPKKK in Jun kinase
pathway
PKC-
MEKK-1
D. melanogaster
Draf
Canoe?
MAPKKK in ERK-dependent
signaling from RTKs
Involved in Notch signaling
C. elegans
Lin45
MAPKKK in ERK-dependent
signaling from RTKs
S. pombe
Byr2
MAPKKK in pheromone
response pathway
Putative GEF for Cdc42sp;
regulates actin cytoskeleton
Scdl
S. cerevisiae
CDC35/CYR 1
Control of cAMP levels
(adenyl cyclase)
for vegetative growth
Table summarizes the molecules that have been demonstrated to date to
interact with Ras-GTP.
aAdapted from Marshall, C. (1996) Ras effectors. Curr Opin Cell Biol. 8, 197-204.
44
The binding of Ras to Raf in mammalian cells may be regulated by at least two
mechanisms. In the first mechanism, Rap1 appears to compete with Ras for Raf interaction, and
thus blocks Ras signaling (271). In the other, cyclic AMP levels appear to prevent the association
of Raf with Ras by an inhibitory phosphorylation event that is presumably mediated through
protein kinase A (272, 273). It is still not clear, however, how the binding of Raf to Ras activates
its kinase activity, but it appears that this step requires additional components located at the plasma
membrane (274, 275). Raf activation appears to be dependent upon its tyrosine phosphorylation
(276). In addition, deletion of the N-terminal regulatory domain results in the constitutive
activation of Raf kinase activity (277). Therefore, it had been proposed, that the role of Ras was to
recruite Raf to the plasma membrane, where Raf would be brought into association with a resident
tyrosine kinase (e.g., Src) that would covalently modify Raf and relieve the inhibitory effects of the
N-terminal regulatory domain. In support of this, targeting Raf-1 to the plasma membrane by
expression constructs containing Ras membrane targeting signals lead to activation of Raf-1 kinase
activity independently of Ras function (278, 279). This constitutive activation of Raf-l following
membrane targeting occurred in the absence of mitogenic stimulation. Importantly, however, this
membrane-targeted Raf-1 could be further activated by tyrosine kinases (279). This synergistic
activation of Raf through Ras and tyrosine kinase-mediated events at the plasma membrane has
recently been demonstrated (280). Interestingly, though, these investigators demonstrated that in
addition to tyrosine phosphorylation, there was yet another activation step resulting from the
recruitment of Raf-1 to the plasma membrane by Ras-GTP. Thus, the role of Ras in Raf-1
activation appears to bring Raf-1 to the plasma membrane for at least two different activation steps,
one of which is tyrosine phosphorylation.
Using the same yeast two-hybrid approach described above, Raf-1 was demonstrated to
directly interact with its substrate MAPK kinase (also known as MEK), and suggested that Raf
was acting as a bridge between Ras and a MAPK signaling cascade (268). Activated MAPK
kinase then catalyzes the dual phosphorylation and activation of at least two MAPKs, designated
45
Erkl and Erk2 (Figurel.2). Numerous biochemical and genetic studies have provided evidence
for the order of this signaling cascade (236, 281).
This cascade of serine/threonine kinases is remarkably conserved and is a recurring theme
downstream of a number of extracellular stimuli and small GTP-binding proteins (Table 1.2). For
example, the pheromone response pathways in both S. pombe and S. cerevisiae are mediated
through a MAPK cascade that is regulated by a G protein (81). Similar cascades have also been
implicated in RTK signaling in D. melanogaster and C. elegans (82-84).
The identification of numerous serine/threonine kinases and their substrate specificities has
defined distinct signaling cascades in response to specific extracellular stimuli. For example, the
Ras/Raf/MAPK cascade is believed to be important in regulating cellular proliferation, survival,
and differentiation. In contrast, the recently identified stress response pathways appear to be
involved in regulating apoptosis (282, 283). Although a linear scheme of signaling has been
identified in each of these pathways, it is clear that this is an oversimplification and cross talk
between these pathways can occur.
The activation of MAPKs subsequently results in the activation of a number of different
transcription factors as well as other kinases that are critical components of protein synthesis (235).
For example, MAPKs have been demonstrated to activate the nuclear transcription factors p62TCF,
c-Jun, c-Myc, and TALl (95, 235). In addition, MAPKs also phosphorylate and regulate the
ribosomal S6 kinase (RSK) and MAP kinase activated protein kinase-2 (MAPKAPK2), which are
believed to then phosphorylate and activate ribosomal subunits (262, 284). Elucidation of the
exact roles of MAPKs in gene expression will provide insight into the critical target genes
downstream of Ras activation and their potential roles in mediating cellular transformation.
The Rho-subfamily of Small GTP-binding Proteins: Their Signaling Pathways and
Requirementfor Ras-mediated Transformation
In addition to the MAPK cascade described above, Ras has also been implicated in regulating a
signaling pathway involving the Rho-subfamily of proteins (13). This family consists of nine
46
proteins: RhoA/B/C/G, Racl/2, Cdc42Hs/G25K, and TC10. They share -50-55% homology
with each other and around 30% homology to Ras, and are believed to function as molecular
switches in a manner analogous to that of Ras. Indeed, a number of GEFs (e.g., Dbl, Ost, and
Tiam-1) and GAPs (e.g., p190, Bcr, and Cdc42-GAP) specific to Rho proteins have been
identified and shown to regulate their GDP/GTP cycle (161, 285). Recently, an intensive area of
research has been focused on identifying targets specific for these Rho-related GTPases and have
lead to the identification of the PAK65 and PKN kinases as well as other putative effector
molecules (286-290).
The Rho-subfamily of proteins have been demonstrated to serve critical regulatory roles in
organization of the actin cytoskeleton. The first evidence for this function came from studies using
the C3 exotransferase of C. botulinum, which inactivates the RhoA, B, and C proteins specifically
through an ADP ribosylation event (13). Cells that were microinjected with C3 underwent a
dramatic morphological change in which they rounded up and lost their stress fibers (291, 292).
In contrast, microinjection of constitutively activated Rho (V14 ) into cells resulted in drastic
changes in cell shape and stimulated the formation of actin stress fibers and focal adhesions (292,
293). Microinjection of constitutively activated forms of Rac and Cdc42, on the other hand, lead to
dramatic effects on the actin cytoskeleton that were quite distinct from that of Rho. Rac-GTP
stimulated the rapid polymerization of actin at the plasma membrane to produce membrane
ruffling and lamellipodia (294), whereas Cdc42-GTP promoted the formation of filopodia (295).
In addition to these independent actions, these GTPases function as though they are linked (295,
296). Activated Cdc42 induces filopodia, but in addition, will subsequently stimulate the
production of lamellipodia, and then focal adhesions and stress fibers (in that temporal order). The
formation of these latter structures in response to Cdc42 activation is dependent upon Rac and Rho
function. Similarly, activated Rac produces lamellipodia, followed by focal adhesions and stress
fibers. Thus, Cdc42, Rac and Rho appear to function in a hierarchical cascade, with Cdc42
activating Rac which in turn leads to the activation of Rho.
47
These GTPases have also been implicated in regulating nuclear as well as cytoplasmic
effects. The first evidence in support of this came from the observation that chronic activation of
Cdc42, Rac, and Rho by deregulated exchange factors resulted in malignant transformation as well
as morphological alterations (166, 297). A direct link from these proteins to the nucleus as well as
to a MAPK cascade was recently demonstrated by three independent groups. Coso et al. and
Minden et al. were able to show that activation of the stress response pathway was dependent upon
Cdc42 and Rac 1, but interestingly, this activation was independent of RhoA (298, 299). The stress
response pathway is induced in response to UV irradiation, pro-inflammatory cytokines, and
environmental stress and is mediated by a series of MAPKs (JNK subgroup) that are distinct from
those downstream of Raf (282). The JNK protein kinases were first identified as a kinase activity
that phosphorylated the c-Jun transcription factor within its N-terminal transactivation domain in
cells exposed to UV irradiation. Both Cdc42 and Racl were capable of activating MEKK1 (a
JNK kinase kinase) and the subsequent downstream members of the kinase cascade (i.e.,
MKK4/SEK/JNKK and SAPK/JNK) in much the same way that Ras activates the Raf/MAPK
cascade described above (298, 299). The PAK65 serine/threonine kinase is the homologue of
STE20 in S. cerevisiae and has been proposed to link Cdc42 and Racl to MEKK1, due largely to
STE20's role in activating a similar MAPK cascade in the response to pheromone (Table 1.2) (81,
290, 300).
A requirement for RhoA in signaling to the serum response factor (SRF) in response to
serum and lysophosphatidic acid (LPA) was recently demonstrated (301). The c-fos serum
response element (SRE) has two distinct binding activities, SRF and the p62TCF ternary complex
factor, which cooperate to maximally activate c-fos transcription (302). The Ras/Raf/MAPK
pathway had been previously demonstrated to signal directly to p62TCF (303, 304). However,
activation of the SRE by serum or LPA is only dependent upon SRF and can occur independently
of the Ras/Raf/MAPK pathway (although suboptimally) (302). Hill et al. were able to show that
Rho family members mediated this p62TCF-independent, SRF-dependent activation. Activated
versions of Cdc42, Racl and RhoA were all capable of inducing transcription from a p6 2 TCF -
48
independent reporter (301). Interestingly, activation of SRF by Cdc42 and Rac 1 appeared to occur
independently of RhoA, yet stimulation by LPA still depended upon functional RhoA. Thus, it
appears that two distinct signaling pathways are mediated by the Rho-related proteins and converge
on SRF. In addition, these two pathways are likely to converge with the Ras/Raf/MAPK-activated
pathway to activate the SRE synergistically and in this way lead to maximal c-fos gene expression.
The identification of Rho family members as activators of MAPK cascades as well as the
conservation of this same signaling structure throughout numerous organisms suggests that many,
if not all, of the MAPK pathways will be controlled by small GTPases. This link between
GTPases and MAPK cascades is likely to invoke cooperating "second signals" that are provided
by other kinases or small molecules.
As discussed above, these "coactivators" have been
implicated in regulating the activation of Raf by Ras-GTP (279). It is tempting to speculate that the
very recently identified and novel kinase, designated Ksr-1, may prove to be this long sought
coactivator (305-308). In much the same way, Cdc42/Racl.GTP may localize PAK65 to an
appropriate compartment in the cell, where a second signal may be delivered. A requirement for a
second signal may explain the apparent roles that Ras seems to play in JNK activation as well as
RhoA-mediated SRF activation (301).
It has been known for some time that growth factors and constitutively active Ras will
stimulate the formation of stress fibers (through Rac and Rho) and membrane ruffling (Racdependent) and suggested that the activities of these GTPases were linked (293, 294). Direct
support of this interrelationship was obtained when it was demonstrated that dominant negative
mutants of either Racl (N17 ) or RhoA (N19 ) blocked Ras-mediated transformation (31-33). In
addition, RhoA (N 19 ), but not Racl (N17 ), was also capable of inhibiting transformation by
constitutively activated RafCAAX. However, activated versions of either Rho (V14 ) or Rac (V 12 )
were able to synergize strongly with RafCAAX in focus formation assays, indicating that
oncogenic Ras drives at least two distinct and cooperating pathways to cause transformation.
Interestingly, oncogenic Ras-mediated transformation is accompanied by the loss of stress fibers
and can be restored by coexpression of dominant negative RhoA (31, 32, 297). Taken together,
49
the above data implicate Rho in the regulation of at least two separate pathways, one that induces
stress fiber formation and another that is important in mediating transformation by oncogenic Ras
(and Raf).
The p190 protein provides a possible link between Ras and Rho activity. As discussed
earlier, p190 may function to antagonize Ras pl20-GAP function (see GTPase Activating
Proteins), while promoting inactivation of the Rho-mediated pathway regulating stress fiber
formation through its Rho-GAP catalytic activity. It is tempting to speculate that the association
of p190 with Rho may serve a second functional role in positively regulating a growth-promoting
signal, which may be mediated through either the GTP-binding domain and/or transcriptional
repressor domain that are also present in p190 (213). Thus, both the pl20-GAP and p190 RhoGAP proteins may serve bifunctional activities: one which downregulates their respective GTPase
substrate, while the second serves an effector function that promotes cellular proliferation through
the interaction with accessory proteins.
The Rho-driven signaling pathway that is involved in the control of cellular proliferation
remains to be elucidated. As discussed above, Rho plays an important role in regulating the c-fos
proto-oncogene. Rho function is also necesssary for the activation of focal adhesion kinase and
MAP kinases by growth factors (309). Furthermore, Rho has been shown to regulate a variety of
signal transducers, including phosphatidylinositol 4-phosphate 5-kinase, phosphatidylinositol (4,5)
3-kinsae, and phospholipase D (310-312). It is unclear which of these activities (or as yet
undetermined pathways) are important in mediating cellular proliferation. Importantly, further
characterization of these Rac/Rho-signaling pathways may identify alternative, and perhaps more
specific, targets for chemotherapeutic strategies designed to inhibit Ras-induced transformation.
50
VI. Ras Signaling as a Target for Drug Therapy
Farnesyltransferase Inhibitors
The ras genes are mutated in approximately 30% of all human tumors, thereby making them one
of the most frequent alterations in cancer (88). Because of this, much effort has focused on
developing chemotherapeutic drugs to inhibit the transforming activity of oncogenic Ras. As
discussed earlier, Ras must be post-translationally modified at the C-terminus in order to acquire
biological activity (58-60). Each step in the processing pathway is dependent upon the preceding
one, such that no post-translational modifications occur if the first step, famesylation, is blocked.
Blocking farnesylation totally abolishes the transforming activity of Ras as measured in NIH/3T3
cells (64, 313). In contrast, blocking steps subsequent to farnesylation, such as palmitylation, has
a much less dramatic effect on oncogenic Ras function despite the lack of significant association
with the plasma membrane (64, 65). Therefore, these observations have made prenyltransferase
molecules excellent targets for the development of anti-Ras chemotherapeutic drugs. Because it
was believed that all Ras proteins were modified by the farnesyl isoprenoid, the main target of
drug research has been the farnesyltransferase (FTase) enzyme (59, 314).
The classical approach of screening compound libraries has yielded several classes of
compounds that inhibit FTase (315). However, despite giving promising results in vitro, all of
these compounds have proven ineffective when tested on intact cells. Therefore, investigators have
focused their efforts on the rational design of inhibitors based on the knowledge of the enzyme's
substrates. The initial goal of these research programs was to identify drugs which would be
sufficiently potent so as to inhibit Ras-mediated transformation, yet specific enough to alleviate
toxicity effects on normal cells. This issue of specificity is important because a single FTase is
required by multiple substrates for appropriate biological function (314). At least eight other
proteins, including the nuclear lamins A and B, are known to be famesylated in addition to the four
Ras proteins (58, 75, 314). Furthermore, any potential drugs should specifically inhibit FTase and
not the geranylgeranyltransferase type I and type II enzymes (GGTase I and GGTase II). This is
51
particularly important given the fact that geranylgeranlyation is five to ten times more prevalent
than farnesylation (59, 316, 317). Thus, an inhibitor exhibiting the above specificity would be
expected to elicit fewer cytotoxic effects.
The initial templates for the design of FTase inhibitors were the substrates for the reaction,
namely farnesyl diphosphate and the CAAX tetrapeptide. The conversion of these charged and
metabolically labile compounds into stable and lipid soluble inhibitors was a major obstacle that
had to be overcome. A number of compounds representing a broad structure base have since been
designed and shown to be potent as well as selective FTase inhibitors (314).
Two examples of farnesyl diphosphate analogs, (at-Hydroxyfarnesyl) phosphonic acid and
manumycin, have been shown to inhibit FTase and are active in cells (318). However, the
inhibition of Ras farnesylation in intact cells is only partial. Furthermore, the absolute specificity
of these compounds in vivo is uncertain due to the large number of enzymes in the cell which
utilize farnesyl diphosphate (316, 317).
CAAX-based inhibitors, on the other hand, have proven to be much more effective in their
ability to inhibit FTase in the intact cell. Early versions of these inhibitors had a number of
problems associated with them, including protease degradation, lipid solubility, and potency.
Within the past few years, significant strides have been made in the design of tetrapeptide
inihibitors and have overcome many of these issues (314, 319-322). These modifications have
provided a set of inhibitors that exhibit potency toward FTase at nanomolar concentrations in vitro,
while retaining selectivity against GGTase I. These compounds have since proven to be very
effective inhibitors of FTase activity in the living cell, as indicated by the inhibition of Ras
processing as well as the absence of [3 H]mevalonate (a metabolic precursor of both farnesyl
diphosphate and geranylgeranyl diphosphate) incorpation into farnesylated proteins (319-321).
Moreover, the degree of inhibition was essentially complete, in contrast with the farnesyl
diphosphate analog inhibitors.
However, higher concentrations (micromolar) of the drug
molecules were required to block Ras processing in vivo than were needed to inhibit FTase activity
52
in vitro (nanomolar). This is an extremely important observation, the implications of which will
be discussed below.
Based on [3H]mevalonate labeling experiments, the FTase inhibitors have clearly been
shown to block the farnesylation of several proteins in addition to Ras (320). Therefore, these
inhibitors are not Ras-specific. However, as was shown in vitro, these inhibitors still retain
selectivity in the cell, as the geranylgeranylation of cellular proteins was not inhibited at
concentrations sufficient to fully inhibit farnesylation (319-321).
The FTase Inhibitor Paradox: Efficacy without Cytotoxicity
Recently, a number of FTase inhibitors have been demonstrated to revert the malignant phenotype
of Ras-transformed cells both in tissue culture and in the animal (319-321, 323-325). In addition,
these effects were selective for ras-inducedphenotypes, as they did not inhibit the growth of cells
transformed by raformos (both of which are downstream of Ras in the signaling cascade) (321,
323, 326, 327). Surprisingly, though, no anti-proliferative or toxic effects on normal cells were
observed in tissue culture or in vivo. These results raise questions as to the biological mechanism
of inhibition, since Ras as well as other farnesylated proteins are critical in normal cell growth and
function (89, 328, 329).
One possible explanation for the above paradox is that while the function of FTase may be
impaired in the presence of these inhibitors, they may not abolish the ability of GGTase I to crossprenylate protein substrates with either geranylgeranyl or farnesyl isoprenoids. It is not known
whether GGTase I can transfer a farnesyl isoprenoid in vivo. In addition, while these FTase
inhibitors do not affect GGTase I-dependent geranylgeranylation, their effects on GGTase Idependent farnesylation have not been examined. Thus, despite an efficient block in FTase
activity, compensatory regulation by GGTase I would enable these substrates (e.g., Ras and
nuclear lamins A and B) to still associate with the appropriate membrane and retain biological
activity.
This possibility, however, is difficult to reconcile with the specific inhibition of
53
transformed cells as cross-prenylation of oncogenic Ras molecules would be expected to activate
the transforming signal.
Recent observations have demonstrated that K-ras4B can be modified by
geranylgeranylation as well as farnesylation both in vitro and in vivo (73, 74). K-ras4B has been
shown to be a substrate for geranylgeranylation by GGTase I with an affinity for the enzyme equal
to that of RaplB, an authentic GGTase I substrate which is solely modified by geranylgeranylation
(74). This substrate specificity was dictated by both the CAAX sequence as well as the polylysine
domain in K-ras4B. In addition, a GGTase I inhibitor has recently been designed which is 10 to
25 fold more potent than FTase inhibitors towards inhibiting geranylgeranylation both in vitro and
in vivo.(73) While H-ras processing in intact cells was found to be very sensitive to FTase
inhibitors, that of K-ras4B was 100 fold more resistant. In contrast, K-ras4B processing and
signaling was much more sensitive to the GGTase I inhibitor. In fact, significant inhibition of
oncogenic K-ras4B signaling (as measured by MAP kinase stimulation) by the GGTase I inhibitor
occurred at concentrations that did not affect oncogenic H-ras signaling. Thus, this unique
processing of K-ras4B helps to explain earlier observations showing that higher concentrations of
FTase inhibitors were required to suppress the transforming activity of oncogenic K-ras than were
necessary for H-ras (73, 74, 325, 330-332). Because K-ras4B processing is more resistant to
FTase inhibitors, this also serves to explain, at least in part, why FTase inhibitors do not inhibit the
growth or transient mitogenic responses of non-transformed cells at concentrations that are
sufficient to prevent the farnesylation of endogenous proteins and revert malignant phenotypes
(319-321, 323, 324). Furthermore,the specific inhibition of transformed cells can be explained
through the sequestration of effectors into inactive cytoplasmic complexes with Ras.GTP as has
been demonstrated for the Raf effector (332, 333).
The above observation suggests that K-ras4B is sufficient to support the growth and
mitogenic responses of normal cells in which H- and N-ras have been functionally inhibited by
FTase inhibitors. Alternatively, other members of the Ras superfamily may functionally
compensate for the absence of Ras function. If such a protein(s) existed, it would not only have to
54
be resistant to FTase inhibitors, but would also have to be able to utilize components of the Ras
signaling cascade(s). In addition, since cell growth has been shown to require Ras function, this
protein would also have to be affected to the same degree as Ras proteins to the dominant
inhibitory growth effects of microinjected Ras antibodies (i.e., Y13-259) and dominant negative
Ras mutants (89, 328, 329). It is possible, however, that this protein may support cell growth only
in collaberation with K-ras4B, and therefore, may not be subject to the same inhibitory effects of
Y13-259 and dominant negative Ras mutants. A strong candidate for such a role is TC21/R-ras2.
This member shares 55% amino acid identity with Ras proteins, is expressed in all human tissues
examined so far, and has partial, but significant, overlap in the Ras signaling pathway (14, 334,
335). In addition, TC21 is recognized by Y13-259, and residues critical for the effects of
dominant negative Ras mutants are identical between Ras and TC21.
Finally, TC21 is
geranylgeranylated as well as farnesylated in vitro, and cells transformed by an oncogenic version
of TC21 are resistant to the inhibitory effects of FTase inhibitors (76). Thus, it is conceivable that
TC21 and/or K-ras4B may allow non-transformed cells to continue to proliferate in the presence of
FTase inhibitors.
Interestingly, the kinetics of morphological reversion induced by FTase inhibitors are too
rapid to easily be explained solely by the suppression of Ras activity (326). Phenotypic reversion
is detectable within 18 to 24 hours. Since fully modified Ras is very stable (half-life of 24 hours)
(336), this amount of time is insufficient to explain depletion of Ras activity from cells treated with
FTase inhibitors. Instead, the inhibitory effects of these drug molecules correlated well with
effects on the regulation of the cytoskeletal architecture, namely the restoration of actin stress fiber
formation. This observation implicated the Rho-subfamily of proteins as targets of the effects
mediated by FTase inhibitors.
One member of this family, RhoB, exists in both
geranylgeranylated and farneslyated forms in vivo and is rapidly turned over in the cell (half life of
-2 hours) (75, 337). Therefore, RhoB represented a potential direct target for FTase inhibitors.
This hypothesis was supported when it was demonstrated that dominant negative mutants of Rho,
including RhoB, mimicked the ability of FTase inhibitors to impair Ras transformation (as
55
discussed above) (31, 32, 34). In addition, Lebowitz et al. have recently demonstrated that FTase
inhibitors suppressed the transformed phenotype, at least in part, by either directly or indirectly
interfering with Rho function (337). Importantly, the effects of these pharmalogical inhibitors
could be ablated by ectopic expression of farnesyl-independent (i.e., myristylated) forms of RhoB.
In contrast, cells transformed by a myrstylated Ras construct remained susceptible to growth
inhibition by these same FTase inhibitors.
Together, the above data stress the importance of designing molecules specific for Ras
family members, in particular, K-ras4B. This is underscored by the fact that K-ras is the most
frequently mutated member of the ras gene family (88). Further characterization of the signals
emanating downstream of oncogenic and normal Ras proteins may reveal distinct signaling
pathways that are critical in mediating transformation, some of which may or may not overlap
with the Rac/Rho signaling pathways. The identification of such mediators may ultimately provide
more specific targets for future drug applications.
56
References
1.
Barbacid, M., (1987). ras genes. Annu Rev Biochem 56: p. 779-827.
2.
Shih, C., et al., (1981). Transforming genes of carcinomas and neuroblastomas introduced
into mouse fibroblasts. Nature 290(5803): p. 261-4.
3.
Sukumar, S., et al., (1983). Induction of mammary carcinomas in rats by nitrosomethylurea involves malignant activation of H-ras-1 locus by single point mutations.
Nature 306(5944): p. 658-61.
4.
Pulciani, S., et al., (1982). Oncogenes in human tumor cell lines: molecular cloning of a
transforming gene from human bladder carcinoma cells. Proc Natl Acad Sci U S A 79(9):
p. 2845-9.
5.
Perucho, M., et al., (1981). Human-tumor-derived cell lines contain common and different
transforming genes. Cell : p. 467-76.
6.
Krontiris, T.G. and G.M. Cooper, (1981). Transforming activity of human tumor DNAs.
Proc Natl Acad Sci U S A 78(2): p. 1181-4.
7.
Eva, A. and S.A. Aaronson, (1983). Frequent activation of c-kis as a transforming gene in
fibrosarcomas induced by methylcholanthrene. Science 220(4600): p. 955-6.
8.
Balmain, A. and I.B. Pragnell, (1983). Mouse skin carcinomas induced in vivo by
chemical carcinogens have a transforming Harvey-ras oncogene. Nature 303(5912): p. 724.
9.
Shimizu, K., et al., (1983). Isolation and preliminary characterization of the transforming
gene of a human neuroblastoma cell line. Proc Natl Acad Sci U S A 80(2): p. 383-7.
10.
Santos, E., et al., (1982). T24 human bladder carcinoma oncogene is an activated form of
the normal human homologue of BALB- and Harvey-MSV transforming genes. Nature
298(5872): p. 343-7.
11.
Parada, L.F., et al., (1982). Human EJ bladder carcinoma oncogene is homologue of
Harvey sarcoma virus ras gene. Nature 297(5866): p. 474-8.
12.
Der, C.J., T.G. Krontiris, and G.M. Cooper, (1982). Transforming genes of human
bladder and lung carcinoma cell lines are homologous to the ras genes of Harvey and
Kirsten sarcoma viruses. Proc Natl Acad Sci U S A 79(11): p. 3637-40.
13.
Hall, A., (1994). Small GTP-binding proteins and the regulation of the actin cytoskeleton.
Annu Rev Cell Biol 10(31): p. 31-54.
14.
Graham, S.M., et al., (1994). Aberrant function of the Ras-related protein TC21/R-Ras2
triggers malignant transformation. Mol Cell Biol 14(6): p. 4108-15.
57
15.
Cox, A.D., et al., (1994). R-Ras induces malignant, but not morphologic, transformation
of NIH3T3 cells. Oncogene 9(11): p. 3281-3288.
16.
Shimizu, K., et al., (1983). Structure of the Ki-ras gene of the human lung carcinoma cell
line Calu- 1. Nature 304(5926): p. 497-500.
17.
McGrath, J.P., et al., (1983). Structure and organization of the human Ki-ras protooncogene and a related processed pseudogene. Nature 304(5926): p. 501-6.
18.
Capon, D.J., et al., (1983). Activation of Ki-ras2 gene in human colon and lung
carcinomas by two different point mutations. Nature 304(5926): p. 507-13.
19.
George, D.L., et al., (1985). Structure and expression of amplified cKi-ras gene sequences
in Y1 mouse adrenal tumor cells. Embo J 4(5): p. 1199-203.
20.
Nakano, H., et al., (1984). Isolation of transforming sequences of two human lung
carcinomas: structural and functional analysis of the activated c-K-ras oncogenes. Proc Natl
Acad Sci U S A 81(1): p. 71-5.
21.
Cichutek, K. and P.H. Duesberg, (1986). Harvey ras genes transform without mutant
codons, apparently activated by truncation of a 5' exon (exon -1). Proc Natl Acad Sci USA
83(8): p. 2340-4.
22.
Schejter, E.D. and B.Z. Shilo, (1985). Characterization of functional domains of p21 ras
by use of chimeric genes. Embo J 4(2): p. 407-12.
23.
Neuman, S.F., et al., (1984). The Drosophila ras oncogenes: structure and nucleotide
sequence. Cell 37(3): p. 1027-33.
24.
Mozer, B., et al., (1985). Characterization and developmental expression of a Drosophila
ras oncogene. Mol Cell Biol 5(4): p. 885-9.
25.
Powers, S., et al., (1984). Genes in S. cerevisiae encoding proteins with domains
homologous to the mammalian ras proteins. Cell 36(3): p. 607-12.
26.
Goldfarb, M., et al., (1982). Isolation and preliminary characterization of a human
transforming gene from T24 bladder carcinoma cells. Nature 296(5856): p. 404-9.
27.
DeFeo, J.D., et al., (1983). ras-Related gene sequences identified and isolated from
Saccharomyces cerevisiae. Nature 306(5944): p. 707-9.
28.
DeFeo, J.D., et al., (1985). Mammalian and yeast ras gene products: biological function in
their heterologous systems. Science 228(4696): p. 179-84.
29.
Kataoka, T., et al., (1985). Functional homology of mammalian and yeast RAS genes. Cell
40(1): p. 19-26.
58
30.
Clark, S.G., J.P. McGrath, and A.D. Levinson, (1985). Expression of normal and
activated human Ha-ras cDNAs in Saccharomyces cerevisiae. Mol Cell Biol 5(10): p.
2746-52.
31.
Khosravi, F.R., et al., (1995). Activation of Rac 1, RhoA, and mitogen-activated protein
kinases is required for Ras transformation. Mol Cell Biol 15(11): p. 6443-6453.
32.
Qiu, R.G., et al., (1995). A role for Rho in Ras transformation. Proc Natl Acad Sci U S A
92(25): p. 11781-11785.
33.
Qiu, R.G., et al., (1995). An essential role for Rac in Ras transformation. Nature
374(6521): p. 457-459.
34.
Prendergast, G.C., et al., (1995). Critical role of Rho in cell transformation by oncogenic
Ras. Oncogene 10(12): p. 2289-2296.
35.
Bourne, H.R., D.A. Sanders, and F. McCormick, (1990). The GTPase superfamily: a
conserved switch for diverse cell functions. Nature 348(6297): p. 125-32.
36.
Thompson, R.C., (1988). EFTu provides an internal kinetic standard for translational
accuracy. Trends Biochem Sci 13(3): p. 91-3.
37.
Gilman, A.G., (1987). G proteins: transducers of receptor-generated signals. Annu. Rev.
Biochem. 56: p. 615-49.
38.
Lacal, J.C., P.S. Anderson, and S.A. Aaronson, (1986). Deletion mutants of Harvey ras
p21 protein reveal the absolute requirement of at least two distant regions for GTP-binding
and transforming activities. Embo J 5(4): p. 679-87.
39.
Willumsen, B.M., et al., (1986). Mutational analysis of a ras catalytic domain. Mol Cell
Biol 6(7): p. 2646-54.
40.
Feramisco, J.R., et al., (1985). Transient reversion of ras oncogene-induced cell
transformation by antibodies specific for amino acid 12 of ras protein. Nature 314(6012):
p. 639-42.
41.
Clark, R., et al., (1985). Antibodies specific for amino acid 12 of the ras oncogene product
inhibit GTP binding. Proc Natl Acad Sci U S A 82(16): p. 5280-4.
42.
Gibbs, J.B., et al., (1984). Intrinsic GTPase activity distinguishes normal and oncogenic
ras p21 molecules. Proc Natl Acad Sci U S A 81(18): p. 5704-8.
43.
Manne, V., E. Bekesi, and H.F. Kung, (1985). Ha-ras proteins exhibit GTPase activity:
point mutations that activate Ha-ras gene products result in decreased GTPase activity. Proc
Natl Acad Sci U S A 82(2): p. 376-80.
44.
McGrath, J.P., et al., (1984). Comparative biochemical properties of normal and activated
human ras p21 protein. Nature 310(5979): p. 644-9.
59
45.
Sweet, R.W., et al., (1984). The product of ras is a GTPase and the T24 oncogenic mutant
is deficient in this activity. Nature 311(5983): p. 273-5.
46.
Temeles, G.L., et al., (1985). Yeast and mammalian ras proteins have conserved
biochemical properties. Nature 313(6004): p. 700-3.
47.
Bourne, H.R., D.A. Sanders, and F. McCormick, (1991). The GTPase superfamily:
conserved structure and molecular mechanism. Nature 349(6305): p. 117-27.
48.
Bollag, G. and F. McCormick, (1991). Regulators and effectors of ras proteins. Annu Rev
Cell Biol 7: p. 601-32.
49.
Milburn, M.V., et al., (1990). Molecular switch for signal transduction: structural
differences between active and inactive forms of protooncogenic ras proteins. Science
247(4945): p. 939-45.
50.
Pai, E.F., et al., (1990). Refined crystal structure of the triphosphate conformation of H-ras
p21 at 1.35 A resolution: implications for the mechanism of GTP hydrolysis. Embo J
9(8): p. 2351-9.
51.
Brunger, A.T., et al., (1990). Crystal structure of an active form of RAS protein, a
complex of a GTP analog and the HRAS p21 catalytic domain. Proc Natl Acad Sci U S A
87(12): p. 4849-53.
52.
Tong, L.A., et al., (1989). Structural differences between a ras oncogene protein and the
normal protein. Nature 337(6202): p. 90-3.
53.
Krengel, U., et al., (1990). Three-dimensional structures of H-ras p21 mutants: molecular
basis for their inability to function as signal switch molecules. Cell 62(3): p. 539-48.
54.
Sigal, I.S., et al., (1986). Mutant ras-encoded proteins with altered nucleotide binding exert
dominant biological effects. Proc Natl Acad Sci U S A 83(4): p. 952-6.
55.
Powers, S., K. O'Neill, and M. Wigler, (1989). Dominant yeast and mammalian RAS
mutants that interfere with the CDC25- dependent activation of wild-type RAS in
Saccharomyces cerevisiae. Mol Cell Biol 9(2): p. 390-5.
56.
Feig, L.A. and G.M. Cooper, (1988). Inhibition of NIH 3T3 cell proliferation by a mutant
ras protein with preferential affinity for GDP. Mol Cell Biol 8(8): p. 3235-43.
57.
Sigal, I.S., et al., (1986). Identification of effector residues and a neutralizing epitope of
Ha- ras-encoded p21. Proc Natl Acad Sci U S A 83(13): p. 4725-9.
58.
Khosravi, F.R., et al., (1992). Protein prenylation: key to ras function and cancer
intervention? Cell Growth Differ 3(7): p. 461-9.
59.
Gibbs, J.B., (1991). Ras C-terminal processing enzymes--new drug targets? Cell 65(1):
p. 1-4.
60
60.
Glomset, J.A. and C.C. Farnsworth, (1994). Role of protein modification reactions in
programming interactions between ras-related GTPases and cell membranes. Annu Rev
Cell Biol 10(181): p. 181-205.
61.
Hancock, J.F., K. Cadwallader, and C.J. Marshall, (1991). Methylation and proteolysis are
essential for efficient membrane binding of prenylated p21K-ras(B). Embo J 10(3):
p. 641-6.
62.
Hrycyna, C.A., et al., (1991). The Saccharomyces cerevisiae STE14 gene encodes a
methyltransferase that mediates C-terminal methylation of a-factor and RAS proteins.
Embo J 10(7): p. 1699-709.
63.
Kato, K., et al., (1992). Isoprenoid addition to Ras protein is the critical modification for its
membrane association and transforming activity. Proc Natl Acad Sci U S A 89(14):
p. 6403-7.
64.
Hancock, J.F., et al., (1989). All ras proteins are polyisoprenylated but only some are
palmitoylated. Cell 57(7): p. 1167-77.
65.
Hancock, J.F., H. Paterson, and C.J. Marshall, (1990). A polybasic domain or
palmitoylation is required in addition to the CAAX motif to localize p21ras to the plasma
membrane. Cell 63(1): p. 133-9.
66.
Hancock, J.F., et al., (1991). A CAAX or a CAAL motif and a second signal are sufficient
for plasma membrane targeting of ras proteins. Embo J 10(13): p. 4033-9.
67.
Ballester, R., M.E. Furth, and O.M. Rosen, (1987). Phorbol ester- and protein kinase Cmediated phosphorylation of the cellular Kirsten ras gene product. J Biol Chem 262(6): p.
2688-95.
68.
Cox, A.D. and C.J. Der, (1992). Protein prenylation: more than just glue? Curr Opin Cell
Biol 4(6): p. 1008-16.
69.
Reiss, Y., et al., (1991). Sequence requirement for peptide recognition by rat brain p2lras
protein farnesyltransferase. Proc Natl Acad Sci U S A 88(3): p. 732-6.
70.
Moores, S.L., et al., (1991). Sequence dependence of protein isoprenylation. J Biol Chem
266(22): p. 14603-10.
71.
Gibbs, J.B., et al., (1989). Xenopus oocyte germinal-vesicle breakdown induced by
[Vall2]Ras is inhibited by a cytosol-localized Ras mutant. Proc Natl Acad Sci U S A
86(17): p. 6630-4.
72.
Pompliano, D.L., et al., (1993). Isoprenoid diphosphate utilization by recombinant human
farnesyl:protein transferase: interactive binding between substrates and a preferred kinetic
pathway. Biochemistry 32(32): p. 8341-7.
73.
Lerner, E.C., et al., (1995). Disruption of oncogenic K-Ras4B processing and signaling by
a potent geranylgeranyltransferase I inhibitor. J Biol Chem 270(45): p. 26770-26773.
61
74.
James, G.L., J.L. Goldstein, and M.S. Brown, (1995). Polylysine and CVIM sequences of
K-RasB dictate specificity of prenylation and confer resistance to benzodiazepine
peptidomimetic in vitro. J Biol Chem 270(11): p. 6221-6226.
75.
Adamson, P., et al., (1992). Post-translational modifications of p2lrho proteins. J Biol
Chem 267(28): p. 20033-8.
76.
Carboni, J.M., et al., (1995). Farnesyltransferase inhibitors are inhibitors of Ras but not RRas2/TC21, transformation. Oncogene 1085(1080): p. 1905-1913.
77.
Marshall, C.J., (1996). Ras effectors. Curr Opin Cell Biol 8: p. 197-204.
78.
Moodie, S.A., et al., (1995). Different structural requirements within the switch II region
of the Ras protein for interactions with specific downstream targets. Oncogene 11(3):
p. 447-454.
79.
Brtva, T.R., et al., (1995). Two distinct Raf domains mediate interaction with Ras. J. Biol.
Chem. 270(17): p. 9809-12.
80.
Drugan, J.K., et al., (1996). Ras interaction with two distinct binding domains in Raf-1
may be required for Ras transformation. J Biol Chem 271(1): p. 233-237.
81.
Wittenberg, C. and S.I. Reed, (1996). Plugging it in: signaling circuits and the yeast cell
cycle. Curr Opin Cell Biol 8: p. 223-230.
82.
Kayne, P.S. and P.W. Sternberg, (1995). Ras pathways in Caenorhabditis elegans. Curr
Opin Genet Dev 5(1): p. 38-43.
83.
Wassarman, D.A., M. Therrien, and G.M. Rubin, (1995). The Ras signaling pathway in
Drosophila. Curr Opin Genet Dev 5(1): p. 44-50.
84.
Duffy, J.B. and N. Perrimon, (1996). Recent advances in understanding signal
transduction pathways in worms and flies. Curr Opin Cell Biol 8: p. 231-238.
85.
Han, M. and P.W. Sternberg, (1990). let-60, a gene that specifies cell fates during C.
elegans vulval induction, encodes a ras protein. Cell 63(5): p. 921-31.
86.
Kataoka, T., et al., (1984). Genetic analysis of yeast RAS 1 and RAS2 genes. Cell 37(2): p.
437-45.
87.
Bos, J.L., (1988). The ras gene family and human carcinogenesis. Mutat Res 195(3): p.
255-71.
88.
Bos, J.L., (1989). ras oncogenes in human cancer: a review [published erratum appears in
Cancer Res 1990 Feb 15;50(4):1352]. Cancer Res 49(17): p. 4682-9.
62
89.
Mulcahy, L.S., M.R. Smith, and D.W. Stacey, (1985). Requirement for ras protooncogene function during serum-stimulated growth of NIH 3T3 cells. Nature 313(5999):
p. 241-3.
90.
Cai, H., J. Szeberenyi, and G.M. Cooper, (1990). Effect of a dominant inhibitory Ha-ras
mutation on mitogenic signal transduction in NIH 3T3 cells. Mol Cell Biol 10(10):
p. 5314-23.
91.
Bar-Sagi, D. and J.R. Feramisco, (1986). Induction of membrane ruffling and fluid-phase
pinocytosis in quiescent fibroblasts by ras proteins. Science 233(4768): p. 1061-8.
92.
Hagag, N., S. Halegoua, and M. Viola, (1986). Inhibition of growth factor-induced
differentiation of PC12 cells by microinjection of antibody to ras p21. Nature 319(6055):
p. 680-2.
93.
Szeberenyi, J., H. Cai, and G.M. Cooper, (1990). Effect of a dominant inhibitory Ha-ras
mutation on neuronal differentiation of PC12 cells. Mol Cell Biol 10(10): p. 5324-32.
94.
Satoh, T., M. Nakafuku, and Y. Kaziro, (1992). Function of Ras as a molecular switch in
signal transduction. J Biol Chem 267(34): p. 24149-52.
95.
Khosravi, F.R. and C.J. Der, (1994). The Ras signal transduction pathway. Cancer
Metastasis Rev 13(1): p. 67-89.
96.
Smith, M.R., S.J. DeGudicibus, and D.W. Stacey, (1986). Requirement for c-ras proteins
during viral oncogene transformation. Nature 320(6062): p. 540-3.
97.
Almoguera, C., et al., (1988). Most human carcinomas of the exocrine pancreas contain
mutant c-K-ras genes. Cell 53(4): p. 549-54.
98.
Pellegata, N.S., et al., (1994). K-ras and p53 gene mutations in pancreatic cancer: ductal
and nonductal tumors progress through different genetic lesions. Cancer Res 54(6):
p. 1556-60.
99.
Smit, V.T., et al., (1988). KRAS codon 12 mutations occur very frequently in pancreatic
adenocarcinomas. Nucleic Acids Res 16(16): p. 7773-82.
100.
Vogelstein, B., et al., (1988). Genetic alterations during colorectal-tumor development. N
Engl J Med 319(9): p. 525-32.
101.
Bos, J.L., et al., (1987). Prevalence of ras gene mutations in human colorectal cancers.
Nature 327(6120): p. 293-7.
102.
Forrester, K., et al., (1987). Detection of high incidence of K-ras oncogenes during human
colon tumorigenesis. Nature 327(6120): p. 298-303.
103.
Muller, R., et al., (1982). Differential expression of cellular oncogenes during pre- and
postnatal development of the mouse. Nature 299(5884): p. 640-4.
63
104.
Muller, R., et al., (1983). Transcription of c-onc genes c-rasKi and c-fms during mouse
development. Mol Cell Biol 3(6): p. 1062-9.
105.
Leon, J., I. Guerrero, and A. Pellicer, (1987). Differential expression of the ras gene family
in mice. Mol Cell Biol 7(4): p. 1535-40.
106.
Mangues, R. and A. Pellicer, (1992). ras activation in experimental carcinogenesis. Semin
Cancer Biol 3(4): p. 229-39.
107.
Guerrero, I. and A. Pellicer, (1987). Mutational activation of oncogenes in animal model
systems of carcinogenesis. Mutat Res 185(3): p. 293-308.
108.
Quintanilla, M., et al., (1986). Carcinogen-specific mutation and amplification of Ha-ras
during mouse skin carcinogenesis. Nature 322(6074): p. 78-80.
109.
Loechler, E.L., C.L. Green, and J.M. Essigmann, (1984). In vivo mutagenesis by 06methylguanine built into a unique site in a viral genome. Proc Natl Acad Sci U S A 81(20):
p. 6271-5.
110.
Eadie, J.S., et al., (1984). Mechanism of mutagenesis by 06-methylguanine. Nature
308(5955): p. 201-3.
111.
Singer, B. and J.T. Kusmierek, (1982). Chemical mutagenesis. Annu Rev Biochem:
p. 655-93.
112.
Adams, J.M. and S. Cory, (1991). Transgenic models of tumor development. Science
254(5035): p. 1161-7.
113.
Sinn, E., et al., (1987). Coexpression of MMTV/v-Ha-ras and MMTV/c-myc genes in
transgenic mice: synergistic action of oncogenes in vivo. Cell 49(4): p. 465-75.
114.
Land, H., L.F. Parada, and R.A. Weinberg, (1983). Tumorigenic conversion of primary
embryo fibroblasts requires at least two cooperating oncogenes. Nature 304(5927): p. 596602.
115.
Newbold, R.F. and R.W. Overell, (1983). Fibroblast immortality is a prerequisite for
transformation by EJ c-Ha- ras oncogene. Nature 304(5927): p. 648-51.
116.
Ruley, H.E., (1983). Adenovirus early region 1A enables viral and cellular transforming
genes to transform primary cells in culture. Nature 304(5927): p. 602-6.
117.
Lee, W.M., et al., (1985). Augmented expression of normal c-myc is sufficient for
cotransformation of rat embryo cells with a mutant ras gene. Mol Cell Biol 5(12): p. 334556.
118.
Weinberg, R.A., (1985). The action of oncogenes in the cytoplasm and nucleus. Science
230(4727): p. 770-6.
64
119.
Schwab, M., H.E. Varmus, and J.M. Bishop, (1985). Human N-myc gene contributes to
neoplastic transformation of mammalian cells in culture. Nature 316(6024): p. 160-2.
120.
Parada, L.F., et al., (1984). Cooperation between gene encoding p53 tumour antigen and
ras in cellular transformation. Nature 312(5995): p. 649-51.
121.
Eliyahu, D., et al., (1984). Participation of p53 cellular tumour antigen in transformation of
normal embryonic cells. Nature 312(5995): p. 646-9.
122.
Dotto, G.P., L.F. Parada, and R.A. Weinberg, (1985). Specific growth response of rastransformed embryo fibroblasts to tumour promoters. Nature 318(6045): p. 472-5.
123.
Pozzatti, R., et al., (1986). Primary rat embryo cells transformed by one or two oncogenes
show different metastatic potentials. Science 232(4747): p. 223-7.
124.
Spandidos, D.A. and N.M. Wilkie, (1984). Malignant transformation of early passage
rodent cells by a single mutated human oncogene. Nature 310(5977): p. 469-75.
125.
Yuspa, S.H., (1994). The pathogenesis of squamous cell cancer: lessons learned from
studies of skin carcinogenesis--thirty-third G. H. A. Clowes Memorial Award Lecture.
Cancer Res 54(5): p. 1178-89.
126.
Hennings, H., et al., (1993). Critical aspects of initiation, promotion, and progression in
multistage epidermal carcinogenesis. Proc Soc Exp Biol Med 202(1): p. 1-8.
127.
Brown, K., et al., (1986). v-ras genes from Harvey and BALB murine sarcoma viruses
can act as initiators of two-stage mouse skin carcinogenesis. Cell 46(3): p. 447-56.
128.
Roop, D.R., et al., (1986). An activated Harvey ras oncogene produces benign tumours on
mouse epidermal tissue. Nature 323(6091): p. 822-4.
129.
Bailleul, B., et al., (1990). Skin hyperkeratosis and papilloma formation in transgenic mice
expressing a ras oncogene from a suprabasal keratin promoter. Cell 62(4): p. 697-708.
130.
Bremner, R. and A. Balmain, (1990). Genetic changes in skin tumor progression:
correlation between presence of a mutant ras gene and loss of heterozygosity on mouse
chromosome 7. Cell 61(3): p. 407-17.
131.
Saez, E., et al., (1995). c-fos is required for malignant progression of skin tumors. Cell
82(5): p. 721-732.
132.
Fearon, E.R. and B. Vogelstein, (1990). A genetic model for colorectal tumorigenesis. Cell
61(5): p. 759-67.
133.
Powell, S.M., et al., (1992). APC mutations occur early during colorectal tumorigenesis.
Nature 359(6392): p. 235-7.
134.
Vogelstein, B. and K.W. Kinzler, (1993). The multistep nature of cancer. Trends Genet
9(4): p. 138-41.
65
135.
Jen, J., et al., (1994). Molecular determinants of dysplasia in colorectal lesions. Cancer Res
54(21): p. 5523-5526.
136.
Yokota, J., et al., (1986). Alterations of myc, myb, and rasHa proto-oncogenes in cancers
are frequent and show clinical correlation. Science 231(4735): p. 261-5.
137.
Cohen, J.B. and A.D. Levinson, (1988). A point mutation in the last intron responsible for
increased expression and transforming activity of the c-Ha-ras oncogene. Nature
334(6178): p. 119-24.
138.
Chen, B., et al., (1994). The second intron of the K-ras gene contains regulatory elements
associated with mouse lung tumor susceptibility. Proc Natl Acad Sci U S A 91(4):
p. 1589-93.
139.
Westaway, D., et al., (1986). Identification of a provirally activated c-Ha-ras oncogene in
an avian nephroblastoma via a novel procedure: cDNA cloning of a chimaeric viral- host
transcript. Embo J 5(2): p. 301-9.
140.
George, D.L., et al., (1986). Enhanced c-Ki-ras expression associated with Friend virus
integration in a bone marrow-derived mouse cell line. Proc Natl Acad Sci U S A 83(6):
p. 1651-5.
141.
Chang, E.H., et al., (1982). Tumorigenic transformation of mammalian cells induced by a
normal human gene homologous to the oncogene of Harvey murine sarcoma virus. Nature
297(5866): p. 479-83.
142.
McKay, I.A., et al., (1986). Transformation and stimulation of DNA synthesis in NIH3T3 cells are a titratable function of normal p21N-ras expression. Embo J 5(10): p. 261721.
143.
Pulciani, S., et al., (1985). ras gene Amplification and malignant transformation. Mol Cell
Biol 5(10): p. 2836-41.
144.
Finney, R.E. and J.M. Bishop, (1993). Predisposition to neoplastic transformation caused
by gene replacement of H-rasl. Science 260(5113): p. 1524-7.
145.
Boguski, M.S. and F. McCormick, (1993). Proteins regulating Ras and its relatives. Nature
366(6456): p. 643-54.
146.
Downward, J., (1992). Regulation of p21ras by GTPase activating proteins and guanine
nucleotide exchange proteins. Curr Opin Genet Dev 2(1): p. 13-8.
147.
Downward, J., (1992). Regulatory mechanisms for ras proteins. Bioessays 14(3): p. 17784.
148.
Broek, D., et al., (1987). The S. cerevisiae CDC25 gene product regulates the
RAS/adenylate cyclase pathway. Cell 48(5): p. 789-99.
66
149.
Boy-Marcotte, E., et al., (1989). The C-terminal part of a gene partially homologous to
CDC25 gene suppresses the cdc25-5 mutation in Saccharomyces cerevisiae. Gene 77(1):
p. 21-30.
150.
Crechet, J.B., et al., (1990). Enhancement of the GDP-GTP exchange of RAS proteins by
the carboxyl- terminal domain of SCD25 [see comments]. Science 248(4957): p. 866-8.
151.
Jones, S., M.L. Vignais, and J.R. Broach, (1991). The CDC25 protein of Saccharomyces
cerevisiae promotes exchange of guanine nucleotides bound to ras. Mol Cell Biol 11(5):
p. 2641-6.
152.
Damak, F., et al., (1991). SDC25, a CDC25-like gene which contains a RAS-activating
domain and is a dispensable gene of Saccharomyces cerevisiae. Mol Cell Biol 11(1):
p. 202-12.
153.
Hughes, D.A., Y. Fukui, and M. Yamamoto, (1990). Homologous activators of ras in
fission and budding yeast. Nature 344(6264): p. 355-7.
154.
Bonfini, L., et al., (1992). The Son of sevenless gene product: a putative activator of Ras.
Science 255(5044): p. 603-6.
155.
Shou, C., et al., (1992). Molecular cloning of cDNAs encoding a guanine-nucleotidereleasing factor for Ras p21 [see comments]. Nature 358(6384): p. 351-4.
156.
Wei, W., et al., (1992). Identification of a mammalian gene structurally and functionally
related to the CDC25 gene of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A
89(15): p. 7100-4.
157.
Martegani, E., et al., (1992). Cloning by functional complementation of a mouse cDNA
encoding a homologue of CDC25, a Saccharomyces cerevisiae RAS activator. Embo J
11(6): p. 2151-7.
158.
Cen, H., et al., (1992). Isolation of multiple mouse cDNAs with coding homology to
Saccharomyces cerevisiae CDC25: identification of a region related to Bcr, Vav, Dbl and
CDC24. Embo J 11(11): p. 4007-15.
159.
Chardin, P., et al., (1993). Human Sosl: a guanine nucleotide exchange factor for Ras that
binds to GRB2. Science 260(5112): p. 1338-43.
160.
Bowtell, D., et al., (1992). Identification of murine homologues of the Drosophila son of
sevenless gene: potential activators of ras. Proc Natl Acad Sci U S A 89(14): p. 6511-5.
161.
Ridley, A.J., (1995). Rho-related proteins: actin cytoskeleton and cell cycle. Curr Opin
Genet Dev 5(1): p. 24-30.
162.
Katzav, S., Z.D. Martin, and M. Barbacid, (1989). vav, a novel human oncogene derived
from a locus ubiquitously expressed in hematopoietic cells. Embo J 8(8): p. 2283-90.
67
163.
Eva, A. and S.A. Aaronson, (1985). Isolation of a new human oncogene from a diffuse Bcell lymphoma. Nature 316(6025): p. 273-5.
164.
Habets, G.G., et al., (1994). Identification of an invasion-inducing gene, Tiam-1, that
encodes a protein with homology to GDP-GTP exchangers for Rho-like proteins. Cell
77(4): p. 537-49.
165.
Hart, M.J., et al., (1991). Catalysis of guanine nucleotide exchange on the CDC42Hs
protein by the dbl oncogene product. Nature 354(6351): p. 311-4.
166.
Michiels, F., et al., (1995). A role for Rac in Tiaml-induced membrane ruffling and
invasion. Nature 375(6529): p. 338-340.
167.
Gulbins, E., et al., (1993). Tyrosine kinase-stimulated guanine nucleotide exchange activity
of Vav in T cell activation [see comments]. Science 260(5109): p. 822-5.
168.
Gulbins, E., et al., (1994). Activation of Ras in vitro and in intact fibroblasts by the Vav
guanine nucleotide exchange protein. Mol Cell Biol 14(2): p. 906-13.
169.
Orita, S., et al., (1993). Comparison of kinetic properties between two mammalian ras p2 1
GDP/GTP exchange proteins, ras guanine nucleotide-releasing factor and smg GDP
dissociation stimulation. J Biol Chem 268(34): p. 25542-6.
170.
Kaibuchi, K., et al., (1991). Molecular cloning of the cDNA for stimulatory GDP/GTP
exchange protein for smg p2 1s (ras p21-like small GTP-binding proteins) and
characterization of stimulatory GDP/GTP exchange protein. Mol Cell Biol 11(5): p. 287380.
171.
Mizuno, T., et al., (1991). A stimulatory GDP/GTP exchange protein for smg p21 is active
on the post-translationally processed form of c-Ki-ras p21 and rhoA p21. Proc Natl Acad
Sci U S A 88(15): p. 6442-6.
172.
Hiroyoshi, M., et al., (1991). Role of the C-terminal region of smg p21, a ras p21-like
small GTP- binding protein, in membrane and smg p21 GDP/GTP exchange protein
interactions. J Biol Chem 266(5): p. 2962-9.
173.
Hata, Y., et al., (1991). Enhancement of the actions of smg p21 GDP/GTP exchange
protein by the protein kinase A-catalyzed phosphorylation of smg p21. J Biol Chem
266(10): p. 6571-7.
174.
Nakanishi, H., et al., (1994). Different functions of Smg GDP dissociation stimulator and
mammalian counterpart of yeast Cdc25. J. Biol. Chem. 269(21): p. 15085-91.
175.
Trahey, M., et al., (1988). Molecular cloning of two types of GAP complementary DNA
from human placenta. Science 242(4886): p. 1697-700.
176.
Vogel, U.S., et al., (1988). Cloning of bovine GAP and its interaction with oncogenic ras
p21. Nature 335(6185): p. 90-3.
68
177.
Xu, G.F., et al., (1990). The neurofibromatosis type 1 gene encodes a protein related to
GAP. Cell 62(3): p. 599-608.
178.
Martin, G.A., et al., (1990). The GAP-related domain of the neurofibromatosis type 1 gene
product interacts with ras p21. Cell 63(4): p. 843-9.
179.
Ballester, R., et al., (1990). The NF1 locus encodes a protein functionally related to
mammalian GAP and yeast IRA proteins. Cell 63(4): p. 851-9.
180.
Cullen, P.J., et al., (1995). Identification of a specific Ins(1,3,4,5)P4-binding protein as a
member of the GAP1 family. Nature 376(6540): p. 527-530.
181.
Maekawa, M., et al., (1994). A novel mammalian Ras GTPase-activating protein which
has phospholipid- binding and Btk homology regions. Mol Cell Biol 14(10): p. 68796885.
182.
Trahey, M., et al., (1987). Biochemical and biological properties of the human N-ras p2 1
protein. Mol Cell Biol 7(1): p. 541-4.
183.
Halenbeck, R., et al., (1990). Purification, characterization, and western blot analysis of
human GTPase-activating protein from native and recombinant sources. J Biol Chem
265(35): p. 21922-8.
184.
Cales, C., et al., (1988). The cytoplasmic protein GAP is implicated as the target for
regulation by the ras gene product. Nature 332(6164): p. 548-51.
185.
Adari, H., et al., (1988). Guanosine triphosphatase activating protein (GAP) interacts with
the p21 ras effector binding domain. Science 240(4851): p. 518-21.
186.
Pawson, T. and G.D. Gish, (1992). SH2 and SH3 domains: from structure to function.
Cell 71(3): p. 359-62.
187.
Cohen, G.B., R. Ren, and D. Baltimore, (1995). Modular binding domains in signal
transduction proteins. Cell 80(2): p. 237-248.
188.
Gibson, T.J., et al., (1994). PH domain: the first anniversary. Trends Biochem Sci 19(9):
p. 349-353.
189.
Musacchio, A., et al., (1993). The PH domain: a common piece in the structural patchwork
of signalling proteins. Trends Biochem Sci 18(9): p. 343-8.
190.
Viskochil, D., R. White, and R. Cawthon, (1993). The neurofibromatosis type 1 gene.
Annu Rev Neurosci : p. 183-205.
191.
Andersen, L.B., et al., (1993). A conserved alternative splice in the von Recklinghausen
neurofibromatosis (NF1) gene produces two neurofibromin isoforms, both of which have
GTPase-activating protein activity. Mol Cell Biol 13(1): p. 487-95.
69
192.
Buchberg, A.M., et al., (1990). Sequence homology shared by neurofibromatosis type-1
gene and IRA-1 and IRA-2 negative regulators of the RAS cyclic AMP pathway [see
comments]. Nature 347(6290): p. 291-4.
193.
Xu, G.F., et al., (1990). The catalytic domain of the neurofibromatosis type 1 gene product
stimulates ras GTPase and complements ira mutants of S. cerevisiae. Cell 63(4): p. 83541.
194.
Bollag, G. and F. McCormick, (1991). Differential regulation of rasGAP and
neurofibromatosis gene product activities. Nature 351(6327): p. 576-9.
195.
Zhang, K., et al., (1990). Suppression of c-ras transformation by GTPase-activating
protein [see comments]. Nature 346(6286): p. 754-6.
196.
DeClue, J.E., et al., (1992). Abnormal regulation of mammalian p2 1ras contributes to
malignant tumor growth in von Recklinghausen (type 1) neurofibromatosis. Cell 69(2):
p. 265-73.
197.
Basu, T.N., et al., (1992). Aberrant regulation of ras proteins in malignant tumour cells
from type 1 neurofibromatosis patients [see comments]. Nature 356(6371): p. 713-5.
198.
Kim, H.A., et al., (1995). Schwann cells from neurofibromin deficient mice exhibit
activation of p2lras, inhibition of cell proliferation and morphological changes. Oncogene
11(2): p. 325-335.
199.
Henkemeyer, M., et al., (1995). Vascular system defects and neuronal apoptosis in mice
lacking ras GTPase-activating protein. Nature 377(6551): p. 695-701.
200.
Largaespada, D.A., et al., (1996). Nfl deficiency causes Ras-mediated
granulocyte/macrophage colony stimulating factor hypersensitivity and chronic myeloid
leukaemia. Nature Genet 12(2): p. 137-143.
201.
Bollag, G., et al., (1996). Loss of NF1 results in activation of the Ras signaling pathway
and leads to aberrant growth in haematopoietic cells. Nature Genet 12(2): p. 144-148.
202.
McCormick, F., (1989). ras GTPase activating protein: signal transmitter and signal
terminator. Cell 56(1): p. 5-8.
203.
McCormick, F., (1990). The world according to GAP. Oncogene 5(9): p. 1281-3.
204.
Kitayama, H., et al., (1989). A ras-related gene with transformation suppressor activity.
Cell 56(1): p. 77-84.
205.
Beranger, F., et al., (1991). Association of the Ras-antagonistic Rapl/Krev- 1 proteins with
the Golgi complex. Proc Natl Acad Sci U S A 88(5): p. 1606-10.
206.
Frech, M., et al., (1990). Inhibition of GTPase activating protein stimulation of Ras-p21
GTPase by the Krev-1 gene product. Science 249(4965): p. 169-71.
70
207.
Hata, Y., et al., (1990). Inhibition of the ras p21 GTPase-activating protein-stimulated
GTPase activity of c-Ha-ras p21 by smg p21 having the same putative effector domain as
ras p21s. J Biol Chem 265(13): p. 7104-7.
208.
McCormick, F., (1994). Raf: the holy grail of Ras biology. Trends Cell Biol 4: p. 347-50.
209.
Yatani, A., et al., (1990). ras p21 and GAP inhibit coupling of muscarinic receptors to
atrial K+ channels. Cell 61(5): p. 769-76.
210.
Martin, G.A., et al., (1992). GAP domains responsible for ras p21-dependent inhibition of
muscarinic atrial K+ channel currents [see comments]. Science 255(5041): p. 192-4.
211.
Ellis, C., et al., (1990). Phosphorylation of GAP and GAP-associated proteins by
transforming and mitogenic tyrosine kinases. Nature 343(6256): p. 377-81.
212.
Moran, M.F., et al., (1991). Protein-tyrosine kinases regulate the phosphorylation, protein
interactions, subcellular distribution, and activity of p2lras GTPase- activating protein. Mol
Cell Biol 11(4): p. 1804-12.
213.
Settleman, J., et al., (1992). Molecular cloning of cDNAs encoding the GAP-associated
protein p190: implications for a signaling pathway from ras to the nucleus. Cell 69(3):
p. 539-49.
214.
Settleman, J., et al., (1992). Association between GTPase activators for Rho and Ras
families. Nature 359(6391): p. 153-4.
215.
McGlade, J., et al., (1993). The N-terminal region of GAP regulates cytoskeletal structure
and cell adhesion. Embo J 12(8): p. 3073-81.
216.
Wong, G., et al., (1992). Molecular cloning and nucleic acid binding properties of the
GAP- associated tyrosine phosphoprotein p62. Cell 69(3): p. 551-8.
217.
Lock, P., et al., (1996). The human p62 cDNA encodes Sam68 and not the RasGAPassociated p62 protein. Cell 84(1): p. 23-24.
218.
Duchesne, M., et al., (1993). Identification of the SH3 domain of GAP as an essential
sequence for Ras-GAP-mediated signaling. Science 259(5094): p. 525-8.
219.
Medema, R.H., et al., (1992). GTPase-activating protein SH2-SH3 domains induce gene
expression in a Ras-dependent fashion. Mol Cell Biol 12(8): p. 3425-30.
220.
Schweighoffer, F., et al., (1992). Implication of GAP in Ras-dependent transactivation of a
polyoma enhancer sequence. Science 256(5058): p. 825-7.
221.
Clark, G.J., et al., (1993). Differential antagonism of Ras biological activity by catalytic
and Src homology domains of Ras GTPase activation protein. Proc Natl Acad Sci U S A
90(11): p. 4887-91.
71
222.
Bollag, G., F. McCormick, and R. Clark, (1993). Characterization of full-length
neurofibromin: tubulin inhibits Ras GAP activity. Embo J 12(5): p. 1923-7.
223.
Takai, Y., et al., (1995). Effects of prenyl modifications on interactions of small G proteins
with regulators. Methods Enzymol 250(122): p. 122-133.
224.
Isomura, M., et al., (1991). Regulation of binding of rhoB p20 to membranes by its
specific regulatory protein, GDP dissociation inhibitor. Oncogene 6(1): p. 119-24.
225.
Hori, Y., et al., (1991). Post-translational modifications of the C-terminal region of the rho
protein are important for its interaction with membranes and the stimulatory and inhibitory
GDP/GTP exchange proteins. Oncogene 6(4): p. 515-22.
226.
Araki, S., et al., (1991). Role of the C-terminal region of smg p25A in its interaction with
membranes and the GDP/GTP exchange protein. Mol Cell Biol 11(3): p. 1438-47.
227.
Li, Y., et al., (1992). Somatic mutations in the neurofibromatosis 1 gene in human tumors.
Cell 69(2): p. 275-81.
228.
Jacks, T., et al., (1994). Tumour predisposition in mice heterozygous for a targeted
mutation in Nfl. Nat Genet 7(3): p. 353-361.
229.
Chevallier, M.M., et al., (1993). Saccharomyces cerevisiae CDC25 (1028-1589) is a
guanine nucleotide releasing factor for mammalian ras proteins and is oncogenic in
NIH3T3 cells. J Biol Chem 268(15): p. 11113-8.
230.
Barlat, I., et al., (1993). The Saccharomyces cerevisiae gene product SDC25 C-domain
functions as an oncoprotein in NIH3T3 cells. Oncogene 8(1): p. 215-8.
231.
Egan, S.E., et al., (1993). Association of Sos Ras exchange protein with Grb2 is
implicated in tyrosine kinase signal transduction and transformation [see comments].
Nature 363(6424): p. 45-51.
232.
Fujioka, H., et al., (1992). Transforming and c-fos promoter/enhancer-stimulating
activities of a stimulatory GDP/GTP exchange protein for small GTP-binding proteins. J
Biol Chem 267(2): p. 926-30.
233.
McCormick, F., (1993). Signal transduction. How receptors turn Ras on [news;
comment]. Nature 363(6424): p. 15-6.
234.
Feig, L.A., (1993). The many roads that lead to Ras [comment]. Science 260(5109): p.
767-8.
235.
Treisman, R., (1996). Regulation of transcription by MAP kinase cascades. Curr Opin Cell
Biol 8: p. 205-215.
236.
Daum, G., et al., (1994). The ins and outs of Raf kinases. Trends Biochem. Sci. 19(11): p.
474-480.
72
237.
Downward, J., et al., (1990). Stimulation of p2lras upon T-cell activation [see comments].
Nature 346(6286): p. 719-23.
238.
Torti, M., et al., (1992). Erythropoietin induces p21ras activation and pl20GAP tyrosine
phosphorylation in human erythroleukemia cells. J Biol Chem 267(12): p. 8293-8.
239.
Medema, R.H., et al., (1993). Ras activation by insulin and epidermal growth factor
through enhanced exchange of guanine nucleotides on p21ras. Mol Cell Biol 13(1): p. 15562.
240.
Li, B.Q., et al., (1992). Nerve growth factor stimulation of the Ras-guanine nucleotide
exchange factor and GAP activities. Science 256(5062): p. 1456-9.
241.
Tsai, M.H., C.L. Yu, and D.W. Stacey, (1990). A cytoplasmic protein inhibits the GTPase
activity of H-Ras in a phospholipid-dependent manner. Science 250(4983): p. 982-5.
242.
Tsai, M.H., et al., (1989). The effect of GTPase activating protein upon ras is inhibited by
mitogenically responsive lipids. Science 243(4890): p. 522-6.
243.
Yu, C.L., M.H. Tsai, and D.W. Stacey, (1990). Serum stimulation of NIH 3T3 cells
induces the production of lipids able to inhibit GTPase-activating protein activity. Mol Cell
Biol 10(12): p. 6683-9.
244.
Serth, J., et al., (1991). The inhibition of the GTPase activating protein-Ha-ras interaction
by acidic lipids is due to physical association of the C-terminal domain of the GTPase
activating protein with micellar structures. Embo J 10(6): p. 1325-30.
245.
Buday, L., P.H. Warne, and J. Downward, (1995). Downregulation of the Ras activation
pathway by MAP kinase phosphorylation of Sos. Oncogene 11(7): p. 1327-1331.
246.
de, V., et al., (1995). Shc associates with an unphosphorylated form of the p21ras guanine
nucleotide exchange factor mSOS. Oncogene 10(5): p. 919-25.
247.
Egan, S.E. and R.A. Weinberg, (1993). The pathway to signal achievement [news]. Nature
365(6449): p. 781-3.
248.
Clark, S.G., M.J. Stem, and H.R. Horvitz, (1992). C. elegans cell-signalling gene sem-5
encodes a protein with SH2 and SH3 domains [see comments]. Nature 356(6367): p. 3404.
249.
Lowenstein, E.J., et al., (1992). The SH2 and SH3 domain-containing protein GRB2 links
receptor tyrosine kinases to ras signaling. Cell 70(3): p. 431-42.
250.
Simon, M.A., G.S. Dodson, and G.M. Rubin, (1993). An SH3-SH2-SH3 protein is
required for p21Rasl activation and binds to sevenless and Sos proteins in vitro. Cell
73(1): p. 169-77.
73
251.
Rozakis, A.M., et al., (1992). Association of the Shc and Grb2/Sem5 SH2-containing
proteins is implicated in activation of the Ras pathway by tyrosine kinases. Nature
360(6405): p. 689-92.
252.
Rozakis, A.M., et al., (1993). The SH2 and SH3 domains of mammalian Grb2 couple the
EGF receptor to the Ras activator mSosl [see comments]. Nature 363(6424): p. 83-5.
253.
Olivier, J.P., et al., (1993). A Drosophila SH2-SH3 adaptor protein implicated in coupling
the sevenless tyrosine kinase to an activator of Ras guanine nucleotide exchange, Sos. Cell
73(1): p. 179-91.
254.
Li, N., et al., (1993). Guanine-nucleotide-releasing factor hSosl binds to Grb2 and links
receptor tyrosine kinases to Ras signalling [see comments]. Nature 363(6424): p. 85-8.
255.
Gale, N.W., et al., (1993). Grb2 mediates the EGF-dependent activation of guanine
nucleotide exchange on Ras [see comments]. Nature 363(6424): p. 88-92.
256.
Buday, L. and J. Downward, (1993). Epidermal growth factor regulates p21ras through
the formation of a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange
factor. Cell 73(3): p. 611-20.
257.
Pelicci, G., et al., (1992). A novel transforming protein (SHC) with an SH2 domain is
implicated in mitogenic signal transduction. Cell 70(1): p. 93-104.
258.
McGlade, J., et al., (1992). Shc proteins are phosphorylated and regulated by the v-Src and
v-Fps protein-tyrosine kinases. Proc Natl Acad Sci U S A 89(19): p. 8869-73.
259.
Roberts, T.M., (1992). Cell biology. A signal chain of events [news; comment]. Nature
360(6404): p. 534-5.
260.
Morrison, D.K., et al., (1988). Signal transduction from membrane to cytoplasm: growth
factors and membrane-bound oncogene products increase Raf-1 phosphorylation and
associated protein kinase activity. Proc Natl Acad Sci U S A 85(23): p. 8855-9.
261.
Heidecker, G., et al., (1992). The role of Raf-1 phosphorylation in signal transduction. Adv
Cancer Res : p. 53-73.
262.
Wood, K.W., et al., (1992). ras mediates nerve growth factor receptor modulation of three
signal- transducing protein kinases: MAP kinase, Raf- 1, and RSK. Cell 68(6): p. 1041-50.
263.
Han, M., et al., (1993). C. elegans lin-45 raf gene participates in let-60 ras-stimulated
vulval differentiation. Nature 363(6425): p. 133-40.
264.
Dickson, B., et al., (1992). Raf functions downstream of Rasl in the Sevenless signal
transduction pathway [see comments]. Nature 360(6404): p. 600-3.
265.
Moodie, S.A., et al., (1993). Complexes of Ras.GTP with Raf-1 and mitogen-activated
protein kinase kinase [see comments]. Science 260(5114): p. 1658-61.
74
266.
Warne, P.H., P.R. Viciana, and J. Downward, (1993). Direct interaction of Ras and the
amino-terminal region of Raf-1 in vitro. Nature 364(6435): p. 352-5.
267.
Fields, S. and 0. Song, (1989). A novel genetic system to detect protein-protein
interactions. Nature 340(6230): p. 245-6.
268.
Van, A.L., et al., (1993). Complex formation between RAS and RAF and other protein
kinases. Proc Natl Acad Sci U S A 90(13): p. 6213-7.
269.
Vojtek, A.B., S.M. Hollenberg, and J.A. Cooper, (1993). Mammalian Ras interacts
directly with the serine/threonine kinase Raf. Cell 74(1): p. 205-14.
270.
Zhang, X.F., et al., (1993). Normal and oncogenic p21ras proteins bind to the aminoterminal regulatory domain of c-Raf-1. Nature 364(6435): p. 308-13.
271.
Cook, S.J., et al., (1993). RapV12 antagonizes Ras-dependent activation of ERK1 and
ERK2 by LPA and EGF in Rat-1 fibroblasts. Embo J 12(9): p. 3475-85.
272.
Wu, J., et al., (1993). Inhibition of the EGF-activated MAP kinase signaling pathway by
adenosine 3',5'-monophosphate [see comments]. Science 262(5136): p. 1065-9.
273.
Cook, S.J. and F. McCormick, (1993). Inhibition by cAMP of Ras-dependent activation of
Raf [see comments]. Science 262(5136): p. 1069-72.
274.
Williams, N.G., T.M. Roberts, and P. Li, (1992). Both p2lras and pp60v-src are required,
but neither alone is sufficient, to activate the Raf-1 kinase. Proc Natl Acad Sci U S A 89(7):
p. 2922-6.
275.
Kikuchi, A. and L.T. Williams, (1994). The post-translational modification of ras p2 1 is
important for Raf-1 activation. J Biol Chem 269(31): p. 20054-20059.
276.
Fabian, J.R., .LO.Daar, and D.K. Morrison, (1993). Critical tyrosine residues regulate the
enzymatic and biological activity of Raf-1 kinase. Mol Cell Biol 13(11): p. 7170-9.
277.
Rapp, U.R., (1991). Role of Raf-1 serine/threonine protein kinase in growth factor signal
transduction. Oncogene 6(4): p. 495-500.
278.
Stokoe, D., et al., (1994). Activation of Raf as a result of recruitment to the plasma
membrane [see comments]. Science 264(5164): p. 1463-7.
279.
Leevers, S.J., H.F. Paterson, and C.J. Marshall, (1994). Requirement for Ras in Raf
activation is overcome by targeting Raf to the plasma membrane. Nature 369(6479):
p. 411-4.
280.
Marais, R., et al., (1995). Ras recruits Raf-1 to the plasma membrane for activation by
tyrosine phosphorylation. Embo J 14(13): p. 3136-3145.
281.
Marshall, C.J., (1994). MAP kinase kinase kinase, MAP kinase kinase and MAP kinase.
Curr. Opin. Genet. Dev. 4(1): p. 82-89.
75
282.
Davis, R.J., (1994). MAPKs: new JNK expands the group. Trends Biochem Sci 19(11):
p. 470-473.
283.
Xia, Z., et al., (1995). Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science 270(5240): p. 1326-1331.
284.
Stokoe, D., et al., (1992). MAPKAP kinase-2; a novel protein kinase activated by
mitogen-activated protein kinase. Embo J 11(11): p. 3985-94.
285.
Lamarche, N. and A. Hall, (1994). GAPs for rho-related GTPases. Trends Genet 10(12):
p. 436-40.
286.
Symon, M., et al., (1996). Wiskott-aldrich syndrome protein, a novel effector for the
GTPase CDC42Hs, is implicated in actin polymerization. Cell 84: p. 723-734.
287.
Watanabe, G., et al., (1996). Protein kinase N (PKN) and PKN-related protein rhophilin as
targets of small GTPase Rho. Science 271(5249): p. 645-648.
288.
Amano, M., et al., (1996). Identification of a putative target for Rho as the serine-threonine
kinase protein kinase N. Science 271(5249): p. 648-650.
289.
Diekmann, D., et al., (1994). Interaction of Rac with p67phox and regulation of phagocytic
NADPH oxidase activity. Science 265(5171): p. 531-3.
290.
Martin, G.A., et al., (1995). A novel serine kinase activated by racl/CDC42Hs-dependent
autophosphorylation is related to PAK65 and STE20. Embo J 14(17): p. 4385.
291.
Chardin, P., et al., (1989). The mammalian G protein rhoC is ADP-ribosylated by
Clostridium botulinum exoenzyme C3 and affects actin microfilaments in Vero cells.
Embo J 8(4): p. 1087-92.
292.
Paterson, H.F., et al., (1990). Microinjection of recombinant p2lrho induces rapid changes
in cell morphology. J Cell Biol 111(3): p. 1001-7.
293.
Ridley, A.J. and A. Hall, (1992). The small GTP-binding protein rho regulates the
assembly of focal adhesions and actin stress fibers in response to growth factors. Cell
70(3): p. 389-99.
294.
Ridley, A.J., et al., (1992). The small GTP-binding protein rac regulates growth factorinduced membrane ruffling. Cell 70(3): p. 401-10.
295.
Nobes, C.D. and A. Hall, (1995). Rho, rac, and cdc42 GTPases regulate the assembly of
multimolecular focal complexes associated with actin stress fibers, lamellipodia, and
filopodia. Cell 81(1): p. 53-62.
296.
Chant, J. and L. Stowers, (1995). GTPase cascades choreographing cellular behavior:
movement, morphogenesis, and more. Cell 81(1): p. 1-4.
76
297.
Khosravi, F.R., et al., (1994). Dbl and Vav mediate transformation via mitogen-activated
protein kinase pathways that are distinct from those activated by oncogenic Ras. Mol. Cell.
Biol. 14(10): p. 6848-57.
298.
Minden, A., et al., (1995). Selective activation of the JNK signaling cascade and c-Jun
transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell 81(7): p. 1147-1157.
299.
Coso, O.A., et al., (1995). The small GTP-binding proteins Rac 1 and Cdc42 regulate the
activity of the JNK/SAPK signaling pathway. Cell 81(7): p. 1137-1146.
300.
Herskowitz, I., (1995). MAP kinase pathways in yeast: for mating and more. Cell 80(2): p.
187-197.
301.
Hill, C.S., J. Wynne, and R. Treisman, (1995). The Rho family GTPases RhoA, Racl, and
CDC42Hs regulate transcriptional activation by SRF. Cell 81(7): p. 1159-1170.
302.
Treisman, R., (1994). Ternary complex factors: growth factor regulated transcriptional
activators. Curr Opin Genet Dev 4(1): p. 96-101.
303.
Gille, H., A.D. Sharrocks, and P.E. Shaw, (1992). Phosphorylation of transcription factor
p62TCF by MAP kinase stimulates ternary complex formation at c-fos promoter. Nature
358(6385): p. 414-7.
304.
Gille, H., et al., (1995). ERK phosphorylation potentiates Elk- -mediated ternary complex
formation and transactivation. Embo J 14(5): p. 951-962.
305.
Downward, J., (1995). KSR: a novel player in the RAS pathway [comment]. Cell 83(6):
p. 831-834.
306.
Sundaram, M. and M. Han, (1995). The C. elegans ksr-1 gene encodes a novel Raf-related
kinase involved in Ras-mediated signal transduction. Cell 83(6): p. 889-901.
307.
Kornfeld, K., D.B. Hom, and H.R. Horvitz, (1995). The ksr-1 gene encodes a novel
protein kinase involved in Ras-mediated signaling in C. elegans. Cell 83(6): p. 903-913.
308.
Therrien, M., et al., (1995). KSR, a novel protein kinase required for RAS signal
transduction. Cell 83(6): p. 879-888.
309.
Kumagai, N., et al., (1993). ADP-ribosylation of rho p21 inhibits lysophosphatidic acidinduced protein tyrosine phosphorylation and phosphatidylinositol 3-kinase activation in
cultured Swiss 3T3 cells. J Biol Chem 268(33): p. 24535-8.
310.
Zhang, J., et al., (1993). Activation of platelet phosphatidylinositide 3-kinase requires the
small GTP-binding protein Rho. J Biol Chem 268(30): p. 22251-4.
311.
Malcolm, K.C., et al., (1994). Activation of rat liver phospholipase D by the small GTPbinding protein RhoA. J. Biol. Chem. 269(42): p. 25951-4.
77
312.
Chong, L.D., et al., (1994). The small GTP-binding protein Rho regulates a
phosphatidylinositol 4- phosphate 5-kinase in mammalian cells. Cell 79(3): p. 507-13.
313.
Jackson, J.H., et al., (1990). Farnesol modification of Kirsten-ras exon 4B protein is
essential for transformation. Proc Natl Acad Sci U S A 87(8): p. 3042-6.
314.
Gibbs, J.B., A. Oliff, and N.E. Kohl, (1994). Farnesyltransferase inhibitors: Ras research
yields a potential cancer therapeutic. Cell 77(2): p. 175-8.
315.
Hancock, J.F., (1993). Anti-Ras drugs come of age. Curr Biol 3(11): p. 770-772.
316.
Glomset, J.A., M.H. Gelb, and C.C. Farnsworth, (1990). Prenyl proteins in eukaryotic
cells: a new type of membrane anchor. Trends Biochem Sci 15(4): p. 139-42.
317.
Maltese, W.A., (1990). Posttranslational modification of proteins by isoprenoids in
mammalian cells. Faseb J 4(15): p. 3319-28.
318.
Tamanoi, F., (1993). Inhibitors of Ras farnesyltransferases. Trends Biochem. Sci. 18(9):
p. 349-353.
319.
Garcia, A.M., et al., (1993). Peptidomimetic inhibitors of Ras farnesylation and function in
whole cells. J Biol Chem 268(25): p. 18415-8.
320.
James, G.L., et al., (1993). Benzodiazepine peptidomimetics: potent inhibitors of Ras
farnesylation in animal cells [see comments]. Science 260(5116): p. 1937-42.
321.
Kohl, N.E., et al., (1993). Selective inhibition of ras-dependent transformation by a
farnesyltransferase inhibitor [see comments]. Science 260(5116): p. 1934-7.
322.
Nigam, M., et al., (1993). Potent inhibition of human tumor p2lras farnesyltransferase by
A1A2- lacking p21ras CA1A2X peptidomimetics. J Biol Chem 268(28): p. 20695-8.
323.
Kohl, N.E., et al., (1994). Protein farnesyltransferase inhibitors block the growth of rasdependent tumors in nude mice. Proc Natl Acad Sci U S A 91(19): p. 9141-9145.
324.
Kohl, N.E., et al., (1995). Inhibition of farnesyltransferase induces regression of
mammary and salivary carcinomas in ras transgenic mice. Nat Med 1(8): p. 792-797.
325.
Manne, V., et al., (1995). Bisubstrate inhibitors of farnesyltransferase: a novel class of
specific inhibitors of ras transformed cells. Oncogene 10(9): p. 1763-1779.
326.
Prendergast, G.C., et al., (1994). Farnesyltransferase inhibition causes morphological
reversion of ras- transformed cells by a complex mechanism that involves regulation of the
actin cytoskeleton. Mol Cell Biol 14(6): p. 4193-202.
327.
Cox, A.D., et al., (1994). The CAAX peptidomimetic compound B581 specifically blocks
farnesylated, but not geranylgeranylated or myristylated, oncogenic ras signaling and
transformation. J Biol Chem 269(30): p. 19203-19206.
78
328.
Stacey, D.W., et al., (1991). Dominant inhibitory Ras mutants demonstrate the
requirement for Ras activity in the action of tyrosine kinase oncogenes. Oncogene 6(12):
p. 2297-304.
329.
Stacey, D.W., L.A. Feig, and J.B. Gibbs, (1991). Dominant inhibitory Ras mutants
selectively inhibit the activity of either cellular or oncogenic Ras. Mol Cell Biol 11(8):
p. 4053-64.
330.
Reiss, Y., et al., (1990). Inhibition of purified p21ras farnesyl:protein transferase by CysAAX tetrapeptides. Cell 62(1): p. 81-8.
331.
Sun, J., et al., (1995). Ras CAAX peptidomimetic FTI 276 selectively blocks tumor
growth in nude mice of a human lung carcinoma with K-Ras mutation and p53 deletion.
Cancer Res 55(19): p. 4243-4247.
332.
Lerner, E.C., et al., (1995). Ras CAAX peptidomimetic FTI-277 selectively blocks
oncogenic Ras signaling by inducing cytoplasmic accumulation of inactive Ras-Raf
complexes. J Biol Chem 270(45): p. 26802-26806.
333.
Miyake, M., et al., (1996). Unfarnesylated transforming Ras mutant inhibits the Rassignaling pathway by forming a stable Ras.Raf complex in the cytosol. Febs Lett 378(1):
p. 15-18.
334.
Chan, A.M., et al., (1994). A human oncogene of the RAS superfamily unmasked by
expression cDNA cloning. Proc Natl Acad Sci U S A 91(16): p. 7558-7562.
335.
Drivas, G.T., et al., (1990). Characterization of four novel ras-like genes expressed in a
human teratocarcinoma cell line. Mol Cell Biol 10(4): p. 1793-8.
336.
Ulsh, L.S. and T.Y. Shih, (1984). Metabolic turnover of human c-rasH p21 protein of EJ
bladder carcinoma and its normal cellular and viral homologs. Mol Cell Biol 4(8): p. 1647-
52.
337.
Lebowitz, P.F., J.P. Davide, and G.C. Prendergast, (1995). Evidence that
farnesyltransferase inhibitors suppress Ras transformation by interfering with Rho activity.
Mol Cell Biol 15(12): p. 6613-6622.
79
Chapter 2
K-ras is an Essential Gene in Mouse Embryogenesis with
Partial Functional Overlap with N-ras
80
Abstract
Mammalian ras genes are critical in the regulation of cellular proliferation and differentiation and
are mutated in -30% of all human tumors. It has been demonstrated that N-ras and H-ras are
dispensable for mouse development. To characterize the normal role of K-ras in growth and
development, I have mutated it via gene targeting in the mouse. On an inbred genetic background,
embryos homozygous for this mutation die between 12 and 14 days of gestation, with fetal liver
defects and evidence of anemia. Thus, K-ras is the only member of the ras gene family essential
for mouse embryogenesis. I also demonstrate that multiple mutations within the ras gene family
can affect phenotype. Most animals lacking N-ras function and heterozygous for the K-ras
mutation exhibit abnormal hematopoietic development and die between days 10 and 12 of
embryogenesis.
Complete elimination of K-ras and N-ras function is compatible with
development through the blastocyst stage, but double mutant embryos do not develop to 9.5 days
of gestation. Thus, partial functional compensation appears to occur within the ras gene family,
but K-ras provides a unique and essential function.
81
Introduction
Over the past decade, a convergence of genetic and biochemical data from diverse systems has
supported a critical role for Ras-mediated signal transduction pathways in multiple aspects of
growth control and development (Satoh et al., 1992; Khosravi and Der, 1994; McCormick, 1994).
Through a combination of genetic studies in Drosophila melanogaster and Caenorhabditis
elegans and biochemical studies using mammalian cells, many of the components in the Ras
signaling cascade have been elucidated (Daum et al., 1994; Davis, 1994; Kayne and Sternberg,
1995; Wassarman et al., 1995; Duffy and Perrimon, 1996; Wittenberg and Reed, 1996). These
studies have revealed that many of the components responsible for transducing the extracellular
signals are shared by many receptor tyrosine kinases and are highly conserved throughout
evolution as well.
A variety of genetic, cell biological, and biochemical approaches have provided significant
insight into the ras family of proto-oncogenes and their role in normal growth and tumorigenesis.
Although it has been known for some time that Ras proteins function as molecular switches
regulated at the level of GDP/GTP binding (Barbacid, 1987; Bourne et al., 1990), only in the past
few years have many of the components in the Ras signaling cascade been identified, cloned, and
biochemically characterized. A critical equilibrium exists in the cell between inactive (GDPbound) and active (GTP-bound) Ras proteins, and the interconversion between these two forms is
regulated by the concerted action of guanine nucleotide exchange factors (GEFs) and GTPase
activating proteins (GAPs) following the appropriate extracellular stimuli (Bollag and McCormick,
1991; Downward, 1992b; Downward, 1992a; Boguski and McCormick, 1993). Many of the
oncogenic mutations in ras either reduce the rate of hydrolysis of GTP on Ras and its stimulation
by GAPs or increase the guanine nucleotide exchange rate, both leading to an accumulation of Ras
in the active, GTP-bound state.
In mammals there are three functional ras genes located on different chromosomes that
encode four highly homologous 21 kD proteins: H-, N-, K4A-, and K4B-ras (Barbacid, 1987).
82
The coding sequences of all three genes are distributed amongst four exons with precisely
corresponding splice junctions, suggesting a common origin from one ancestral gene. K-ras is
unique in that it possesses two alternative fourth coding exons, thereby allowing the synthesis of
two p21 isoforms which differ only in their carboxy terminal (C-terminal) residues (Capon et al.,
1983; McGrath et al., 1983; Shimizu et al., 1983). The first 86 amino acids of the mammalian
Ras proteins, which harbors the putative effector domain, are 100% identical. Only the C-termini
of these proteins differ significantly from one another in a region known as the hypervariable
domain.
Despite considerable progress in elucidating the signal transduction pathways involving
Ras, it is still not known what individual roles, if any, the different ras family members play.
Many observations suggest that these proteins possess overlapping functions. For example, all
three ras genes are expressed ubiquitously (Chesa et al., 1987; Furth et al., 1987; Leon et al.,
1987). All cell types analyzed, including those which are terminally differentiated and postmitotic, have been found to express the Ras proteins. In addition, certain tumor types (e.g.,
thyroid) show no absolute specificity for which ras family member is mutated (Bos, 1989;
Lemoine et al., 1989). Finally, it has been demonstrated in yeast as well as in mice that ras gene
function is dispensable. In S. cerevisiae, two RAS genes, RASI andRAS2, have been identified
(Powers et al., 1984). Strains carrying mutations in both genes are inviable, whereas inactivation
individually is compatible with growth (Kataoka et al., 1984). Importantly, mice homozygous null
for either N-ras (Umanoff et al., 1995) or H-ras (M. Katsuki, personal communication) are viable
and exhibit no overt abnormalities in development and post-natally.
However, several lines of evidence suggest the existence of unique roles for the three
mammalian ras genes. For example, despite ubiquitous ras expression, levels of ras mRNA
appear to be regulated both temporally and spatially, with certain tissues expressing one or more
members of the family preferentially (Muller et al., 1982; Muller et al., 1983; Leon et al., 1987).
K-ras and N-ras exhibit similar expression profiles. In addition, many tumor types exhibit
mutation of one member of the family more frequently than the other two (e.g., K-ras in colon,
83
lung, and pancreatic tumors; N-ras in myeloid disorders; and H-ras in skin and mammary
tumors), suggesting a unique oncogenic role for each of these genes in specific tissues (Bos,
1988b; Bos, 1988a; Bos, 1989). As mentioned above, K-ras is alternatively spliced at its last
coding exon, resulting in two isoforms with distinct C-termini, K-ras4A and 4B. K-ras4B, the
predominant isoform (Capon et al., 1983; George et al., 1985), is distinct from the other three Ras
proteins in the type of post-translational modifications that occur at the C-terminus (Hancock et al.,
1989; Hancock et al., 1990; James et al., 1995). This difference is believed to be responsible for
the specific association of K-ras4B with the GEF, Smg GDS (Mizuno et al., 1991; Orita et al.,
1993). Interestingly, this GEF not only catalyzes the exchange of bound GDP by GTP, but also
translocates small G proteins (as shown for K-ras4B and RaplB) from the membrane to the
cytoplasm (Kawamura et al., 1993; Nakanishi et al., 1994). Therefore, it is tempting to speculate
that this specific interaction and translocation may allow K-ras4B to associate with a distinct subset
of potential effector molecules not shared by the other Ras molecules.
Because activating ras mutations have been detected in up to 30% of all human tumors
analyzed (Barbacid, 1987; Bos, 1988a; Bos, 1989), considerable research has been directed
towards rational drug design aimed at selectively inhibiting Ras function in transformed cells
(Hancock, 1993; Gibbs et al., 1994). The efficacy of these drugs will depend, in part, on the
physiological consequences of the inhibition of Ras in normal cells, including whether the loss of
Ras function is compatible with cell viability. Gene targeting experiments have demonstrated that
neither N-ras nor H-ras function are essential in the mouse.
In contrast, microinjection
experiments suggest that Ras activity is required for mouse embryos to develop beyond the twocell stage (Yamauchi et al., 1994). Together, these data suggest that K-ras has a unique and
essential function or that some critical threshold level of overall Ras activity is required during
early embryogenesis. As a means of addressing these and related issues, I have generated mice
carrying a null allele of K-ras by gene targeting. In addition, I have crossed this mutation with the
N-ras null allele to examine possible genetic interactions between these two family members.
84
Results
Disruption of the Murine K-ras Gene
I targeted one allele of the murine K-ras gene in mouse embryonic stem (ES) cells using the
positive-negative selection method of Mansour et al. (Mansour et al., 1988). The K-ras targeting
vector was constructed by replacing exon 1 sequence with the bacterial neomycin gene (neo)
expression cassette as shown in Figure 2.1A. Loss of exon 1 sequences should result in a nonfunctional allele of K-ras as it contains a critical portion of the effector domain (George et al.,
1985; Willumsen et al., 1986). The herpes simplex virus thymidine kinase (HSV-tk) gene was
also placed downstream of the K-ras sequences in order to select against ES cells that had
randomly integrated the entire DNA targeting vector.
Following introduction of the K-ras targeting vector into 129/Sv D3 ES cells, the resulting
G418- and gancyclovir-resistant clones were screened by Southern blot analysis using a probe
located 3' to the sequences present in the targeting vector. This probe detects an 8.1 kilobase (kb)
StuI fragment from wild-type DNA and an additional 7.0 kb BamHI to StuI mutant-specific
fragment (Figure 2.1A and 2.1B). Eight out of 380 ES cell clones screened had acquired the
exogenous K-ras sequences by homologous recombination as detected by the 3' probe and were
therefore heterozygous for the mutation (K-ras+/-). Counter-selection by gancyclovir resulted in a
13-fold reduction in the number of ES cell colonies compared to G418 selection alone.
Further analysis using a 5' external probe revealed that 2 of these 8 clones had undergone
aberrant recombination at the 5' side (data not shown), and these were not used in the generation of
chimeras. Interestingly, Southern blot analysis on the K-ras+/ - clones using a probe derived from
neo sequences revealed that all 8 targeted clones contained an additional 6.9 kb band as well as the
expected 8.4 kb fragment in a Stul (Figure 2.1C). Extensive Southern blot and polymerase chain
reaction (PCR) analysis of these clones showed that the neo and 3' fragment of K-ras carried in the
targeting vector were duplicated in a head-to-tail fashion one or more times (data not shown). The
genomic configuration of K-ras mutant alleles is depicted in Figure 2.1A. These anomalous
85
Figure 2.1. Disruption of K-ras in ES cells.
(A) The K-ras targeting vector, pK-ras KO, was constructed by inserting fragments from intron 0
and intron 1 of the mouse K-ras gene into the plasmid pPNT. The regions of homology consist of
a 2.8 kb NotI-Sall fragment and a 5.1 kb HindIll-KpnI fragment. Both the pkg-neo and HSV-tk
cassettes were positioned such that they were transcribed in the same transcriptional orientation as
K-ras.
(B) Southern blot analysis of BamHI plus Stul-digested genomic DNA from ES cell clones using
a probe 3' to the region of homology (3' ext probe). Lanes 3, 4, 5, and 6 represent four
independent K-ras+l-ES cells clones, as they possess both an 8.1 kb wild-type (wt) allele and a
7.0 kb mutant-specific K-ras allele. The DNA in Lane 1 is from wt ES cells, Lane 2 from a nonhomologous integrant, and Lanes 7 and 8 represent two independent K-ras-1 - mutant ES cell
clones which were obtained following exposure to increasing concentrations of G418.
(C) Southern blot analysis of StuI-digested genomic DNA using a probe specific for neo. On a
parallel set of samples to (B), the neo probe detected the expected 8.4 kb StuI fragment, as well as
an additional 6.9 kb fragment in all K-ras+l- ES cell clones (Lanes 3-6). As expected, no signal
was detected in the wt ES cells (Lane 1), and the lower band depicted in Lane 2 represents the
random integration pattern for this non-homologous integrant. A number of different digests were
performed and screened with the above probes as well as with additional 5' external and internal
probes to determine the actual configuration of the mutant allele. Both the expected and actual
K-ras mutant allele configurations are shown in (A). This was confirmed further by PCR analysis
using the primer pairs shown in (A). Primer pairs 3'neo + 5'neo and 3'hom + 5' hom specifically
amplify a 5.1 kb and 1.8 kb fragment, respectively, as would be expected for this configuration.
This head-to-tail integration pattern occurred either one time (see Lanes 3 and 5 in (B)) or multiple
times (see Lanes 4 and 6 in (B)).
(D) PCR analysis of E12.5 embryos derived from a K-ras+/- intercross showing the presence of
K-ras-1- embryos (lanes marked with an asterisk (*)). The two alleles can be distinguished using
primer pairs that specifically amplify a 360 bp wt fragment (5'-IO + 3'-Ex1) or a 270 bp mutant
specific fragment (5'-IO + 3'-neo).
86
oc
C)
I-I
A, n
I
·J
Z
EP
O
W
Z
1?C
o
h
bD
E
•o
· 1•
.0
0
o
r"
.0
.oj
Figure 2.1
B
C
1
2
3
4
5
6
7
1
8
8.4kb
8.1kb
b
7.0kb
2
3
5
4
p.~
=
6.9kb *.
..
neo probe
3' probe
360 bp 270 bp PCR
88
6
recombination events may be due to the relatively low level of expression of the K-ras locus
(Muller et al., 1983); perhaps only heterozygous ES cell clones that duplicated neo-containing
sequences attained sufficient levels of protein to provide G418 resistance at the selection level used.
Regardless, in each of the heterozygous ES cell clones used for further study, critical K-ras exon 1
sequences had been deleted as confirmed by Southern blot analysis on K-ras homozygous mutant
ES cells (data not shown).
K-ras is an Essential Gene
Chimeric animals were created by injecting K-ras+l- ES cells into C57BL/6 blastocyst-stage
embryos. Germline contribution was determined by breeding the chimeras to C57BL/6 mice, and
BL/6:129/Sv agouti progeny were genotyped. Those mice that carried the mutant allele were
initially identified by Southern blot analysis and subsequently by PCR amplification of tail DNA
(data not shown). Three independent heterozygous ES cell clones produced chimeras that
transmitted the K-ras mutant allele through the germline. To establish the requirements for K-ras
function during mouse development, K-ras+/l mice were mated and the genotypes of offspring
determined at weaning. Genotyping of the first 83 offspring from these heterozygous intercrosses
revealed no K-ras-1- animals, indicating that K-ras is an essential gene for mouse embryogenesis.
I collected embryos at progressively earlier times in development to delineate the timing of
the death of K-ras-1 - embryos; all embryos were genotyped by PCR analysis (Figure 2. 1D). This
analysis was carried out on both a mixed BL/6:129/Sv background as well as on an inbred 129/Sv
background. The viability plot for both genetic backgrounds is depicted in Figure 2.2. On a mixed
background, K-ras-1-embryonic viability was not affected until embryonic day 12.5 (E12.5). The
number of viable K-ras-1 - embryos decreased with increased gestational age, with no mutants
surviving past birth. In contrast to the broad window of lethality observed on the mixed genetic
background, K-ras- 1- embryos died during a much more restricted developmental period when the
mutation was examined on an inbred 129/Sv background. Lethality was again first evident at
E12.5, and no K-ras-1 - embryo survived beyond E14.0.
89
v25
-I
10
5
0
9.5
10.5
11.5
12.5
13.5
14.5
15.5
16.5
17.5
18.5
19.5
gestational days
Figure 2.2. Viability plot for K-ras-l- embryos.
The data is graphed as the percentage of viable embryos that were K-ras-1- as a function of
increasing gestational age. All embryos were derived from K-ras+l-intercrosses; thus, 25%
would be expected to be K-ras-1- embryos. This analysis was performed on both a mixed
BL/6:129/Sv genetic background as well as on a pure 129/Sv background. All heterozygous
parents used in this analysis were the Fl progeny of chimeras bred with either pure BL/6 females
(for the mixed genetic background analysis) or pure 129/Sv females (for the inbred genetic
background analysis). On the mixed genetic background, approximately 600 total implants were
genotyped, ranging from 30 to 170 embryos per gestational day. On the pure 129/Sv genetic
background, approximately 400 total implants were genotyped. During the critical time period
(E 11.5-14.5), the number of embryos genotyped ranged from 30 to 130 per gestational day.
90
On both the mixed and inbred backgrounds, K-ras-1- embryos appeared morphologically
normal and were indistinguishable from their littermates up to E10.5. Beginning at E11.5, mutant
embryos could be identified morphologically based on their smaller size and delayed growth. The
E12.5 K-ras-1- embryo shown in Figure 2.3A exemplifies the mutant phenotype: the mutant is
developmentally delayed, has a less obvious superficial vasculature, and is paler than normal
littermates. Moreover, the livers of mutants were very pale and reduced in size (typically 2-8 fold
fewer total cells than control livers), and the embryo exhibited signs of edema, particularly in the
pericardial space. These superficial features are consistent with anemia and a defect in the
production or circulation of red blood cells. The developmental delay ranged from 0.5 to 3
gestational days, with those embryos surviving late in gestation (mixed background) exhibiting the
most significant delay. Typically, this delay was coordinate; however, some embryos did exhibit a
non-coordinate delay as shown in Figure 2.3B. In this K-ras-1- embryo, features such as the limbs,
skin, tail, and whiskers had developed to a stage associated with E17.5-18.5, whereas the eyes did
not develop beyond the equivalent of E15.5 since eye closure was not attained. Moreover,
histological analysis of E15.5 or older K-ras-1 - embryos on the mixed genetic background showed
that a small percentage of these mutants exhibited a non-coordinate development of internal organs
(data not shown).
Fetal Liver Defect in K-ras-"- Embryos
Morphologically, K-ras-1- exhibited a phenotype that was consistent with a defect leading to
anemia. The fetal organs/tissues required at this stage in development to support a functional
hematopoietic and circulatory system for the red blood cells include the placenta, extraembryonic
membranes (e.g., yolk sac and chorion), liver, heart, and vasculature system. Histological
examination of these and other tissues was carried out on K-ras 1/- embryos. Due to the more
uniform expressivity of the homozygous mutant phenotype on the 129/Sv background, most of
the histological and cellular analysis was performed on embryos from this genetic background.
With
91
Figure 2.3. Phenotypic comparison of K-ras"- embryos and control littermates.
(A) The wild-type littermate is on the left and the K-ras-/ - littermate is at the right. Note the slight
developmentally delay (- 0.5 gestational days) and pale coloring of the liver in the K-ras-1embryo.
(B) The control E18.5 K-ras+l- embryo is on the left and the K-ras-" - embryo is on the right.
Note the marked reduction in size of the mutant relative to the control littermate as well as the noncoordinate development of the K-ras-1 - embryo. The eyes have not developed beyond E15.5,
whereas the limbs, tail, and skin have all advanced to at least E17.5.
(C) and (D) Parasagittal section through an E12.5 K-ras-1 - (C) and a control wild-type (D) fetal
liver. Note the areas of hypocellularity in the K-ras mutant fetal liver, whereas the cells are densely
packed in the control liver. Also, pyknotic nuclei (white arrows) in the distal portion of the
K-ras-" - hepatic lobe are indicated.
(E) and (F) Cell death analysis on an adjacent fetal liver section from (C) and (D). Note the
presence of significant numbers of TUNEL-positive (brown staining) cells in the K-ras-1 - fetal
livers (E). In more severely effected embryos, these apoptotic cells were present throughout the
liver. In contrast, very few cells stain positive in the TUNEL assay from control fetal livers (F).
92
the exception of the fetal liver (see below), no other tissues of the K-ras-'- embryos were
consistently defective.
Histological examination of the livers from E12.5 to E13.5 K-ras-/-embryos indicated that
they were smaller and lacked extensive cellularization compared with controls (Figure 2.3C and
2.3D). In addition, cell death was observed in the livers of more severely affected mutant
embryos. This cell death was first apparent in the distal portions of the hepatic lobes (Figure
2.3C), but extended throughout the entire organ in the final stages of viability (data not shown).
The pyknotic nuclear morphology exhibited in mutant livers is typically associated with apoptosis.
To assess whether this cell death was due to apoptosis, I analyzed fetal liver sections by the
TUNEL assay. Liver sections from both E12.5 and E13.5 control embryos showed a few isolated
cells that stained positive for biotin-dUTP incorporation (Figure 2.3F and data not shown),
whereas numerous cells were TUNEL-positive in K-ras-/ - liver sections (Figure 2.3E and data not
shown). Thus, the cell death observed in K-ras-deficient embryos was due largely, if not
exclusively, to apoptosis. Furthermore, this excessive cell death was specific to the liver as other
tissues did not exhibit significantly enhanced levels of TUNEL-positive staining (data not shown).
Functional Analysis of K-ras-1- Hematopoiesis
At E12.5, the liver constitutes the major hematopoietic organ, predominantly for definitive
erythropoiesis (Dzierzak and Medvinsky, 1995). Based on the timing of death for the K-ras-1embryos, it was conceivable that there may have been a specific defect in this process.
Histological analysis, however, established the presence of definitive (enucleated) red cells in the
embryo.
Furthermore, peripheral blood smears from E12.5 to E18.5 (mixed background
embryos were used for E14.5 or older) embryos showed that mutants were comparable to control
embryos of the same developmental stage in the percentage of enucleated vs. nucleated red cells
(data not shown). Therefore, erythroid cells of K-ras-1- embryos were capable of achieving endstage differentiation within the hepatic microenvironment. However, this analysis does not
establish that hematopoiesis occurred efficiently (see below).
94
Ras has been implicated in relaying the signal downstream of a number of hematopoietic
growth and survival factors (Satoh et al., 1992). In particular, Ras has been found to be important
in eliciting a survival signal downstream of GM-CSF and IL-3 in hematopoietic progenitor cells
(Kinoshita et al., 1995). The cell death observed in the fetal liver may, therefore, reflect an intrinsic
defect of the mutant hematopoietic progenitor cells to survive, proliferate, and/or differentiate.
Alternatively, the cell death may represent a failure of the mutant hepatic microenvironment to
support these processes.
To determine the functional potential of K-ras-l- hematopoietic progenitors and stem cells,
hematopoietic assays were performed in vitro and in vivo. Single cell suspensions made from
E12.5 livers of 129/Sv derived K-ras-l- and control embryos were plated at equal cell densities in
vitro in methylcellulose medium optimized for hematopoietic colony differentiation. Comparable
sizes, onset of differentiation, and morphologies were found for CFU-E, BFU-E, CFU-GM, and
CFU-GEMM colonies derived from mutant and control fetal livers (data not shown). However, I
consistently observed an -2 fold reduction in the number of colonies derived from the K-ras-lfetal livers as compared to controls (data not shown). This difference may indicate that K-ras-/ committed progenitors are partially impaired in their ability to survive and/or differentiate.
Alternatively, the developmental delay of the mutant embryos may account for this difference, as
control embryos of a similar developmental stage could also exhibit a 1.2-2 fold reduction in the
number of colonies obtained (data not shown).
To examine the presence and function of more primitive K-ras-/- multipotential progenitors
as well as the long-term repopulating hematopoietic stem cell (LTR-HSC), in vivo reconstitution
assays were performed. Lethally-irradiated BL/6 recipient mice were injected retro-orbitally with
single cell suspensions made from the entire livers of 129/Sv derived, E13.5 mutant and control
embryos. Donor cell contribution to the peripheral blood was monitored by the glucose phosphate
isomerase (GPI) assay two weeks post-injection and at 1 month intervals thereafter. Both the
onset and extent of contribution to the peripheral blood were equivalent for mutant (3/4 cases) and
control cells (data not shown). To date, 3/4 recipients have survived 4 or more months post-
95
injection with K-ras-1 - hematopoietic cells (data not shown), indicating that both short-term (1
month) and long-term (4-6 months) repopulation has taken effect. Thus, K-ras function is not
required for differentiation of the LTR-HSC. This result is consistent with the in vitro colony
assays, and together, these data suggest that the apparent anemia in K-ras- / - embryos is a
consequence of defects in the fetal liver microenvironment.
K-ras-1- ES Cells have Reduced Contribution to Hematopoietic Compartments
Analysis of K-ras-/- embryos has shown a requirement for K-ras in the normal
development of, at least, the fetal liver. However, due to the attendant lethality of the K-ras-1embryo, it was not possible to determine what effects, if any, the absence of K-ras function would
have later in gestation or in the adult animal. This issue is important, in part, given the recent
efforts to develop chemotherapeutic strategies to inhibit Ras function by such drugs as
farnesyltransferase inhibitors (Hancock, 1993; Gibbs et al., 1994). Therefore, K-ras+l-ES cells
were subjected to enhanced concentrations of G418 to generate K-ras-1 - ES cells (Mortensen et al.,
1992). Out of 200 clones screened, two were found to have lost the wild-type allele (Figure 2. 1B).
These K-ras-1 -ES cell clones were then injected into BL/6 blastocysts to create chimeric animals.
For comparison, chimeras were also generated using the parental K-ras+l-ES cell line. Only 4-6
K-ras-1 - ES cells could be injected per blastocyst to avoid the lethality associated with K-ras
homozygosity.
Contribution by the K-ras-deficient cells to chimeric animals was estimated from the extent
of the agouti coat color and found to range from -10 to 50%. In addition, I determined the percent
contribution of mutant cells to the internal tissues of four week old chimeras using GPI analysis.
More than 25 tissues were examined from 8 K-ras-1- chimeras and 4 control K-ras+/- chimeras
using this assay. As summarized in Figure 2.4, significant contribution by the K-ras-/- cells was
observed in most tissues, suggesting that most cell types can develop and survive in the absence of
K-ras function.
However, since this assay measures the percent contribution to the
96
Figure 2.4. GPI isoenzyme analysis on K-ras+ /- and K-ras-1- chimeras.
Tissue contribution of K-ras+/- and K-ras-/- ES cells was analyzed by the GPI isoenzyme assay as
described in the experimental procedures. The graph represents the average percent contribution of
K-ras+/-and K-ras-1- ES cells to representative tissues in the chimeras. The number of animals
from which each tissue was examined is indicated in parentheses following the tissue (K-ras+/- /
K-ras-l-). The lowest and highest values of contribution to tissues in individual chimeras are
indicated in the columns to the right, with the K-ras+ /- chimeras listed above in each case. The
data is shown in two graphs, with those tissues exhibiting lower contribution (except for the
pancreas) by the K-ras-1- cells shown in the upper graph and those exhibiting normal contribution
in the lower graph.
97
Figure 2.4
lympho/monocytes (315)
%contribution
Lowest Highest
-M
IK-ras+l"
whole blood (4/8)
0 K-ras"/ -
r
platelets (3/6)
RBC (4/6)
thymus (2/7)
P"Mm
RMIM
spleen (4/8)
lung (4/8)
bone marrow (4/8)
2.0
2.3
1.0
1.0
3.0
2.3
10.0
1.0
1.0
1.0
27.5
3.7
43.8
12.5
22.5
10.0
45.0
15.0
6.3
10.0
1.0
45.0
1.0
52.5
1.0
3.0
1.0
3.0
1.0
liver A (4/8)
liver B (4/8)
1.0
coat color (4/8)
pancreas (4/8)
40
30
20
10
---1 --
cecum (4/8)
colon (4/8)
1:8
IT:•
90.0
50.0
47.5
stomach (4/7)
IK-ras+l'
36.3
U K-ras-/-
12.5
1.0
1.0
42.5
1.0
47.5
v/~·rr////~7m/rr///~///rr/r//~il
50.0
10.0
46.3
1.0
7.5
50.0
50.0
4:9
98:8
5.0
50.0
13.8
1.0
55.0
50.0
5.0
7.5
35.0
52.5
55.0
52.5
1.0
T---~-
medulla (4/8)
cerebrum (4/8)
atrium (3/8)
cerebellum (3/8)1
7.5
ventricle (4/8)
23.8
1.0
12.5
3.0
47.5
adrenal (4/8)
kidney (4/8)
0
•
I
10
I
I
I
20
30
40
average % contribution
60
43.8
43.8
17.5
28.8
JI
37.5
5.0
v~n/n/n/nnm/n~
ileum (4/8)
duodenum/jujenum (4/8)
bladder (4/8)
52.5
50
1.0
~''/~'//~/~////I/~-////1~51
41.3
10.0
10.0
3.0
1.0
C€
36.3
48.8
36.3
50.0
40.0
42.5
45.0
50.0
50.0
56.3
50.0
55.0
55.0
whole tissue, it is possible that K-ras may be required for the proper development of certain cell
types. Indeed, the homozygous mutant phenotype indicates that this must be so.
Interestingly, relatively low contribution by the K-ras-1- cells was observed in the lung as
well as in multiple hematopoietic lineages and the tissues that support their production throughout
embryogenesis and adult life (e.g., liver and spleen). Moreover, those chimeras with the highest
percent contributions to the liver and spleen exhibited the lowest contribution to the hematopoietic
cells of the bone marrow (data not shown). In addition, in those chimeras with a relatively high
contribution of K-ras-deficient cells in the bone marrow, the mutant cells were underrepresented in
the more differentiated cells of the blood. The low contribution to hematopoietic lineages stands in
contrast with the in vitro and in vivo hematopoietic cell analyses and suggests that the lack of K-ras
function may affect hematopoietic progenitor cells directly. This discrepancy may be explained by
the fact that in the chimeras, K-ras-deficient hematopoietic cells are developing in competition with
wild-type cells. Thus, any subtle intrinsic defect present in the mutant cells may be accentuated.
No Upregulation of Ras Family Members in K-ras-"/ Embryos
The observed differences in viability for K-ras-l-embryos on the two different genetic backgrounds
suggested that it is likely that there are one or more modifier loci influencing the requirement for
K-ras function. Given the common expression patterns and signaling pathways utilized by K-ras
and N-ras, it was conceivable that differences in N-ras expression levels could affect the K-ras
mutant phenotype. To determine if N-ras or H-ras were upregulated in the K-ras mutant
background, I examined the levels of these proteins in mouse embryonic fibroblasts (MEFs)
derived from E13.5 embryos on both genetic backgrounds. Lysates of subconfluent cultures of
MEFs were immunoprecipitated with Y13-259 antibody (which recognizes all three forms of Ras)
and subsequently immunoblotted with antibodies specific for each of the three Ras proteins. As
shown in Figure 2.5A, there was no detectable K-ras protein in MEFs derived from K-ras-l embryos. Moreover, neither N-ras nor H-ras protein levels were altered in cells lacking K-ras.
99
Figure 2.5. N-ras and H-ras are not upregulated in response to the loss of K-ras.
(A) Mouse embryonic fibroblasts (MEFs) were derived from E13.5 littermates on both genetic
backgrounds and analyzed for the levels of K, N-, and H-ras proteins. Ras was
immunoprecipitated from at least two independently derived clones for each genotype using the
pan-Ras antibody Y13-259. Immunocomplexes were then analyzed by immunoblotting with
monoclonal antibodies specific for each of the Ras proteins. The blot probed with K-ras (F234)
was stripped and reprobed with a pan Ras (F111) antibody to confirm that the mutant lysates were
intact (data not shown). Lysates from cells prepared from a mixed genetic background are shown;
however, identical results were obtained on the pure 129/Sv background (data not shown).
(B) Tissues were prepared from E12.5 embryos derived on the mixed genetic background and
analyzed as above. One immunoblot was made and probed with the same series of Ras antibodies
as used in (A). The order of analysis was as follows: N-ras (F155), H-ras (F235), K-ras (F234),
and then pan Ras (F111). The slight amount of signal which is detected in the K-ras-1 - tissues by
the K-ras specific antibody is due to background cross-reactivity to the faster migrating N- and Hras proteins. Probing with the pan Ras antibody mirrored the expression levels seen with each
antibody (data not shown). Similar results were also obtained with heart and lung tissues (data
not shown).
100
Figure 2.5
K-ras Genotype:
+1+ +1+ +1- +1- -I
K-ras
--
I--------
N-ras
H-ras
,,r•I,--------..-.
Western Ab:
K-ras
K-ras Genotype:
N-ras
+/+ +/-
1ien
Liver
+/+ +/. ./
+/ +/- ./.
n
m
Brain
H-ras
I-
]~iI,
I,
ViT
Carcass I
1
I
IP Ab: Y13-259 (pan)
101
~
I
]
1·
In order to assess whether N-ras and/or H-ras may have been upregulated in a tissuespecific manner, extracts were prepared from E12.5 mutant and control littermate tissues
(BL/6:129/Sv background) and analyzed as above. Examination of 5 different tissues revealed that
there was no significant change in either N-ras or H-ras protein levels in the K-ras deficient tissues
(Figure 2.5B and data not shown). Ras proteins are active when bound to GTP and tight
regulation of the GTP/GDP bound states of these proteins is critical for maintaining normal
growth control. Therefore, it remains possible that there is functional compensation for the loss of
K-ras through increases in the level of GTP-bound N-ras and/or H-ras.
Genetic Interaction Between K-ras and N-ras
In contrast to the requirement for K-ras in mouse embryogenesis described here, neither N-ras
(Umanoff et al., 1995) nor H-ras (M. Katsuki, personal communication) are essential genes in the
mouse. One possible explanation for the normal phenotype of N- and H-ras mutants, and for the
relatively late onset phenotype in the K-ras mutants, is that different members of the family have at
least partial overlapping function. To address a possible genetic interaction between K- and N-ras,
mice carrying various combinations of the two null mutations were generated on a mixed
BL/6:129/Sv genetic background. As shown in Table 2.1, double heterozygotes (N-ras+l-;
K-ras+/- ) were viable with no overt abnormalities. However, animals deficient for N-ras and
heterozygous for the K-ras mutation (N-ras-l-; K-ras+l- ) died during gestation.
Also,
heterozygosity at the N-ras locus significantly worsened the K-ras homozygous mutant phenotype
(N-ras+l-;K-ras-l- ) (Table 2.2).
Embryos were collected at progressively earlier timepoints in development to delineate the
timing of death of N-ras-l-; K-ras+l- and N-ras+l-; K-ras -1- embryos; due to breeding
considerations, a more extensive analysis was undertaken on the N-ras-l-; K-ras+/- embryos. As
with the K-ras-1- embryos on a mixed background, N-ras-l-; K-ras+l- mutants exhibited a variable
expressivity in phenotype and a broad window of lethality. -70% of these mutants died between
E10.0 and E12.0, with the remainder dying perinatally (Table 2.1). A few embryos were found to
102
Table 2.1. Summary of Dissection Analysis for N-rasl-; K-ras+l- Embryos
Embryonic
Day
N-ras:
K-ras:
9.5-10.0
# viable recovered:
Genotypes of Embryos from N+/'; K +1" x N-1'; K +/+
+/+/-/-/+/+
+/+/+
+/-
11
14
16
% abnormal:
18.2d
21.4d
31.3d
50.0 d
10.5-11.0
# viable recovered:
%abnormal:
39
5.1d
22
4.6d
30
3 .3 d
20
6 5 .0d,h
11.5-12.0
# viable recovered:
% abnormal:
12.5-13.0
12
13
18
12
4
7.7d,h
5.6d
8.3d
100.0d,h
# viable recovered:
19
14
17
4
% abnormal:
5.3s
14.3s,p
17.6s,p
7 5 .0 d,s,p
13.5-14.0
# viable recovered:
% abnormal:
11
9.1d
9
22 .2 d,p
13
15 .4d
5
80.Od,p,e
14.5-15.0
# viable recovered:
13
9
12
8
% abnormal:
7.7d
33.3d,p,e
16.7d,p
87.5d,p,e,t
# viable recovered:
11
9
9
4
% abnormal:
0.0
33 .3d,s,p
11.1d
100.Od,s,p,e
16.5-17.0
# viable recovered:
% abnormal:
11
9.1s
11
9.1s,p
17
11.8s,p
6
100.Od,p,e,t
17.5-18.0
# viable recovered:
% abnormal:
11
0.0
13
15.4d,s
6
16.7s
3
33.3d
18.5-19.0
# viable recovered:
11
10
9
4
% abnormal:
0.0
0.0
0.0
50.0d,t
15.5-16.0
Embryos resulting from a N-ras+l-;K-ras+/- x N-ras-/-; K-ras+/+cross were dissected at various
times in gestation and analyzed for their viability, gross morphological appearance, and subsequently
fixed for histological purposes. Based on the parent's genotypes, four different genotypic classes of
embryos should result, each with an expected frequency of 25%. Abnormalities are denoted as
follows: (d) delayed by 0.5 day or more, (h) dilated heart and pericardial sac, (s) small for
developmental stage, (p) pale and less vascularized, (e) asymmetrical development of the eye: either
significantly smaller than its normal counterpart or the pigment of the eye was overgrown, and (t)
severe shortening of the tail.
survive up to 2 days past birth, but were subsequently neglected by their mothers and died shortly
thereafter. No apparent differences in phenotype were noted in crosses performed with parents of
different mutant genotypes.
N-ras'-; K-ras+l" Embryos Die with Severe Anemia
N-ras-l-; K-ras+l-embryos were indistinguishable from normal littermates at E8.5. Starting at
E9.5, a higher percentage of N-ras-l-; K-ras+l- embryos were delayed by 0.5-1.0 developmental
days (50% vs. -23% average of the other three genotypes). By E10.5, 65% of viable embryos
were abnormal (Table 2.1).
The E10.5 N-ras-l-; K-ras+l- embryo shown in Figure 2.6A
exemplifies the phenotype observed at this stage: the mutant has arrested at -9.5 days of
development, is markedly more pale than normal littermates, and has a dilated heart and pericardial
sac. Figure 2.6B demonstrates the severity of dilatation within the heart and pericardial sac that can
be observed in N-ras-l-; K-ras+l- embryos. Very few circulating red blood cells are seen within
either the embryo or its yolk sac. Furthermore, yolk sacs from these embryos exhibited a
wrinkled or roughened appearance when compared to the smooth yolk sacs of littermate controls
(Figure 2.6C).
Despite an overall growth delay in N-ras-l-; K-ras+l embryos, many
developmental processes were completed, including cardiac contraction, fusion of the allantois and
chorion, rotation of the embryo, and closure of the anterior neuropore.
Histological examination of affected E1O.5N-ras-l-;K-ras+l- embryos demonstrated the
near or complete absence of blood islands in their yolk sacs and significantly reduced numbers of
circulating primitive erythrocytes in either the yolk sac (compare Figures 2.7A and 2.7B) or the
embryo (data not shown).
However, other tissues of mesodermal origin, such as the
myocardium, somites, and blood vessels, were present and appeared to develop normally.
Numerous pyknotic nuclei were observed throughout N-ras-l-; K-ras+/- embryos. Although in the
yolk sac cell death appeared to be restricted to cells of mesodermal origin (data not shown),
extensive cell death occurred throughout the embryo in cells derived from all three germ layers
(compare Figures 2.7C with 2.7D and Figure 2.7E with 2.7F). In earlier N-ras-l-; K-ras+l-
104
Figure 2.6. Comparison of N-ras-A; K-ras + " and control littermates at E10.5.
(A) Embryos were isolated at E10.5. Embryonic genotypes are as follows: N-ras-l-; K-ras+l(left) and N-ras+l-;K-ras+l- (right). The N-ras-l-; K-ras+l- embryo has only developed to a stage
equivalent to E9.5, has a dilated heart and pericardial sac, and has reduced numbers of circulating
red blood cells.
(B) Higher magnification view of a different N-ras-/-; K-ras+l- embryo isolated at E10.5. This
mutant represents the severity in dilation that can be observed in both the heart and pericardial sac.
Amazingly, cardiac contraction still occurs in these embryos.
(C) Visceral yolk sacs from E10.5 N-ras-l-; K-ras+l- embryos (2 on the left) and a N-ras+l-;
K-ras+l- embryos (right). Note the roughened and wrinkled appearance that the N-ras-l-; K-ras+lyolk sacs take on compared to the smooth appearance of the control yolk sac. Moreover, there is a
marked reduction in the number of circulating embryonic blood cells present in the yolk sacs of
N-ras-l-; K-ras+/- embryos.
105
Figure 2.7. Histology of E9.5 and E10.5 N-ras-l; K-ras+l- and control embryos.
(A) and (B) Histological analysis of E10.5 N-ras-'l; K-ras+l- (A) and N-ras+l+;K-ras+l- (B)
visceral yolk sacs. Note the strict absence of blood islands (larger black arrow) and the presence of
very limiting numbers of circulating primitive erythrocytes (small black arrows) in the N-ras-l-;
K-ras+l- yolk sac. Otherwise, the yolk sac tissue and endothelial-lined blood vessels exhibit
similar appearances in both yolk sacs.
(C) and (D) Parasagittal sections through the forebrains of an E9.5 N-ras-l-; K-ras+l- embryo (C)
and a N-ras+l+;K-ras+l - littermate control (D). Note the prevelant cell death (pyknotic nuclei
(black arrows)) throughout the forebrain of the N-ras-l-; K-ras+l-embryo.
(E) and (F) Parasagittal sections through the mid-portion of an E10.5 N-ras-l/; K-ras+l- embryo
(E) and a N-ras+l+;K-ras+l- control littermate (F). The cell death observed at E9.5 extends
throughout the entire embryo by E10.5. This section reveals prevalent cell death in the primitive
mesenchyme which extends into the somitic tissue.
107
embryos (E9.5), cell death was prevalent in the forebrain (Figure 2.7C) and to a lesser extent along
the neural axis. I cannot conclude if the cell death is due solely to an extreme anemia and
subsequent hypoxia, or whether Ras function is required for global cell survival.
Surprisingly, a significant proportion (-30%) of N-ras-1-; K-ras+l-embryos survived past
this critical stage in development. As can be seen in Table 2.1, almost all of them were abnormal
and readily identifiable except at the final stages of gestation. The N-ras-/-; K-ras+l- embryo
shown in Figure 2.8A represents some of the phenotypes observed at these later stages in
development: the embryo is developmentally delayed by -0.5 gestational days, is small for its
developmental stage, and is very anemic and edematous. Most N-ras-l-; K-ras+/-embryos were
delayed by only 0.5-1.0 days in development and never exhibited the non-coordinate delay that
could be observed in late stage K-ras-1 - embryos. Interestingly, 22% of E13.5-18.5 N-ras-l-;
K-ras+/- embryos showed an asymmetrical pattern in eye development, with only the right eye
being affected, and 20% exhibited a defect in proper tail development (Table 2.1). Two different
abnormalities were observed with respect to eye development:
either the right eye was
significantly smaller than the left eye (compare Figure 2.8D with 2.8G) or the pigmentation in the
right eye was markedly over-developed in comparison with the left eye (compare Figure 2.8E with
2.8H). A control embryo is shown for comparison in Figures 2.8C and 2.8F. Histological
examination, however, revealed that most structures in the eye appeared to develop correctly.
Moreover, other structures within the head of the same embryo had developed symmetrically,
demonstrating that this anomaly was specific to the eye. Figure 2.8B demonstrates the severe
truncation in tail development, which was also observed at a fairly high frequency (20%). In
addition, a higher percentage of embryos with only two of the four ras alleles (N-ras+/-;K-ras+/and N-ras-l-; K-ras+/+), as compared to those carrying three of the four ras alleles (N-ras+/-;
K-ras+/+), showed similar phenotypes (see Table 1). In summary, these data suggest that a
critical threshold level of Ras activity must be met in order for development to occur normally.
Histological analysis of E15.5-16.5 N-ras-l-; K-ras+l- embryos revealed that the only
defect that could be consistently defined was again in the fetal liver. As shown in Figures 2.9A
109
Figure 2.8. N-ras'l-; K-ras' "/ embryos exhibit morphological abnormalities late in gestation.
(A) E15.5 N-ras-l-; K-ras+/- embryo (left) and a control N-ras-l-; K-ras+l + littermate (right) are
shown. The N-ras-/-; K-ras+/ - embryo is developmentally delayed by 0.5 gestational days and is
severely anemic and edematous.
(B) E18.5 N-ras-l-; K-ras+l-embryo (right) and a control N-ras+l-;K-ras+l- littermate (left) are
shown. Embryos were fixed in Bouin's and subsequently photographed. Note the severe
truncation in tail development in the N-ras-/-; K-ras+l- embryo. This occurred in -20% of
N-ras-l-; K-ras+l-embryos, age E14.5 or older.
Right eye (C)-(E) and left eye (F)-(H) development in the same respective embryo at E15.5. Two
different developmental and asymmetrical abnormalities were observed in -22% of N-ras-l-;
K-ras+/- embryos between the ages of E13.5 and E16.5. Either the right eye, specifically, was
significantly smaller than the left eye in N-ras-l-; K-ras+l-embryos (compare (D) and (G)), or the
pigment of the eye was overgrown, with the right eye again being more affected than the left eye
(compare (E) and (H)). A control N-ras-/-; K-ras+l + embryo is shown in (C) and (F) for
comparison.
110
Figure 2.9. Histology of E15.5-16.5 N-ras-l-; K-ras+l- fetal livers.
(A) and (B) Parasagittal sections through the fetal livers of an E15.5 N-ras-l-; K-ras+/- embryo
(A) and a control E16.5 N-ras-/-; K-ras+l+ embryo (B). Note the absence of blood filled,
endothelial-lined vessels (longer black arrow in (B)) in the N-ras-l-;K-ras+l- embryo. Moreover,
the ratio of erythroblasts (dark, blue staining cells and smaller black arrow) to hepatocytes is
significantly reduced in these embryos.
(C) Parasagittal section through the fetal liver of an E16.5 N-ras-l-; K-ras+l- embryo. A similar,
but more severe phenotype, was observed at this age, in which the hepatocytes would take on a
very vacuolated appearance (indicated by the black arrows).
(D) Higher magnification view of the fetal liver in (C) demonstrating the vacuoles (black arrows).
112
and 2.9B, livers from E15.5 N-ras-1-; K-ras+l-embryos have a significantly reduced ratio in the
number of erythroblasts to hepatocytes as compared to normal control littermates.
These
hepatocytes also tended to become extremely vacuolated by E16.5 (Figure 2.9C and 2.9D). I did
not observe elevated cell death in these livers, suggesting that this defect is either different than the
defect in K-ras-1- fetal livers or not as severe. Moreover, there were very few circulating red blood
cells within the embryonic tissues (compare Figures 2.9A and 2.9B; data not shown). Peripheral
blood smears obtained from these animals confirmed that definitive erythropoiesis occurred, and
that the ratio of enucleated to nucleated red blood cells was appropriate for their developmental
stage (data not shown). Therefore, their anemia appears to be due to inefficient, but apparently
normal, production of definitive erythrocytes and may reflect a defect in the survival and/or
differentiation of either the erythroblasts or a more primitive progenitor cell. As in the case of the
K-ras-1- phenotype, this may be due to an intrinsic defect and/or a defect within the
microenvironment to support these hematopoietic processes (see Discussion).
As shown in Table 2.2, N-ras+/-;K-ras-" - embryos were capable of surviving to E9.5.
However, these embryos were more severely affected than N-ras-1 -; K-ras+/l- embryos, as 40%
were inviable and 100% were abnormal at this developmental stage.
Morphological and
histological examination of N-ras+l-;K-ras-1 - embryos revealed a similar phenotype to N-ras-1-;
K-ras+/l- embryos. However, N-ras+/l;K-ras-1 - embryos exhibited more extensive cell death at
E9.5 than their N-ras-l-; K-ras+l-counterparts (data not shown). Thus, embryos carrying only one
of the four functional alleles of N-ras and K-ras were less severely affected if the one allele was
K-ras.
Hematopoietic Colony Formation in Cultures of N-ras-l-; K-ras+/- Yolk Sacs
Prior to the establishment of fetal liver hematopoiesis at ~E1O.5-1 1.0, the earliest erythroid cells
arise in the blood islands of the yolk sac, giving rise to primitive (nucleated) red blood cells
(Dzierzak and Medvinsky, 1995; Orkin, 1995). The absence of blood islands as well as the
limited number of primitive erythrocytes observed in N-ras-l - , K-ras+/- yolk sacs, may reflect a
114
o
c
r
r
E
i;
~
r,
;r;
L
r
C
3
~
o
h
3
1
1
I
+
+
+
Ic
Iv
0
ri
0
0
+
+
++
++
a~c
r-
rnIooc
SN
Od 'Ile
T~~~''~
W
>
0 Cow
io
9z. i
eq
I
Cu~
;
~
c ki,
OOOa
--
j
so
0I
AC
~~~c
od
v 400
*
0
C)
0B w
14:
o
a l 2
~4
03Oa) v
a.)
ý
L
Q
C)
li
04
oo
cl
u0
0
C)
a)
CG
g
"o-
Ln
S0
Ura
$a4
ve
0
a.)V
3
bO
a. >=t 0o
vlo0
ya.it
wC0 oca.a
-
0 o
a.)
4-J
soo
a)
oc ·(
C4
(L)
4-J
Us
a) g
150 a)
r-e cn
oo
R
-
o
~8<eA
oi
a) a.
=
0
rc
COO)0
a.)
cVj
n~A
4-
cl
Q
4-)
u
CIS
C)$
a
;l<
*
>
0>,ght
0ý:
.'"
cna. 0bJ-o
S
00.)
+ +
ed
~O
<0
+,
Zn~
~l w)
B 0-u
a.C
0 a.'s) 0y c
4
failure in either their ability to survive or the ability of the erythroid progenitor cells to survive
and/or differentiate efficiently within the yolk sac microenvironment.
To examine the presence and function of N-ras-/- , K-ras+/- hematopoietic progenitors, in
vitro colony assays were performed with E9.5 and E10.5 embryonic yolk sacs. Erythroid,
myeloid, and mixed progenitors were present in N-ras-/-, K-ras+/- yolk sacs and capable of
proliferating and differentiating normally (data not shown). However, a more pronounced
reduction in the number of all three progenitor classes was observed from the yolk sacs of more
severely affected N-ras-1 -, K-ras+l- embryos compared to similarly staged control embryos (data
not shown). Thus, this marked reduction in colony number appeared to represent an intrinsic
defect in the progenitors for their ability to survive, proliferate, and/or differentiate rather than the
developmental delay of the mutant embryos. The possibility still exists that there may be an
additional defect residing within the yolk sac microenvironment.
N-rasrl; K-rasr" Embryos Die Between E3.5 and E9.5
Due to the difficulty in assessing the phenotype of double homozygous embryos (only 1/16
embryos generated from a N-ras+/-; K-ras+/- by N-ras+/-; K-ras+/- cross is expected to be
N-ras-l-; K-ras-l-), the analysis of this genotype was limited. As summarized in Table 2.2,
N-ras-l -; K-ras-1 - embryos survived to the blastocyst stage and were normal.
Out of 123
blastocysts isolated and genotyped by PCR analysis, 7 were determined to be N-ras-l-; K-ras-l- .
This yield was consistent with the 1/16 expected frequency for this genotypic class. Embryos
were also isolated at E9.5 and scored for phenotypic abnormalities. As shown in Table 2.2, no
N-ras-/-;K-ras-1- embryos were recovered out of 72 genotyped implants (4-5 were expected) and
a significant proportion (12%) of implants were resorbed and could not be genotyped (data not
shown). These data indicate that N-ras-1-; K-ras-1- embryos develop normally to the blastocyst
stage, but subsequently fail in gestation sometime before E9.5. Thus, H-ras appears to be
sufficient to support embryonic development to at least the blastocyst stage. Alternatively, given
the long half-lives of Ras proteins (24 hours) (Ulsh and Shih, 1984), it is conceivable that N-ras-l-;
116
K-ras-/ - embryos survive to the blastocyst stage due to maternal contribution of these proteins. It
is clear, however, that at least one allele from either K-ras or N-ras is needed for embryonic
survival up to E9.5 and beyond.
117
Discussion
Ras function is central in the signal transduction pathways leading downstream of many growth
and survival factors (Satoh et al., 1992) and is known to be required for proper cellular
proliferation, differentiation, and survival in many developmental systems (Barbacid, 1987;
Khosravi and Der, 1994). Given the structural and functional similarities between the three
mammalian ras genes, it has long been of interest to determine if distinct functions exist for one or
more members of the gene family. To understand the role of individual ras genes in mammalian
development, I and others have created targeted null alleles for each one of them in the mouse.
Analyses of mice lacking N-ras and H-ras function have demonstrated that both genes are
dispensable for normal development. Here, I have shown that K-ras provides an essential
function in mouse embryogenesis and have demonstrated partial functional compensation between
different members of the Ras gene family.
K-ras is an Essential Gene in the Mouse
On an inbred 129/Sv genetic background, K-ras-1 - embryos failed in gestation between E12 and
E14. Thus, although the growth and differentiation of many tissues can proceed apparently
normally in the absence of K-ras function through mid-gestation, completion of embryogenesis is
dependent on the activity of this gene. These mutant embryos exhibited a slight developmental
growth delay starting at approximately E11, which was more pronounced in embryos late in
gestation on the mixed (BL/6:129/Sv) genetic background. The lethality is likely to be due to
hematopoietic defects, as evidenced by the overall pale color of the mutant embryos and the
increased levels of cell death observed in the fetal liver (the major site of erythropoiesis in midgestation). However, I have shown that the K-ras function is not required for the differentiation of
hematopoietic progenitors in vitro or upon transplant into lethally-irradiated recipients, suggesting
that the apparent anemia in the mutant embryos may be caused by an abnormal hematopoietic
microenvironment in the fetal liver. Interestingly, in chimeric mice composed in part of K-ras-
118
deficient cells, the contribution of mutant cells to different hematopoietic compartments was
consistently lower than to other tissues. Therefore, the absence of K-ras may cause a slight
impairment in the capacity of hematopoietic cells to differentiate or survive, which is manifested
when the mutant cells are in competition with wild-type cells during development and
differentiation in the chimeras or in an otherwise defective fetal liver microenvironment in the
homozygous mutant embryos. The phenotype of embryos mutant for both K- and N-ras also
supports a direct role for Ras function in hematopoiesis (see below).
The requirement for K-ras in the developing mouse may reflect either a unique function of
this gene not shared by H- or N-ras or simply the expression pattern of the different members of
the gene family. Although several studies have concluded that all three genes are expressed
ubiquitously (Muller et al., 1982; Muller et al., 1983; Leon et al., 1987), these were conducted on
whole tissues or embryos. Therefore, it is possible that a critical cell type (e.g., within the fetal
liver) expresses K-ras exclusively.
In the context of the K-ras mutation and without
transcriptional upregulation of H- or N-ras, such a cell would be effectively devoid of Ras function
and might fail to differentiate properly or die. In fact, upon examination of mutant MEFs in
culture and various tissues in K-ras-1- embryos, I have seen no evidence for compensatory
increases in the level of either N- or H-Ras. More precise expression analysis will be necessary to
address this possibility directly.
Based largely on differences in post-translational modification, it has been suggested that
K-Ras, and specifically the 4B isoform, may have a unique function in cell signaling. Localization
of Ras proteins to the plasma membrane is critical for their biological activity (Gibbs, 1991;
Khosravi et al., 1992; Glomset and Farnsworth, 1994). Membrane association is achieved
through a series of closely linked post-translational modifications, including farnesylation,
proteolysis, and carboxylmethylation, which are signaled by the consensus CAAX (C, cysteine; A,
aliphatic amino acid; X, any amino acid) sequence located at the C-terminus. In addition, N-, H-,
and K-Ras4A are subsequently palmitoylated at upstream cysteine residues (Hancock et al., 1989).
In K-ras4B, however, these upstream cysteine residues are substituted by a polylysine domain that
119
serves an analogous function to that of palmitylation (Hancock et al., 1990; Hancock et al., 1991).
In addition, it was recently demonstrated that K-ras4B is geranylgeranylated as well as farnesylated
both in vitro and in vivo (James et al., 1995; Lerner et al., 1995b). Together, these posttranslational modifications promote the specific interaction of Ras molecules with the plasma
membrane as well as with upstream and downstream components of signaling pathways (Takai et
al., 1992; Marshall, 1993). The specific association of K-ras4B with the smg-GDS exchange
factor is believed to be mediated, at least in part, through its distinctive C-terminal modifications
(Mizuno et al., 1991). Thus, in certain contexts in the developing and adult animal, signal
transduction may be dependent specifically on K-ras4B. The lethality of the K-ras-1 - embryos
may, therefore, reflect the disruption of these pathways. This possibility could be addressed by
creating a mutant allele of K-ras that specifically blocks production of the 4B isoform.
K-ras and N-ras Interact Genetically
The normal phenotype of animals mutant for either N- or H-ras as well as the relatively late death
of K-ras mutant embryos could be explained by partially overlapping function within the ras
family. Furthermore, I have found that genetic background can affect the expressivity of the
K-ras-1- phenotype, suggesting the existence of modifier genes that can influence the requirement
for K-ras function in development. Due to the similar expression profiles of K- and N-ras, I
addressed the possibility of functional compensation between these two genes. Analysis of mice
carrying various combinations of the K- and N-ras null alleles strongly suggests some form of
overlapping function. For example, -70% of animals deficient for N-ras and heterozygous for
K-ras (N-ras-l -; K-ras+/-) died between 10 and 12 days of gestation, with the remainder having
failed later in gestation or just after birth. This result shows that the normal development of N-rasdeficient mice is dependent on wild-type levels of K-ras. Similarly, the K-ras homozygous
mutant phenotype was significantly worsened in embryos with only one functional N-ras allele
(N-ras+/l-;K-ras-l-). Again consistent with a specific developmental function for K-ras, N-ras+/-;
K-ras-1 - embryos were more severely impaired than N-ras-1 -; K-ras+/ - embryos. Finally,
120
embryos lacking both K- and N-ras function (N-ras-l-; K-ras-l-) failed at an as yet undetermined
stage between the blastocyst (E3.5) and early organogenesis (E9.5). Therefore, in early murine
development, there appears to be a critical threshold level of Ras activity, which may be achieved
by various combinations of the three gene products. Beginning prior to organogenesis, the overall
threshold appears to rise, and still later, a specific requirement for K-ras is revealed.
Functional Requirement for Ras in Hematopoiesis
Various lines of evidence point to a critical role for Ras function in hematopoiesis. In addition to
the apparent anemia of K-ras mutant embryos and the low contribution of K-ras-1- cells to the
hematopoietic compartments of chimeric animals, I observed the absence of blood islands in the
yolk sacs of the majority of N-ras-l-; K-ras+l- embryos. Prior to the establishment of fetal liver
hematopoiesis at -E10.5-11.0, the earliest erythroid cells arise in yolk sac blood islands, where
they produce primitive (nucleated) red blood cells (Dzierzak and Medvinsky, 1995; Orkin, 1995).
The absence of blood islands as well as the limited number of primitive erythrocytes observed in
N-ras-l-; K-ras+l- yolk sacs may reflect an impairment in the ability of primitive erythrocytes or
their progenitors to survive and/or differentiate efficiently within the yolk sac microenvironment.
Targeted disruption of the GATA-2, Tal-II/SCL, and Rbtn2/LM02 genes results in a similar
hematopoietic defect. In contrast to results from analysis of Tal-1 and Rbtn2 mutant embryos
(Warren et al., 1994; Robb et al., 1995; Shivdasani et al., 1995), in vitro hematopoietic colony
assays on E9.5 and E10.5 N-ras-l-; K-ras+l- embryonic yolk sacs revealed that erythroid, myeloid,
and mixed progenitors were present and capable of proliferating and differentiating normally.
However, a marked reduction in the number of all three progenitor classes was observed in the
yolk sacs of severely affected N-ras-1 -; K-ras+/- embryos (data not shown). In this respect, the
N-ras-1 -; K-ras+l- phenotype more closely resembles that of the GATA-2 mutant (Tsai et al.,
1994). Interestingly, Towatari et al. recently demonstrated that GATA2 was phosphorylated in
response to the survival factor, IL-3, via activation of a MEK/MAPK cascade in hematopoietic
progenitor cells (Towatari et al., 1995). This cascade is known to lie downstream of Ras in many
121
signal transduction pathways. Therefore, the defect in N-ras-l-; K-ras+l-embryos may be due, in
part, to inefficient signaling to GATA2 in response to IL-3.
Ras function has also been implicated downstream of a number of other hematopoietic
cytokines as well, such as GM-CSF, EPO (erythropoietin), and SCF (stem-cell factor) (Satoh et
al., 1992). These factors are critical for the maintenance and proliferation of hematopoietic cells,
including multipotential progenitors (Arai et al., 1990). In the absence of stromal cells or
cytokines, hematopoietic cells cease to proliferate and die by apoptosis (Williams et al., 1990).
Recently, the Ras signaling pathway was shown to play a pivotal role in the anti-apoptotic
functions of GM-CSF and IL-3. Whereas Ras function was not required for promoting mitotic
entry in IL-3 dependent hematopoietic cell lines, it was essential for long-term proliferation as well
as cell survival (Kinoshita et al., 1995). Thus, a reduction in the overall level of Ras activity or the
specific elimination of K-ras may lead to apoptotic elimination of hematopoietic progenitors. A
cell survival function for Ras is also supported by the observation of widespread cell death in the
N-ras-/-; K-ras+l- embryos.
Implications for Oncogenesis and Therapy
An estimated 30% of all human cancers carry mutations in one member of the ras family, with
K-ras mutations occurring most frequently (Bos, 1989; Khosravi and Der, 1994). Although the
predominance of K-ras mutation in certain tumor types has some correlation with the expression
profile of the three ras genes in various tissues (Leon et al., 1987), my results suggest that K-ras
may have specific functions in signal transduction not shared by the other family members. Thus,
mutational activation of K-ras may result in the stimulation of a suite of signal transduction
pathways common to all Ras proteins plus those that are singularly dependent on K-ras. The
further characterization of the developmental phenotype of the K-ras mutant mouse may then
provide insights into the signal transduction requirements for oncogenic transformation.
Moreover, the inhibition of these K-ras-specific pathways may have therapeutic value in cancer
treatment.
122
Our results have additional implications important for the design of anti-cancer drugs based
on the inhibition of oncogenic or normal Ras function, including the recently described
farnesyltransferase inhibitors (FTIs). Our data demonstrate that inhibition of K-ras function, at
least during embryogenesis, is lethal. Moreover, analysis of the contribution of K-ras-deficient
cells to various tissues in chimeric animals suggests that the gene is also important in the
development or maintenance of cells at later stages of gestation or in the adult animal, including in
different hematopoietic compartments and in the lung. Therefore, it is likely that drugs that inhibit
Ras function nonspecifically would be highly toxic. Interestingly, higher concentrations of FTIs
are required to suppress the transforming activity of oncogenic K-ras than H-ras (Reiss et al.,
1990; James et al., 1995; Lerner et al., 1995a; Lerner et al., 1995b; Manne et al., 1995; Sun et al.,
1995). This may be explained by the fact that K-ras4B can be modified by geranylgeranylation as
well as farnesylation (James et al., 1995; Lerner et al., 1995b), and this difference in modification
may account for the non-toxic effect of FTIs observed in vivo (Kohl et al., 1995). This observation
also supports an important role for the K-ras4B isoform in cellular function. Based on the lack of
phenotype in the H- and N-ras mutant mice, it should be possible to develop nontoxic inhibitors
specific for the oncogenic forms of these proteins. Alternatively, it may be more sensible to screen
for compounds that inhibit steps downstream of Ras in the signal transduction pathways leading to
cellular transformation rather than cell growth/differentiation, should such a distinction in signaling
pathways exist. Finally, our data do not address directly the requirement for K-ras in the adult,
and, therefore, it remains possible that inhibition of its function might be tolerated during cancer
treatment. To examine what cell types in the adult are dependent on K-ras (and other ras family
members), it will be necessary to develop conditional mutant alleles of these genes.
123
Experimental Procedures:
Construction of Targeting Vectors
A genomic DNA clone corresponding to K-ras was isolated from a 129/Sv genomic library using
a probe derived from pHiHi3 (Ellis et al., 1981). The genomic DNA was excised with SalIl, and
the resulting two genomic fragments were subcloned into pGEM4, forming pK-ras-5' and
pK-ras-3'. pK-ras-5' was found to encompass exon 0 and its flanking sequence, whereas
pK-ras-3' covered exon 1 and surrounding sequence. The targeting vector was constructed by first
inserting a 2.8 kb NotI-SalI fragment from pK-ras-5' into pKSII + (Stratagene), creating
pKSII+/K-ras-5'. Then a 5.1 kb HindIII-KpnI fragment from pK-ras-3' was cloned into pKSII + ,
forming pKSII+/K-ras-3'. Next, a four piece ligation was performed with the following fragments
to create pK-ras-KO: a 2.8 kb NotI-XhoI fragment from pKSII+/K-ras-5', a 1.8 kb XhoI-BamHI
fragment containing PGK-neo-pA sequences from pPNT (Tybulewicz et al., 1991), a 5.1 kb
BamHI-KpnI fragment from pKSII+/pK-ras-3', and a 5.4 kb KpnI-NotI fragment containing
PGK-HSV-tk-pA sequences from pPNT.
Electroporation, Selection of ES Cell Clones, and Southern Blot Analysis
D3 ES cells (Gossler et al., 1986) were cultured and electroporated as described by Tybulewicz et
al. (Tybulewicz et al., 1991), except that primary mouse embryonic fibroblasts were used as feeder
cells. G418 (GIBCO-BRL) was used at 200 gg/ml active weight.
Individual clones were
expanded and genomic DNAs were isolated using the method of Laird et al. (Laird et al., 1991).
DNAs were digested with BamHI plus Stul and resolved on 0.8% agarose gels. Samples were
transferred onto Hybond-N (Amersham) and hybridized with the
32 p-labeled
probes indicated in
Figure 1A using Expresshyb (Clontech). ES cell clones homozygous for the null mutation
(K-ras-/ -) were created by enhanced G418 selection (Mortensen et al., 1992) of the heterozygous
(K-ras+l-) clones. K-ras+l-ES cell clones were plated at a density of 5 x 104 to 5 x 105 cells/p100
and 40 hours after plating, the medium was supplemented with G418 at concentrations ranging
124
from 200 gtg/ml to 1.0 mg/ml active weight. After 9-10 days of selection, individual clones were
expanded from those conditions under which clear selection had occurred and analyzed as above.
Confirmation of the actual configuration of the mutant allele was performed by Southern blot
analysis on multiple digest patterns using the probes described in Figure 2.1. PCR analysis was
also performed using Klentaq and the primer pairs indicated in Figure 2. 1A. Primer sequences
were as follows: 3' hom (5'-GGGATfGCAGCAATGATTTGGGGG-3'), 5'hom (5'-CCTGAA
GATCTTACTCATCAAACTG-3'), 3'neo (5'-AAGCTGACTCTAGAGGATCCCC-3'), and
5'neo (5'-ACGAGACTAGTGAGACGTGC-3'). PCR conditions were as recommended by the
manufacturer.
Generation of Chimeras
C57BL/6 blastocyst-stage embryos were injected with 10-15 K-ras+/- ES cells or 4-6 K-ras-1- ES
cells and then transferred to pseudopregnant CD1 or Swiss Webster females for further
development, essentially as described (Bradley, 1987). Chimeric mice were mated to C57BL/6
and 129/Sv animals and agouti offspring were genotyped. Germline transmission of the mutant
allele was detected by either Southern blot (as above) or PCR analysis of tail DNA obtained at
weaning.
PCR Analysis of Offspring and Embryos
Tail and yolk sac DNA was prepared using the method of Laird et al. (Laird et al., 1991). All PCR
reactions were performed under the following conditions: 10 mM Tris-HC1, pH8.3, 50 mM KC1,
2 mM MgC12, 0.001% gelatin, 0.01% NP40, 0.01% Tween-20, 0.2 mM dNTP's, and 0.2-0.4 gM
of each primer in the reaction. The annealing temperature was 60 0C for both K-ras and N-ras
PCR reactions and 30 rounds of amplification were performed. Primer sequences for K-ras
genotyping were as follows: 5'-10 (5'-AGGGTAGGTGTTGGGATAGC-3'), 3'-Exl (5'-CTCA
GTCATTTIICAGCAGGC-3'), and 3'-neo (5'-ACGAGACTAGTGAGACGTGC-3'). The primer
sequences for N-ras genotyping were: 5'WT (5'-CCCAGGATTCTTACCGAAAGC-3'), 3'WT
125
(5'-CCTGTAGAGGTTAATATCTGC-3'), and 3'MUT (5'-AATATGCGAAGTGGACCTGGG3'). Blastocysts were isolated from superovulated females as described and collected into 10 pl of
TE, pH 8.0. They were subsequently heated at 95 0C for 5 minutes, treated with Proteinase K (200
gg/ml) at 550C for 90 minutes, and were then heated at 95 0C for 5 minutes. The sample was then
split in half for K-ras and N-ras PCR analysis. PCR conditions were identical to those described
above, except that 40 rounds of amplification were performed and the annealing temperature was
58 0C.
Histological Analysis of Embryos and Yolk Sacs
Embryos were dissected free of decidua and uterine muscle and separated from the yolk sac.
Depending on the experimental procedure, either the yolk sac or embryo was saved for genotyping
by PCR. For histology, embryos (or yolk sacs) were fixed in 10% neutral buffered formalin,
dehydrated in graded solutions of alcohol, embedded in paraffin, sectioned at 4-6 gpm and stained
with hematoxylin and eosin (H & E).
Cell Death Analysis
Serial sections from E12.5 or E13.5 embryos were prepared as described above and every fifth
slide was stained with H & E. Unstained slides were deparaffinized in xylene and rehydrated
through a graded alcohol series and finally H20. Sections were then incubated with Proteinase K
(10 gg/ml) in 10 mM Tris-HC1, pH 8.0, 20 mM EDTA for 15 minutes at 25 0C, rinsed in H20,
incubated for 30 minutes at 25 0C in 3% H202, 10% MeOH, and then rinsed as before. Sections
were then pre-treated for 15 minutes at 25 0C in 1X TdT buffer (30 mM Tris, 140 mM sodium
cacodylate, 1 mM CoC12), incubated at 37 0 C for 1 hour in 1X TdT buffer, 40 pM biotin-16-dUTP
(Boehringer Mannheim), 20 units TdT (Gibco-BRL), and the reaction was stopped by washes in
2X SSC followed by PBS. The incorporated biotin-dUTP was detected using the Vectastain ABC
kit with DAB as the peroxidase substrate (both from Vector Laboratories) according to the
126
manufacturer's instructions. Sections were counterstained with 0.025% methylgreen in 0.1 M
NaOAc, pH 4.0, dehydrated, and mounted with coverslips.
Hematopoietic Progenitor Cell Analysis
E12.5 fetal livers were dissected free and collected in Iscove's modified Dulbecco's medium
(IMDM), 2% FCS, disaggregated by passage through 23 and 26 gauge needles, counted, and
plated in duplicate in a-minimal essential medium supplemented with 0.9% methylcellulose, 30%
FBS, 1%BSA, 2 mM glutamine, 0.1 mM 2-mercaptoethanol, 3 U/ml EPO and 2% pokeweed
mitogen-stimulated murine spleen cell conditioned medium (Stem-Cell Technologies, Inc.).
Colony formation was monitored at the appropriate times (CFU-E on days 2-3; BFU-E and CFUGM on days 6-8; CFU-GEMM on days 8-12), and were subsequently picked, applied to slides,
stained and examined microscopically. Yolk sac progenitor assays were performed on E9.5 and
E10.5 yolk sacs as described (Wong et al., 1986; Shivdasani et al., 1995) using the same medium
as used for fetal liver colony assays. In vivo irradiation rescues were performed essentially as
described (Till, 1961).
129/Sv E13.5 fetal livers were isolated and disaggregated as above,
counted, and injected retro-orbitally into C57BL/6 female recipient mice which had been lethally
irradiated with 1200 rads of gamma irradiation. Blood samples were collected two weeks
following injection and thereafter at one month intervals. Peripheral blood smears were examined
and GPI analysis was, also, performed to determine the percentage and timing of contribution by
donor cells.
Preparation of Blood Cell Fractions
Whole blood was collected in anticoagulant (3.8% NaCitrate) via heart puncture and diluted with 1
volume of phosphate buffered saline. Samples were then layered onto an equal volume of FicollHypaque (Histopaque-1077, Sigma) and prepared according to the manufacturer's suggestion.
Following centrifugation, fractions corresponding to platelets, monocytes, and red blood cells were
127
collected and processed as recommended. Final cell pellets were stored at -800C until they were
used for GPI or hemoglobin (RBC's) analysis.
GPI Assay
The separation and detection of GPI isoforms was performed as described (Bradley, 1987). The
tissues analyzed included: tail, bladder, colon, cecum, small intestine, stomach, pancreas, spleen,
kidney, adrenal, liver (2 different lobes), atrium, ventricle, thymus, salivary gland, lung, eye,
medulla oblongata, cerebrum, cerebellum, whole blood, RBC, lymphocytes and monocytes,
platelets, and bone marrow. Hemoglobin assays were also performed on the RBC fractions to
confirm purity and support the GPI data. This assay was performed as described (Pevny et al.,
1991; Williams et al., 1994).
Preparation of Mouse Embryonic Fibroblasts
Mouse embryonic fibroblasts (MEFs) were prepared essentially as described (Bradley, 1987) and
were maintained in DMEM supplemented with 10% heat inactivated fetal calf serum (Hyclone).
Preparation of Embryonic Tissue Extracts
Embryos were collected at E12.5 in phosphate buffered saline (PBS) and dissected free of yolk
sac and placenta. Five different tissues were dissected out, frozen immediately in a dry ice/EtOH
bath, and stored at -80 0C until further analysis. The tissues recovered included brain, liver, heart,
lung, and carcass. Yolk sacs were also retained for genotyping by PCR analysis.
Preparation of Cell Lysates
For MEFs, cells from 3-5 pl00s were washed 3 times with cold PBS, scraped from the plates,
and collected into PBS on ice. Cells were pelleted and resuspended in 1.2 ml of lysis buffer (50
mM Tris-HC1, pH 8.0, 150 mM NaC1, 5 mM MgC12, 1% Triton X-100, 0.5% sodium
deoxycholate, 0.1% SDS, 0.5 mM PMSF, 10 gpg/ml leupeptin, 10 ptg/ml aprotinin, and 10 gg/ml
128
pepstatin) using a 26 gauge needle. For E12.5 tissues, the tissues were immediately placed into
100 pl of lysis buffer and disaggregated by passage through 23 and 26 gauge needles. Extracts of
equivalent genotypes were then pooled as follows: 13 for lung, heart, and liver, and 5 for brain
and carcass. After this step, tissues and MEFs were treated identically. The lysates were
incubated for 30 minutes at 40C on a rotator, cellular debris was pelleted, and the supernatant
collected. Protein concentration was determined using the Bio-Rad detergent-compatible protein
assay system and equivalent amounts of protein for each of the three genotypes (+/+, +/-, and -/-)
were used in immunoprecipitations.
Immunoprecipitation and Western Analysis
Immunoprecipitations were performed in a final volume of 1 ml with 1-5 jIg/ml of Y13-259
antibody (Santa Cruz Biotechnology, Inc.) for 2 hours to overnight at 40 C on a rotator wheel.
Protein G PLUS-Agarose (Santa Cruz Biotechnology, Inc.) was added and incubated for 2 hours
at 40C. Immunoprecipitates were pelleted and washed as follows: 2 times with 1 ml of lysis
buffer, 2 times with 1 ml of high salt solution (1 M NaC1, 10 mM Tris-HC1, pH 7.5, and 0.5%
Triton X-100), and 2 times with 1 ml of KSCN wash (0.75 M KSCN, 10 mM Tris-HC1, pH 7.5,
and 1% Titron X-100). Complexes were resuspended in protein sample buffer, separated on 15%
SDS/PAGE gels, and transferred onto PVDF membranes using a semi-dry transfer system
(Owl). Western blot analysis was performed using an enhanced chemiluminescence system
(Amersham) according to the manufacturer's recommendations, with the following exceptions:
blocking was done in PBS, 0.2% Tween-20, 5% non-fat dry milk; washes were done in PBS,
0.2% Tween-20; primary antibodies were incubated in blocking solution at 1 gg/ml for 2 hours at
25 0C or overnight at 40 C; and the secondary anti-mouse IgG antibody conjugated to horseradish
peroxidase was incubated at a 1:7000 dilution in blocking solution for 2 hours at 25 0 C. The
primary mouse monoclonal antibodies used were K-ras (F234), N-ras (F155), H-ras (F235) (all
from Santa Cruz Biotechnology, Inc.), and pan ras (Ab2 = clone F111) (Oncogene Science).
129
Stripping of immunoblots was done by incubating the blots in 50 mM glycine, pH 2.5, 0.05%
Tween-20 for 30 minutes at 600 C.
130
References
Arai, K. I., Lee, F., Miyajima, A., Miyatake, S., Arai, N., and Yokota, T. (1990). Cytokines:
coordinators of immune and inflammatory responses. Annu Rev Biochem 783-836.
Barbacid, M. (1987). ras genes. Annu Rev Biochem 56, 779-827.
Boguski, M. S., and McCormick, F. (1993). Proteins regulating Ras and its relatives. Nature
366, 643-54.
Bollag, G., and McCormick, F. (1991). Regulators and effectors of ras proteins. Annu Rev Cell
Biol 7, 601-32.
Bos, J. L. (1988a). The ras gene family and human carcinogenesis. Mutat Res 195, 255-71.
Bos, J. L. (1988b). Ras oncogenes in hematopoietic malignancies. Hematol Pathol 2, 55-63.
Bos, J. L. (1989). ras oncogenes in human cancer: a review [published erratum appears in Cancer
Res 1990 Feb 15;50(4):1352]. Cancer Res 49, 4682-9.
Bourne, H. R., Sanders, D. A., and McCormick, F. (1990).
conserved switch for diverse cell functions. Nature 348, 125-32.
The GTPase superfamily: a
Bradley, A. (1987). In Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.
J. Robertson, eds. (Oxford: IRL, Press), pp. 113-152.
Capon, D. J., Seeburg, P. H., McGrath, J. P., Hayflick, J. S., Edman, U., Levinson, A. D., and
Goeddel, D. V. (1983). Activation of Ki-ras2 gene in human colon and lung carcinomas by two
different point mutations. Nature 304, 507-13.
Chesa, P. G., Rettig, W. J., Melamed, M. R., Old, L. J., and Niman, H. L. (1987). Expression of
p2lras in normal and malignant human tissues: lack of association with proliferation and
malignancy. Proc Natl Acad Sci U S A 84, 3234-8.
Daum, G., Eisenmann, T. I., Fries, H. W., Troppmair, J., and Rapp, U. R. (1994). The ins and
outs of Raf kinases. Trends Biochem. Sci. 19, 474-480.
Davis, R. J. (1994). MAPKs: new JNK expands the group. Trends Biochem Sci 19, 470-473.
Downward, J. (1992a). Regulation of p2lras by GTPase activating proteins and guanine
nucleotide exchange proteins. Curr Opin Genet Dev 2, 13-8.
Downward, J. (1992b). Regulatory mechanisms for ras proteins. Bioessays 14, 177-84.
Duffy, J. B., and Perrimon, N. (1996). Recent advances in understanding signal transduction
pathways in worms and flies. Curr Opin Cell Biol 8, 231-238.
Dzierzak, E., and Medvinsky, A. (1995). Mouse embryonic hematopoiesis. Trends Genet 11,
359-366.
131
Ellis, R. W., Defeo, D., Shih, T. Y., Gonda, M. A., Young, H. A., Tsuchida, N., Lowy, D. R.,
and Scolnick, E. M. (1981). The p21 src genes of Harvey and Kirsten sarcoma viruses originate
from divergent members of a family of normal vertebrate genes. Nature 292, 506-11.
Furth, M. E., Aldrich, T. H., and Cordon, C. C. (1987).
proteins in normal human tissues. Oncogene 1, 47-58.
Expression of ras proto-oncogene
George, D. L., Scott, A. F., Trusko, S., Glick, B., Ford, E., and Dorney, D. J. (1985). Structure
and expression of amplified cKi-ras gene sequences in Y1 mouse adrenal tumor cells. Embo J 4,
1199-203.
Gibbs, J. B. (1991). Ras C-terminal processing enzymes--new drug targets? Cell 65, 1-4.
Gibbs, J. B., Oliff, A., and Kohl, N. E. (1994). Farnesyltransferase inhibitors: Ras research
yields a potential cancer therapeutic. Cell 77, 175-8.
Glomset, J. A., and Farnsworth, C. C. (1994). Role of protein modification reactions in
programming interactions between ras-related GTPases and cell membranes. Annu Rev Cell Biol
10, 181-205.
Gossler, A., Doetschman, T., Korn, R., Serfling, E., and Kemler, R. (1986). Transgenesis by
means of blastocyst-derived embryonic stem cell lines. Proc Natl Acad Sci U S A 83, 9065-9.
Hancock, J. F. (1993). Anti-Ras drugs come of age. Curr Biol 3, 770-772.
Hancock, J. F., Cadwallader, K., Paterson, H., and Marshall, C. J. (1991). A CAAX or a CAAL
motif and a second signal are sufficient for plasma membrane targeting of ras proteins. Embo J
10, 4033-9.
Hancock, J. F., Magee, A. I., Childs, J. E., and Marshall, C. J. (1989). All ras proteins are
polyisoprenylated but only some are palmitoylated. Cell 57, 1167-77.
Hancock, J. F., Paterson, H., and Marshall, C. J. (1990). A polybasic domain or palmitoylation is
required in addition to the CAAX motif to localize p2lras to the plasma membrane. Cell 63,
133-9.
James, G. L., Goldstein, J. L., and Brown, M. S. (1995). Polylysine and CVIM sequences of KRasB dictate specificity of prenylation and confer resistance to benzodiazepine peptidomimetic in
vitro. J Biol Chem 270, 6221-6226.
Kataoka, T., Powers, S., McGill, C., Fasano, O., Strathern, J., Broach, J., and Wigler, M. (1984).
Genetic analysis of yeast RAS 1 and RAS2 genes. Cell 37, 437-45.
Kawamura, M., Kaibuchi, K., Kishi, K., and Takai, Y. (1993). Translocation of Ki-ras p2 1
between membrane and cytoplasm by smg GDS. Biochem Biophys Res Commun 190, 832-41.
Kayne, P. S., and Sternberg, P. W. (1995). Ras pathways in Caenorhabditis elegans. Curr Opin
Genet Dev 5, 38-43.
132
Khosravi, F. R., Cox, A. D., Kato, K., and Der, C. J. (1992). Protein prenylation: key to ras
function and cancer intervention? Cell Growth Differ 3, 461-9.
Khosravi, F. R., and Der, C. J. (1994). The Ras signal transduction pathway. Cancer Metastasis
Rev 13, 67-89.
Kinoshita, T., Yokota, T., Arai, K., and Miyajima, A. (1995). Suppression of apoptotic death in
hematopoietic cells by signalling through the IL-3/GM-CSF receptors. Embo J 14, 266-275.
Kohl, N. E., Omer, C. A., Conner, M. W., Anthony, N. J., Davide, J. P., deSolms, S. J., Giuliani,
E. A., Gomez, R. P., Graham, S. L., Hamilton, K., and et, a. 1. (1995). Inhibition of
farnesyltransferase induces regression of mammary and salivary carcinomas in ras transgenic
mice. Nat Med 1, 792-797.
Laird, P. W., Zijderveld, A., Linders, K., Rudnicki, M. A., Jaenisch, R., and Berns, A. (1991).
Simplified mammalian DNA isolation procedure. Nucleic Acids Res 19, 4293.
Lemoine, N. R., Mayall, E. S., Wyllie, F. S., Williams, E. D., Goyns, M., Stringer, B., and
Wynford, T. D. (1989). High frequency of ras oncogene activation in all stages of human thyroid
tumorigenesis. Oncogene 4, 159-64.
Leon, J., Guerrero, I., and Pellicer, A. (1987). Differential expression of the ras gene family in
mice. Mol Cell Biol 7, 1535-40.
Lerner, E. C., Qian, Y., Blaskovich, M. A., Fossum, R. D., Vogt, A., Sun, J., Cox, A. D., Der, C.
J., Hamilton, A. D., and Sebti, S. M. (1995a). Ras CAAX peptidomimetic FTI-277 selectively
blocks oncogenic Ras signaling by inducing cytoplasmic accumulation of inactive Ras-Raf
complexes. J Biol Chem 270, 26802-26806.
Lerner, E. C., Qian, Y., Hamilton, A. D., and Sebti, S. M. (1995b). Disruption of oncogenic KRas4B processing and signaling by a potent geranylgeranyltransferase I inhibitor. J Biol Chem
270, 26770-26773.
Manne, V., Yan, N., Carboni, J. M., Tuomari, A. V., Ricca, C. S., Brown, J. G., Andahazy, M.
L., Schmidt, R. J., Patel, D., Zahler, R., and et, a. 1. (1995). Bisubstrate inhibitors of
farnesyltransferase: a novel class of specific inhibitors of ras transformed cells. Oncogene 10,
1763-1779.
Mansour, S. L., Thomas, K. R., and Capecchi, M. R. (1988). Disruption of the proto-oncogene
int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to nonselectable genes. Nature 336, 348-52.
Marshall, C. J. (1993). Protein prenylation: a mediator of protein-protein interactions. Science
259, 1865-6.
McCormick, F. (1994). Activators and effectors of ras p21 proteins. Curr Opin Genet Dev 4,
71-6.
133
McGrath, J. P., Capon, D. J., Smith, D. H., Chen, E. Y., Seeburg, P. H., Goeddel, D. V., and
Levinson, A. D. (1983). Structure and organization of the human Ki-ras proto-oncogene and a
related processed pseudogene. Nature 304, 501-6.
Mizuno, T., Kaibuchi, K., Yamamoto, T., Kawamura, M., Sakoda, T., Fujioka, H., Matsuura, Y.,
and Takai, Y. (1991). A stimulatory GDP/GTP exchange protein for smg p21 is active on the
post-translationally processed form of c-Ki-ras p21 and rhoA p21. Proc Natl Acad Sci U S A 88,
6442-6.
Mortensen, R. M., Conner, D. A., Chao, S., Geisterfer, L. A., and Seidman, J. G. (1992).
Production of homozygous mutant ES cells with a single targeting construct. Mol Cell Biol 12,
2391-5.
Muller, R., Slamon, D. J., Adamson, E. D., Tremblay, J. M., Muller, D., Cline, M. J., and
Verma, I. M. (1983). Transcription of c-onc genes c-rasKi and c-fms during mouse
development. Mol Cell Biol 3, 1062-9.
Muller, R., Slamon, D. J., Tremblay, J. M., Cline, M. J., and Verma, I. M. (1982). Differential
expression of cellular oncogenes during pre- and postnatal development of the mouse. Nature
299, 640-4.
Nakanishi, H., Kaibuchi, K., Orita, S., Ueno, N., and Takai, Y. (1994). Different functions of
Smg GDP dissociation stimulator and mammalian counterpart of yeast Cdc25. J. Biol. Chem.
269, 15085-91.
Orita, S., Kaibuchi, K., Kuroda, S., Shimizu, K., Nakanishi, H., and Takai, Y. (1993).
Comparison of kinetic properties between two mammalian ras p21 GDP/GTP exchange proteins,
ras guanine nucleotide-releasing factor and smg GDP dissociation stimulation. J Biol Chem 268,
25542-6.
Orkin, S. H. (1995). Hematopoiesis: how does it happen? Current Opinion in Cell Biology 7,
870-7.
Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S. F., D'Agati, V., Orkin, S. H., and
Costantini, F. (1991). Erythroid differentiation in chimaeric mice blocked by a targeted mutation
in the gene for transcription factor GATA- 1. Nature 349, 257-60.
Powers, S., Kataoka, T., Fasano, O., Goldfarb, M., Strathern, J., Broach, J., and Wigler, M.
(1984). Genes in S. cerevisiae encoding proteins with domains homologous to the mammalian
ras proteins. Cell 36, 607-12.
Reiss, Y., Goldstein, J. L., Seabra, M. C., Casey, P. J., and Brown, M. S. (1990). Inhibition of
purified p21ras farnesyl:protein transferase by Cys-AAX tetrapeptides. Cell 62, 81-8.
Robb, L., Lyons, I., Li, R., Hartley, L., Kontgen, F., Harvey, R. P., Metcalf, D., and Begley, C. G.
(1995). Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene.
Proc Natl Acad Sci U S A 92, 7075-7079.
134
Satoh, T., Nakafuku, M., and Kaziro, Y. (1992). Function of Ras as a molecular switch in signal
transduction. J Biol Chem 267, 24149-52.
Shimizu, K., Birnbaum, D., Ruley, M. A., Fasano, O., Suard, Y., Edlund, L., Taparowsky, E.,
Goldfarb, M., and Wigler, M. (1983). Structure of the Ki-ras gene of the human lung carcinoma
cell line Calu- 1. Nature 304, 497-500.
Shivdasani, R. A., Mayer, E. L., and Orkin, S. H. (1995). Absence of blood formation in mice
lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature 373, 432-434.
Sun, J., Qian, Y., Hamilton, A. D., and Sebti, S. M. (1995). Ras CAAX peptidomimetic FTI
276 selectively blocks tumor growth in nude mice of a human lung carcinoma with K-Ras
mutation and p53 deletion. Cancer Res 55, 4243-4247.
Takai, Y., Kaibuchi, K., Kikuchi, A., and Kawata, M. (1992). Small GTP-binding proteins. Int
Rev Cytol 187-230.
Till, J. E. a. M., E.A. (1961). Radiation Research. 14, 213.
Towatari, M., May, G. E., Marais, R., Perkins, G. R., Marshall, C. J., Cowley, S., and Enver, T.
(1995). Regulation of GATA-2 phosphorylation by mitogen-activated protein kinase and
interleukin-3. J Biol Chem 270, 4101-4107.
Tsai, F. Y., Keller, G., Kuo, F. C., Weiss, M., Chen, J., Rosenblatt, M., Alt, F. W., and Orkin, S.
H. (1994). An early haematopoietic defect in mice lacking the transcription factor GATA-2.
Nature 371, 221-226.
Tybulewicz, V. L., Crawford, C. E., Jackson, P. K., Bronson, R. T., and Mulligan, R. C. (1991).
Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl protooncogene. Cell 65, 1153-63.
Ulsh, L. S., and Shih, T. Y. (1984). Metabolic turnover of human c-rasH p21 protein of EJ
bladder carcinoma and its normal cellular and viral homologs. Mol Cell Biol 4, 1647-52.
Umanoff, H., Edelmann, W., Pellicer, A., and Kucherlapati, R. (1995). The murine N-ras gene is
not essential for growth and development. Proc Natl Acad Sci U S A 92, 1709-1713.
Warren, A. J., Colledge, W. H., Carlton, M. B., Evans, M. J., Smith, A. J., and Rabbitts, T. H.
(1994). The oncogenic cysteine-rich LIM domain protein rbtn2 is essential for erythroid
development. Cell 78, 45-57.
Wassarman, D. A., Therrien, M., and Rubin, G. M. (1995).
Drosophila. Curr Opin Genet Dev 5, 44-50.
The Ras signaling pathway in
Williams, B. O., Schmitt, E. M., Remington, L., Bronson, R. T., Albert, D. M., Weinberg, R. A.,
and Jacks, T. (1994). Extensive contribution of Rb-deficient cells to adult chimeric mice with
limited histopathological consequences. Embo J 13, 4251-4259.
135
Williams, G. T., Smith, C. A., Spooncer, E., Dexter, T. M., and Taylor, D. R. (1990).
Haemopoietic colony stimulating factors promote cell survival by suppressing apoptosis. Nature
343, 76-9.
Willumsen, B. M., Papageorge, A. G., Kung, H. F., Bekesi, E., Robins, T., Johnsen, M., Vass,
W. C., and Lowy, D. R. (1986). Mutational analysis of a ras catalytic domain. Mol Cell Biol 6,
2646-54.
Wittenberg, C., and Reed, S. I. (1996). Plugging it in: signaling circuits and the yeast cell cycle.
Curr Opin Cell Biol 8, 223-230.
Wong, P. M., Chung, S. W., Chui, D. H., and Eaves, C. J. (1986). Properties of the earliest
clonogenic hemopoietic precursors to appear in the developing murine yolk sac. Proc Natl Acad
Sci USA 83, 3851-4.
Yamauchi, N., Kiessling, A. A., and Cooper, G. M. (1994). The Ras/Raf signaling pathway is
required for progression of mouse embryos through the two-cell stage. Mol Cell Biol 14, 66556662.
136
Chapter 3
Analysis of an Oncogenic Allele of K-ras in the Initiation and Progression of
Tumorigenesis in the Mouse via a Novel Approach
137
Abstract
Ras genes are critical in the regulation of normal and neoplastic cell growth. Mutational activation
of Ras leads to altered growth control and occurs in -30% of all human cancers. K-ras is the
most frequently mutated member in this gene family and is commonly associated with
adenocarcinomas of the pancreas, colon, and lung. To elucidate further the role of K-ras in the
initiation and progression of tumorigenesis, I have created a mouse strain carrying a spontaneously
activatable allele of K-ras through a novel variation of the hit-and-run gene targeting strategy. ES
cells carrying a disruption of one allele of the K-ras gene were generated via gene targeting by a
single reciprocal recombination event. The resulting insertion allele was composed, in part, of an
additional copy of exon 1 in which an activating mutation (Asp 12 ) had been introduced.
Spontaneous resolution of this duplication via intrachromosomal recombination will produce an
oncogenic allele of K-ras that differs from wild-type by only the introduced point mutations. This
"run" step was performed in tissue culture, but in addition, an innovative approach was taken in
which the resolution was allowed to occur in vivo. ES cell clones carrying the targeted insertion
were used to generate germline chimeras and established mouse lines. Because every cell in the
developing and adult mouse carried the insertion mutant allele, this recombination event was
expected to occur broadly and predispose the mice to a wide range of tumor types. Indeed, mice
carrying the mutant allele are highly susceptible to lung tumors and lymphoma, with an onset as
early as 3 months of age.
These animals should prove invaluable for testing various
environmental and genetic factors that may cooperate with an oncogenic K-ras allele to promote
tumorigenesis. In addition, they should provide an excellent model system for screening potential
chemotherapeutic drugs designed to inhibit the transforming activity of oncogenic K-ras.
138
Introduction
Over the past several years, a considerable amount of epidemiological and experimental evidence
has implicated a pivotal function for oncogenic Ras mutants in the development of human cancers.
First, oncogenic ras mutations have been detected in -30% of all human tumors (Bos, 1989;
Khosravi and Der, 1994).
Those tumor types most frequently associated with mutated ras alleles
include hematological disorders of the myelomonocytic lineage as well as carcinomas. In contrast,
oncogenic ras mutations are rare in tumors of neuroectodermal origin and more differentiated
lymphoid malignancies, suggesting that ras does not play an important role in the development of
these tumor types. Second, the biological differences between normal Ras proteins and their
oncogenic counterparts have been extensively documented in in vitro cell culture systems.
Depending upon the cell type, expression of oncogenic, but not normal, Ras proteins can either
induce cellular proliferation and malignant transformation (e.g., rodent cell lines such as NIH/3T3
or Rat-i fibroblasts) or differentiation and growth inhibition (e.g., the PC12 pheochromocytoma
cell line) (Barbacid, 1987). Third, mice engineered to harbor oncogenic alleles of ras, either
through transgenic or retroviral infection approaches, display increased incidences of tumor
formation (Adams and Cory, 1991). Finally, specific activating ras mutations are reproducibly
and frequently associated with carcinogen- and radiation-induced tumors in rodent model systems
(Guerrero and Pellicer, 1987; Mangues and Pellicer, 1992).
However, ras mutation is not the only defect associated with the development of a
particular tumor. Indeed, most cancers are a multistep process, resulting from the accumulation of
independent genetic events (Weinberg, 1989; Vogelstein and Kinzler, 1993). Moreover, the
progressive development of aneuploidy during tumorigenesis suggests that many of the
aberrations observed in tumor cells may be a secondary consequence of the genomic instability
that may occur subsequent to an already established malignancy. Therefore, the precise role that
ras genes play in tumorigenesis has been difficult to evaluate. The evidence discussed above
suggests that ras mutations play a causative role in neoplastic development rather than occurring as
139
a consequence of the process. Indeed, ras mutation has been implicated as an early event in the
development of multiple tumor types (Barbacid, 1987; Bos, 1988; Vogelstein et al., 1988). Two
of the best characterized systems for this analysis are the mouse skin carcinogenesis and human
colorectal cancer models (Fearon and Vogelstein, 1990; Hennings et al., 1993; Yuspa, 1994).
Because these tumors evolve through well-defined morphological stages, it has been possible to
establish the order in which genetic alterations occur. In each system, ras mutations have been
associated with both benign and malignant stages of the neoplasm at equally high frequencies
(90% of skin papillomas and carcinomas; 50% of colonic adenomas and carcinomas), suggesting
that ras activation occurs early in tumorigenesis. In skin carcinogenesis models, activation of the
H-ras gene is thought to be an initiating event following treatment with a mutagen (e.g., DMBA)
(Balmain et al., 1984; Quintanilla et al., 1986). These "initiated" cells lie dormant and, importantly,
do not exhibit neoplastic properties unless they are induced to proliferate, either through treatment
with a tumor promoter (e.g., TPA) or by a natural growth-promoting stimulus such as wounding
(Brown et al., 1986). During promotion, the initiated cells are thought to possess a growth
advantage, with their proliferation resulting in the formation of a benign papilloma. Over time,
papillomas acquire additional genetic alterations and progress into malignant carcinomas of
varying morphological stages (Bremner and Balmain, 1990).
In colorectal cancer, alterations in both APC and K-ras have been implicated in its early
stages. However, the initiating event appears to be mutation of the APC gene (Powell et al., 1992).
Mutations in APC have been found in the majority of all colon cancers, including both sporadic
and familial cases. Indeed, mutations in APC have been shown to be responsible for the familial
adenomatous polyposis (FAP) syndrome in humans, with loss of heterozygosity at the APC locus
occuring frequently in the development of adenomas (Groden et al., 1991; Nishisho et al., 1991;
Powell et al., 1993; Levy et al., 1994). Further analysis of multiple benign lesions (including both
aberrant crypt foci and polyps) has revealed that mutation of the APC locus is closely associated
with dysplasia, defined by a disruption in normal morphology and considered to be a hallmark of
malignant potential (Jen et al., 1994). In contrast, activation of K-ras is more frequently associated
140
with non-dysplastic lesions, in particular, aberrant crypt foci, which have an apparently limited
potential to progress to larger tumors (Jen et al., 1994; Smith et al., 1994; Yamashita et al., 1995).
Interestingly, only those dysplastic lesions that carried both APC and K-ras mutations were
classifed as adenomas in these studies. Thus, these models provide evidence that ras oncogenes
have an important role in both the initiation and progression of tumorigenesis. Importantly,
however, activation of Ras is insufficient for full transformation and requires the presence of
cooperating genetic events. In addition, the order in which these genetic events occur appears to
have a significant impact on both tumor morphology and progression.
We are interested in trying to create a better animal model with which to study the role of
oncogenic Ras, K-ras in particular, in the initiation and progression of tumorigenesis. K-ras is the
most frequently mutated member of the gene family, particularly in adenocarcinomas of the
pancreas (-80%), colon (-50%), and lung (-25-50%) (Bos et al., 1987; Forrester et al., 1987;
Vogelstein et al., 1988; Bos, 1989; Pellegata et al., 1994; Mills et al., 1995). These are three very
common and clinically important tumor types, and an accurate animal model of the diseases would
prove invaluable in the development of drugs for their treatment. In addition, I have recently
demonstrated that K-ras has a unique role during normal mouse development (Chapter 2); thus,
this may be true in tumor development as well.
A number of different animal models have been developed to analyze the function of
oncogenic Ras in the mouse. All of these models have been made through the use of transgenics
and have a number of disadvantages associated with them (Adams and Cory, 1991). First, many
of the existing transgenic strains have specifically looked at oncogenic H-ras. The best known of
these, the OncomouseTM, carries an activated H-ras gene driven by the mouse mammary tumor
virus (MMTV) promoter (Sinn et al., 1987). For the reasons listed above, it is important to look at
activated K-ras in much more detail. This is underscored by the fact that the transforming ability
of tumor cells harboring an activated allele of K-ras are harder to inhibit with existing
chemotherapeutic agents than are tumor cells carrying oncogenic H-ras (James et al., 1995; Lerner
et al., 1995a; Lerner et al., 1995b; Manne et al., 1995; Sun et al., 1995). A second problem
141
associated with the use of transgenes to deliver oncogenic Ras to the cell is their use of an artificial
promoter to direct their expression to a specific tissue. Due to both the promoter strength and copy
number of integrants, this results in an expression level of Ras that is much higher than the
observed endogenous levels in both normal and tumor cells. This is important since the level of
oncogenic Ras appears to modulate its transforming potency and is frequently auqmented late in
tumor progression (Barbacid, 1987; Bos, 1988; Finney and Bishop, 1993). In addition, it is
possible that drugs that would be effective against oncogenic Ras expressed under its normal
physiological constraints may fail to work if the protein were expressed at artificially high levels.
Thirdly, the mutant Ras protein is expressed in every cell of the affected tissue in the transgenic
strain. This is in contrast to what normally occurs during tumorigenesis, in which a clone of cells
harboring a mutation in ras would be surrounded by neighboring cells with normal Ras function.
It is well known that the transformed properties of tumor cells can be affected through their
interactions with neighboring cells. Indeed, normal cells can inhibit the transformed phenotype of
ras-transfectedcells, but only when plated at a high cell density (Spandidos, 1986). Finally, the
transgenic Ras strains have all targeted ras expression to a specific tissue, and thus the observed
pathological consequences and tumor spectrums are limited with respect to each strain. In
addition, the choice of promoter driving the transgene does not assure its expression in the
appropriate target cell of the tissue, especially since the target cell of many tumors is not well
defined. Since ras mutations are associated with a wide range of tumor types, an ideal animal
model would show a broad tumor spectrum, each initiating from the correct target cell.
I have attempted to address these and related issues by creating a mouse strain that
overcomes all of the problems described above. Using a novel variation of the hit-and-run gene
targeting strategy (Hasty et al., 1991), I have created a strain of mice carrying a spontaneously
activatable allele of oncogenic K-ras in all cells of the animal.
An intrachromosomal
recombination event is necessary to activate this allele and is expected to occur at some stochastic
frequency in all cells of the developing and adult mouse. Importantly, because the mutation is
targeted to the K-ras locus, the oncogenic allele is expressed under its own promoter and positional
142
constraints. Mice carrying this latent allele are expected to be predisposed to a wide range of tumor
types, and indeed, I show that these mice are highly prone to, at least, lung tumors and thymic
lymphomas.
143
Results
Generation of ES Cells Carrying a Spontaneously Activatable Allele of K-ras
Figure 3.1B shows a schematic representation of the hit-and-run targeting procedure used to
generate mouse embryonic stem (ES) cells carrying a spontaneously activatable allele of K-ras.
This procedure consists of two steps of homologous recombination events that are normally
facilitated by the presence of positive (hit step) and negative (run step) selection in vitro (Hasty et
al., 1991; Hasty and Bradley, 1993). We have attempted a novel variation of this strategy in which
the "run" step was allowed to occur spontaneously in the mouse. The insertion allele generated
following the "hit" step is expected to be inactive and in order to restore a functional and oncogenic
allele of K-ras, the intrachromosomal recombination event (run step) must occur. Due to the
stochastic nature of this event occurring in the cells of the animal, I refer to this allele as the K-ras
latent allele. In addition, I have also applied the standard negative selection in vitro to select for ES
cells that have undergone the intrachromosomal recombination to generate a functional oncogenic
allele of K-ras, and I, therefore, refer to this as the K-ras activated allele. Hereafter, the K-ras
latent and activated alleles are referred to as K-rasD 12 -L and K-ras D12-A, respectively.
In order to generate ES cells carrying an insertion allele that was applicable to study the
"run" step both in vivo and in vitro, two different targeting constructs carrying an activating
mutation in K-ras were designed. Figure 3.1A shows the mutations that were incorporated into
each K-ras targeting vector. Through site-directed mutagenesis, I converted the glycine residue at
codon 12 to an aspartic acid residue. This is a known oncogenic mutation in Ras and is commonly
found in multiple tumor types in both humans and rodents (Guerrero and Pellicer, 1987; Bos,
1989; Mangues and Pellicer, 1992). Because this mutation was not identifiable with a restriction
enzyme, a unique HindIII site was also introduced 20 nucleotides upstream from the activating
mutation to facilitate screening for targeted events. However, unlike the Asp 12 mutation, this
alteration did not result in an amino acid change at position 5.
144
Figure 3.1
A.
codon:
1
2
3
4
5
6
7
8
9
10
11
12
13
wild type: ATG ACT GAG TAT AAA CTT GTG GTG GTT GGA GCT GGT GGC
activated: ATG ACT GAG TAT AAG CTT GTG GTG GTT GGA GCT GAT GGC
I
HindIl
I
G--D
i
Figure 3.1. Strategy for creating activatable alleles of K-ras.
A. Genomic sequence comparison between the wild-type and mutant allele of K-ras from
codons 1 to 13 of exon 1. Using site-directed mutagenesis, two alterations were made.
Without changing the amino acid at position 5, a unique HindIII site was created to
facilitate the screening of ES cell clones for targeted events. The second mutation
converted Gly 1 2 to Asp and is oncogenic.
B. Diagram represents the hit-and-run targeting approach that was used to introduce the
activating mutation into K-ras. The initial targeting event occurs via a single reciprocal
recombination between the K-ras gene and the insertion vector. Both insertion vectors
were comprised of K-ras exon 1 and flanking sequences (denoted by M and N boxes)
carrying the alterations described above (a ^ represents the HindIII mutation and an *
represents the Asp 12 mutation). For the K-rasD12 -A allele, both the neo and tk selectable
markers (as is shown) were included in the insertion vector outside of the region of
homology. In contrast, the K-rasD1 2 -L allele targeting vector only contained the neo
selectable marker. To direct integration, both vectors were linearized at a unique XhoI
site contained within the region of homology. A correctly targeted cell will become
G418-resistant (G418 r ) and, in the case of K-rasD12 -A, gancyclovir-sensitive (GANC s )
and will carry a duplication of the homologous sequences. Due to the insertion sequences,
it is expected that this mutant allele will be non-functional. For the run step, either an
intrachromatid recombination (depicted) or an unequal sister chromatid exchange within
the duplicated sequences will result in the restoration of a functional K-ras allele.
Depending upon which side of the mutation that the recombination occurs, either the
desired mutation will be incorporated, as is shown, or a wild-type K-ras allele will be
restored. For the K-rasD1 2 -A allele, these "pop-out" events were selected for by placing
the cells into medium supplemented with gancyclovir. Cells which have correctly excised
the selectable markers are G418 s , GANCr. In contrast, ES cells correctly targeted for the
K-rasD12 -L allele were directly used to generate mice where the run step is expected to
occur at some stochastic frequency in all cells of the animal.
Figure 3.1
B.
X
XhoI
Ex I
G418rGANCS
neo NTR I tk [
,.,•
m-
Intrachromosomal
Recombination
Latent Allele = in vivo
Activated Allele = in vitro
G418sGANCr
'''"~"''
toe
I,In
"""":"
Irr
Al· ~
~U-l
LlrXL
I~a
~I
-
The two targeting constructs are virtually identical except for the presence of the negative
selectable marker, the tk gene, in the K-rasD12 -A allele vector. This marker was included to
facilitate the identification of clones that had undergone the intrachromosomal recombination (run
step) in vitro. However, since this process will occur in the mouse with the K-rasD12 -L allele, this
marker was not necessary. In addition, this version of the tk gene causes sterility when expressed
in the germ line of male mice, and therefore, was excluded from the K-rasD12 -L allele targeting
vector.
The genomic structure for each allele following a correctly targeted insertional
recombination is diagrammed in Figure 3.2. As stated above, it is expected that these alleles of
K-ras will be inactive due to the presence of the insertion sequences.
Following introduction of the two different targeting vectors into 129/Sv D3 ES cells, the
resulting G418 r clones were screened for targeted events by Southern blot analysis using a probe
located 5' to the sequences present in the targeting vectors. This probe detects a 12.1 kilobase (kb)
BamHI to KpnI fragment from wild-type DNA and an additional 9.1 kb BamHI mutant-specific
fragment (Figure 3.2 and data not shown). As shown in Table 3.1, -20% of K-rasD12 -L and
-40% of K-rasD12-A ES cell clones screened had acquired the desired sequences by homologous
recombination as detected by the 5' probe and were, therefore, heterozygous for the mutant allele.
To verify the presence of the HindIII mutation in the targeted clones, Southern blotting was
performed using a 5' probe contained within the duplicated sequences. This analysis demonstrated
that the HindIII mutation had integrated into none, one, or both of the duplicates for each allele
(Figure 3.3). This variation in the integration pattern is expected and is associated with gap
formation and repair, mismatch heteroduplex repair, and the branch migration of Holliday
junctions during the initial insertional recombination event (Hasty and Bradley, 1993). As
summarized in Table 3.1, all possible integration patterns were recovered with the K-rasD12 -L
allele, whereas only three of the four possibilities were obtained with the K-rasD12 -A allele.
Because the vectors were linearized 3' to the mutation, the highest expected pattern of integration
would be one in which the mutation is present only in the 3' duplicate (i.e., -/+). Indeed, this was
observed, with -50% of targeted clones for each allele exhibiting a -/+ (5'/3') integration pattern
147
Figure 3.2. Genomic configurations of the K-rasD12-L and K-rasD12 -A alleles following
insertional recombination.
Following integration into the K-ras locus, both alleles carry a duplication of exon 1 and the
flanking sequences (represented by the shaded boxes) contained within the targeting vector. The
extent of homology on either side of the mutations is 3.2 kb. The K-rasD12-L allele also carries a
Pgk-1 promoter driven neo gene, which terminates with the Pgk-1 derived polyadenylation signal.
In contrast, both the neo and tk selectable markers are present in the K-rasD12-A allele. A single
Pgk-1 promoter was used to drive the expression of both genes. In between the two marker
genes, the vector includes a 5' non-translated (NTR) fragment containing an internal ribosomal
entry site, which allows efficient translation of the tk gene from the bicistronic message. In
addition, two polyadenylation signals are included at the 3' end of the tk gene. In this
configuration, both alleles should be non-functional.
Based on the site of linearization within the homologous sequences, the expected pattern of
integration would position the mutations in the 3' duplicate, as is shown. The positions of the
probes used in this study are shown. Also represented are the expected fragments in targeted
clones heterozygous for the insertion following digestion with BamHI (B) + KpnI (K) and
detection with the 5' external probe. In addition, the expected fragments detected using the 5'
internal probe following a HindIII (H)+ KpnI (K) are also depicted for all integration patterns and
are the same for both mutant alleles. ^ indicates the targeted HindIII mutation and * represents the
Asp 12 mutation.
148
eq
L
I$I
x
x
4I
EP
~Cj
?r:
fP
EQ
E9
~1
?C
SC
c~l
W
iiiii
:::::
:·:·:
r(
iI
x
w
e:
ijijj
:':':
W
x
·Q
cy
hi
cr
I
I
I
0d
Table 3.1. Summary of Targeting Frequencies and Integration Patterns.
Allele
# G418 r
clones
screened
# targeted
clones
Latent
229
45
12
2
24
2
(19.7%)
(26.7%)
(4.4%)
(53.3%)
(4.4%)
# of targeted clones exhibiting each of the
predicted integration patterns for HindIII
-,+
+,+
-,+,-
*5/45 (11.1%) contained >1 copy
Activated
176
68
(38.6%)
25
(36.8%)
0
(0.0%)
30
(44.1%)
1
(1.5%)
*10/68 (14.7%) contained >1 copy
*2/68 (2.9%) were aberrant integrants
The number of correctly targeted G418 r clones was determined by Southern blot analysis
using a probe 5' to the region of homology. These clones were subsequently screened by
Southern blotting using a 5' internal probe to determine the presence of the HindIII
mutation in each duplicate. The integration patterns for each duplicate are depicted as 5', 3'
with a + indicating the presence of the HindIII site. The highest expected integration
pattern (-,+) was the most frequently represented event of the four. Some clones were
found to have integrated more than one copy of the vector and their frequencies are also
noted.
150
Activated Allele
Latent Allele
I
5' copy:
3' copy:
wt+5'wt 5'mut 3'wt3'mut -
+
..
+
+
+
+
+
I
+
+
wowllrgeCg
+)~ +·- t
-
+
+
Figure 3.3. Observed integration patterns in targeted K-ras clones.
A representative subset of targeted clones from both alleles was digested with HindIII + KpnI and
analyzed by Southern blotting using the 5' internal probe shown in Figure 3.2. The integration
pattern for each clone is labelled above its respective lane, with a + sign indicating the presence of
the HindIII mutation in the listed duplicate. The fragments for the wild-type allele as well as for
each duplicate are identified to the left, with wt referring to a wild-type digestion pattern (i.e., no
HindIII site) and mut. indicating that the HindIII site is present. The sizes of each of the fragments
are as follows: wt and 5' wt copy are -10 kb, 5' mut copy is -8.9 kb, 3' wt copy is 7.2 kb, and the
3' mut copy is 6.1 kb.
151
for the HindIII mutation. Clones that had not incorporated the mutation into either duplicate (due
to repair) were also frequently represented, whereas resolution of branch migration events in the 5'
duplicate was more rare. This is not surprising, since the mutation was positioned 1.5 kb from the
site of linearization, a distance that is sufficiently far enough away from the double strand break
such that branch migration across the mutation will occur less frequently (Hasty and Bradley,
1993).
In addition, all targeted clones were verified for legitimate recombination at their 3' ends
as well as for the number of copies that had integrated into the locus (data not shown). All clones
that were found to have integrated aberrantly or in multiple copies were not used in the subsequent
run step.
Genomic sequence analysis was performed to determine whether the Asp 12 mutation had
co-integrated with the HindIII mutation. As shown in Figure 3.4, this analysis confirmed the
presence of the HindIII A-to-G mutation at nucleotide 15 in those clones that had previously
revealed its existence by Southern blotting. In addition, only those clones that had integrated a
HindIII mutation into at least one of the duplicates also showed the presence of the G-to-A
transition at nucleotide 35 (the nucleotide responsible for the Asp12 mutation). Moreover, based
on the intensity of the nucleotide signals, the Asp 12 and HindIII mutations were always present in
equal copy numbers (Figure 3.4 and data not shown). This suggests that the two mutations
always co-integrated into the same duplicate(s). However, I can not distinguish between clones
that had integrated one copy of each mutation into either the same or distinct duplicates.
Creation of ES Cells Heterozygous for an Oncogenic Allele of K-ras Through
Intrachromosomal Recombination of the K-rasD12 -A Allele in vitro.
To create a functionally oncogenic allele of K-ras, an intrachromosomal recombination event must
occur between the duplicated sequences that simultaneously excises the vector DNA containing the
selectable markers. This can occur through either an intrachromatid recombination (depicted in
Figure 3.1B) or an unequal sister-chromatid exchange. The ideal clone for negative selection is
one that has the mutation present in both duplicates. Thus, irrespective of the position of the
152
I-
Activated
I
Latent
I
g
:12 ;->D
:5', 3' HindIII
wt DNA
113
G ATC GA TCGATC
GATCGATCGATCGA
TC
Figure 3.4. The aspartic acid and HindIII mutations appear to co-integrate.
Genomic DNAs from the clones shown in Figure 3.3 were sequenced to verify the presence of the
activating mutation at codon 12. A subset of those clones is shown here. The integration pattern
for the HindIII mutation is listed above each clone. Above that, the presence (+) or absence (-) of
the oncogenic mutation is indicated as determined by sequence analysis. For those clones which
had integrated the HindIII site in both duplicates, sequence analysis and band intensity appeared to
indicate that the aspartic acid mutation had also integrated into both copies and is indicated by a ++
symbol. The sequence of wild-type (wt) ES cell DNA is shown for comparison. The position of
each nucleotide alteration is indicated at the sides.
153
crossover, the mutation would be left in the chromosome following recombination. For the
K-rasD12 -A allele, one clone (clone 194) was recovered with this structure. All other K-rasD12 -A
clones that showed the presence of the Asp 12 mutation appeared to carry it in only one of the
duplicates (presumably the 3' copy). Therefore, depending upon which side of the mutation that
the cross-over occurs, either the mutation will remain in the chromosome or the wild-type allele
will be restored. Since the vector contained 3.2 kb of homology on either side of the mutation
(Figure 3.2), it was expected that both events would occur with an equal frequency. Importantly,
irrespective of the initial integration pattern, the only alteration that would be remain in the genome
following the recombination would be the desired HindIII and Asp 12 point mutations.
To select for K-rasD12-A cells that had excised the DNA including the negative selectable
marker, the six independent clones analyzed in Figure 3.3 were subjected to tk counter-selection.
GANCr clones were isolated and examined for the presence of the "pop-out" event. As shown in
Table 3.2, only 15% (14/94) of phenotypically GANC r clones had excised the neo and tk genes in
the first round of screening.
Unfortunately, the main limitation to this procedure is the
spontaneously high frequency of the loss of sensitivity to the negative selection agent due to events
other than homologous recombination. To reduce this background, DNAs were prepared and
analyzed from only those clones that were both GANC r and G418s in the subsequent round of
screening. Using this prescreening procedure, 100% (49/49) of such clones had correctly excised
the selectable markers (Table 3.2). Of the 63 "pop-out" events obtained from both rounds of
selection, 3 (-5%) clones were found to contain the desired HindIII mutation, whereas 95% had
restored a wild-type allele (Table 3.2). As can be seen in Figure 3.5A, Southern blot analysis
demonstrated that a 5' HindII site was retained (clones 194-A and -B) or created (clone 153-A) in
the three "pop-out" clones following homologous recombination. Clone 153-B is representative of
the many clones which had restored a wild-type allele. Further analysis using a probe located 5' to
the duplicated sequences demonstrated that loss of the 3' HindIII site in clones 194-A and -B was
not simply due to a mutation in the restriction site, but rather to an intrachromosomal
recombination
154
Table 3.2. Summary of in vitro run step on K-rasD12-A allele.
parental
clone
(5', 3')
# GANCr # GANCr
& G418s
colonies
expanded colonies
# colonies
screened
# pop-out
events
allele
restored in
pop-out
12 G->D
presence
17
1
15
1
wt
ND
28
3
3
3
wt
ND
5 (-,+)
17
0
17
0
NA
NA
153 (-,+)
17
29
2
5
15
5
2
5
1-wt; 1-H3
wt
no; no
no
159 (-,+)
18
10
18
10
wt
ND
62
36
35
35
wt
ND
186 (-,+)
7
1
7
1
wt
ND
194 (+,+)
22
0
22
0
NA
NA
75
6
6
6
4-wt; 2-H3
no; yes
292
64
143
63
60-wt; 3-H3
2
3 (-,+)
Totals:
Six independently targeted clones with the above listed integration patterns for the HindIII
mutation were placed into gancyclovir to select for clones which had popped-out the selectable
markers. All GANC r clones were expanded and tested for their sensitivity to G418 as
described in the Experimental Procedures. As predicted, Southern blot analysis demonstrated
that only those clones which were both GANC r and G418s had removed the selectable
markers. The nature of the restored allele, with respect to both the HindIII and aspartic acid
mutations, was determined by Southern blot analysis as well as genomic sequencing and is
summarized in the last two columns. NA = not applicable; ND = not determined.
I
155
clonal step:
Hit
Run
="-I <
•1
Hit
Run
run-
I--hit
hit 3' copy -
-- hit 5' copy
& run
3' copy
-et
wt/run
oaf* 40
-
hit
1 234 5678
-- 520 bp
520 bp-
-- 406 bp
134 bp-
Figure 3.5. Functional intrachromosomal recombination in the K-rasDI2 -A allele.
A. Genomic DNAs from GANCr, G418s clones were digested with HindIII + KpnI and analyzed
as described in Figure 3.3. Analysis shows that clones 153-A, 194-A, and 194-B have all
undergone intrachromosomal recombination to create a mutated K-ras allele, whereas clone 153-B
restored a wild-type allele. Clones 153 and 194 were the parental "hit" clones selected for GANCr.
Clone 153 carries the HindIII mutation in the 3' duplicate, whereas clone 194 carries the mutation
in both duplicates. Wild-type (wt) ES cell DNA is also shown for comparison. All fragments are
identified to the side of each panel and are described in Figures 3.2 and 3.3.
B. A parallel set of DNAs were digested with BamHI + KpnI and analyzed with the 5' external
probe (Figure 3.2). Southern blotting shows that clones 153-A, 153-B, 194-A, and 194-B have all
lost the 9.1 kb BamHI fragment specific to non-recombined, targeted clones.
C. and D. PCR analysis was performed on a parallel set of DNAs as described in Experimental
Procedures and shows the presence of the wild-type allele (520 bp fragment in both C. and D.) and
the D 12 mutation (Figure C. 134 bp fragment in lanes 2, 5, 7, and 8) or the HindIII mutation
(Figure D. 406 bp fi-agment in lanes 2, 3, 5, 7, and 8). Sample identity is as follows: lane 1 is wt
ES cell DNA, lane 2 is clone 153, lane 3 is clone 153-A, lane 4 is clone 153-B, lane 5 is clone 194,
lane 6 is clone 194-C2, lane 7 is clone 194-A, and lane 8 is clone 194-B. Clone 194-C is similar to
clone 153-B in that it had restored a wild-type K-ras allele following drug selection.
156
which had correctly excised the non-homologous vector sequences (source of the internal BamHI
site) (Figure 3.5B).
As discussed above, it was expected that -50% of all "pop-out" events from five of the
clones and 100% from clone 194 would carry the desired mutation. However, as shown in Table
3.2, I observed a much lower frequency than this for both types of clones. This suggests that the
majority of clones had gained resistance to the negative selection agent through mechanisms other
than homologous recombination (e.g., chromosomal loss). Alternatively, the presence of a
functional K-rasD12 allele may be detrimental to the growth and survival of the ES cell.
To verify the presence of the Asp 12 mutation, I performed genomic sequence and PCR
analysis on the three independent "pop-out" clones. Interestingly, only two of the three clones
contained the activating mutation. Genomic sequencing confirmed the presence of both the A-toG and G-to-A transitions at nucleotides 15 and 35, respectively, in clones 194-A and 194-B.
However, clone 153-A only carried the HindIII mutation at nucleotide 15 (Figure 3.6 and data not
shown).
This was demonstrated further by a sensitive PCR assay designed to detect each
mutation. Clones 194-A and 194-B contained both the 406 bp HindIII-specific and the 134 bp
Aspl 2 -specific PCR products in addition to the wild-type fragment (lanes 7 and 8, Figure 3.5C and
D). In contrast, clone 153-A did not contain the Asp 12 -specific PCR product (lane 3, Figure 3.5 C
and D). This suggests, therefore, that the Asp 12 mutation had either been repaired in clone 153-A
or had been carried in a different duplicate (i.e. the 5' copy) than the HindIII mutation in the
parental clone (153).
The fact that I recovered two independent ES cell clones heterozygous for an activated
allele of K-ras suggests that this oncogenic mutation is not detrimental to the ES cell. In support
of this, no obvious defects in ES cell growth have been observed in either of these clones.
However, I do not know if K-rasD12 is functionally expressed, as antibodies directed against this
oncoprotein fail to work in our hands. Alternatively, it is possible that independent mutations may
have occurred during the generation of these clones, enabling them to tolerate the expression of
K-rasD 12 . In addition, I do not know at this time if the pluripotency of the K-rasD12 ES cells may
157
HindHI:
12 G->D:
++
++
_
Hit
__
Run
__
Hit
__
Run
12G--
GCI/A
H2
A/G -
GA TCGA TCGATCG AT C GATC
G AT C
Figure 3.6. Generation of ES cells carrying a functional oncogenic allele of K-ras.
Genomic sequence analysis of the pop-out events shown in Figure 3.5. The presence of each
mutation is listed above its respective clone. Either no (-), one (+), or two (++) copies of each
mutation were found. The number of copies of the HindIII mutation was determined by Southern
blot analysis and subsequently confirmed by sequencing. Copy number of the oncogenic mutation
was inferred by sequence band intensity and direct comparison to the HindIII site alteration. Of
the three pop-out events, clones 194-A (data not shown) and 194-B both carried a functional
oncogenic allele of K-ras, whereas clone 153-A had lost the activating mutation. Clone 194-C had
restored a wt allele based on Southern blot analysis and, as expected, did not show the presence of
either mutation. For comparision, the sequence of wild-type (wt) ES cell DNA is also shown.
Because this reaction was from a different gel, the mobility of the upper bands are different relative
to the other samples. Therefore, the position of nucleotide 35 in the wt DNA sample is indicated
by a dash. The position of the HindIII and Asp1 2 mutations in all other samples is indicated at the
side.
158
be adversely affected and are currently trying to generate chimeras from each of these ES cell
clones.
Generation of Mice Carrying a Latent Oncogenic K-ras Allele, K-rasD 12 -L, and its
Tumorigenic Consequences
Four independent K-rasD12 -L heterozygous ES cell clones were selected for spontaneous
recombination analysis in the mouse based on their integration patterns for the HindIII and Aspl2
mutations. Two of the clones had integrated the mutations into both duplicates, and therefore,
should always generate a functional K-rasD12 allele following intrachromosomal recombination.
The other two clones had integrated the HindIII mutation into the 5' duplicate, and the presence of
the Asp 12 mutation was verified by sequence analysis (Figure 3.4 and data not shown). However,
as discussed earlier, I can not say with certainty that it is the 5' duplicate that carried the mutation.
The latter two clones were chosen to control for the possibility of K-rasD 12 expression from the
downstream duplicate (e.g., due to a cryptic promoter site) prior to the recombination event. In
addition, it is important to note, that all clones were maintained under positive selection (i.e., in the
presence of G418) in vitro during clonal expansion in order to minimize subpopulations of cells
spontaneously undergoing the intrachromosomal recombination prior to the in vivo analysis.
Chimeric animals were created by injecting cells from the four independent K-rasD 12 -L
clones into C57BL/6 blastocyst-stage embryos. These chimeras were then bred to C57BL/6 mice,
and BL/6:129/Sv agouti offspring were genotyped to determine germline contribution. All four
clones have produced chimeras that transmitted the K-rasD12-L allele through the germline (Figure
3.7). Because the PCR assay designed for genotyping only detected the presence of the insertion, I
also performed the Aspl 2 -specific PCR analysis on F1 heterozygotes. This analysis confirmed the
presence of the Asp 12 mutation in all twenty of the heterozygous offspring examined (data not
shown).
159
*
k**
*
390 bp 220 bp -
Figure 3.7. Germ line transmission of the K-rasD12-L allele.
PCR analysis shows the presence of wild-type (220 bp) and mutant (390 bp) K-ras alleles in the
DNA of Fl heterozygous offspring (indicated by an asterisk (*)). The other four animals were
homozygous for the wild-type K-ras allele. Aspl2-specific PCR analysis was also performed
(not shown) and confirmed the presence of the Asp 12 mutation in all heterozygous offspring.
160
12
It is expected that at some stochastic frequency, the duplicated sequences in the K-rasD -L
allele will undergo intrachromosomal recombination to produce an activated allele of K-ras. The
frequency and onset of this spontaneous event as well as the number of duplicates carrying the
mutation will influence the end number of cells carrying a functional K-rasD12 allele. Because a
large number of cells (in chimeras) or every cell (in germline Fl progeny) in the developing and
adult mouse will carry the duplicated mutant allele, the somatic recombination event should occur
broadly and predispose these mice to a wide range of tumor types.
Because this study is currently ongoing, preliminary data on only a limited number of
animals can be presented at this time. Starting at 3-4 months of age, a small number (6/40) of
K-rasD12 -L chimeras and two Fl heterozygous animals have either died suddenly or exhibited
signs of distress and were sacrificed for complete necropsy. These animals ranged in age from 84
to 220 days. Autopsy revealed the presence of obvious tumors in the lung and/or thymus in 75%
and 50% of the animals, respectively. Tumor samples were saved for DNA analysis to determine
the status of the intrachromosomal recombination event (currently in progress). Histopathology
has only been perfomed on four of the animals at this time and confirmed the presence of 2 lung
adenomas, 2 lung carcinoma, and 1 lymphoma (Figure 3.8). This is of great interest, given the
high frequency of K-ras mutations associated with tumors of these tissues in both humans and
rodents (Bos, 1989; Mangues and Pellicer, 1992). Importantly, these data suggest that this system
is feasible for activating an oncogene in vivo.
Based on a significant amount of in vitro and in vivo data, it is believed that an oncogenic
allele of K-ras will provide the cell with a growth advantage, but will not be transforming in the
absence of other cooperating mutational events (Barbacid, 1987). Thus, it is expected that these
animals should have a reasonable lifespan. Indeed, most chimeras do not show any overt signs of
illness at this time, with the oldest chimeras and Fl progeny being 8-9 months and 4 months of
age, respectively. Because other mutational events are necessary for full transformation, I am
currently in the process of breeding this mutation into other cancer-prone strains. In particular, due
161
to the frequent association of K-ras activation with mutation of the p53 and APC genes in several
human tumor types, I am interested in examining the cooperative effects between these mutations.
162
Figure 3.8. Histopathology of tumors in K-rasD 12-L allele mice.
A. Section showing the presence of both lymphoma (L) and a small adenoma (A) in the lung of a
3 month old chimera (100X magnification).
B. Section showing the presence of a large adenoma (A) in the lung, which was surrounded by
normal (N) lung tissue (100X). Importantly, this mouse exhibited multi-focal adenomas (not
shown).
C. Higher magnification (400X) view of the adenoma shown in panel B.
D. Section through the lung demonstrating a clara cell carcinoma (100X). Clara cells normally
function to secrete surfactin in the lung tissue.
E. Different area of the carcinoma (C) depicted in panel D. This tumor was defined by the excess
amount of surfactin present in the lung tissue and macrophages (pink staining cells indicated by
black arrows).
F. Higher magnification (400X) view of the carcinoma shown in panel E (400X).
163
Discussion
Oncogenic ras mutations occur in -30% of all human tumors, with K-ras being the most
frequently mutated member of this gene family. K-ras mutations are associated with three very
common and clinically important tumor types, namely pancreatic, colon, and lung carcinomas
(Bos, 1989). In order to develop drugs designed to inhibit tumorigenesis, an accurate animal
model of the disease is invaluable. There are a number of problems associated with the current
approaches available to analyze both oncogenes and tumor suppressor genes and their roles in the
initiation and progression of tumorigenesis. We now demonstrate a novel method for activating
an oncogenic allele of the K-ras gene in vivo, which may be applied to the generation of other
improved animal models of cancer.
Strategies For Analyzing Functional Mutations in the Mouse
A number of different approaches have been utilized in the past to examine the effect of activated
ras alleles on tumor development in vivo. Transgenic mice carrying activated ras genes have been
created either through the use of retroviruses or direct microinjection of recombinant DNA into the
pronucleus of fertilized eggs (Adams and Cory, 1991). Although an enormous amount of
information has been gained through these approaches, the results must be interpreted with
caution. As discussed earlier, there are a number of disadvantages associated with ras transgenes.
Not only do they position the ras oncogene outside of its normal genomic context, but they also
result in abnormally high levels of expression of the mutant protein due to either gene dosage (i.e.,
multiple integrants), the choice of promoter driving the activated ras allele, and/or position effects.
This issue is important since the level of oncogenic Ras appears to modulate its transforming
potency (see below).
This problem can be overcome by targeting the expression of the desired mutation to the
endogenous locus via homologous recombination. In the last decade, considerable technological
advances in gene targeting approaches have provided a powerful tool for studying gene function in
165
vivo. Generally, these strategies require the introduction of a selectable drug marker into the
targeted locus of mouse embryonic stem (ES) cells (Hasty and Bradley, 1993). The resulting
targeted disruption has greatly facilitated the ability to study the effect of a null mutation on the
whole animal and has been invaluable in studying the roles of tumor suppressor genes in
tumorigenesis. However, this large scale alteration in gene structure is not desirable for creating
subtle mutations in the mammalian genome for either fine-structure analysis or to mimic human
genetic diseases resulting from small specific mutations (i.e., point mutations or small insertions
and deletions).
Recently, techniques designed to leave behind subtle genetic modifications, with very little
or no alterations to the rest of the genome, have been developed. There are three documented
methods designed for this purpose: the hit-and-run (or in-out) (Hasty et al., 1991; Valancius and
Smithies, 1991), the double replacement (similar to tag-and-exchange) (Askew et al., 1993; Wu et
al., 1994), and the combination of site-specific and homologous recombination (e.g., Cre/LoxP)
(Kilby et al., 1993; Barinaga, 1994). One advantage of the first two approaches is that after the
selectable marker has been removed, only the desired alteration remains in the genome. In
contrast, the Cre/LoxP system leaves behind a small insertion consisting of the LoxP site
following excision of the selectable marker. The main limition, however, of the first two
approaches arises from their loss of sensitivity to the negative selectable marker as well as their
sensitivity to the loss of the whole chromosome containing the targeted locus during the removal
of selectable markers. Thus, as measured in vitro, the efficiency of the desired recombination
event is lowered. In addition, the pluripotency of the targeted ES cells may be adversely affected
by the exposure to two successive steps of selection. Prior to this work, these approaches had only
been applied to ES cells in vitro. In fact, the double replacement strategy is only applicable in
vitro. The drawback to this is that any subtle modification will be represented in every cell of the
animal in established mouse lines. Thus, while this may be more representative of familially
inherited mutations, it does not mimic sporadic forms of cancer.
166
In contrast, the Cre/LoxP system has provided a very powerful genetic tool with which to
create subtle mutations via a site-specific recombinase. Importantly, this method has the potential
to create the desired alteration in a tissue/cell-specific manner by directing Cre expression, and thus
excision, to a specific cell type or lineage (Barinaga, 1994). However, despite the high efficiency
of Cre recombinase-mediated excision, this method is severely limited by the availability of
transgenic mice expressing the Cre recombinase under the appropriate tissue/cell-specific
promoter. This is important since the target cell of the initiating (and subsequent) mutation in
many cancers is not well defined. Therefore, finding the appropriate promoter to direct the
expression of the desired modification is not necessarily straightforward. In addition, all cells
within the affected tissue will express the mutation. Thus, while this may increase the target cell
population for subsequent cooperating events, it does not mimic spontaneous tumorigenesis, nor
does it allow for the potentially inhibitory interaction with normal neighboring cells. Finally, since
its expression will be directed to a specific tissue, only a limited tumor spectrum would be
presented. Overall, despite being a powerful strategy for creating subtle mutations in a more
controllable fashion, it has many of the same disadvantages associated with transgenics for animal
cancer models.
We have now demonstrated a variation on the hit-and-run targeting procedure in vivo. This
approach overcomes many of the disadvantages associated with these other systems, especially for
studying tumor development. Importantly, the stochastic process of generating the mutation in
somatic cells is more representative of many of the genetic hits that occur during the initiation and
progression of tumorigenesis. In addition, this strategy obviates the need for a specific promoter
to target expression of the mutation to the correct target cell. In theory, every cell in a mouse
carrying a latent version of the mutated allele has the potential to generate the alteration through an
intrachromosomal recombination. The end number of cells expressing a functional mutation will
be determined by the number of duplicates carrying the mutation, the position of the mutation
relative to the lengths of the arms of homology, and the frequency and onset of the functional
recombination event. For example, functional recombination in a pluripotent stem cell or early in
167
development could result in the clonal expansion of the mutated allele into potentially many
different cell lineages, assuming the differentiating capacity of the cell is not affected. Thus, a large
number of cells/cell types in the whole animal may carry the mutation. In contrast, only a limited
number of cells will carry the functional mutation if the recombination occurs later in the adult
mouse. Therefore, depending upon the frequency and onset of the activation, this model has the
capacity to represent both familial and sporadic forms of cancer.
Furthermore, this approach allows expression of the mutated allele to be controlled by its
endogenous promoter and positional constraints. With respect to Ras, all previous approaches
utilizing transgenes have implemented promoters that result in a significantly higher than normal
level of activated Ras expression. This becomes an issue because the transforming potency of Ras
appears to be modulated by its level of expression. Although point mutations within ras are gainof-function and ectopic overexpression permits transformation even in the presence of a normal
allele (Tabin and Weinberg, 1985), their proposed dominance has been questioned (Capon et al.,
1983; Santos et al., 1984; Craig and Sager, 1985; Geiser et al., 1986). Analysis of ras genes in
tumor cells has revealed that in many cases the expression of the mutant allele is frequently
augmented by gene amplification or other mechanisms (Barbacid, 1987; Bos, 1988; Cohen and
Levinson, 1988; Finney and Bishop, 1993). In particular, the ratio between the mutant and the
normal allele is oftentimes increased during progression (Bos et al., 1987; Bremner and Balmain,
1990). In addition, loss of the normal ras allele has been observed in human tumors and
frequently occurs in mouse skin tumor progression (Yokota et al., 1986; Bremner and Balmain,
1990). However, the significance of this latter finding is not known and may simply reflect the
coincident deletion of a linked gene (e.g., a tumor suppressor gene) important for tumor
progression.
Recently, Finney and Bishop directly addressed this issue of dominance. Utilizing a
modified hit-and-run strategy, they were able to introduce an activating mutation (H-rasE12 ) into
the endogenous H-ras gene in Ratl fibroblasts (Finney and Bishop, 1993).
Importantly,
heterozygous cells expressing the mutant and normal alleles at equal levels were neither
168
transformed nor tumorigenic. Instead, they were predisposed to neoplastic transformation at a low
frequency. Interestingly, all spontaneously transformed cell lines retained the normal H-ras allele
and greater than 90% of the lines had amplified the mutant allele. In support of this observation,
analysis of clones carrying a single copy of the mutant H-ras allele driven by the MLV-LTR
(parental "hit" step clones) revealed that mutant H-ras expression was 20 times greater in these
cells than in cells where its expression was driven from its natural promoter, and as a result, they
were highly transformed and tumorigenic. Together, these results imply that a single point
mutation in H-ras is insufficient for neoplastic transformation, even of already established cell
lines. Thus, in order to render a cell transformed, at least one additional event must occur, of
which increasing the expression of a mutant ras allele may be one.
Since our approach allows the oncogenic allele of K-ras to be expressed under the normal
physiological control of its native promoter, any augmentation in the expression of the allele would
be a consequence of natural events occurring during tumorigenesis. The relevance of this may
become important in the development of drugs designed to inhibit Ras-transformed cells. It is
possible that chemotherapeutic drugs that would be effective against a mutant Ras protein
controlled under its natural constraints would fail to work as effectively if the protein were
expressed at artificially high levels. Therefore, having an accurate animal model of the disease is
invaluable. This is underscored by the fact that many of the compounds that have proven effective
in cell-free or cell culture systems are often times found to be ineffective or toxic when tested in
vivo.
Examining the Multistep Nature of Cancer in the Mouse
By using the novel approach described here, every cell in the animal will carry the spontaneously
activatable allele. Therefore, it is expected that these animals will be predisposed to a broad
spectrum of tumor types with variability in the onset of presentation. I have now demonstrated
that this approach is feasible for activating an oncogene in vivo. In addition, more than one tumor
type was represented in these animals, suggesting that more than one cell type is capable of
169
carrying out the recombination event. At this time, K-rasD12 -L animals appear to be highly
susceptible to lung tumors and thymic lymphomas. This is not surprising, given the frequent
association of K-ras mutations in these tumor types in mouse carcinogenesis models (Guerrero
and Pellicer, 1987; Mangues and Pellicer, 1992). Furthermore, the onset of tumorigenesis in these
animals appears to occur within a broad window of time. The earliest presentation occurred at -3
months of age; however, at this time, chimeras with greater than 95% contribution (based on coat
color) by K-rasD12 -L ES cells have survived out to 8.5 months of age with no overt abnormalities.
In addition to activating Ras, additional genetic events must occur in order for a cell to be fully
transformed. Thus, in those K-rasD12 -L animals exhibiting an increased lifespan, it may be
possible to uncover the cooperating genetic events associated with a particular tumor type.
Over the past decade, it has become clear that cancer is a genetic disease, arising from the
accumulation of several mutations, most of which are somatic in nature (Vogelstein and Kinzler,
1993). Because each cancer appears to be clonal in origin, it is likely that they represent sequential
mutations of growth-regulatory genes in a single cell and its descendants. In addition, some
tumors, such as those of the colon, evolve through a series of well-defined morphological stages,
thus making it possible to establish an order in which mutations occur in that tumor type (Fearon
and Vogelstein, 1990). Many of the alterations in colorectal cancer have now been identified and
include mutations of the APC, ras,DCC, and p53 genes as well as others. The APCMin (hereafter
referred to as Min) mouse has provided an excellent model system with which to study the early
events in intestinal neoplasia. The Min mouse strain was generated in a chemical mutagenesis
screen and was subsequently shown to have a nonsense mutation in the APC gene (Moser et al.,
1990; Su et al., 1992). Min mice develop a severe and early onset of polyposis, with remarkable
similarities to the presentation of FAP in humans. However, the distribution of tumors along the
intestine differs between humans and mice. Whereas humans exhibit the majority of lesions in the
colon and rectum, Min mice display numerous adenomas in both the small and large intestines,
with highest concentrations present in the small bowel (Moser et al., 1990; Kim et al., 1993). In
addition, the formation of adenomas in Min mice appears to be dependent upon the loss of the
170
wild-type APC allele (Levy et al., 1994; Luongo et al., 1994; Oshima et al., 1995). Interestingly,
adenomas from APC mutant mice do not appear to be associated with activating mutations in
K-ras (R. Smits and R. Fodde, personal communication), and their progression to carcinoma is
strain dependent (i.e., due to allelic modifiers) (Moser et al., 1992). The reason(s) for these
differences between the mouse and human models of intestinal neoplasia is presently unknown.
Other investigators have tried to examine this multistep nature of intestinal neoplastic
progression through the use of transgenic mice. Transgenic mouse lines expressing either SV40
TAg, an oncogenic form of K-ras (Val 12), or a dominant negative p53 mutant (Ala 143) were
created and analyzed singly, in combination, or in association with the APCMin mutation (Kim et
al., 1993). Whereas expression of K-rasV 12 alone resulted in no detectable abnormalities, it did
cooperate with SV40 TAg to produce marked proliferative and dysplastic changes in the intestinal
epithelium. However, this dysplasia failed to progress to form adenomas despite continued
expression of the transgenes. Importantly, when K-rasV12 and APCMin mutations were analyzed
in combination, no synergistic effect was observed. One possible explanation for the lack of
cooperation between the Min and K-rasV12 mutations may be due to inappropriate target cell
expression of K-rasV 12 . The expression of all of the transgenes in this study were directed to
post-mitotic enterocytes. In contrast, initiation of tumorigenesis in Min mice typically occurs in the
intestinal crypts (location of stem cells) rather than in villus-associated epithelial cells (Moser et al.,
1992). Thus, cooperation between Min and oncogenic alleles of K-ras may require appropriately
targeted expression of K-ras to the crypt stem cells or their immediate descendants.
Indeed, D'abaco et al. recently demonstrated that co-expression of a defective APC allele
and an activated allele of H-ras was sufficient to transform normal colonic epithelial cells and
render them tumorigenic (D'Abaco et al., 1996).
Making use of the Immorto mouse and
Immorto-Min mouse hybrids, they were able to derive colonic epithelial cell lines and examine the
effect of an overexpressed, activated H-ras allele on tumor progression. The Immorto mouse is a
transgenic mouse carrying a temperature-sensitive allele of SV40 TAg under the control of an
interferon-y inducible promoter. Introduction of oncogenic H-ras into both cell lines allowed
171
them to continually proliferate in the absence of functional SV40 TAg, unlike the parental cell lines
that require SV40 TAg to proliferate and survive. Thus, an activated allele of H-ras was able to
replace the immortalization function of SV40 TAg. Moreover, the loss of one functional APC
allele and co-expression of an oncogenic allele of H-ras was sufficient to fully transform mouse
colonic epithelial cells. Interestingly, tumorigenesis appeared to proceed without the loss or
mutation of the wild-type APC allele as well.
However, despite showing a cooperative effect between the APCMin and activated H-ras
mutations, the above result must be interpreted with caution. First, human colorectal cancer is
associated with K-ras mutation, not H-ras (Bos et al., 1987; Vogelstein et al., 1988). Because I
have shown that K-ras has a unique role in normal mouse development, it is possible that it may
also have a unique role in the formation of specific tumor types. Therefore, it would be important
to know if activation of K-ras has a similar cooperative effect in this system. In addition, this
effect was observed in the presence of abnormally high levels of oncogenic H-ras. Finally, it
would interesting to know if these two mutations actually cooperated in vivo in either the
progression of intestinal neoplasia or its distributional presentation in the intestinal tract.
K-rasD12 -L animals should provide a valuable tool for examining this and related issues.
Due to the frequent association of K-ras mutations with alterations in p53 in several human tumor
types (Vogelstein et al., 1988; Mitsudomi et al., 1992; Pellegata et al., 1994), and APC in human
colorectal cancer (Vogelstein et al., 1988; Jen et al., 1994), I are currently in the process of crossing
the K-rasD12-L allele into p53 deficient and APCMin mouse strains. It will be of great interest to
determine what the cooperating effects, if any, that these mutations will have, particularly with
respect to the initiation and progression of neoplasms in the intestine/colon, pancreas, and lung.
Moreover, a novel cooperative role between these genes in tumor development may be uncovered.
In addition, it will be important to examine possible cooperating effects between the K-rasD12 -L
allele and mutations in other growth regulatory genes, such as the Rb and Nfl tumor suppressor
genes. Lastly, this novel approach for mutational activation may be invaluable in the generation of
other improved animal cancer models.
172
Experimental Procedures
Construction of Targeting Vectors
The K-ras genomic clone used to construct both targeting vectors was previously described in
Chapter 2. For site directed mutagenesis, a 1.9 kb SalI-XhoI fragment containing exon 1
sequences was isolated from pK-ras-3' and subcloned into pGEM-7Z+ (Promega). Mutagenesis
was then performed to create pK-ras-ExlD 12 using the Amersham Scultptor kit. The sequence of
the oligo used to create the HindIII and D 12 mutations was 5'-ATGACTGAGTATAAGCTIGTG
GTGGTTGGAGCTGATGGCGTAGGC-3', with the two nucleotide alterations indicated in bold
face type. All clones were sequenced to insure that only the desired mutations were incorporated
into exon 1. Next, p-3'-K-rasD12 was created via a three piece ligation with the following
fragments: a 1.9 kb SalI-XhoI fragment from pK-ras-ExlD12, a 1.7 kb XhoI-XbaI fragment
from pK-ras-3', and a 3.0 kb SalI-XhoI fragment from pKSII+ (Stratagene).
Two different vectors were created to contain the desired selectable markers for each allele.
For the latent allele backbone, a 1.8 kb XhoI-SacI fragment from pPGKRN containing a wild-type
neo gene was subcloned into a 5.5 kb XhoI-XbaI fragment from pPNT (Tybulewicz et al., 1991)
to create pPRNT. Next, pKSII+-Rneo was created by subcloning a 1.9 kb EcoRI-Acc65I neo
fragment from pPRNT into EcoRI-Acc65I digested pKSII + . For the activated allele, pKSII+Rneo:tk was constructed by inserting a 4.0 kb EcoRI-NsiI fragment from pPGKneoNTRtkpA
(Wu et al., 1994) into the EcoRV site of pKSII+AXhoI. pKSII+AXhoI was created by deleting
sequences from the Apal to Clal sites in pKSII + for the purpose of removing the XhoI site and
was necessary in order to create a unique XhoI site in the final targeting vector for linearization.
The final targeting constructs were then created via three piece ligations. A 2.8 kb NotISall fragment from pK-ras-5' and a 3.6 kb SalI-XbaI fragment from p-3'-K-rasD12 were ligated
together with either a 4.8 kb XbaI-NotI fragment from pKSII+-Rneo to create pK-rasD12-L , or a
7 kb XbaI-NotI fragment from pKSII+-Rneo:tk to create pK-rasD12-A. Exon 1 sequences in the
final targeting vectors were subsequently confirmed by sequencing.
173
Electroporation, Selection of ES Cell Clones, and Southern Blot Analysis
D3 ES cells (Gossler et al., 1986) were cultured and electroporated as described in Chapter 2. The
ES medium was supplemented with G418 at 200 gg/ml (active weight) 48 hours after
electroporation. After 9-10 days of selection, colonies were picked and expanded. Genomic
DNAs were isolated as described (Laird et al., 1991). To identify targeted clones, DNAs were
digested with BamHI + KpnI, resolved on 0.8% agarose gels, and Southern blot analysis was
performed as described in Chapter 2 using a 5' external probe. Targeted clones were analyzed
further using Southern blotting to determine the integration pattern and copy number.
Confirmation of the D 12 mutation was done by sequence analysis as described below. All clones
were maintained under positive selection (i.e., G418) prior to the "run" step in order to minimize
mixed populations due to pop-out events during clonal expansion.
Revertants of the K-rasD12 -A allele were isolated essentially as described (Hasty and
Bradley, 1993). Clonal lines were placed into ES medium supplemented with 2 gpM gancyclovir
24-48 hours after plating and selection was continued for 8-10 days. Due to the high frequency of
clones which become GANC r via mechanisms other than intrachromosomal recombination, a
prescreening procedure was used (Wu et al., 1994). Individual GANC r clones were isolated and
grown to confluence. Following trypsinization, cells from each clone were divided as follows:
one half was frozen down and one quarter was replated in ES medium containing either
gancyclovir (I) or G418 (II). Cells which grew in the first set of plates (I) but not in the second set
of plates (II) were GANCr, G418 s and, therefore, reflected the loss of both selectable markers.
DNA was prepared from those cells as before and subsequently screened by Southern blotting to
determine the nature of the pop-out event. Clones retaining the HindII mutation were sequenced
to verify the presence of the D 12 mutation.
174
Genomic Sequence Analysis
PCR was used to amplify K-ras exon 1 sequences. The 5' primer (5'-GGGTAGGTGTTGGGAT
AGCTGTCGACAAGC-3') was located in intron 0, and the 3' primer (5'-CCTITACAAGCGCA
CGCAGACTGTAGAGC-3') was located in intron 1. The 520 bp fragment was phenolchloroform extracted, purified in a Microcon 100 microconcentrator (Amicon), and then
sequenced directly (U.S. Biochemical).
The primer used for sequence analysis was 5'-
TCTTGTGTGAGACATG-3', located immediately 5' to exon 1.
Generation of Chimeras
C57BL/6 blastocyst-stage embryos were injected with 10-15 K-rasD12 -L ES cells or 8-10
K-rasD12 -A ES cells and then transferred to pseudopregnant Swiss Webster females for further
development, essentially as described (Bradley, 1987). Chimeric mice were mated to C57BL/6
and 129/Sv animals and F1 agouti offspring were genotyped. Germline transmission of the
mutant allele was detected by either Southern blot or PCR analysis of tail DNA obtained at
weaning.
PCR Analysis
Tail DNA was processed as described (Laird et al., 1991) and analyzed by PCR. All PCR
conditions were exactly as those described in Chapter 2, except for the choice of primer pairs.
K-rasD12-L primers and their final concentrations used for genotyping were as follows: 0.6 [pM
Lat. 5'WT (5'-TGCACAGCTTAGTGAGACCC-3'),
0.4 pM Lat. 3'WT (5'-GACTGCTCTCTTT
CACCTCC-3'), and 0.2 p.M Lat. 3'MUT (5'-GGAGCAAAGCTGCTATTGGC-3'). Lat. 5'WT +
Lat. 3'WT yields a 220 bp fragment, whereas Lat. 5'WT + Lat. 3'MUT produces a 390 bp mutantspecific fragment. For K-rasD12 -A allele PCR, the following primers and their final concentrations
were used to detect the presence of the D 12 mutation: 0.6 p.M 5'K-raslO (5'-AGGGTAGGTGTT
GGGATAGC-3'), 0.6 pgM Act. K-ras 3'11 (5'-CCTTTACAAGCGCACGCAGAC-3'), and 0.4
gM Act. K-ras 5'H3 (5'-GCTTGTGGTGGTTGGAGCTGA-3').
175
To detect the presence of the
HindIII mutation, the first two primers were retained and Act. K-ras 5'H3 was replaced with its
exact complement, Act. K-ras 3'H3 (5'-TCAGCTCCAACCACCACAAGC-3').
These two
primers contain the D 12 and HindIII nucleotide alterations at their 5' and 3' ends, thus making it
possible to exploit the destability of the specific nucleotide change at the 3' end for specificity.
5'K-raslO + Act. K-ras 3'11 yields a 520 bp wt fragment, Act. K-ras 5'H3 + Act. K-ras 3'11
produces a 134 bp D 12 -specific fragment, and 5'K-raslO + Act. K-ras 3'H3 yields a 406 bp
HindlIl-specific fragment.
Histological Analysis
All animals showing obvious tumors or other signs of distress were sacrificed and subjected to
full necropsy. For histological analysis, all tissues and tumors were fixed in either Bouin's fixative
or 10% neutral buffered formalin, dehydrated in graded solutions of alcohol, embedded in paraffin,
sectioned at 4-6 gLm and stained with hematoxylin and eosin (H & E).
176
References
Adams, J. M., and Cory, S. (1991). Transgenic models of tumor development. Science 254,
1161-7.
Askew, G. R., Doetschman, T., and Lingrel, J. B. (1993). Site-directed point mutations in
embryonic stem cells: a gene-targeting tag-and-exchange strategy. Mol Cell Biol 13, 4115-24.
Balmain, A., Ramsden, M., Bowden, G. T., and Smith, J. (1984). Activation of the mouse
cellular Harvey-ras gene in chemically induced benign skin papillomas. Nature 307, 658-60.
Barbacid, M. (1987). ras genes. Annu Rev Biochem 56, 779-827.
Barinaga, M. (1994). Knockout mice: round two [news; comment]. Science 265, 26-8.
Bos, J. L. (1988). The ras gene family and human carcinogenesis. Mutat Res 195, 255-71.
Bos, J. L. (1989). ras oncogenes in human cancer: a review [published erratum appears in Cancer
Res 1990 Feb 15;50(4):1352]. Cancer Res 49, 4682-9.
Bos, J. L., Fearon, E. R., Hamilton, S. R., Verlaan, de, V. M., van, B. J., van, der, Eb, Aj, and
Vogelstein, B. (1987). Prevalence of ras gene mutations in human colorectal cancers. Nature
327, 293-7.
Bradley, A. (1987). In Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.
J. Robertson, eds. (Oxford: IRL, Press), pp. 113-152.
Bremner, R., and Balmain, A. (1990). Genetic changes in skin tumor progression: correlation
between presence of a mutant ras gene and loss of heterozygosity on mouse chromosome 7. Cell
61, 407-17.
Brown, K., Quintanilla, M., Ramsden, M., Kerr, I. B., Young, S., and Balmain, A. (1986). v-ras
genes from Harvey and BALB murine sarcoma viruses can act as initiators of two-stage mouse
skin carcinogenesis. Cell 46, 447-56.
Capon, D. J., Seeburg, P. H., McGrath, J. P., Hayflick, J. S., Edman, U., Levinson, A. D., and
Goeddel, D. V. (1983). Activation of Ki-ras2 gene in human colon and lung carcinomas by two
different point mutations. Nature 304, 507-13.
Cohen, J. B., and Levinson, A. D. (1988). A point mutation in the last intron responsible for
increased expression and transforming activity of the c-Ha-ras oncogene. Nature 334, 119-24.
Craig, R. W., and Sager, R. (1985). Suppression of tumorigenicity in hybrids of normal and
oncogene- transformed CHEF cells. Proc Natl Acad Sci U S A 82, 2062-6.
D'Abaco, G. M., Whitehead, R. H., and Burgess, A. W. (1996). Synergy between Apc M in and
an activated ras mutation is sufficient to induce colon carcinomas. Mol. Cell. Biol. 16, 884-891.
177
Fearon, E. R., and Vogelstein, B. (1990). A genetic model for colorectal tumorigenesis. Cell 61,
759-67.
Finney, R. E., and Bishop, J. M. (1993). Predisposition to neoplastic transformation caused by
gene replacement of H-rasl. Science 260, 1524-7.
Forrester, K., Almoguera, C., Han, K., Grizzle, W. E., and Perucho, M. (1987). Detection of
high incidence of K-ras oncogenes during human colon tumorigenesis. Nature 327, 298-303.
Geiser, A. G., Der, C. J., Marshall, C. J., and Stanbridge, E. J. (1986). Suppression of
tumorigenicity with continued expression of the c-Ha-ras oncogene in EJ bladder carcinomahuman fibroblast hybrid cells. Proc Natl Acad Sci U S A 83, 5209-13.
Gossler, A., Doetschman, T., Korn, R., Serfling, E., and Kemler, R. (1986). Transgenesis by
means of blastocyst-derived embryonic stem cell lines. Proc Natl Acad Sci U S A 83, 9065-9.
Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Gelbert, L., Albertsen, H., Joslyn, G.,
Stevens, J., Spirio, L., Robertson, M., and et, a. 1. (1991). Identification and characterization of
the familial adenomatous polyposis coli gene. Cell 66, 589-600.
Guerrero, I., and Pellicer, A. (1987). Mutational activation of oncogenes in animal model
systems of carcinogenesis. Mutat Res 185, 293-308.
Hasty, P., and Bradley, A. (1993). Gene targeting vectors for mammalian cells.
Targeting: A Practical Approach, A. L. Joyner, eds. (Oxford: IRL Press), pp. 1-31.
In Gene
Hasty, P., Ramirez, S. R., Krumlauf, R., and Bradley, A. (1991). Introduction of a subtle
mutation into the Hox-2.6 locus in embryonic stem cells [published erratum appears in Nature
1991 Sep 5;353(6339):94]. Nature 350, 243-6.
Hennings, H., Glick, A. B., Greenhalgh, D. A., Morgan, D. L., Strickland, J. E., Tennenbaum, T.,
and Yuspa, S. H. (1993). Critical aspects of initiation, promotion, and progression in multistage
epidermal carcinogenesis. Proc Soc Exp Biol Med 202, 1-8.
James, G. L., Goldstein, J. L., and Brown, M. S. (1995). Polylysine and CVIM sequences of KRasB dictate specificity of prenylation and confer resistance to benzodiazepine peptidomimetic in
vitro. J Biol Chem 270, 6221-6226.
Jen, J., Powell, S. M., Papadopoulos, N., Smith, K. J., Hamilton, S. R., Vogelstein, B., and
Kinzler, K. W. (1994). Molecular determinants of dysplasia in colorectal lesions. Cancer Res
54, 5523-5526.
Khosravi, F. R., and Der, C. J. (1994). The Ras signal transduction pathway. Cancer Metastasis
Rev 13, 67-89.
Kilby, N. J., Snaith, M. R., and Murray, J. A. (1993).
genome engineering. Trends Genet 9, 413-21.
178
Site-specific recombinases: tools for
Kim, S. H., Roth, K. A., Moser, A. R., and Gordon, J. I. (1993). Transgenic mouse models that
explore the multistep hypothesis of intestinal neoplasia. J Cell Biol 123, 877-93.
Laird, P. W., Zijderveld, A., Linders, K., Rudnicki, M. A., Jaenisch, R., and Berns, A. (1991).
Simplified mammalian DNA isolation procedure. Nucleic Acids Res 19, 4293.
Lerner, E. C., Qian, Y., Blaskovich, M. A., Fossum, R. D., Vogt, A., Sun, J., Cox, A. D., Der, C.
J., Hamilton, A. D., and Sebti, S. M. (1995a). Ras CAAX peptidomimetic FTI-277 selectively
blocks oncogenic Ras signaling by inducing cytoplasmic accumulation of inactive Ras-Raf
complexes. J Biol Chem 270, 26802-26806.
Lerner, E. C., Qian, Y., Hamilton, A. D., and Sebti, S. M. (1995b). Disruption of oncogenic KRas4B processing and signaling by a potent geranylgeranyltransferase I inhibitor. J Biol Chem
270, 26770-26773.
Levy, D. B., Smith, K. J., Beazer, B. Y., Hamilton, S. R., Vogelstein, B., and Kinzler, K. W.
(1994). Inactivation of both APC alleles in human and mouse tumors. Cancer Res 54, 5953-8.
Luongo, C., Moser, A. R., Gledhill, S., and Dove, W. F. (1994). Loss of Apc+ in intestinal
adenomas from Min mice. Cancer Res 54, 5947-52.
Mangues, R., and Pellicer, A. (1992). ras activation in experimental carcinogenesis. Semin
Cancer Biol 3, 229-39.
Manne, V., Yan, N., Carboni, J. M., Tuomari, A. V., Ricca, C. S., Brown, J. G., Andahazy, M.
L., Schmidt, R. J., Patel, D., Zahler, R., and et, a. 1. (1995). Bisubstrate inhibitors of
farnesyltransferase: a novel class of specific inhibitors of ras transformed cells. Oncogene 10,
1763-1779.
Mills, N. E., Fishman, C. L., Rom, W. N., Dubin, N., and Jacobson, D. R. (1995). Increased
prevalence of K-ras oncogene mutations in lung adenocarcinoma. Cancer Res 55, 1444-1447.
Mitsudomi, T., Steinberg, S. M., Nau, M. M., Carbone, D., D'Amico, D., Bodner, S., Oie, H. K.,
Linnoila, R. I., Mulshine, J. L., Minna, J. D., and et, a. 1. (1992). p53 gene mutations in nonsmall-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical
features. Oncogene 7, 171-80.
Moser, A. R., Dove, W. F., Roth, K. A., and Gordon, J. I. (1992). The Min (multiple intestinal
neoplasia) mutation: its effect on gut epithelial cell differentiation and interaction with a modifier
system. J Cell Biol 116, 1517-26.
Moser, A. R., Pitot, H. C., and Dove, W. F. (1990). A dominant mutation that predisposes to
multiple intestinal neoplasia in the mouse. Science 247, 322-4.
Nishisho, I., Nakamura, Y., Miyoshi, Y., Miki, Y., Ando, H., Horii, A., Koyama, K.,
Utsunomiya, J., Baba, S., and Hedge, P. (1991). Mutations of chromosome 5q21 genes in FAP
and colorectal cancer patients. Science 253, 665-9.
179
Oshima, M., Oshima, H., Kitagawa, K., Kobayashi, M., Itakura, C., and Taketo, M. (1995).
Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice
carrying a truncated Apc gene. Proc Natl Acad Sci U S A 92, 4482-4486.
Pellegata, N. S., Sessa, F., Renault, B., Bonato, M., Leone, B. E., Solcia, E., and Ranzani, G. N.
(1994). K-ras and p53 gene mutations in pancreatic cancer: ductal and nonductal tumors progress
through different genetic lesions. Cancer Res 54, 1556-60.
Powell, S. M., Petersen, G. M., Krush, A. J., Booker, S., Jen, J., Giardiello, F. M., Hamilton, S.
R., Vogelstein, B., and Kinzler, K. W. (1993). Molecular diagnosis of familial adenomatous
polyposis [see comments]. N Engl J Med 329, 1982-7.
Powell, S. M., Zilz, N., Beazer, B. Y., Bryan, T. M., Hamilton, S. R., Thibodeau, S. N.,
Vogelstein, B., and Kinzler, K. W. (1992). APC mutations occur early during colorectal
tumorigenesis. Nature 359, 235-7.
Quintanilla, M., Brown, K., Ramsden, M., and Balmain, A. (1986). Carcinogen-specific
mutation and amplification of Ha-ras during mouse skin carcinogenesis. Nature 322, 78-80.
Santos, E., Martin, Z. D., Reddy, E. P., Pierotti, M. A., Della, P. G., and Barbacid, M. (1984).
Malignant activation of a K-ras oncogene in lung carcinoma but not in normal tissue of the same
patient. Science 223, 661-4.
Sinn, E., Muller, W., Pattengale, P., Tepler, I., Wallace, R., and Leder, P. (1987). Coexpression
of MMTV/v-Ha-ras and MMTV/c-myc genes in transgenic mice: synergistic action of oncogenes
in vivo. Cell 49, 465-75.
Smith, A. J., Stem, H. S., Penner, M., Hay, K., Mitri, A., Bapat, B. V., and Gallinger, S. (1994).
Somatic APC and K-ras codon 12 mutations in aberrant crypt foci from human colons. Cancer
Res 54, 5527-5530.
Spandidos, D. A. (1986). The human T24 Ha-rasl oncogene: a study of the effects of
overexpression of the mutated ras gene product in rodent cells. Anticancer Res 6, 259-62.
Su, L. K., Kinzler, K. W., Vogelstein, B., Preisinger, A. C., Moser, A. R., Luongo, C., Gould, K.
A., and Dove, W. F. (1992). Multiple intestinal neoplasia caused by a mutation in the murine
homolog of the APC gene [published erratum appears in Science 1992 May 22;256(5060): 1114].
Science 256, 668-70.
Sun, J., Qian, Y., Hamilton, A. D., and Sebti, S. M. (1995). Ras CAAX peptidomimetic FTI
276 selectively blocks tumor growth in nude mice of a human lung carcinoma with K-Ras
mutation and p53 deletion. Cancer Res 55, 4243-4247.
Tabin, C. J., and Weinberg, R. A. (1985). Analysis of viral and somatic activations of the cHaras gene. J Virol 53, 260-5.
Tybulewicz, V. L., Crawford, C. E., Jackson, P. K., Bronson, R. T., and Mulligan, R. C. (1991).
Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl protooncogene. Cell 65, 1153-63.
180
Valancius, V., and Smithies, 0. (1991). Testing an "in-out" targeting procedure for making
subtle genomic modifications in mouse embryonic stem cells. Mol Cell Biol 11, 1402-8.
Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M.,
Nakamura, Y., White, R., Smits, A. M., and Bos, J. L. (1988). Genetic alterations during
colorectal-tumor development. N Engl J Med 319, 525-32.
Vogelstein, B., and Kinzler, K. W. (1993). The multistep nature of cancer. Trends Genet 9,
138-41.
Weinberg, R. A. (1989). Oncogenes and Multistep Carcinogenesis. In Oncogenes and the
Molecular Origins of Cancer, eds. Cold Spring Harbor Laboratory Press), pp. 307-326.
Wu, H., Liu, X., and Jaenisch, R. (1994). Double replacement: strategy for efficient introduction
of subtle mutations into the murine Colla-1 gene by homologous recombination in embryonic
stem cells. Proc Natl Acad Sci U S A 91, 2819-23.
Yamashita, N., Minamoto, T., Ochiai, A., Onda, M., and Esumi, H. (1995). Frequent and
characteristic K-ras activation in aberrant crypt foci of colon. Is there preference among K-ras
mutants for malignant progression? Cancer 1527-1533.
Yokota, J., Tsunetsugu, Y. Y., Battifora, H., Le, F. C., and Cline, M. J. (1986). Alterations of
myc, myb, and rasHa proto-oncogenes in cancers are frequent and show clinical correlation.
Science 231, 261-5.
Yuspa, S. H. (1994). The pathogenesis of squamous cell cancer: lessons learned from studies of
skin carcinogenesis--thirty-third G. H. A. Clowes Memorial Award Lecture. Cancer Res 54,
1178-89.
181
Chapter 4
Overview and Future Directions
182
This thesis focused on trying to understand the role(s) that ras family members play in the
normal growth and development of the mouse as well as in the initiation and progression of
tumorigenesis. Unveiling the function that ras oncogenes serve in basic cellular growth and
differentiation will further our knowledge on how its disregulation can lead to neoplastic
development. ras genes (and other members of the signaling cascade) are highly conserved
throughout evolution, underscoring their fundamental role in growth control of the cell. However,
ever since the identification of these genes in the mammalian genome, no one had been able to
demonstrate a distinct role for any of the three members of the ras gene family. I have now
demonstrated a unique and vital function of K-ras in mouse embryogenesis.
In the future, it will be of great importance to determine why K-ras function is unique. I
do not know if the requirement for K-ras reflects a unique function of the gene product not shared
by N-ras or H-ras or simply differences in the expression patterns of the family members. A
more precise analysis of the expression of ras genes must be done in order to determine if a
critical cell type exclusively expresses K-ras. In particular, this analysis should be directed to the
fetal liver due to the defects associated with this tissue in K-ras-1- embryos. Alternatively, K-ras
could be relaying a unique signal transduction cascade. The differences in K-ras4B processing and
its specific regulation by the smg-GDS exchange factor suggests that K-ras may be brought into
association with a distinct subset of effectors, thereby elliciting a unique function in cell signaling.
By generating mutant alleles specific for each K-ras isoform, one could determine the
requirements and distinct functions that may be associated with each isoform.
The K-ras-deficient embryos and ES cell clones are a valuable source for isolating specific
cell populations devoid of K-ras function. Therefore, biochemical characterization of these cells
may allow identification of a distinct signaling pathway(s) emanating from K-ras in response to
specific growth/survival factors. This will not only be of value in understanding the role of K-ras
in normal cell growth and differentiation, but may also offer another potential (and perhaps more
specific) target for drug therapy. Hematopoietic defects and significant cell death were observed in
both K-ras-1 - embryos and compound mutants of N- and K-ras. Given the finding that Ras
183
mediates a survival signal downstream of certain cytokines, it will be important to dissect the
function that each Ras member serves in relaying such signals. The availability of mice deficient
in specific ras genes now makes this type of analysis feasible. I was able to show partial overlap
in function between N- and K-ras in early murine development. Thus, a more thorough analysis
of various combinations of the three mutant alleles (H-, N-, and K-ras) would reveal the extent of
functional overlap between various family members and help define the threshold level of activity
that is required for carrying out vital functions.
Due to the lethality of K-ras-1- embryos and the limited contribution that could be achieved
by K-ras-1 - ES cells in chimeras, it was difficult to assess what the requirement for K-ras was in
the adult animal. Therefore, the generation of tissue/cell specific mutant alleles would allow for a
more defined analysis of what cells, if any, require K-ras function in the adult animal.
Alternatively, the novel strategy that I developed could, in theory, be applied as a method for
cell/tissue specific "knock-in". Because the insertion allele is expected to be inactive, breeding the
mutation to homozygosity would result in embryonic lethality. Therefore, the generation of viable
offspring from heterozygous intercrosses would select for those animals that restore K-ras
function through intrachromosomal recombination in the critical cell type(s) of genotypically
homozygous mutant animals. Thus, extensive expression analysis on these mice could reveal
which cells require K-ras function for the completion of embryogenesis and later in adult life. The
success of this approach would depend, in part, on the frequency and onset of the activating
recombination.
Defining the requirement for K-ras in adult tissues is important, given the enormous
amount of research by pharmaceutical companies devoted to developing anti-cancer drugs based
on the inhibition of oncogenic or normal Ras function. Our results suggest that drugs that block
Ras function non-specifically would be highly toxic. In fact, the recent finding that K-ras4B (the
predominant isoform) is geranylgeranylated provides a strong explanation for the non-toxic effect
of farnesyl-transferase inhibitors in vivo, as geranylgeranylation is highly resistant to their
184
inhibitory effect. Thus, it would seem more plausable to develop drugs designed to inhibit specific
members of the Ras family rather than overall Ras activity.
On this note, the creation of the K-rasD12 L allele mouse strain should prove invaluable in
the development of drugs designed to specifically inhibit tumor cells carrying an oncogenic allele
of K-ras. In the future, it will be necessary to define the mechanism(s) of activation of the
K-rasD12 L allele to confirm its association with the observed tumor phenotypes. Southern blotting
of tumor DNAs will be instrumental in this analysis and will help establish whether activation can
occur in the absence of intrachromosomal recombination. Moreover, this analysis can address the
importance of allelic amplification during tumor progression.
In addition, it will be very
interesting to characterize the lesions that are presented in older animals. For example, is there an
even broader spectrum of pathological consequences associated with oncogenic K-ras in the
mouse? How limited are the tumors with respect to their progression? And most importantly,
how does this allele cooperate, if at all, with other tumor suppressor mutants in the initiation and
progression of tumorigenesis?
Having established the tumor phenotypes associated with the K-rasD12 L allele, I will be
able to test the efficacy of various anti-Ras chemotherapeutic agents on tumor regression as well as
tumor formation. All too often, drugs that show promise in cell culture or cell-free systems prove
ineffective or toxic when tested in vivo. Therefore, the availability of mice which more accurately
reflect the natural tumorgenic process may have a significant impact on these studies.
I believe that this novel method of oncogene activation may be applied to other genes to
generate additional improved animal models of cancer. For example, the creation of mice deficient
in tumor suppressor genes has greatly extended our knowledge on the function of these genes, not
only in tumorigenesis, but in development as well. However, mice heterozygous for the mutations
don't always present the same phenotype that is associated with their familial inheritance in
humans. This may partly be explained through species-specific differences in either the sensitivity
to the mutation(s) or the rate-limiting cooperative events in the appropriate target cell. Due to the
high susceptibility of lethal tumor types in some of these mutant strains, their lifespan is
185
significantly shortened. Thus, the potential for cooperating events to occur is severely limited and
may, therefore, not allow for presentation of the familial phenotype. It is tempting to speculate that
through the combination of more carefully targeted mutations in the mouse, we will be able to
better recapitulate human cancer models and define the relevant aberrations associated with each
cancer. All of this in hope of creating better chemotherapeutic treatments designed to specifically
inhibit the neoplastic processes associated with each type of cancer.
186
Appendix 1
The PDGF Inducible Factor SIF is Related to
the Interferon Activated p91 Transcription Factor
This chapter represents some of my work while in Dr. Brent Cochran's lab. It was submitted for
publication, although it was never published.
Abstract
Transcriptional regulation of the c-fos proto-oncogene is controlled by an array of regulatory
elements and transcription factors. One of these elements is a conserved regulatory sequence
which binds to a growth factor inducible DNA-binding factor termed SIF (c-sis/PDGF inducible
factor). This element can confer PDGF responsiveness onto the c-fos promoter independently of
the serum response element (SRE). Here we show that the SIF DNA binding complex reacts
with antibodies against the 91 kD subunit of the interferon-stimulated transcription factor ISGF3.
In addition, we show that interferon-y induces SIF DNA binding activity and that the binding
specificity of SIF is closely related to that of the interferon-y activated factors. These results
suggest that growth factors and interferons activate common signal transduction pathways.
188
Introduction/Results/Discussion
c-fos transcription is transiently activated by a wide variety of extracellular stimuli (Verma and
Sassone-Corsi, 1987). We have previously described a DNA binding factor whose binding
activity is induced by v-sis conditioned media (SCM) and PDGF, but not by phorbol esters
(Hayes et al., 1987; Wagner et al., 1990). This factor binds to a conserved sequence (the
sis/PDGF inducible element SIE) just upstream of the serum response element (SRE) of the c-fos
promoter. In addition to PDGF, SIF binding activity is induced by a variety of growth factors
including EGF (Sadowski and Gilman, 1993), growth hormone (Meyer et al., 1993), CSF-1, and
insulin (unpublished results). The SIE is the only c-fos promoter element whose in vivo footprint
changes upon c-fos activation (Herrera et al., 1989). In cultured cells, the SIE and SRE are each
sufficient to confer transcriptional activity onto a truncated c-fos promoter in response to PDGF
(Wagner et al., 1990). However, studies in transgenic mice analyzing point mutations in either
element indicate that both are required for in vivo c-fos expression (T. Curran, personal
communication).
UV cross-linking experiments identify an approximately 91 kD protein that interacts
specifically with the SIF DNA binding site (Figure 1.1). In crude extracts of quiescent Balb/c-3T3
cells, several proteins become crosslinked to a
3 2 P-labeled
SIE probe in unstimulated cells. An
additional band of approximately 91kD is crosslinked in the extracts from v-sis conditioned media
(SCM) treated Balb/c-3T3 cells. Moreover, crosslinking of this 91 kD protein can be specifically
reduced by inclusion of unlabelled SIE oligonucleotides in the binding reaction. From this data
and from purification and sedimentation analysis (data not shown), it can be concluded that a
protein of approximately 91 kD in molecular weight is the principal DNA binding component of
SIF.
Recently, a 91 kD protein has been identified as a component of the interferon stimulated
transcription factor, ISGF3 (Fu, 1992; Schindler et al., 1992a). Interferon induces the tyrosine
phosphorylation and DNA binding activity of this transcription factor (Schindler et al., 1992b;
189
4(
CO cC,
ct,
cO'
92-
68-
!
45-
31-
a
aU
Figure 1.1. Specific crosslinking of a 91 kD protein to the SIE in extracts of v-sis
conditioned media treated cells.
Extracts from quiescent (Q) or v-sis conditioned medium (SCM) treated Balb/c-3T3 cells were
crosslinked to an SIE DNA probe and electrophoresed through SDS-PAGE gels and exposed to
X-ray film. In the last lane, the crosslinking was done in the presence of 0.5 pmol unlabelled SIE
oligonucleotide. The positions of the molecular weight markers are indicated along with the
position of an induced specific band.
190
Shuai et al., 1992). Because of the similarities in molecular weight, inducible DNA binding, and
the fact that some genes are induced by both PDGF and interferon (Garcia-Blanco et al., 1989), we
investigated whether ISGF3 and SIF share any common components.
To determine whether any of the SIE complexes are immunologically related to the IFN
induced complexes, antibodies to the 91 and 113 kD components of ISGF3 were pre-incubated
with extracts from PDGF-treated cells and analyzed by mobility-shift assays (Figure 1.2).
Antisera to the 91 kD protein efficiently bound to and supershifted all of the PDGF-induced
complexes. However, antisera to the 113 kD protein or sera from a non-immunized rabbit did not
react with the SIF complexes. The antisera to p91 is directed against a C-terminal peptide of this
protein and does not recognize the 84 kD protein produced by the same gene (Igarashi et al.,
1993). Inclusion of excess peptide antigen in the binding reaction eliminated the supershift (data
not shown). An antibody directed against a part of p91 that includes the SH2 domain reacts with
selected, but not all complexes that form specifically with an SIE oligonucleotide (data not shown).
Thus, the epitopes which this antisera recognizes are either occluded in some of these complexes
or the protein recognized by the C-terminal antibody in this complex is closely related, but not
identical to the ISGF3 p91.
There are two classes of interferon responsive regulatory elements. One is termed the
ISRE and is primarily responsive to interferons ca and
P3
(Friedman and Stark,
1985; Levy et al.,
1988). Subsequently, it has been found that there are also regulatory elements specifically
responsive to IFN-y (Lew et al., 1991). The p91 ISGF3 protein is found in the IFN-a stimulated
ISRE binding complex, but does not determine binding specificity at this site (Veals et al., 1992).
However, in response to stimulation by interferon-y, inducible binding is seen to IFN-y
responsive elements (IGRE), and this binding activity may be mediated directly by p91 (Shuai et
al., 1992; Pearse et al., 1993). Recently, a consensus sequence has been derived for the minimal
IFN-y activation sequences (Pearse et al., 1993). Known SIF DNA binding elements closely
resemble this consensus.
191
Balb/c-3T3
C,Q'Oj
, 'o
W
a
sY
Figure 1.2. Antisera to the ISGF3 p91 supershifts SIF complexes.
Nuclear extracts from Balb/c-3T3 cells were used in mobility shift assays with the SIE probe after
pre-incubation with either antibodies against the p91 or p113 proteins of ISGF3 or from normal
non-immune rabbit sera (NRS). All extracts were made from PDGF treated cells except the lane
marked Q for quiescent cell extracts.
192
A comparison of IFN-y responsive elements and the c-fos SIE is shown in Table 1.1. The
sequence similarity between these two elements has led us to ask whether IFN-y can induce
binding to the SIE and whether SIE and IFN-y responsive elements can cross compete with one
another for binding to SIF and IFN-y activated factors. Results of these experiments are shown in
Figure 1.3.
U937 cells were treated for thirty minutes with IFN-y and extracts from these cells were
analyzed by mobility shift assay using a probe derived from the IFN-y response region (GRR) of
the high affinity Fc receptor for IgG gene (FcyRI). A complex is induced by IFN-y in these cells
which has previously been shown to be composed of at least in part the p91 protein (Wilson and
Finbloom, 1992; Pearse et al., 1993). Both the wild type SIE found in c-fos and a high affinity
SIE oligonucleotide can compete for binding to this complex in the mobility shift assay, whereas a
non-binding point mutant of the SIE fails to compete for this band (Wagner et al., 1990). The
band is competed with an unlabelled homologous GRR oligonucleotide and an oligonucleotide
derived from the FcyRI which contains primarily the minimal IFN-y responsive element of the
GRR. It is also competed by the IFN-y responsive element of the Ly6E gene. The interferon-cx,
03 responsive ISRE does not compete for this binding. Interestingly, the IGRE elements from the
GBP and MIG genes also fail to compete for this binding, or do so only very weakly. A similar
set of competition experiments was performed using the wild type c-fos SIE as a probe with
extracts from PDGF treated HepG2 cells containing exogenous PDGF receptors (Valius and
Kazlauskas, 1993). An essentially identical competition was seen in this experiment. In other
experiments (not shown), we have found that IFN-y induces binding to the high affinity SIE site
in both U937 cells and A431 cells. In more quantitative competition assays (not shown), the high
affinity SIE oligonucleotide also proves to be a high affinity competitor for 91 kD binding to the
GRR probe. The order of affinity for binding from either extracts of IFN-y or PDGF treated cells
is the high affinity SIE followed by the wild type c-fos SIE and the GRR and then the Ly6E site
(SIE + > SIE,GRR > Ly6E). The IFN-y responsive elements from the GBP and MIG genes, as
well as the consensus ISRE, show little or no competition.
193
Table 1.1. Comparison of the sequences of the c-fos SIE and interferon responsive elements.
IFN-y consensus
TTCCNNNAA
A
human c-fos SIE
AGTTCCCGTCAATCCC
SIE+
GRR core
GRR long
CATTTCCCGTAAATCCCT
TATTTCCCAGAAAAGGAA
GCATGTTTCAAGGATTTGAGATGTATTTCCCAGAAAAGG
Ly6E
ATAITTCCTGTAAGTGCAT
MIG
GBP
ISRE consensus
TGGTTTCACATCCCTTACTATAAA
TACTTTCAGTTTCATATTACTCTAAA
AGTTTCACTTTTCC
TT
C
The consensus of IFN-y responsive elements is from Pearse et al. (Pearse et al., 1993). SIE is the
sis/PDGF inducible element from the c-fos gene. SIE + is a high affinity SIF binding site (Wagner
et al., 1990). GRR and Ly6E are the core IFN-y responsive elements from the FcyRI and Ly6E
genes (Pearse et al., 1993). MIG is an element from the monokine induced by interferon-y gene
(Wright and Farber, 1991). The GRR long element is the optimal IFN-y response element from
the FcyRI gene (Pearse et al., 1993). GBP is the interferon responsive element from the guanylate
binding protein gene (Lew et al., 1991). The ISRE consensus is from Levy et al. (Levy et al.,
1988). Sequences with homology to the consensus IFN-y responsive element are underlined.
194
A
GRR-I
probe
L
.
,
U937
cells
SIF
probe
HEPG2
cells
.
NM
m mm
O
Figure 1.3. The c-fos SIE and IFN-y responsive elements cross compete for binding to
IFN-y and PDGF induced complexes.
Mobility shifts assays were performed with extracts from IFN-y treated U937 cells or from
PDGF-BB treated HepG2 cells that express the PDGF3 receptor (Valius and Kazlauskas, 1993).
The GRR oligonucleotide was used as a probe for the U937 cell extracts and the c-fos wild type
SIE was used as a probe for the HepG2 cell extracts. Where indicated, competitor
oligonucleotides were added to the binding reactions. SIF + is the high affinity SIF binding site
m67. SIF is the wildtype c-fos SIE, and SIF* is the nonbinding mutant SIE m56. These
sequences are given in Wagner et al. (Wagner et al., 1990). The ISRE oligonucleotide is derived
from the ISG-54 gene (Levy et al., 1988) and is 5'-AATTTCACTTT CTAGTTTCACTTICCCTT
TTGT-3' and 5'-AATTACAAAAGGGAAAGTGAAACTAGAAAGTGA-3'. The sequences of
the other competitor oligonucleotides are as indicated in Table 1.1 except that they are double
stranded with overhanging HindIII termini for labelling.
195
Thus, the IFN-y responsive elements can be divided into two groups -- those that compete for SIF
binding and those which do not. One sequence difference between these classes of elements is that
those that compete have the sequence TTCC and those that do not compete begin with the
sequence TTAC. This sequence is located in the part of the SIE where SIF binding is disrupted by
DNA methylation (Hayes et al., 1987). The second difference between these elements is that the
GBP and MIG genes contain composite elements with nearby or overlapping ISREs to the IFN-y
consensus element (Lew et al., 1991; Wright and Farber, 1991). It may be that interactions
between proteins binding this site and proteins binding the ISRE slightly alter the affinity of p91
for these IFN-y responsive elements. Alternatively, a distinct interferon stimulated complex may
bind to these sites. In any case, IFN-y induces a binding activity that is capable of binding to the
SIE. This complex has a sequence specificity similar to complexes induced by PDGF. Both of
these complexes appear to contain the ISGF3-91 kD or closely related protein. However, the SIE
binding complexes induced by PDGF and interferon-y are likely to be distinct. That is, the
mobility shift band pattern observed on the high affinity SIE differs slightly between extracts of
IFN-y treated cells and from those of PDGF treated cells (data not shown).
To confirm further that the 91 kD protein which complexes with the SIE is closely related
to the 91 kD protein that is part of the ISGF3 complex, we have investigated complex formation
on the SIE using extracts of mutant cells which have specific deficiencies in the response to
interferons. One of these mutant cells is specifically deficient in expression of mRNAs which
encode the 91 and 84 kD proteins of ISGF3 (McKendry et al., 1991; Muller et al., 1993) (G.R.
Stark and I.M. Kerr, personal communication). Treatment of the parental 2fTGH cell line with
IFN-y induces a complex which binds the high affinity SIE (Figure 1.4). This complex is
supershifted by the anti-C-terminal p91 antisera and is specifically competed by unlabelled SIE
(data not shown). In the cell line (U3A) which is defective in the expression of the gene encoding
the 91 kD protein, no induction can be detected, although a faint constitutive complex is unaffected.
In contrast, induction of SIE binding is not affected in the U2A cell line. U2A cells are defective
for p48 ISGF3, which mediates binding to the ISRE (Stark and Kerr, personal
196
U2A
U3A
2FTGH
C) 4~'y
'44p
SMS S*
-I
-r
hr
~
EIN
OW
0nm Mn, d
@W
UUIIIWI
Figure 1.4. Inducible binding to the SIE is diminished in cell lines deficient in ISGF3-p91.
Extracts of the 2fTGH cell line and the mutant derivatives U2A and U3A were used in mobility
shift assays with the the high affinity SIE probe. In each case, quiescent cells were treated with
IFN-a or y or with PDGF-BB.
197
communication). Thus, expression of the p91 gene is required for IFN-y induced complex
formation on the SIE. The parental 2fTGH cells do not show a response to PDGF, so it cannot be
determined what the effect of eliminating p91 expression is on PDGF inducible complex
formation.
The growth factor inducible DNA binding complex SIF is thus related to the IFN-y
stimulated p91 by size, binding specificity, and immunoreactivity. It is likely that the 91 kD
protein of ISGF3 is a component of SIF, although it is possible that the PDGF induced complex
contains a closely related protein instead. Moreover, on tris/glycine gels as many as four distinct
bands can be observed with the high affinity SIE probe after PDGF stimulation. The multiple
complexes formed on the SIE observed on mobility shift gels after induction by IFN-y or PDGF
may be due to differences in phosphorylation, the ability to complex with other proteins, as well as
binding by other proteins that could be closely related to p91.
p91 has previously been shown to be phosphorylated on tyrosine in response to interferon
(Schindler et al., 1992b; Shuai et al., 1992). By genetic complementation it has been found that the
Jak2 tyrosine kinase is required for the response to IFN-y (Watling et al., 1993). Jak2 is a
cytoplasmic tyrosine kinase with two putative tyrosine kinase domains (Harpur et al., 1992). Jak2
has also been found to be tightly associated with the growth hormone receptor in pre-adipocytes
and growth hormone induces SIF DNA binding (Argetsinger et al., 1993; Meyer et al., 1993).
Thus, the JAK family kinases are candidates for being the ISGF3 and/or SIF kinases although this
has not been directly demonstrated. Since IFN-y can induce transient c-fos expression (Wan et al.,
1988) and the SIE can mediate c-fos induction by PDGF, it is likely that a pathway involving JAK
family kinases will be activated by PDGF and other growth factors as well. We are currently
investigating this possibility.
198
Experimental Procedures
Maintenance of Cell Lines
Balb/c-3T3 cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS).
HepG2/PDGF-O3R cells were maintained in DMEM supplemented with 10% FBS and G418 at
500 p.g/ml. U937 cells were grown in suspension in RPMI-193 supplemented with 10% FBS
and 2mM L-glutamine. 2fTGH and mutant derivate cell lines (U2A and U3A) were maintained in
DMEM supplemented with 10% FBS and 2mM L-glutamine in 10% C02.
Prepartion of Nuclear Extracts
Cell lines were grown to confluence and subsequently serum starved as follows: Balb/c-3T3,
2fTGH, U2A and U3A cell lines for 48 hours in 0.5% FBS, and HepG2 cells in DMEM alone for
72 hours. U937 cells were grown to high density only prior to stimulation. Cells were then
stimulated with either PDGF-BB (25 ng/ml, R&D systems) or IFN-a or y (200 U/ml,
recombinant human, Genzyme) for 30' at 37 0 C. Cells were rinsed three times with ice-cold
phosphate-buffered saline (PBS). PBS containing 1 mM Na3VO4 and 5 mM NaF was added to
each plate, and the cells were scraped from the dish and pelleted at 1500 rpm for 10 min at 40 C.
Cells were resuspended in the same buffer and pelleted as before.
Then, the pellet was
resuspended in 0.8 ml ice-cold hypotonic buffer, transferred to microfuge tubes, and allowed to
swell on ice for 15-30 min. The lysate was vortexed vigorously for I min and the nuclei pelleted
(14,000 g for 30 s). The nuclear pellets were resuspended in 100-150 gl of high salt buffer and
rotated at 40 C for 30 min. The extracted proteins were separated from residual nuclei (14,000 g
for 20 min) and the supernatant was quick frozen in a dry ice/methanol bath. The buffer
compositions were as follows: 1) hypotonic buffer: 10 mM Hepes (pH 7.9), 10 mM KCI, 1.5
mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM Na3VO4, 1 mM Na4P207, 20 mM NaF, 1
mM dithiothreitol (DTT), 0.5 mM phenylmethylsulphonyl fluoride (PMSF), 0.125 gM okadaic
acid, and 1 g.g/ml each of leupeptin, antipain, pepstatin, and chymostatin; 2) high salt buffer: 20
199
mM Hepes (pH 7.9), 420 mM NaC1, 1.5 mM MgC12, 25% glycerol, 1 mM EDTA, 1 mM
EGTA, 1 mM Na3VO4, 1 mM Na4P207, 20 mM NaF, 1 mM DTT, 0.5 mM PMSF, 0.125 IM
okadaic acid, and 1 gg/ml each of leupeptin, antipain, pepstatin, and chymostatin. For mobilityshift assays, nuclear extracts (12 gg) were incubated with or without antisera in binding buffer for
1 h on ice, after which
3 2 P-endlabelled
oligonucleotide m67-SIE probe (Wagner et al., 1990)
(-30,000 c.p.m., ~5 fmol) was added and the reactions were incubated for 30 min at 30 0 C. Final
binding reactions (20 pl) contained: 14 mM Hepes, pH 7.9, 85 mM NaC1, 10 mM KC1, 0.3 mM
MgC12,1.25 mM DTT, 0.25 mM EDTA, 0.2 mM EGTA, 15% glycerol, 50 gg/ml poly(dIdC)-poly(dI-dC), and 250 pg/ml acetylated bovine serum albumin (BSA). Binding reactions were
analyzed on 5% polyacrylamide gels (39:1 acrylamide:bis) containing 2.5% glycerol in 1X TGE
(50 mM Tris, 380 mM glycine, and 2 mM EDTA) buffer at room temperature. For U937 nuclear
extracts, mobility-shift reactions contained 150 gg/ml of poly(dI-dC)-poly(dI-dC) and were
analyzed on 5% polyacrylamide gels (39:1 acrylamide:bis) containing 2.5% glycerol in 0.5X TBE
(45 mM Tris, 45 mM borate, and 1 mM EDTA) buffer at room temperature.
Unlabelled
competitor oligonucleotides were added to the reactions at 100X molar excess.
Crosslinking of Nuclear Extracts
Balb/c-3T3 cells were rendered quiescent as described above and treated for 30 min with v-sis
conditioned medium (SCM). Nuclear extracts were prepared as described (Wagner et al., 1990).
The probe was made from a c-fos SIE oligonucleotide (5'-AGCTTCAGTTCCCGTCAATCAAG
CT-3') cloned into the SmaI site of mpl8. A body labeled BrdU substituted probe was prepared
and used for UV crosslinking according to the protocol described by Chodosh et al. (Chodosh et
al., 1986).
200
Acknowledgments
We thank Jessica Schwartz, Christy Carter-Su, George Stark, and Ian Kerr for comunication of
unpublished results and comments on the manuscript. We are also grateful to George Stark, Ian
Kerr, and Andrius Kazlauskas for the provision of the cell lines used in this study. This work was
supported by NIH grant P01-CA42063 to B.H.C.
201
References
Argetsinger, L. S., Campbell, G. S., Yang, X., Witthuhn, B. A., Silvennoinen, O., Ihle, J. N., and
Carter-Su, C. (1993). Identification of JAK2 as a growth hormone receptor-associated tyrosine
kinase. Cell 74, 237-44.
Chodosh, L. A., Carthew, R. W., and Sharp, P. A. (1986). A single polypeptide possesses the
binding and transcription activities of the adenovirus major late transcription factor. Mol Cell Biol
6, 4723-33.
Friedman, R. L., and Stark, G. R. (1985). alpha-Interferon-induced transcription of HLA and
metallothionein genes containing homologous upstream sequences. Nature 314, 637-9.
Fu, X. Y. (1992). A transcription factor with SH2 and SH3 domains is directly activated by an
interferon alpha-induced cytoplasmic protein tyrosine kinase(s). Cell 70, 323-35.
Garcia-Blanco, M. A., Lengyel, P., Morrison, E., Brownlee, C., Stiles, C. D., Rutherford, M.,
Hannigan, G., and Williams, B. R. (1989). Regulation of 2',5'-oligoadenylate synthetase gene
expression by interferons and platelet-derived growth factor. Mol Cell Biol 9, 1060-8.
Harpur, A. G., Andres, A. C., Ziemiecki, A., Aston, R. R., and Wilks, A. F. (1992). JAK2, a
third member of the JAK family of protein tyrosine kinases. Oncogene 7, 1347-53.
Hayes, T. E., Kitchen, A. M., and Cochran, B. H. (1987). A rapidly inducible DNA-binding
activity which binds upstream of the c- fos proto-oncogene. J Cell Physiol Suppl 5, 63-8.
Herrera, R. E., Shaw, P. E., and Nordheim, A. (1989). Occupation of the c-fos serum response
element in vivo by a multi- protein complex is unaltered by growth factor induction. Nature 340,
68-70.
Igarashi, K., David, M., Larner, A. C., and Finbloom, D. S. (1993). In vitro activation of a
transcription factor by gamma interferon requires a membrane-associated tyrosine kinase and is
mimicked by vanadate. Mol Cell Biol 13, 3984-9.
Levy, D. E., Kessler, D. S., Pine, R., Reich, N., and Darnell, J., Jr. (1988). Interferon-induced
nuclear factors that bind a shared promoter element correlate with positive and negative
transcriptional control. Genes Dev 2, 383-93.
Lew, D. J., Decker, T., Strehlow, I., and Darnell, J. E. (1991). Overlapping elements in the
guanylate-binding protein gene promoter mediate transcriptional induction by alpha and gamma
interferons. Mol Cell Biol 11, 182-91.
McKendry, R., John, J., Flavell, D., Muller, M., Kerr, I. M., and Stark, G. R. (1991). Highfrequency mutagenesis of human cells and characterization of a mutant unresponsive to both alpha
and gamma interferons. Proc Natl Acad Sci U S A 88, 11455-9.
Meyer, D. J., Stephenson, E. W., Johnson, L., Cochran, B. H., and Schwartz, J. (1993). The
serum response element can mediate induction of c-fos by growth hormone. Proc Natl Acad Sci
USA 90, 6721-5.
202
Muller, M., Laxton, C., Briscoe, J., Schindler, C., Improta, T., Darnell, J. J., Stark, G. R., and
Kerr, I. M. (1993). Complementation of a mutant cell line: central role of the 91 kDa polypeptide
of ISGF3 in the interferon-alpha and -gamma signal transduction pathways. Embo J 12, 4221-8.
Pearse, R. N., Feinman, R., Shuai, K., Darnell, J., Jr., and Ravetch, J. V. (1993). Interferon
gamma-induced transcription of the high-affinity Fc receptor for IgG requires assembly of a
complex that includes the 91-kDa subunit of transcription factor ISGF3. Proc Natl Acad Sci U S
A 90, 4314-8.
Sadowski, H. B., and Gilman, M. Z. (1993). Cell-free activation of a DNA-binding protein by
epidermal growth factor. Nature 362, 79-83.
Schindler, C., Fu, X. Y., Improta, T., Aebersold, R., and Darnell, J., Jr. (1992a). Proteins of
transcription factor ISGF-3: one gene encodes the 91-and 84- kDa ISGF-3 proteins that are
activated by interferon alpha. Proc Natl Acad Sci U S A 89, 7836-9.
Schindler, C., Shuai, K., Prezioso, V. R., and Darnell, J., Jr. (1992b). Interferon-dependent
tyrosine phosphorylation of a latent cytoplasmic transcription factor [see comments]. Science
257, 809-13.
Shuai, K., Schindler, C., Prezioso, V. R., and Darnell, J., Jr. (1992). Activation of transcription
by IFN-gamma: tyrosine phosphorylation of a 91-kD DNA binding protein. Science 258, 180812.
Valius, M., and Kazlauskas, A. (1993). Phospholipase C-gamma 1 and phosphatidylinositol 3
kinase are the downstream mediators of the PDGF receptor's mitogenic signal. Cell 73, 321-34.
Veals, S. A., Schindler, C., Leonard, D., Fu, X. Y., Aebersold, R., Darnell, J., Jr., and Levy, D. E.
(1992). Subunit of an alpha-interferon-responsive transcription factor is related to interferon
regulatory factor and Myb families of DNA-binding proteins. Mol Cell Biol 12, 3315-24.
Verma, I. M., and Sassone-Corsi, P. (1987).
regulation. Cell 51, 513-4.
Proto-oncogene fos: complex but versatile
Wagner, B. J., Hayes, T. E., Hoban, C. J., and Cochran, B. H. (1990). The SIF binding element
confers sis/PDGF inducibility onto the c-fos promoter. Embo J 9, 4477-84.
Wan, Y. J., Levi, B. Z., and Ozato, K. (1988). Induction of c-fos gene expression by interferons.
J Interferon Res 8, 105-12.
Watling, D., Guschin, D., Muller, M., Silvennoinen, O., Witthuhn, B. A., Quelle, F. W., Rogers,
N. C., Schindler, C., Stark, G. R., Ihle, J. N., and et, a. (1993). Complementation by the protein
tyrosine kinase JAK2 of a mutant cell line defective in the interferon-gamma signal transduction
pathway [see comments]. Nature 366, 166-70.
Wilson, K. C., and Finbloom, D. S. (1992). Interferon gamma rapidly induces in human
monocytes a DNA-binding factor that recognizes the gamma response region within the promoter
of the gene for the high-affinity Fc gamma receptor. Proc Natl Acad Sci U S A 89, 11964-8.
203
Wright, T. M., and Farber, J. M. (1991). 5' regulatory region of a novel cytokine gene mediates
selective activation by interferon gamma. J Exp Med 173, 417-22.
204
CURRICULUM VITAE
Leisa Johnson
Home Address:
Work Address:
73 5th St. Apt. 2
Cambridge, MA 02141
(617)-497-2378
MIT-CCR E17-518
77 Mass. Ave
Cambridge, MA 02139
(617)-253-0264
Date of Birth:
January 19, 1967
Education:
1989 B.A.
Hastings College
Chemistry
Hastings, NE
1996 Ph.D.
Massachusetts Institute of Technology
Biology
Thesis advisor: Tyler Jacks
Cambridge, MA
1988
University of Arizona Cancer Center
Advisor: Roger L. Miesfeld
Undergraduate summer research position
Tucson, AZ
1989
Eppley Institute for Research in Cancer
and Allied Diseases
Advisor: Jill Pelling
Undergraduate research position
Omaha, NE
1990-1993
Massachusetts Institute of Technology
Graduate student in the laboratory of
Brent Cochran who moved to Tufts
Medical School in 1993
Boston, MA
1993-1996
Massachusetts Institute of Technology
Graduate student in the laboratory of
Tyler Jacks
Boston, MA
Research Experience:
Awards:
1985
Valedictorian
Academic All-American
Academic Scholarship
Athletic (volleyball and track) Scholarship
205
1987
Physics Scholarship
1989
summa cum laude
Chemical Rubber Plant Co. Outstanding Senior Chemist
Teaching Experience:
1988
Organic Chemistry - lab assistant
Nurses Organic Chemistry - teaching assistant
Hastings College
1991
Molecular Biology, 7.08 - teaching assistant
Massachusetts Institute of Technology
1992
Introductory Biology Lab, 7.02 - teaching assistant and
director of developmental lab section
Massachusetts Institute of Technology
Bibliography:
Original Reports:
1.
Meyer, D.J., Stephenson, E.W., Johnson, L., Cochran, B.H., and Schwartz, J.
The serum response element can mediate induction of c-fos by growth hormone.
Proc Natl Acad Sci USA 1993; 90: 6721-6725.
2.
Johnson, L., Greenbaum, D., Mercer, K., Murphy, E., Schmitt, E., Bronson, R.T.,
Umanoff, H., Edelmann, W., Kucherlapati, R., and Jacks, T. K-ras is an essential
gene in the mouse with partial functional overlap with N-ras. Submitted.
3.
Johnson, L., Greenbaum, D., Bronson, R.T., and Jacks, T. Analysis of an
oncogenic allele of K-ras in the initiation and progression of tumorigenesis in the
mouse via a novel approach. In preparation.
Abstracts:
1.
Johnson, L., Reddy, P.S., and Cochran, B.H. Regulation and characterization of
the SIS/PDGF inducible factor. Eighth Annual Meeting on Oncogenes; June
1992.
2.
Johnson, L., Reddy, P.S., and Cochran, B.H. Regulation and characterization of
the SIS/PDGF inducible factor. Kestone Symposia on Molecular and Cellular
Biology, Transcription: Factors, Regulation, and Differentiation; January 1993.
3.
Johnson, L., Fu, X.Y., and Cochran, B.H. A component of the SIS/PDGF
inducible factor reacts with an antibody against the 91kD subunit of ISGF3.
Ninth Annual Meeting on Oncogenes; June 1993.
206
4.
Johnson, L., Greenbaum, D., Schmitt, E., Murphy, L., Bronson, R.T., Umanoff,
H., Kucherlapati, R., and Jacks, T. Targeted mutation of the K-ras gene in the
mouse. Mouse Molecular Genetics; 1995.
207