Tissue Specific Regulation of the High Density Lipoprotein (HDL)
Receptor, Scavenger Receptor Class B, Type I (SR-BI) by the
Scaffold Protein PDZK1
by
Sara Anne Fenske
B.S. Cellular and Molecular Biology
University of Michigan, 2001
Submitted to the Department of Biology in Partial Fulfillment of the
Requirements for the Degree of
Doctor of Philosophy
at the Massachusetts Institute of Technology
©Massachusetts Institute of Technology
All Rights Reserved
Signature of Author
Sara Anne Fenske
Department of Biology
Certified by
(i
Monty Krieger
Professor of Biology
Thesis Supervisor
Accepted
by
MASCUSTSINTTT
-- 1 --
MASSACHUSETTS INSTE
OF TECHNOLOGY
SEP 0 9 2008
LIBRARIES
`-----
A•CHIVES,
Stephen P. Bell or Tania Baker
Professor of Biology
Graduate Committee Co-Chair
Tissue Specific Regulation of the High Density
Lipoprotein (HDL) Receptor, Scavenger Receptor
Class B, Type I (SR-BI) by the Scaffold Protein
PDZK1
by
Sara Anne Fenske
Submitted to the Department of Biology in partial fulfillment of the requirements for degree of
Doctor of Philosophy in Biology.
Abstract
PDZK1 is a four PDZ-domain containing cytoplasmic adaptor protein that binds the Cterminus of the high-density lipoprotein (HDL) receptor SR-BI. Abolishing PDZK1 expression
in PDZK1 knockout (KO) mice leads to a post-transcriptional, tissue-specific decrease in SR-BI
protein level and an increase in total plasma cholesterol carried in abnormally-large HDL
particles. A greater than 95% decrease in SR-BI expression levels is observed in the livers of
PDZK1 KO mice. The mechanism behind this tissue-specific regulation of SR-BI expression is
unclear. PDZK1 comprises multiple structural features that, aside from the first PDZ domain,
which binds SR-BI, are not known to interact with SR-BI. It seems probable that these structures
(three PDZ domains, at least one phosphorylation site on the C-terminal tail, and a putative PDZbinding motif at its C-terminus) might interact with other cellular components to influence
hepatic SR-BI expression. This thesis explores the role of PDZKI's structural features in the
PDZKl-dependent regulation of hepatic SR-BI through the hepatic expression of PDZK1 and
various truncation and point mutants of PDZK1 in wild-type (WT) and PDZK1 KO mice. These
studies demonstrated that overexpression of the first PDZ domain of PDZK1 can affect hepatic
SR-BI abundance and localization in both WT and PDZK1 KO mice, but was not sufficient to
restore normal SR-BI function in PDZK1 KO mice. Overexpression of the first three domains of
PDZK1 in PDZK1 KO mice was able to partially restore cell-surface localization and function of
hepatic SR-BI, but was not able to fully restore SR-BI abundance, localization and abundance.
Overexpression of full-length PDZK1 or a mutant missing the C-terminal PDZ-binding motif of
PDZK1 in PDZK1 KO mice was sufficient to restore normal SR-BI abundance and activity.
Therefore, we conclude that some structural feature of PDZK1 between the PDZ3 domain and
the C-terminal PDZ-binding motif is required for normal SR-BI expression and. thus, function. It
is possible that this feature may be the PDZ4 domain of PDZK1, as preliminary data suggests
that overexpression of the four PDZ domains of PDZK1 (missing the C-terminal tail) might be
able to fully restore hepatic SR-BI function.
Thesis Supervisor: Monty Krieger
Title: Professor of Biology
Acknowledgements
Many have helped and supported me during the past seven years. To list them all and what they
have done for me would require too many pages, so I will keep this brief and trust that my
friends and colleagues know how much I appreciate all that they have done, and that I thank
them sincerely, even if they are not specifically named here.
I would like to thank my advisor, Monty Krieger, for all of his help, support, advice and puns.
He has been a wonderful mentor.
I would like to thank my thesis defense committee members Hazel Sive, Olivier Kocher, Harvey
Lodish, and David Sabatini for agreeing to serve on my committee. I would also like to thank
Harvey Lodish and David Sabatini for being members of my thesis committee for the entirety of
my graduate career and for the helpful advice and suggestions they've given me during our
discussions.
I would also like to thank Olivier Kocher for allowing me to collaborate with him, and for
sharing his lab and scientific expertise with me.
Thank you to all of my collaborators, especially Attilio Rigotti, the members of the Kocher lab,
and Adelina Duka.
To the Krieger Lab, it would be too difficult to describe what each person has done for me, so I
will simply say thank you for your friendship, encouragement, and lunchtime conversations.
Finally, I would like to thank my husband and my family for all of their love and support.
Table of Contents
Abstract
Acknowledgements
Table of Contents
List of Abbreviations
List of Figures
3
5
6
8
10
Chapter One: Introduction
Section One: Cholesterol and Lipoprotein Metabolism
I Cholesterol
A Cholesterol and Atherosclerosis
II Lipoproteins
A LDL
1 LDL Structure
2 LDL-Receptor Mediated Endocytosis
B HDL
III Scavenger Receptor, Class B, Type I
A Scavenger Receptors
B SR-BI Structure and Function
C SR-BI Activity In Vivo
D Regulation of SR-BI
Section Two: PDZ Domains and PDZ Proteins
I PDZ Domain Structure
II PDZK1
Section Three: Overview of Questions Addressed in this Dissertation
References
13
15
Chapter Two: Overexpression of the PDZ1 Domain of PDZK1
Blocks the Activity of Hepatic Scavenger Receptor Class B, Type I
(SR-BI) by Altering its Abundance and Cellular Localization
Abstract
Introduction
Experimental Procedures
Results
Effects of the PDZK1-Tg on hepatic SR-BI expression
and lipoprotein metabolism
Effects of the PDZ1-Tg on lipoprotein metabolism and
hepatic SR-BI expression
Discussion
References
Acknowledgements
45
16
16
18
18
19
20
21
21
22
25
25
27
27
29
34
37
47
49
50
53
55
58
62
64
66
Chapter Three: Hepatic Cell-Surface Localization of the
High-Density Lipoprotein Receptor, SR-BI, is Controlled
by the First Three PDZ Domains of PDZK1
Abstract
Introduction
Experimental Procedures
Results
Effects of the pTEM-Tg on hepatic SR-BI expression
and lipoprotein metabolism
Effects of the PDZl.2-Tg and PDZl.2.3-Tg on lipoprotein
metabolism and hepatic SR-BI expression
Discussion
References
Acknowledgements
Chapter Four: Determining the Effects of Expressing Three
PDZK1 Mutants (PDZ1.2.3.4, MUT2, and PDZ2.3.4) on
Hepatic SR-BI Function
PDZl.2.3.4
MUT1 and MUT2
PDZ2.3.4 and Adenovirus Production
Experimental Procedures
References
Chapter Five: Conclusions and Future Investigations
Summary of Findings
Future Investigations
References
Appendix 1: Isolating Genes Related to the Function of SR-BI,
an HDL Receptor
Summary
Experimental Procedures
References
67
69
70
72
74
76
79
85
87
89
91
93
96
101
104
106
107
109
111
115
117
119
120
121
List of Abbreviations
e-COP - Epsilon coatomer protein
ABC - ATP binding cassette
ABCA1 - ATP binding cassette transporter Al
ABCG1 - ATP binding cassette transporter Gi
ABCG4 - ATP binding cassette transporter G4
apoA-I - Apolipoprotein A-I
apoA-IV - Apolipoprotein A-IV
apoB - Apolipoprotein B
apoB-100 - Apolipoprotein B-100
apoB48 - Apolipoprotein B48
apoC - Apolipoprotein C
apoC-I - Apolipoprotein C-I
apoD - Apolipoprotein D
apoM - Apolipoprotein M
apoE - Apolipoprotein E
ATP - Adenosine-5'-triphosphate
BCR - Breakpoint cluster region protein
C/EBP - CCAAT/ enhancer-binding protein
CETP - Cholesteryl ester transfer protein
CFEX - Chloride-formate exchanger
CFTR - Cystic fibrosis transmembrane conductance regulator
CHD - Coronary heart disease
CHO - Chinese hamster ovary
CIC3B - Chloride channel PDZ isoform 3B
D-AKAP2 - Dual-specific protein kinase A-anchoring protein 2
DNA - Deoxyribonucleic acid
ECL - Enhanced chemiluminescent
eNOS - Endothelial nitric oxide synthase
ER - Endoplasmic reticulum
FPLC - Fast performance liquid chromatography
GST - Glutathione-S-transferase
hOAT4 - Organic anion transporter 4
HDL - High-density lipoproteins
HMG-CoA - P-hydroxy-3-methylglutaryl CoA
IDL - Intermediate-density lipoproteins
IgG - Immunoglobulin G
kb - Kilobase
kDa - Kilodalton
KO - Knockout
LCAT - Lecithin: cholesterol acyltransferase
LDL - Low-density lipoproteins
LPL - Lipoprotein lipase
LRH-1 - Liver receptor homolog 1
LXR - Liver X receptor
MAP17 - Membrane-Associated Protein 17
MRP2 - Multi-drug resistance protein 2
MRP4 - Multi-drug resistance protein 4
MUC17/ Muc3(17)) - Mucin 17
MUPP1 - Multi-PDZ-domain protein
NaPi-I - Sodium-phosphate cotransporter I
NaPi-IIa - Sodium-phosphate cotransporter IIa
NHE3 - Na+/H+ exchanger isoform 3
NHERF-1- Na+/H+ exchanger regulatory factor 1
NHERF-2 - Na+/H+ exchanger regulatory factor 2
nm - Nanometer
NOS2 - Nitric Oxide Synthase 2
OATP-A/ OATP1A2 - Organic anion transporting polypeptide A
OATP-1/ OATP1A1 - Organic anion transporting polypeptide 1
OAtp5/ OATP1A6 - Organic anion transporting polypeptide 5
OK - Oossum kidney
OCTN1 - Organic cation transporter 1
OCTN2 - Organic cation transporter 2
PCR - Polymerase Chain Reaction
PDZ - postsynaptic density protein (PSD-95)/Drosophila disc large tumor suppressor (dlg)/tight
junction protein (ZOl)
PEPT-1 - Peptide transport 1
PEPT-2 - Peptide transport 2
PKA - Protein kinase A
PLTP - Phospholipid transfer protein
PPARa, y - Peroxisome proliferator activated receptor a, y
RNA - Ribonucleic acid
S1P - Site 1 protease
S2P - Site 2 protease
SCAP - SREBP cleavage activating protein
SLK - Ste20-related serine/threonine protein kinase
SR-AI - Scavenger Receptor, Class A, Type I
SR-AII - Scavenger Receptor, Class A, Type II
SR-BI - Scavenger Receptor, Class B, Type I
SR-BII - Scavenger Receptor, Class B, Type II
SR-BIII - Scavenger Receptor, Class B, Type III
SR-CI - Scavenger Receptor, Class C, Type I
SR-CII - Scavenger Receptor, Class B, Type II
SREs - Sterol regulatory elements
SREBPs - Sterol regulatory element -binding proteins
TC - Total cholesterol
Tg - Transgenic
TGN - Trans Golgi Network
UC - Unesterified cholesterol
URAT1 - Organic anion transporter 1
VLDL - Very low-density lipoprotein
WT - Wild-type
List of Figures and Tables
Chapter One: Introduction
Figure 1. Structure of cholesterol
Table 1. Characteristics of the major classes of human
Plasma Lipoproteins
Figure 2. Representation of the structure of an LDL particle
Figure 3. Receptor-mediated endocytosis of LDL by the LDL receptor
Figure 4. Model of the topology of murine SR-BI
Figure 5. Model for selective lipid uptake from HDL via SR-BI
Figure 6. Model of PDZK1 protein structure
Table 2. List of proteins reported to interact with PDZK1
Figure 7. Diagrams of wild-type and mutant PDZK1 protein structures
15
18
19
20
23
24
29
29
36
Chapter Two: Overexpression of the PDZ1 Domain of PDZK1 Blocks the Activity of
Hepatic Scavenger Receptor Class B, Type I (SR-BI) by Altering its Abundance and
Cellular Localization
Figure 1. Hepatic expression of PDZK1 and PDZ1 transgenes
54
Figure 2. Effect of expression of the PDZK1 transgene on hepatic
56
SR-BI protein levels (A) and plasma lipoprotein cholesterol (B and C)
in WT and PDZK1 KO mice
Figure 3. Immunohistochemical analysis of hepatic SR-BI in WT and
57
PDZK1 KO nontransgenic (A and B), PDZK1 transgenic (C and D),
and PDZ1 transgenic (E and F) mice.
Figure 4. Effect of expression of the PDZ 1 transgene on hepatic SR-BI
60
protein levels (A) and plasma lipoprotein cholesterol (B and C) in WT
and PDZK1 KO mice.
61
Figure 5. Immunoblot analysis of the effects of the PDZ 1 transgene on
the N-glycosylation of hepatic SR-BI in WT mice.
Chapter Three: Hepatic Cell-Surface Localization of the High-Density Lipoprotein
Receptor, SR-BI, is Controlled by the First Three PDZ Domains of PDZK1
Figure 1. Hepatic expression of PDZ1.2, PDZ1.2.3 and pTEM transgenes. 75
Figure 2. Effects of expression of the pTEM transgene on hepatic SR-BI 77
protein levels (A) and plasma lipoprotein cholesterol (B and C) in WT
and PDZK1 KO mice.
78
Figure 3. Immunohistochemical analysis of hepatic SR-BI in WT and
PDZK1 KO nontransgenic (A and B), pTEM transgenic (C and D),
PDZ1.2 transgenic (E and F), and PDZ1.2.3 transgenic mice.
81
Figure 4. Effects of expression of the PDZ1.2 transgene on hepatic
SR-BI protein levels (A) and plasma lipoprotein cholesterol (B and C)
in WT and PDZK1 KO mice.
83
Figure 5. Effect of expression of the PDZ1.2.3 transgene on hepatic
(B
and
C)
cholesterol
lipoprotein
(A)
and
plasma
protein
levels
SR-BI
in WT and PDZK1 KO mice.
Chapter Four: Determining the Effects of Expressing Three PDZK1
MUT2, and PDZ2.3.4) on Hepatic SR-BI Function
Figure 1. Structures of PDZKl, the truncation mutants PDZ1.2.3.4
and PDZ2.3.4, and the point mutant MUT2.
Table 1. Effect of PDZl.2.3.4-Tg on plasma cholesterol levels in
two founder lines.
Figure 2. Effect of expression of the PDZ1.2.3.4 transgene on
plasma lipoprotein cholesterol profiles in WT and PDZK1 KO
mice from founder 1159.
Figure 3. In vitro binding of PDZK1 point mutants to the SR-BI
C-terminal peptide.
Table 2. Effect of MUT1-Tg expression on plasma cholesterol
levels in three founder lines.
Table 3. Effect of MUT2-Tg on plasma cholesterol levels in
three founder lines.
Figure 4. Effect of expression of the MUT2 transgene on plasma
lipoprotein cholesterol profiles in WT and PDZK1 KO mice from
founder 694.
Figure 5. Hepatic expression of PDZK1 and PDZ2.3.4 by adenovirus
in WT mice.
Table 4. Effect of Ad.EA1l, Ad.PDZK1, Ad.PDZ2.3.4 hepatic
expression on plasma cholesterol levels in WT and PDZK1 KO mice.
Chapter Five: Conclusions and Future Investigations
Figure 1. Diagrams of wild-type and mutant PDZK1 protein structures.
Mutants (PDZ1.2.3.4,
94
94
95
97
98
99
100
100
103
109
Chapter One
Introduction
Section One: Cholesterol and Lipoprotein Metabolism
I. Cholesterol
In 1816, the chemist Michel Chevreul suggested to a meeting of the French Academy of
Sciences that a fat-like substance, discovered decades before in gallstones, be called cholesterine.
The structure of cholesterine, or cholesterol (Figure 1), was not determined, however, until 1932
through the work of numerous investigators, including Adolf Windaus and Heinrich Wieland,
who won the Nobel prize for their work elucidating the structures of cholesterol and bile acids
(1,2).
0113
%A.
HO
Figure 1: Structure of Cholesterol
Regulation of cholesterol levels and transport is essential to many cell functions.
Cholesterol is a key structural component of many eukaryotic membranes, where it maintains
proper membrane fluidity by packing between phospholipids in membranes. It also serves as the
substrate for synthesis of steroid hormones in endocrine tissues (e.g. adrenal gland, ovary, and
testis), bile acids in the liver, vitamin D in the skin and kidney, and covalent-modification of the
signaling protein hedgehog (3,4). One source of cholesterol for cells is endogenous synthesis
from mevalonate and isoprenoid precursors. A key enzyme in this process, 0-hydroxy-3methylglutaryl CoA (HMG-CoA) reductase, converts HMG-CoA into mevalonate in the early
steps of the biosynthetic pathway, and it's expression is controlled by the cell as one method of
regulating cholesterol synthesis (reviewed in greater detail in under LDL-receptor mediated
endocytosis). In addition to biosynthesis of cholesterol, cells also take up cholesterol from
plasma lipoproteins, large particles composed of protein and lipid (reviewed in greater detail in
the sections ahead). Most cholesterol in human plasma is carried by low-density lipoproteins
(LDL) and high-density lipoproteins (HDL), whose structures, function, and metabolism will be
discussed in detail in the sections to follow (4).
A. Cholesterol and Atherosclerosis
Cholesterol and the major plasma cholesterol carriers HDL and LDL are perhaps best
known for their role in the development of atherosclerosis and heart disease. Heart disease has
been the leading cause of death in the United States for the past 80 years, and the primary cause
of heart disease is atherosclerosis (5).
Atherosclerosis pathogenesis is a complex process in which a fatty deposit (called an
atherosclerotic plaque) builds up in the inner lining of the wall of arteries. This process is known
to involve both lipid metabolism and inflammation. Early-stage atherosclerotic plaques are
composed of cholesterol-laden macrophage cells, called foam cells, that accumulate in the blood
vessel wall. As the plaque develops and grows larger, portions of the plaque become fibrotic and
the plaque develops a fibrous cap. If the atherosclerotic plaque becomes fragile, it can rupture,
causing a blood clot to form, significantly or completely blocking blood flow in the vessel (6, 7).
If this blockage occurs in a blood vessel that feeds the heart, this causes a myocardial infarction,
otherwise known as a heart attack.
One of the first studies to link cholesterol to atherosclerosis was performed in 1913 by a
pathologist named Anitschkow, who demonstrated that rabbits fed purified cholesterol dissolved
in sunflower oil developed high plasma cholesterol levels and vascular lesions that closely
resembled human atherosclerosis (6). Multiple epidemiological studies, including the famous
Framingham Heart Study, begun in 1950, have demonstrated a positive correlation between
blood cholesterol levels and the risk of coronary heart disease (CHD). These studies also
revealed a positive correlation between plasma cholesterol levels carried by LDL particles and
CHD, and an inverse correlation between HDL cholesterol levels and CHD (8). This link
between LDL cholesterol levels and heart disease was further elucidated by the work of Brown
and Goldstein investigating the cause of familial hypercholesterolemia, a disease characterized
by abnormally high plasma LDL cholesterol levels and early-onset CHD. This work led to the
elucidation of the LDL receptor pathway (which is discussed in greater detail in subsection
II.A.2), as well as demonstrating that loss of LDL receptor activity could lead to high plasma
LDL cholesterol levels, which, in turn, leads to atherosclerosis (9). Later studies pointed to the
potential role of modified forms of LDL, such as oxidized LDL, and their interaction with
scavenger receptors found on macrophages in the development foam cells found in
atherosclerotic lesions (9).
In contrast, HDL is thought to be involved in a process called reverse cholesterol
transport. In this process, HDL removes cholesterol from extrahepatic tissues, including excess
cholesterol in macrophage foam cells, and delivers it to the liver for excretion in the bile, thereby
removing excess cholesterol from the body. It is thought that HDL's role in reverse cholesterol
transport may explain, at least in part, the atheroprotective role it plays (10)
II. Lipoproteins
Due to their hydrophobicity, cholesterol and other lipids, including triglycerides and
phospholipids, are carried through the plasma in macromolecular particles called lipoproteins.
Lipoproteins are composed of a non-polar core of neutral lipid surrounded by an amphipathic
outer shell which includes proteins (called apolipoproteins), phospholipids, and unesterified or
free cholesterol (11). There are five distinct lipoproteins, each with their own function (Table 1).
The largest lipoprotein, chylomicrons are formed from dietary fats, and lipids secreted in
bile that are reabsorbed from the gastrointestinal lumen. The neutral lipid at the core of the
chylomicron is mainly triglycerides, and apoB48 and apoE are the key proteins in this particle
(see Table 1 for further details). Chylomicrons are synthesized by the intestines and secreted into
the lymph. Once in the plasma, the triglyceride molecules in the core are hydrolyzed by
lipoprotein lipase (LPL), which is an enzyme bound to endothelial cells in capillaries. This
hydrolysis reduces the volume of the chylomicron particle, leading to loss of surface molecules
such as phospholipids, unesterified cholesterol, and transferable apolipoproteins to other
circulating lipoproteins, especially HDL particles. The remaining particle is called a chylomicron
remnant, which is quickly taken up by the liver via receptor-mediated endocytosis (4).
Very low-density lipoprotein (VLDL) particles are another apoB containing triglyceriderich lipoprotein. VLDL particles contain apoB 100 and apoE, though VLDLs in rodents also
contain apoB48 (see Table 1 for further details). These particles are synthesized by the liver and
secreted into the blood. Like chylomicrons, the triglycerides in VLDL particles are hydrolyzed
by LPL. This results in a loss of volume, transforming VLDL particles into intermediate-density
lipoproteins (IDL) (Table 1). These IDL particles are either endocytosed by the liver, or further
acted upon by hepatic lipase (which hydrolyzes phospholipids, and to a lesser extent
triglycerides, on lipoproteins) and cholesteryl ester transfer protein (which transfers cholesteryl
esters from HDL particles to IDL/LDL particles in exchange for triglycerides) to convert the IDL
particle into a low-density lipoprotein (LDL) (4).
Properties
Diameter (nm)
Triglycerides (%
of core lipid)
Cholesteryl
Esters (% of core
lipids)
Protein: Lipid
Mass Ratio
Major
Apolipoproteins
Apolipoproteins
Major
Physiological
Function
Chylomicron
VLDL
IDL
LDL
HDL
75-1200
30-80
23-35
18-25
5-12
75
31
12
11
3
25
69
88
89
1:100
9:100
17:100
25:100
90:100
A, B-48, C, E
B-100, C, E
B-100, E
B-100
A, C
Transports
dietary
triglycerides to
extrahepatic
tissues;
Triglyceridedepleted
remnants deliver
dietary
cholesterol and
some
triglycerides to
the liver
Transports
hepatic
triglycerides
to
extrahepatic
tissues;
Converted
into IDL
Transient
intermediate
between
VLDL and
LDL;
Transports
lipids to
liver
Transports
plasma
cholesterol
to the liver
and to
extrahepatic
tissues
Takes up
cholesterol
from
extrahepatic
tissues and
delivers it to
the liver,
steroidogenic
tissues, and
other
lipoproteins
Table 1: Characteristics of the Major Classes of Human Plasma Lipoproteins (142, 143,
165).
A. LDL
LDL particles are the main carriers of cholesterol, as cholesteryl ester, in human plasma
(12).
1. LDL Structure
LDL particles are composed of a neutral lipid core, comprising mainly cholesteryl esters
and some triglycerides, surrounded by an amphipathic shell composed of phospholipids,
unesterified cholesterol, and a single copy of the apoB-100 protein (13) (see Table 1 and Figure
2 for further details).
Cholesterol
Phospholipid
Figure 2: Representation of the structure of an LDL particle.
LDL is a spherical macromolecule containing mainly cholesteryl ester and some triglycerides at
its core, with a shell comprising phospholipid, unesterified cholesterol and a single copy of
apoB- 100.
2. LDL-Receptor Mediated Endocytosis
The work of Brown and Goldstein led to the elucidation of the mechanism by which LDL
particles deliver their cholesterol to the liver and extrahepatic tissues (Figure 3). The LDL
receptor, which mediates the cellular uptake of LDL cholesterol, is mostly expressed
in the liver,
though it is expressed at lower levels in other tissues (4). During receptor-mediated
endocytosis,
the LDL receptor, located in clathrin-coated pits on the cell surface, binds LDL particles by their
apoB-100 component with high affinity, followed by endocytosis through coated vesicles that
convert to endosomes. The low pH in the lumen of endosomal compartments results in the
dissociation of the LDL particle from its receptor, followed by recycling of the receptor to the
cell surface. The entire LDL particle is degraded in the lysosome by enzymatic
hydrolysis,
releasing the cholesterol for cellular metabolism (14). Loss of LDL receptor activity, due to
mutations in the LDL receptor (as in the case of familial hypercholesterolemia) or in proteins
involved in the receptor-mediated endocytosis pathway (as in the case of autosomal recessive
hypercholesterolemia) leads to increased plasma cholesterol levels found in apoB-containing
particles, especially LDL particles (15-19).
Transfer of Lipoprotein Cholesterol to Cells
a. LDL Receptor-Mediated Endocytosis
TGN
GOLGI
RER
NUCLEUS
LDL
Receptor
LDL
C
Figure 3. Receptor-mediated endocytosis of LDL by the LDL Receptor.
Reprinted, with permission, from the Annual Review of Biochemistry, Volume 68 (c) 1999 by
Annual Reviews www.annualreviews.org (14).
Both expression of the LDL receptor and endogenous cholesterol biosynthesis are
controlled by cholesterol-mediated negative feedback regulation through sterol regulatory
element -binding proteins (SREBPs) found in the endoplasmic reticulum (ER) membrane.
SREBPs contain an amino-terminal transcription factor domain, which controls gene
transcription through binding to sterol regulatory elements (SREs). In sterol-poor cell
environments, the SREBP binds to an ER integral membrane sterol-sensing protein called
SREBP cleavage activating protein or SCAP. This interaction allows for the first proteolytic
cleavage of SREBP from its C-terminal regulatory domain by Site 1 protease (S 1P), followed by
cleavage by the Site 2 protease (S2P) within one of the SREBP's integral membrane domains,
releasing the SREBP transcription factor into the cytoplasm. This allows the SREBP
transcription factor to enter the nucleus and, along with other transcription factors, upregulate
transcription of genes involved in the biosynthetic pathway of cholesterol, such as HMG-CoA
synthase and HMG-CoA reductase, as well as expression of the LDL receptor. Build-up of
sterols in the cell blocks proteolytic release of SREBP (20).
B. HDL
Like LDL, HDL particles are composed of a neutral lipid core of mainly cholesteryl
esters, and an amphipathic shell composed of phospholipids, cholesterol and apolipoproteins.
Unlike LDL, which contains a single copy of apoB-100, HDL contains multiple apolipoproteins.
In addition to the minor apolipoprotein components, such as apoA-IV, apoC, apoD, apoM and
apoE; HDL's major apolipoproteins are apoA-I, which constitutes approximately 70% of HDL
protein and is present on almost all HDL particles, and apoA-II, which constitutes about 20% of
HDL protein and is present on approximately two-thirds of particles (4, 21). HDL biosynthesis
begins with the secretion of lipid-free or lipid-poor apoA-I by the intestines and liver or the
release of lipid-poor apoA-I from triglyceride-rich lipoproteins during lipolysis. This form of
HDL is known as Pre-P HDL (22). This is followed by lipidation of the apoA-I protein through
efflux of cellular phospholipids and cholesterol via the ATP-binding cassette transporter protein
ABCA1, forming discoidal HDL. ABCA1 is highly expressed in macrophages, and defects in
ABCA1 function are the cause of Tangier disease, which is characterized by an almost complete
lack of plasma HDL, accumulation of macrophage foam cells in various tissues, and a moderate
increase in the risk for atherosclerosis (10). Discoidal HDL is remodeled into spherical a-HDL,
the most abundant form of HDL, by the enzyme lecithin: cholesterol acyltransferase (LCAT),
which circulates in the blood bound to lipoproteins or in lipid-free form. LCAT transfers the 2acyl group from lecithin or phosphatidylethanolamine to the hydroxyl group on free cholesterol
to generate cholesteryl esters, which constitute the core of the mature, alpha-HDL particle.
Further remodeling occurs through the exchange of lipids between HDL and other lipoproteins,
such as VLDL, IDL and LDL particles (23), such as the transfer of phospholipids to HDL from
other lipoproteins by phospholipid transfer protein (PLTP), following hydrolysis of the
triglyceride core by lipoprotein lipase (21).
Further addition and removal of HDL cholesterol is performed by several different
proteins. ABCG1 and ABCG4 are members of the ABC family of half transporters that form
homodimers to function (24). ABCG1 is expressed in a number of extrahepatic tissues, including
macrophages, brain, thymus, spleen and lung, while ABCG4 is expressed in the eye and brain.
Both ABCG1 and ABCG4 promote cholesterol efflux from cells to HDL and other lipoproteins,
but not to lipid-free apoA-I. The mechanism behind this efflux is not clear, but it does not seem
to require that these transporters bind the acceptor lipoproteins in certain cell types (23, 25),
though binding of ABCG1 to HDL was detected in cultured macrophages (26). ABCGI appears
to translocate cholesterol to cell-surface lipid domains that are accessible to extracellular
lipoproteins (23, 25). Cholesteryl esters are removed from HDL particles by Cholesteryl ester
transfer protein (CETP), which transfers cholesteryl esters from HDL to apoB-containing
particles in exchange for triglycerides, shifting plasma cholesteryl esters from HDL to LDL and
VLDL particles (27). Organisms that do not express CETP, such as mice, have most of their
plasma cholesteryl esters carried by HDL, while organisms that do express CETP, such as
humans, carry the majority of their cholesteryl esters in LDL particles (21).
III. Scavenger Receptor, Class B, Type I
A. Scavenger Receptors
One of the most extensively studied proteins involved in cholesterol uptake from and
efflux to HDL is the HDL receptor Scavenger Receptor, Class B, Type I (SR-BI). SR-BI is a
member of the scavenger receptor family, which are cell-surface transmembrane proteins that
can bind modified lipoproteins, such as acetylated or oxidized LDL. Brown and Goldstein and
colleagues first identified scavenger receptor activity while examining the mechanisms behind
the accumulation of LDL cholesterol in macrophages in atherosclerotic plaques (14). These
receptors were found to mediate cholesterol uptake from modified LDL into cultured
macrophages, causing these cells to become cholesterol-laden and to resemble the foam cells
present in atherosclerotic lesions. Macrophage scavenger receptors are considered potentially
important players in the development of atherosclerosis because of the key role oxidized LDL is
thought to play in the generation of atherosclerotic lesions (28).
Several classes of scavenger receptors, expressed in a variety of tissues, including
macrophages, have been characterized over the past 19 years. These classes of receptors are
grouped by structural similarity, generally by sequence comparisons; and identified as class A,
class B, etc. Individual receptor proteins within each class are labeled as separate types: type I,
type II, and so on. Different types of receptors within each class can either be products of
alternatively spliced mRNAs from a single gene, as is the case with the first identified scavenger
receptors SR-AI and SR-AII; or products from different genes, as in the case of SR-CI and SRCII (14).
SR-BI belongs to the class B scavenger receptors, which, among others, include the
protein CD36, as well as SR-BII, which is an alternatively spliced product of the SR-B gene (SRBII will be further discussed in the sections to follow). In addition to binding a variety of typical
scavenger receptor ligands, such as modified lipoproteins, maleylated bovine serum albumin,
advanced glycation end-product modified proteins, and apoptotic cells, SR-BI also binds the
native lipoproteins HDL, LDL and VLDL. However, most studies have focused on SR-BI as the
high-affinity HDL receptor. SR-BI binds cholesteryl-ester rich spherical a-HDL particles via
their lipoproteins with higher affinity than lipid-poor pre3-HDL particles or lipid-free apoA-I
(28).
B. SR-BI Structure and Function
SR-BI (Figure 4) is a 509 amino-acid-long integral membrane cell-surface glycoprotein.
The proposed topology, based on sequence similarity to another class B scavenger receptor,
CD36, is a horseshoe-like extracellular loop, with multiple N-glycosylation and disulfide-bond
sites. N- and C-terminal transmembrane domains flank this extracellular loop. SR-BI also has
short N- and C-terminal cytoplasmic domains (8 amino-acids and 44 amino-acids respectively)
(29-31). SR-BI cell surface expression and activity are substantially reduced when either one of
2 of the 11 N-linked glycosylation sites is removed by mutation (32). SR-BI is also fatty acylated
at two sites near the C-terminus (29).
In addition, alternative splicing of the SR-BI mRNA product, skipping the 12th exon of
the SR-BI gene, produces a variant called SR-BII, which is three residues shorter than SR-BI and
differs from SR-BI in its final 39 C-terminal amino acids that compose the C-terminal
cytoplasmic domain. SR-BII accounts for only 5-15% of the SR-BI/BII protein in various
tissues, is endocytosed from the cell surface and primarily localized intracellularly (33-35). A
third mRNA splice variant, SR-BIII, has been reported in a single publication as being detected
in human atherosclerotic plaques. The putative protein sequence for SR-BIII would differ from
SR-BI in its final 43 amino acids (36).
outsid
inside
Figure 4. Model of the topology of murine SR-BI.
Reprinted, with permission, from the Annual Review of Biochemistry, Volume 68 (c) 1999 by
Annual Reviews www.annualreviews.org.
In addition to binding lipoproteins, SR-BI can also mediate lipid uptake from lipoprotein
particles into cells. The mechanism by which SR-BI does this differs from that of the LDL
receptor. The LDL receptor pathway for the delivery of lipoprotein cholesterol to cells involves
clathrin-coated pit-mediated endocytosis, with subsequent lysosomal degradation of the entire
LDL particle (37). In contrast, SR-BI employs a mechanism, termed selective uptake, to bring
cholesteryl ester into the cell (38-41) (Figure 5). Selective uptake does not require the
endocytosis and subsequent degradation of the entire HDL particle (42-44). Instead, SR-BI
mediates the binding of the HDL particle to the cell surface, followed by binding-dependent lipid
transfer of cholesteryl esters to the cell (38, 45, 46). The lipid-depleted HDL particle then
dissociates and re-enters the circulation. Though SR-BI can bind and mediate lipid uptake from
lipoproteins other than HDL (such a LDL and VLDL), SR-BI displays nonreciprocal cross
competition between HDL and LDL, in which HDL can block all LDL binding but LDL is a
poor inhibitor of HDL binding to SR-BI (47, 48). For this reason, LDL is not thought to be
effective at interfering with HDL binding to SR-BI in vivo. Mutational analyses of SR-BI
demonstrated that alteration of certain residues on SR-BI are capable of inhibiting detectable
HDL binding, but not LDL binding (48).
Figure 5. Model for selective lipid uptake from HDL via SR-BI.
CD36, another class B scavenger receptor and homolog of SR-BI, is able to bind HDL,
but is not able to mediate efficient selective lipid uptake. A structure/function analysis of SR-BI,
in which chimeras were constructed between SR-BI and CD36, established that the extracellular
domain of SR-BI is sufficient to confer efficient selective uptake activity on the cytoplasmic and
transmembrane domains of CD36 (45, 49).
In addition to lipid uptake from HDL, SR-BI can also mediate the bi-directional flux of
free (unesterified) cholesterol between cells and HDL. There is a strong correlation between the
level of SR-BI expression and the rate of cholesterol efflux to HDL in a variety of cell types,
including cultured macrophages (50), and this efflux is dependent on HDL binding to SR-BI
(51). This flux of cholesterol between HDL and cells via SR-BI is closely linked to the
composition and phospholipid content of the lipoprotein (52, 53).
C. SR-BI Activity In Vivo
A large body of work using in vivo, primarily murine, systems shows that SR-BI plays a
key role in HDL metabolism. SR-BI is highly expressed in the liver and steroidogenic tissues
(adrenal gland, ovary and testis), which have the highest levels of HDL selective lipid uptake,
but is also expressed at lower levels in the intestines, lungs, macrophages, endothelial cells,
smooth muscle cells, neuroglia, retinal pigment epithelial cells, and keratinocytes (4, 38).
Experimental changes in SR-BI expression in the mouse lead to changes in total plasma
cholesterol levels, HDL structure, biliary cholesterol secretion, and the amount of cholesterol
stored in steroidogenic tissues (39, 40, 54-57). Hepatic overexpression of SR-BI by adenovirus
or stable transgene leads to a dramatic reduction in plasma HDL cholesterol levels and a
concurrent increase in the cholesterol concentration in hepatic bile (39, 58-61). Furthermore,
there are severe consequences if the SR-BI gene is knocked-out in mice (SR-BI KO mice),
including a 2- to 2.5-fold increase in plasma cholesterol levels found in abnormally large HDL
particles, an abnormal unesterified: total plasma cholesterol ratio (-0.5 in SR-BI KO mice
compared to -0.25 in controls), and reduced biliary cholesterol secretion and gallbladder bile
cholesterol content without changes in either biliary bile acid or phospholipid secretion, bile acid
pool size, or fecal bile excretion (57, 62). In addition, SR-BI KO mice display female infertility,
due to an apparent defect in oocyte maturation and development (62); defects in red blood cell
maturation (62, 63); and a reduced platelet count (65). Liver specific expression of SR-BI in SRBI KO mice results in normal plasma cholesterol levels and a normal unesterified: total plasma
cholesterol ratio, and restoration of female fertility and a normal platelet count (64, 65). When
the SR-BI knockout mouse is crossed with mouse models of atherosclerosis, dramatic
acceleration in the onset and/or development of atherosclerosis is observed (62, 66). In addition,
bone marrow transplant studies in mice indicate that SR-BI expression in bone marrow- derived
cells is atheroprotective (67-69), indicating that SR-BI-mediated efflux of cholesterol from
macrophages might be anti-atherogenic. All of these studies demonstrate the important role that
SR-BI, especially hepatic SR-BI, plays in HDL metabolism and reverse cholesterol transport.
D. Regulation of SR-BI
The SR-BI gene is found on chromosome 12 in humans and rats and chromosome 5 in
mice and comprises 13 exons (33). SR-BI transcriptional regulation can be affected by a number
of dietary, hormonal, metabolic and pharmacological manipulations. In hamsters, hepatic SR-BI
expression is stimulated by dietary plant-derived polyunsaturated fatty acids, and is suppressed
by dietary myristic acid. Dietary vitamin E levels inversely regulate hepatic SR-BI expression in
mice. In rats, pharmacologic estrogen levels reduce SR-BI expression in the liver (28), but
stimulate SR-BI expression in ovaries and adrenal gland (70). Interestingly, estrogen increases
the hepatic expression of SR-BII via an unknown post-transcriptional mechanism (71).
The human and rat promoters of the SR-BI are the best-studied, and have been shown to
contain consensus-DNA sequences that bind a number of transcription factors, including
steroidogenic factor-1 (SR-1), CCAAT/ enhancer-binding protein (C/EBP), sterol-regulatory
element binding protein 1 (SREBP-1), liver X receptor (LXR), and liver receptor homolog 1
(LRH-1). Regulation of SR-BI expression by various molecules is likely to involve these and
other as yet unidentified transcription factors. In vitro and in vivo studies have demonstrated the
important role of nuclear receptors such as farnesoid X receptor (FXR), LXR, LRH-1,
peroxisome proliferator activated receptor a (PPARa), and PPARy in regulating SR-BI
transcription (4, 72).
Post-transcriptional regulation of SR-BI protein function needs further investigation as
well. The role of subcellular localization in regulating SR-BI protein function remains unclear.
Though degradation of the HDL particle in SR-BI-mediated selective uptake is not required,
some have suggested a potential role for transient internalization of HDL bound to SR-BI in
cholesteryl ester uptake and cholesterol efflux. In hepatocyte couplets, SR-BI was found in juxtanuclear compartments, accompanied by the transient internalization of HDL followed by
resecretion or retroendocytosis (73-75). In adipocytes, anti-SR-BI antibody staining revealed a
punctate intracellular distribution (76). Furthermore, the intracellular population of murine
hepatic SR-BI displayed a punctate perinuclear localization that colocalized with a late
endosomal/ lysosomal marker (77). However, several studies have shown that: 1) purified
murine SR-BI (mSR-BI) reconstituted in liposomes is able to mediate lipid uptake from HDL,
and 2) mSR-BI-mediated selective lipid uptake is unaffected by the inhibition of endocytosis in
Chinese hamster ovary (CHO) cells and primary mouse hepatocytes (44, 78-80). Therefore
internalization of HDL is not required for mSR-BI-mediated lipid uptake. However, lipid uptake
from HDL particles in CHO cells expressing human SR-BI was significantly decreased when
endocytosis was inhibited (81). In addition, retroendocytosis has been linked to mSR-BI's ability
to mediate efflux of cholesterol from CHO cells to HDL particles (82), but retroendocytosis of
HDL during SR-BI-mediated efflux was not seen in cultured macrophages (83). Therefore,
further studies are required to clarify the role of transient internalization in the mechanism of SRBI-mediated lipid transfer.
Many researchers in the field agree that SR-BI is clustered on the cell surface in plasma
membrane microdomains (29, 84). However, which microdomains are involved remains
controversial. Though SR-BI has been detected on both the basolateral and apical surfaces in
polarized hepatocytes when SR-BI is overexpressed by adenovirus, in sections from normal
livers, SR-BI appears to be localized mainly to the basolateral domain. This basolateral
localization is also seen in the kidney cell line, MDCK. In contrast, in polarized intestinal
enterocytes, SR-BI is localized mainly to the apical surface, as well as in the intestinal epithelial
cell line CaCo2 (4). In steroidogenic cells, many agree that SR-BI is likely to be localized in
microvillar channels. Microvillar channels are one kind of plasma membrane microdomain. SRBI was found to be necessary for the formation and/or stability of microvillar channels in
steroidogenic cells in vivo (85, 86). These microvillar channels serve to sequester HDL for
cholesteryl ester selective uptake (87, 88). Additionally, it's been demonstrated that HDL binds
to SR-BI localized on microvillar extensions and in microvillar channels in several cell types
(84, 89). In addition, SR-BI is found in microvilli of human intestinal enterocytes (90). SR-BI
found in microvillar extensions and channels in cell culture are also thought to be present in both
monomeric and dimeric or oligomeric forms, though the functional consequences of this
dimerization is not clear (91, 92).
A more controversial issue is the clustering of SR-BI in caveolae. Caveolae are flask
shaped invaginations in the plasma membrane that are cholesterol- and glycolipid-rich
microdomains (93-103). Our lab has shown, through immunofluorescence, that SR-BI partially
co-localizes with caveolin-1, a constituent of caveolae, in CHO cells (29). SR-BI has also been
co-purified with caveolae and caveolin-1, using biochemical purification methods, by several
independent groups in multiple cell types, including adrenocortical cells and endothelial cells
(29, 104). However, another study showed no co-purification between SR-BI and caveolae, and
claimed little- if any- HDL binding in caveolae in multiple cell lines (89). In the hepatoma cell
line, HepG2, SR-BI and caveolin-1 did not co-purify, though SR-BI was found in low-density
lipid rafts (105). This controversy may stem from complications in the methodologies used that
can affect the conclusions. For example, the conditions under which cells are grown can affect
the expression of caveolin-1 in NIH 3T3 cells, which is necessary for the formation of caveolae
(106-112). It may also stem from differences in localization in different tissues and cell-types.
It is unclear how this potential caveolar localization might affect SR-BI-mediated lipid
transfer. It has been claimed that HDL derived cholesteryl esters are initially transferred to
caveolae in CHO cells (113). However, caveolin-1 inhibits HDL-derived cholesteryl ester
selective uptake when expressed in macrophage cell lines (84) and has no affect on SR-BI
mediated selective uptake from HDL or free cholesterol efflux in two other cell lines (114). In
endothelial cells, SR-BI, localized to caveolae, mediates the upregulation of endothelial nitric
oxide synthase (eNOS) expression and activity by HDL, as well as protection of endothelial cells
from apoptosis and promotion of growth and migration by HDL (115-118). This activation of
eNOS, which is also localized in caveolae, by SR-BI/HDL involves binding of HDL to SR-BI
(119). Though it's unclear how SR-BI mediates eNOS activation, it is known to requires the
presence of the C-terminal transmembrane and cytoplasmic domains of SR-BI and the
interaction between SR-BI and the tyrosine kinase, Src, which is part of the signaling pathway
leading to the activation of eNOS (116, 119, 120). Therefore, though a role for caveolaelocalized SR-BI in eNOS activation is emerging, how caveolar localization affects lipid transfer
through SR-BI in various cell types is not yet clear.
To date, only one intracellular protein, the PDZ-domain containing protein, PDZK1, is
known to directly interact with SR-BI to post-transcriptionally regulate its function.
Section Two: PDZ Domains and PDZ proteins
I. PDZ domain structure
PDZ domains (named for the first three PDZ-containing proteins identified: the
postsynaptic protein PDS-95/SAP90, the Drosophila septate junction protein Discs-large, and the
tight junction protein ZO- 1) are modular protein interaction domains that play a part in targeting
proteins and assembling protein complexes. Found in a diverse set of organisms, PDZ domains
are one of the more common protein domains represented in sequenced genomes. These -90
amino acid domains mediate protein-protein interactions, most commonly by binding the Ctermini of target proteins in a sequence-specific manner. Based on numerous crystal structures of
PDZ domains complexed with their target peptide ligand, the common structure of PDZ domains
is composed of six 03 strands (P3A- f3F) and two ca helices (caA and cB), which fold into an overall
six-stranded P3sandwich. The four C-terminal residues of the target protein bind as an
antiparallel P strand in a groove between the 3B strand and aB helix. This binding can be
stabilized by hydrogen bonds formed between the PDZ domain and the extended peptide, but
this generally does not take part in sequence specificity. The conserved Gly-Leu-Gly-Phe
sequence of the PDZ domain (or Gly-Tyr-Gly-Phe, as in the case of PDZK1) is found within the
loop connecting the 3A-PB strands and this sequence coordinates the C-terminal carboxylate
(COO-) group of the target peptide. The side chain of the "0" or C-terminal residue of the ligand
peptide has been shown to jut into a hydrophobic pocket within PDZ domains, explaining the
preference of PDZ domains for hydrophobic C-terminal amino acids, such as valine, isoleucine,
or leucine, on target peptides. The 0 and -2 positions on the ligand peptide typically play a
greater role in binding preference, though the -1 position may also contribute, depending on the
individual PDZ domain (121).
It is the -2 position on the target sequence that forms the basis for the classification of
PDZ interactions. Class I PDZ domains bind target proteins with a serine or threonine residue at
the -2 position of the target protein (X-S/T-X-a). The hydroxyl group on serine or threonine sidechains typically forms a hydrogen bond with the first residue of the aB helix (aB 1), a histidine
residue that is highly conserved among Class I PDZ domains. Class II PDZ domains bind a
target protein with a hydrophobic residue at the -2 position (X-4-X-ý), and generally have a
hydrophobic residue at the aB iposition in the PDZ domain. The third class of PDZ domains
binds target ligands with a negatively charged residue at the -2 position (X-D/E-X-4). The
carboxylate group on the side-chain of the aspartate or glutamate residue generally then
coordinates with the hydroxyl group of a tyrosine at the aB1 position (121). However, PDZ
domains vary in the stringency of their specificity, and can demonstrate more than one class of
specificity. In addition, the residues N-terminal to the -2 position in PDZ-binding sequences can
also contribute to specificity. The -3 position has been found to interact with the peptide binding
groove, and has been shown to play a role in specificity. Indeed, several studies have
demonstrated that additional residues besides the final four C-terminal amino acids can also be
important, up to -8.
Occasionally PDZ domains interact with an internal 3-finger sequence on the target
protein, which binds to the same site on the PDZ domain as a C-terminal peptide (121). This type
of interaction, in addition to the more traditional interaction with C-termini, is sometimes
employed in homo- or heterodimerization of PDZ proteins (122). In addition PDZ proteins can
dimerize through interactions between the P3A strands of their individual PDZ domains (123125).
PDZ-domain containing proteins often comprise multiple PDZ domains (up to 13 in one
particular PDZ protein, MUPP1). These PDZ domains are often closely grouped in tandem
arrays, sometimes in pairs or triplets. It's not clear what the significance of this grouping is,
though there is some evidence that that multiple domains can cooperate to enhance binding to
their target ligands. Having multiple PDZ domains allows PDZ proteins to bind multiple target
proteins simultaneously, and thus assemble larger protein complexes. This ability to act as a
scaffold has allowed PDZ proteins to play key roles in various cell processes, such as organizing
signal transduction pathways or establishing cell polarity (121).
II. PDZK1
PDZK1 (also known as Diphor-1, CLAMP, Cap70, and NaPi-Capl) is a 519 amino acid
cytoplasmic protein, with a tandem array of four PDZ domains (Figure 6) (126-131). In addition
to its PDZ-domains, PDZK1 has a putative PDZ-binding sequence at its C-terminus, and at least
one phosphorylation site on the C-terminal tail (126-128). PDZK1 is most highly expressed in
the brush-border membrane of the proximal tubules of kidneys and is expressed at lower levels
in the liver and small intestines and is also expressed at low levels in the adrenal gland and testis
(127, 129-131). In addition to SR-BI, PDZK1 is known to interact with a number
of proteins,
many of which are transporters (summarized in Table 2). In addition, PDZK1 can form
heterodimers with the PDZ proteins NHERF-1 and NHERF-2, two PDZ proteins that are also
expressed in the kidney; though the functional significance of these interactions remains unclear
(132). Most PDZK1 interactions have been studied in the kidney and intestines.
Putative PDZbindina Motif
51 9
PDZK1
C
(SR-BI Binding)
Phosphorylation
Site(s)
Figure 6. Model of PDZK1 protein structure
Table 2.
Putative PDZK1binding protein
Cterminal
Sequence
Interaction
Class
Scavenger
receptor class Btype I (SR-BI)
Interacting
PDZ
domain
EAKL
II
1
Membrane
associated protein
17 (MAP17)
STPM
I
1.4
Consequences of
binding
References
tissue-specific control
of SR-BI protein
levels (liver, small
intestine)
intracellular localization
of PDZK1 in
oossum kidney (OK)
cells; regulation of
PDZK1 protein levels
126, 135,
136, 140,
144
in liver
127, 135,
145, 146
Putative PDZK1binding protein
Cterminal
Sequence
ATRL
Interaction
Class
I
Interacting
PDZ
domain
3
Sodium-phosphate
cotransporter I
(NaPi-I)
Organic anion
transporter 1
(URAT1)
TTRL
I
3
STOF
I
1.2.4
Organic anion
transporter 4
(hOAT4)
STSL
I
1.4
Cystic fibrosis
transmembrane
conductance
regulator (CFTR)
DTRL
I
1.3.4
Multidrug
resistance protein
2 (MRP2)
STKF
I
1
Organic cation
transporter 1
(OCTNI)
ITAF
I
2
Chloride-formate
exchanger
(CFEX)
ATKL
I
1
Chloride channel
PDZ isoform 3B
(CIC3B)
STTL
I
1
Sodium-phosphate
cotransporter IIa
(NaPi-IIa)
Consequences of
binding
References
control of NaPi-IIa
protein levels under
phosphate-rich diet
(kidney)
unknown
130, 146,
147
regulation of URAT1
protein levels and
activity in
HEK293 cells
regulation of hOAT4
protein levels and
activity in
HEK293 cells
146, 148
potentiation of activity
by tethering CFTR
molecules (in
recordings from
HEK293
cell membranes with
recombinant PDZK1),
regulation of activity of
CFTR in small
intestines
unknown
131, 151,
152
regulation of OCTN1
activity in HEK293
cells, possibly through
subcellular localization
regulation of CFEX
activity through control
of protein levels in
kidney proximal tubule
cells
modulation of
intracellular localization
of CIC3B in BHK21
cells
146, 155
146
148, 149,
150
153, 154
146, 147,
156
157
Putative PDZK1binding protein
Cterminal
Sequence
Interaction
Class
Interacting
PDZ
domain
Dual-specific
protein kinase Aanchoring protein
2
(D-AKAP2)
Na+/H+
exchanger isoform
3 (NHE3)
STKL
I
STHM
Organic cation
transporter 2
(OCTN2)
Na+/H+
exchanger
regulatory factor 1
(NHERF-1)
Na+/H+
exchanger
regulatory factor 2
(NHERF-2)
Gene product
KIAA0793
Consequences of
binding
References
4
unknown
146, 158
I
1
regulation of activity in
small intestine
enterocytes
130, 146,
159
STAF
I
2.4
160, 161
FSNL
I
4
regulation of activity
without increased cell
surface levels of
OCTN2 protein in
HEK293 cells,
regulation of activity
through protein level
and subcellular
localization in small
intestine epithelial cells
unknown
FSNF
I
4
unknown
146
DKNL
unknown
n/d
unknown
146
Breakpoint cluster
region protein
(BCR)
STEV
I
1
unknown
162
Organic anion
transporting
polypeptide 5
(OAtp5/
OATP1A6)
Ste20-related
serine/threonine
protein kinase
(SLK)
KTKL
I
4
unknown
146
STGS
I
3
unknown
158
146
Consequences of
binding
References
2.3
regulation of PEPT-2
activity in HEK293
cells
149
I
n/d
unknown
149
ETAL
I
n/d
functional coupling
between MRP4 and
CFTR, leading to
attenuation of
potentiation of CFTR
activity in gut epithelial
152
KTKL
I
1.3
regulation of activity
through subcellular
localization in
hepatocytes
133
Unknown
Unknown
n/d
regulation of activity
through control of
protein level in
HEK293 cells,
regulation of activity
through protein level
and subcellular
localization in small
161
TTSF
I
1.2.4
GTRL
(mNOS2)
MSAL
I
n/d
Putative PDZK1binding protein
Cterminal
Sequence
Interaction
Class
Interacting
PDZ
domain
Peptide transport 2
(PEPT-2)
KTKL
I
Organic anion
transporting
polypeptide A
(OATP-A/
OATP1A2)
Multi-drug
resistance protein
4 (MRP4)
KTKL
Organic anion
transporting
polypeptide 1
(OATP-1/
cells
OATP1A1)
Peptide transport 1
(PEPT-1)
intestine epithelial cells
Mucin 17
(MUC17/
Muc3(17))
Nitric Oxide
Synthase 2
(NOS2)
(hNOS2)
stabilizes MUC17 on
apical membrane of
small intestine
enterocytes
regulation of NOS2
activity and apical
localization in MDCK
163
cells
Table 2. List of Proteins Reported to Interact with PDZK1.
Adapted and revised from Current Opinion in Lipidology (16) 2005 (ref. 164).
In hepatocytes, PDZK1 is known to bind three proteins, membrane-associated protein 17
(MAP17), organic anion transporter polypeptide lal (Oatplal), and SR-BI (126, 127, 133).
Hepatic Oatplal, which PDZK1 binds through its first and third domains, has reduced function
in the absence of PDZK1 in PDZK1 KO mice. This appears to be due to a mislocalization of
Oatp 1al to an intracellular compartment, rather than its usual basolateral cell-surface localization
(133). MAP17 is a small integral membrane protein of unknown function, and whose expression
is stimulated in human carcinoma (134). When MAP 17, which is normally expressed at low
levels in hepatocytes, is overexpressed in the liver, a dramatic reduction in both PDZK1 and SRBI protein levels is seen, along with an increase in plasma total and HDL cholesterol levels. This
decrease in PDZK1 protein abundance in MAP17-Tg hepatocytes was shown to be due to a 3fold increase in protein turnover via a proteasome-independent degradation pathway (135).
PDZK1 interacts with the cytoplasmic C-terminus of SR-BI via the N-terminal most PDZ
domain, PDZ 1 (126). PDZK1 apparently does not bind the C-terminus of SR-BII, whose Cterminal sequence differs from that of SR-BI. Unlike the C-terminal four amino acids of SR-BI
(EAKL), the C-terminal four amino acids of SR-BII (SAMA) are not expected to bind PDZdomains (121). Though PDZK1 is most highly expressed in the kidney, it is also expressed, like
SR-BI, in the liver and intestines; but has very low expression in the adrenal gland, ovary, and
testis, in which SR-BI is abundantly expressed (38, 126). The first study to look at the
relationship between PDZK1 and SR-BI found that expression of both PDZK1 and SR-BI in
CHO cells resulted in an increased abundance of SR-BI protein. This change in protein level was
not accompanied by a change in mRNA level, indicating that PDZK1 might influence SR-BI in a
post-transcriptional manner (126). In another study, it was demonstrated that loss of SR-BI's Cterminal most amino acid abolishes its interaction with the PDZ 1 domain of PDZK1, and that
overexpression of truncated SR-BI missing this PDZK1-interacting sequence did not affect HDL
metabolism due to a lack of cell-surface expression in the liver (136). In addition to the effect
that overexpression of MAP 17 has on hepatic SR-BI and PDZKlprotein levels, several other
studies have found a correlation between hepatic PDZK1 and SR-BI expression. These studies
found that feeding mice a PPAR-a agonist, ciprofibrate, or an atherogenic diet (containing
cholate and high levels of cholesterol) suppressed hepatic expression of both PDZK1 and SR-BI
by an unknown post-transcriptional mechanism (137, 138). All of these studies together suggest
that PDZK1 influences SR-BI expression and function in cells and in vivo.
The generation of a PDZK1 KO mouse line by Kocher and colleagues allowed for further
exploration of the role that PDZK1 plays in SR-BI function. It was found that PDZK1 knockout
mice showed a dramatic decrease (>95%) in SR-BI expression in the liver, a partial decrease
(-50%) in the small intestine, but no change in steroidogenic tissues, macrophages or endothelial
cells (119, 139, 140). This change in hepatic SR-BI abundance is brought about through an
unknown post-transcriptional mechanism (140). As a consequence of this decrease in hepatic
SR-BI protein levels, PDZK1 KO mice exhibit -1.7-fold higher plasma cholesterol levels, which
is found in abnormally large HDL particles (140). This phenotype is similar to, thought not as
severe as, that in SR-BI KO mice (40). Therefore, it was concluded that PDZK1 is a tissuespecific regulator of SR-BI protein level and function. The role of PDZK1 in hepatic SR-BI
function was investigated further with the SR-BI/PDZK1 double knockout mouse line. It was
found that hepatic overexpression of SR-BI in SR-BI/PDZK1 double knockout mice leads to
cell-surface expression of SR-BI and normal function (141). Thus SR-BI can function normally
in the absence of PDZK1 when steady-state cell-surface expression levels are similar to those in
wild-type hepatocytes (141). However, the mechanism by which PDZK1 regulates SR-BI
abundance, localization and function in non-transgenic hepatocytes remains unclear.
In addition to the SR-BI interacting domain PDZ1, PDZK1 contains three PDZ domains
(PDZ2, PDZ3, and PDZ4) and a C-terminal tail that are not known to bind SR-BI (Figure 6). In
initial efforts to define what roles these structural feature might play in the regulation of SR-BI
abundance, Nakamura et al. expressed truncated forms of PDZK1 (PDZ1.2, PDZ1.2.3, and
PDZ 1.2.3.4 lacking the C-terminal 66 amino acids long tail) in CHO cells and the rat hepatoma
cell line Fao, both of which expressed SR-BI but not PDZK1. It was shown that these PDZK1
truncation constructs do not increase SR-BI expression as full-length PDZK1 does (128). This
study also demonstrated that PDZK1 is phosphorylated on at least one serine on its C-terminal
tail, and that this phosphorylation is required for PDZK1-dependent regulation of SR-BI
expression in Fao cells. It was also demonstrated that PDZK1 can be phosphorylated via Protein
kinase A (PKA) in vitro and in cell culture, and that that injection of glucagon, which activates
PKA through the glucagon receptor, increased phosphorylation of hepatic PDZK1, which
correlated with a -1.8-fold increase in both PDZK1 and SR-BI protein (128). This suggested that
phosphorylation of PDZK1 may play a role in regulating SR-BI protein levels in vivo. However,
it is not clear from this study whether phosphorylation of PDZK1 is necessary for SR-BI
expression and function, nor how these truncated forms of PDZK1 might affect the regulation of
SR-BI in vivo.
In addition to regulating SR-BI expression in hepatocytes, PDZK1 was also recently
found to play a role in HDL/SR-BI activation of eNOS in endothelial cells, and NO-independent
endothelial migration. In this study it was found that PDZK1 is expressed in endothelial cells,
and that loss of PDZK1 expression in these cells prevented activation of eNOS by HDL, though
other pathways for eNOS activation remained unimpaired. Knock-down of PDZK1 in an
endothelial cell line also attenuated HDL-stimulated endothelial migration, and in PDZK1
knockout mice re-endothelialization after physical abrasion was absent. Interestingly, though the
exact mechanism by which PDZK1 regulates SR-BI's activation of eNOS was not fully
deciphered, it was found that PDZK1 did not regulate SR-BI's abundance or cell-surface
localization in endothelial cells, nor was HDL binding to SR-BI or cholesterol efflux to HDL
PDZK1-dependent (120, 140). However, it was determined that Src-activation by SR-BI is
PDZKl-dependent, though association of Src and SR-BI is not. Furthermore, it was found that a
truncation mutant of PDZK1, missing the C-terminal two PDZ domains, acted as a dominant
negative with regard to SR-BI/HDL activation of Src (120). These results indicate that PDZK1
can regulate various aspects of SR-BI's function in different tissues through apparently different
mechanisms.
Section Three: Overview of questions addressed in this dissertation
Our lab, in collaboration with Dr. Olivier Kocher's lab at Beth Israel Deaconess Medical
Center, Harvard Medical School, and Attilio Rigotti's lab at Pontificia Universidad Cat61lica in
Santiago, Chile, has been interested in exploring further the mechanism behind PDZKl's
regulation of SR-BI. There are many different explanations for how PDZK1 might regulate
hepatic SR-BI protein, including control of SR-BI's synthesis, posttranslational modification,
intracellular transport, subcellular localization (plasma membrane microdomains), recycling
(transient internalization), and/or stability. However, one of the simplest explanations for the
decrease in SR-BI protein levels in the absence of PDZK1 is that binding to PDZK1 protects SRBI from degradation in some manner. Therefore, the obvious first experiment would be to
determine the protein stability of SR-BI in the absence of PDZK1. Unfortunately, though
expression of PDZK1 can increase SR-BI protein levels is cell culture, no cell line has been
found that recapitulates the PDZKl-dependence for SR-BI expression seen in the liver. In
addition, unpublished work by Eyal Reinstein in the Krieger lab demonstrated that in PDZK1
KO primary hepatocytes, SR-BI loses its PDZK1-dependence for expression and function almost
immediately after isolation and introduction into normal cell culture. One hypothesis is that this
loss of PDZK1-dependence is due to a loss of polarization in the hepatocytes. However attempts
by Reinstein and others in the Krieger lab to reestablish polarity through sandwich cultures have
failed thus far.
Therefore, given that it is impossible at this time to examine SR-BI's PDZKldependence for expression through cell culture experiments, we then turned to in vivo
experiments to begin to elucidate the mechanism behind PDZK1's regulation of hepatic SR-BI
function. Given that PDZK1 contains three PDZ domains that do not interact with SR-BI, it is
reasonable to propose that PDZK1 might interact with other proteins via these domains to
influence the activity of SR-BI. PDZK1's C-terminal tail has at least one phosphorylation site,
which may be one way that SR-BI and PDZK1 protein levels are controlled post-translationally.
In addition, the C-terminal tail of PDZK1 comprises a putative PDZ-interacting motif in its final
three C-terminal amino acids (the residues T-E-M). PDZK1 is known to form heterodimers with
other PDZ proteins (NHERF-1 and NHERF-2) (132), and PDZ proteins in general are known to
form homodimers as well (121). Therefore, this PDZ-binding motif might result in PDZK1
forming heterodimers or homodimers through the interaction of the PDZ domain on one PDZK1
molecule with the C-terminal PDZ-binding motif on another PDZK1 molecule. If so, this
dimerization might influence SR-BI function. This is an especially attractive idea given that SRBI is also thought to dimerize, though the role that dimerization plays in SR-BI function is
unknown (91, 92).
Therefore, I, and my collaborators, endeavored to elucidate further the role that PDZKl's
structural features play in regulating hepatic SR-BI in an effort to narrow the list of possible
mechanisms. To do this, we generated transgenic and adenoviral constructs expressing truncation
mutants of PDZK1 comprising various regions of PDZK1 (Figure 6). These truncation mutants
include PDZ1 (comprising mainly the first PDZ domain of PDZK1, which is the domain that
binds SR-BI), PDZ1.2 (comprising mainly the first and second PDZ domains), PDZ1.2.3,
PDZ1.2.3.4 (composed of all four PDZ domains, but missing the C-terminal tail), and pTEM
(comprising the entire PDZK1 protein except for the putative PDZ-binding motif in the final
three residues, T-E-M). These constructs, expressed in the livers of both WT and PDZK1 KO
mice, were then used to determine: 1) which structural features of PDZK1 are required for
normal SR-BI expression, localization, and function? and 2) if any structural features beyond the
first PDZ domain are required, does their absence result in inhibition of SR-BI function (can they
act as dominant negative mutants)?
Two additional constructs were generated that expressed PDZK1 without a functional
PDZ1 domain. One of these constructs encodes the truncation protein PDZ2.3.4, which contains
the N-terminus and the PDZ2, PDZ3, and PDZ4 domains, and the C-terminal tail of PDZK1, but
lacks the PDZ1 domain. Another construct encodes a protein we call MUT2, which has a point
mutation (Ala20Tyr) in the conserved Gly-Tyr-Gly-Phe sequence located in the loop connecting
the P3A-PB strands of the PDZ 1 domain, which coordinates the carboxylate group at the very Cterminus of the peptide ligand. These constructs were generated to determine if they could act as
dominant negative mutants in WT mice by competing with endogenous PDZK1 for interactions
with other cellular components, thereby indicating that these interactions are necessary for
normal PDZK1 regulation of SR-BI.
Whos
Site)
phorylation
1
PDZK1 N
W1
-
tvC519
-
utativ PDZ-
(SR-BI Bikling)
Binding Motif)
1•
PDZI
11l
-c
N
(SRBI BI3ing)
PDZ1.2I
220
EC
M
(SR-BI Binding)
1
PDZ1.2.3 N
-35
-
359
-C
(Sl•Ol
(SR-Bi Bi•ding)
Biiding)
PDZ1.2.3.4
461
.
.c
-
r
(SR-BI
BI
ing)
(Phosphorylation
MUT2
W
Site)
519
utatia PDZ-
-l
~C
J
A
AlTyr(Phophorylation
Binding Motif)
Site)
(Phosphorylatlon She)
PDZ2.3.4
1
N-
-l
C
ind
utative PDZ-
Binding Motif)
Figure 7. Diagrams of wild-type and mutant PDZK1 protein structures.
In chapter 2, I, along with my collaborators, examine the effects of expressing full-length
PDZK1 and the PDZl truncation mutant in the livers of WT and PDZK1 KO mice on hepatic
SR-BI abundance, localization, and function. In chapter 3, we examine the effects of expressing
the PDZ1.2, PDZl.2.3, and pTEM truncation mutants in the livers of WT and PDZK1 KO mice
on SR-BI protein levels, localization, and function. In chapter 4, I discuss the initial data
collected on SR-BI function in mice with hepatic expression of the PDZl.2.3.4, MUT2, and
PDZ2.3.4 .mutants.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Frangsmyr, T. and Lindsten, J. (1993) Nobelprize.org
<http://nobelprize.org/nobel_prizes/medicine/laureates/1 985/presentation-speech.html>
Sterwart, J. (1999) Proteins, enzymes, genes: the interplay of chemistry and biology. New
Haven(CT): Yale University Press
Breitling, R. (2007) BioEssays 29, 1085-1094
Rigotti, A., Miettinen, H. E., and Krieger, M. (2003) Endocr.Rev. 24, 357-387
Center for Disease Control. Deaths: Leading Causes for 2002. National Vital Statistics
Reports 2005;53(17)
Steinberg, D. (2004) J. LipidRes. 45, 1583-1593
Libby, P., Aikawa, M., and Sch6nbeck, U. (2000) Biochim Biophys Acta. 1529, 299-309
Steinberg, D. (2005) J. LipidRes. 46, 179-190
Steinberg, D. (2005) J. Lipid.Res. 46, 2037-2051
Tall, A. (2008) JIntern Med 263, 256-273
Olofsson, S., Wiklund, 0., and Bor6n, J. (2007) Vasc Health Risk Manag. 3, 491-502
Hevonoja, T., Pentikaiinen, M., Hyv6nen, M., Kovanen, P., Ala-Korpela, M. (2000)
Biochim Biophys Acta. 1488, 189-210
Esterbauer, H., Gebicki, J., Puhl, H., Jiirgens, G. (1992) Free Radic. Biol. Med. 13, 341390.
Krieger, M. (1999) Annu. Rev. Biochem. 68, 523-558
Goldstein, J., Hobbs, H. and Brown, M. (2001) "Familial hypercholesterolemia." In
Scriver, C., Beaudet, A., Sly, W. and Valle, D. (eds), The Metabolic and Molecular Bases
of Inherited Disease, 8th edn, Vol. II. McGraw Hill, New York(NY): McGraw Hill
Zuliani, G., Arca, M., Signore, A., Bader, G., Fazio, S., Chianelli, M., Bellosta, S.,
Campagna, F., Montali, A., Maioli, M., Pacifico A, Ricci G, Fellin R. (1999) Arterioscler.
Thromb. Vasc. Biol., 19, 802-809
Khachadurian, A.K. and Uthman, S.M. (1973) Nutr. Metab. 15, 132-140
Arca, M., Zuliani, G., Wilund, K., Campagna, F., Fellin, R., Bertolini, S., Calandra, S.,
Ricci, G., Glorioso, N., Maioli, M., Pintus P, Carru C, Cossu F, Cohen J, Hobbs HH (2002)
Lancet 359, 841-847
Garcia, C.K., Wilund, K., Arca, M., Zuliani, G., Fellin, R., Maioli, M., Calandra, S.,
Bertolini, S., Cossu, F., Grishin, N., Barnes R, Cohen JC, Hobbs HH (2001) Science 292,
1394-1398
Brown, M. And Goldstein, J. (1999) Proc.Natl. Acad. Sci. USA 96, 11041-11048
Rader, D. (2006) J. Clin. Invest. 116, 3090-3100
Sviridov, D. and Nestel, P. (2007) Curr Opin Lipidol 18, 157-163
Zannis, V., Chroni, A., and Krieger, M. (2006) J Mol Med 84, 276-294
Kusuhara, H. and Sugiyama, Y. (2007) Eur JPhysiol453, 735-744
Oram, J. and Vaughan, A. (2006) Circ. Res. 99, 1031-1043
Lorenzi, I., von Eckardstein, A., Radosavljevic, S., Rohrer, L. (2008) Biochim Biophys
Acta. doi: 10.1016/j.bbalip.2008.04.006
Shah, P. (2007) Eur HeartJ. 28, 5-12
Yancey, P., Bortnick, A., Kellner-Weibel, G., de la Llera-Moya, M., Phillips, M., and
Rothblat, G. (2003) Arterioscler. Thromb. Vasc. Biol. 23, 712-719
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
Babitt, J., Trigatti, B., Rigotti, A., Smart, E. J., Anderson, R. G. W., Xu, S., Krieger, M.
(1997) J. Biol. Chem. 272, 13242-13249
Greenwalt, D. E., Lipsky, R. H., Ockenhouse, C. F., Ikeda, H., Tandon, N. N., and
Jamieson, G. A. (1992) Blood 80, 1105-1115
Tao, N., Wagner, S. J., and Lublin, D. M. (1996) J. Biol. Chem. 271, 22315-22320
Vifials, M., Xu, S., Vasile, E., Krieger, M. (2003) J. Biol. Chem. 278, 5325-5332
Rhainds, D. and Brissette, L. (2004) Int JBiochem Cell Biol. 36, 39-77
Eckhardt, E., Cai, L., Shetty, S., Zhao, Z., Szanto, A., Webb, N., Van der Westhuyzen, D.
(2006) 281, 4348-4353
Eckhardt, E. R., Cai, L., Sun, B., Webb, N. R., van der Westhuyzen, D. R. (2004) J. Biol.
Chem.279, 14372-14381
Svensson, P., Englund, M., Snickestrand, M., Higg, D., Ohlsson, B., Stemme, V.,
Mattsson-Hulten, L., Thelle, D., Fagerberg, B., Wiklund, O., Carlsson, L., Carlsson, B.
(2005) BMC CardiovascDisord.5, 25
Brown, M. S., and Goldstein, J. L. (1986) Science 232, 34-47
Acton, S., Rigotti, A., Landshulz, K.T., Xu, S., Hobbs, H.H., Krieger, M. (1996) Science
271, 518-520
Kozarsky, K.F., Donahee, M.H., Rigotti, A., Iqbal, S.N., Edelman, E.R., Krieger, M.
(1997) Nature 387, 414-417
Rigotti, A., Trigatti, B.L., Penman, M., Rayburn, H., Herz, J., Krieger, M. (1997) Proc.
Natl. Acad Sci. U.S.A. 94, 12610-12615
Rigotti A., Edelman, E.R., Seifert, P., Iqbal, S.N. Demattos R.B., et al. (1996) J. Biol.
Chem. 271, 33545-33549
Glass, C., Pittman, R. C., Weinstein, D. B., and Steinberg, D. (1983) Proc.Natl. Acad. Sci.
U. S. A. 80, 5435-5439
Stein, Y., Dabach, Y., Hollander, G., Halperin, G., and Stein, 0. (1983) Biochim. Biophys.
Acta 752, 98-105
Nieland, T., Ehrlich, M., Krieger, M., Kirchhausen, T. (2005) Biochim. Biophys. Acta.
1734, 44-51
Gu, X., Trigatti, B., Xu, S., Acton, S., Babitt, J., and Krieger, M. (1998) J. Biol. Chem. 273,
26338-26348
Liu, T., Krieger, M., Kan, H. Y., and Zannis, V. I. (2002) J. Biol. Chem. 277, 21576-21584
Van Eck, M., Hoekstra, M., Out, R., Bos, I., Kruijt, J., Hildebrand, R., and Van Berkel, T.
(2007) JLipidRes. 49, 136-146
Gu, X., R. Lawrence, and M. Krieger (2000) JBiol Chem 275, 9120-30
Connelly, M., Klein, S., Azhar, S., Abumrad, N., Williams, D. (1999) JBiol Chem 274,
41-47
Ji, Y., Jians, B., Wang, N., Sun, Y., de la Llera Moya, M., Phillips, M.C., Rothblat, G.H.,
Swaney, J.B., Tall, A.R. (1997) J. Biol. Chem. 272, 20982-20985
Gu, X. Kozarsky, K., Krieger, M. (2000) J. Biol. Chem. 275, 29993-30001
Yancey, P., de la Llera-Moya, M., Swarnakar, S., Monzo, P., Klein, S., Connelly, M.,
Johnson, W., Williams, D., and Rothblat, G. (2000) J. Biol. Chem. 275, 36596-36604
Yancey, P. G., Kawashiri, M., Moore, R., Glick, J., Williams, D., Connelly, M., Rader, D.,
and Rothblat, G. (2004) J. LipidRes. 45, 337-346
Arai, T., Wang, N., Bezouevski, M., Welcch, C., Tall, A.R. (1999) J. Biol. Chem. 274,
12610-12615
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
Ueda, Y., et al. (2000) J. Biol. Chem. 274, 2366-2371
Kozarsky, K.F., Donahee, M.H., Glick, J.M,, Krieger, M., Rader, D.J. (2000) Artioscler.
Thromb. Vasc. Biol. 20, 721-727
Mardones, P., Quinones, V., Amigo, L, Moreno, M., Miquel, J.F., Schwarz, M., Miettinen,
H.E., Trigatti, B., Krieger, M., VanPatten, S., Cohen, D.E., Rigotti, A. (2001) J LipidRes.
42, 170-180
Ji, Y., Wang, N., Ramakrishnan, R., Sehayek, E., Huszar, D., Breslow, J., Tall, A. (1999) J
Biol Chem 274, 33398-33402
Wang, N., Arai, T., Ji, Y., Rinninger, F., Tall, A. (1998) JBiol Chem 273, 32920-32926
Sehayek, E., Ono, J., Shefer, S., Nguyen, L., Wang, N., Batta, A., Salen, G., Smith, J., Tall,
A., Breslow, J. (1998) ProcNatlAcad Sci USA 95, 10194-10199
Alam, K., Meidell, R., Spady, D. (2001) JBiol Chem 276, 15641-15649
Trigatti, B., Rayburn, H., Vinals, M., Braun, A., Miettinen, H., Penman, M., Hertz, M.,
Schrenzel, M., Amigo, L., Rigotti, A., Krieger, M. (1999) Proc Natl Acad Sci USA 96,
9322-9327
Holm, T.M., Braun, A., Trigatti, B.L., Brugnara, C., Sakamoto, M., Krieger, M., Andrews,
N.C. (2002) Blood 99, 1817-1824
Yesilaltay, A., Gabriela, M., Morales, Amigo, L., Zanlungo, S., Rigotti, A., Karackattu, S.,
Donahee, M., Kozarsky, K., and Krieger, M. (2006) Endocrinology 147, 1577-1588
Dole, V., Matuskova, J., Vasile, E., Ayce Yesilaltay, A., Bergmeier, W., Bernimoulin, M.,
Wagner, D., Monty Krieger, M. (2008) Arterioscler. Thromb. Vasc. Biol. 28, 1111-1116
Huszar, D., Varban, M.L., Rinninger, F., Feeley, R., Arai, T., Fairchild-Huntress, V.,
Donovan, M.J., Tall, A.R. (2000) Arterioscler. Thromb. Vasc. Biol. 20, 1068-1073
Covey, S.D., Krieger, M., Wang, W., Penman, M., Trigatti, B.L. (2003) Arterioscler.
Thromb. Vasc. Biol. 23, 1589-1593
Zhang, W., Yancey, P.G., Su, Y.R., Babaev, V.R., Zhang, Y., Fazio, S., Linton, M.F.
(2003) Circulation.108, 2258-2263
Van Eck, M., Bos. I., Hildebrand, R., Van Rij, B., Van Berkel, T. (2004) Am. J. Pathol.
165, 785-94
Landschulz, K., Pathak, R., Rigotti, A., Krieger, M., Hobbs, H. (1996) J. Clin. Invest. 98,
984-995
Graf, G., Roswell, K., Smart, E. (2001) JLipidRes 42, 1444-1449
Malerod,L., Sporstol, M., Juvet, L., Mousavi, A., Gjoen, T., and Berg, T. (2003) Biochem
Biophys Res Commun. 305, 557-565
Rhode, S., Breuer, A., Hesse, J., Sonnleitner, M., Pagler, T., Doringer, M., Schutz, G.,
Stangl, H. (2004) Cell Biochem Biophys 41, 343-356
Wustner, D. (2006) Traffic 7, 699-715
Silver, D., Wang, N., Xiao, X., Tall, A. (2001) JBiol Chem 276, 25287-25293
Tondu, A. L., Robichon, C., Yvan-Charvet, L., Donne, N., Le Liepvre, X., Hajduch, E.,
Ferre, P., Dugail, I., and Dagher G. (2005). J. Biol. Chem. 280, 33536-33540
Ahras, M., Naing, T., and McPherson R. (2008) JLipid Res. 49, 569-1576
Harder, C., Vassiliou, G., McBride, H., McPherson, R. (2006) JLipidRes. 47, 492-503
Liu, B., Krieger, M. (2002) JBiol Chem 277, 34125-34135
Sun, B., Eckhardt, E.R.M., Shetty, S., van der Westhuyzen, D.R., Webb, N.R. (2006) J.
LipidRes. 47, 1700-1713
81.
Zhang, Y., Ahmed, A., Tran, T., Lin, J., McFarlane, N., Boreham, D., Igdoura, S.,
Truant, R., Trigatti, B. (2007) Mol Membr Biol. 24, 442-454
82. Pagler, T., Rhode, S., Neuhofer, A., Laggner, H., Strobl, W., Hinterndorfer, C., Volf, I.,
Pavelka, M., Eckhardt, E., van der Westhuyzen, D., Schutz, G., Stangl, H. (2006) JBiol
Chem 281, 11193-11204
83. Lorenzi, I., von Eckardstein, A., Cavelier, C., Radosavljevic, S., Rohrer, L. (2008) JMol
Med 86, 171-183
84. Matveev, S., Uittenbogaard, A., van der Westhuyzen, D., Smart, E.J. (2001) Eur. J.
Biochem. 268, 5609-5616
85. Williams, D. L., Wong, J. S., and Hamilton, R. L. (2002) J. LipidRes. 43, 544-549
86. Azhar, S., Nomoto, A., and Reaven, E. (2002) J. Lipid Res. 43, 861-871
87. Reaven, E., Spicher, M., Azhar, S. (1989) J. LipidRes. 30, 1551-156
88. Williams, D. L., Wong, J. S., Wissig, S. L., Hamilton, R. L. (1995) J. Lipid Res. 36,
745-758
89. Peng, Y., Admentin, W., Connelly, M.A., Lund-Katz, S., Phillips, M.C., Williams, D.L.
(2004) Mol. Biol. Cell. 15, 384-396
90. Levyl, E., M6nard, D., Sucl, I., Delvin, E., Marcill, V., Brissette, L., Thibault, L., and
Bendayan, M. J Cell Sci. 117, 327-337
91. Reaven, E., Nomoto, A., Cortez, Y., Azhar, S., (2006) Nutr Metab (Lond) 3, 43
92. Reaven, E., Cortez, Y., Leers-Sucheta, S., Nomoto, A., and Azhar, S. (2004) J. LipidRes.
45, 513-528
93. Palade, G. E. (1953) J. Appl. Phys. 24, 1424
94. Yamada, E. (1955) J. Biophys. Biochem. Cytol. 1, 445-458
95. Rothberg, K. G., Heuser, J. E., Donzell, W. C., Ying, Y.-S., Glenney, J. R., and Anderson,
R. G. W. (1992) Cell 68, 673-682
96. Schroeder, R., London, E., and Brown, D. (1994) Proc.Natl. Acad. Sci. U. S. A. 91,
12130-12134
97. Rothberg, K. G., Ying, Y.-S., Kamen, B. A., and Anderson, R. G. W. (1990) J. Cell Biol.
111, 2931-2938
98. Chang, W.-J., Rothberg, K. G., Kamen, B. A., and Anderson, R. G. W. (1992) J. Cell Biol.
118, 63-69
99. Simionescu, N., Lupu, F., and Simionescu, M. (1983) J Cell Biol. 97, 1592-1600
100. Smart, E. J., Ying, Y.-S., Conrad, P. A., and Anderson, R. G. W. (1994) J. Cell Biol. 127,
1185-1197
101. Parton, R. G. (1994) J. Histochem. Cytochem. 42, 155-166
102. Liu, P., and Anderson, R. G. W. (1995) J. Biol. Chem. 270, 27179-27185
103. Brown, D. A., and Rose, J. K. (1992) Cell 68, 533-544
104. Uittenbogaard, A., Shaul, P.W., Yuhanna, I.S., Blair, A., Smart, E.J. (2000) J. Biol. Chem.
275: 11278-11283
105. Rhainds, D., Bourgeois, P., Bourret, G., Huard, K., Falstrault, L., and Brissette, L. (2004) J
Cell Science 117, 3095-3105
106. Galbiati, F., Volente, D., Engelman, J.A., Watanabe, G., Burk, R., Pestell, R.G., Lisanti,
M.P. (1998) E.M.B.O.J. 17, 6633-6648
107. Sargiacomo, M., Scherer, P.E., Tang, Z., Kubler, E., Song, K.S., Sanders, M.C., Lisanti,
M.P. (1995) Proc. Natl. Acad. Sci. USA. 92, 9407-9411
108. Monier, S., D.J., Dietzen, Hastings, W.R., Lubllin, D.M., Kurzchalia, T.V. (1996) FEBS
Lett. 388, 143-149
109. Monier, S., Parton, R.G., Vogel, F., Behlke, J., Henske, A., Kurzchalia, T.V. (1995) Mol.
Biol. Cell. 6,911-927
110. Razani, B., Engelman, J.A., Wang, X. B., Shuber, W., Zhang, X. L., Marks, C. B.,
Macaluso, F., Russell, R. G., Li, M., Pestell, R.G., Vizio, D. Di, Hou, H., Jr., Kneitz, B.,
Lagaud, G., Christ, G. J., Edelmann, W., Lisanti, M. P. (2001) J. Biol. Chem. 276,
38121-38138
111. Drab, M., Verkade, P., Elger, M., Kasper, M., Lohn, M., Lauterbach, B., Menne, J.,
Lindschau, C., Mende, F., Luft, F. C., Schedl, A., Haller, H., Kurzchalia, T. V. (2001)
Science 293, 2449-2452
112. Li, S., Song, K. S., Koh, S. S., Kikuchi, A., Lisanti, M.P. (1996) J. Biol. Chem. 271,
28647-28654
113. Graf, G.A., Connell, P.M., van der Westhuyzen, D.R., Smart E.J. (1999) J. Biol. Chem.
274, 12043-12048
114. Wang, L., Connelly, M.A., Ostermeyer, A.G., Chen, H.-H., Williams, D.L., Brown, D.A.
(2003) J. LipidRes. 44, 807-815
115. Mineo, C., Deguchi, H., Griffin, J., Shaul, P. (2006) Circ Res. 98, 1352-1364
116. Yuhanna, I., Zhu, Y., Cox, B., Hahner, L., Osborne-Lawrence, S., Lu, P., Marcel, Y.,
Anderson, R., Mendelsohn, M., Hobbs, H., Shaul, P. (2001) Nat Med. 7, 853-857
117. Mineo, C., Yuhanna, I., Quon, M., Shaul, P. (2003) JBiol Chem. 278, 9142-9149
118. Seetharam, D., Mineo, C., Gormley, A., Gibson, L., Vongpatanasin, W., Chambliss K.,
Hahner L., Cummings M., Kitchens, R., Marcel, Y., Rader, D., Shaul, P. (2006) Circ Res.
98, 63-72
119. 119 Assanasen, C., Mineo, C., Seetharam, D., Yuhanna, I., Marcel, Y., Connelly, M.,
Williams, D., de la Llera-Moya, M., Shaul, P., Silver, D. (2005) J. Clin. Invest. 115,
969-977
120. Zhu, W., Saddar, S., Seetharam, D., Chambliss, K., Longoria, C., Silver, D., Yuhanna, I.,
Shaul, P., and Mineo, C. (2008) Circ. Res. 102, 480-487
121. Hung, A. and Sheng, M. (2002) JBiol Chem. 277, 5699-5702
122. Hillier, B. J., Christopherson, K. S., Prehoda, K. E., Bredt, D. S., and Lim, W. A. (1999)
Science 284, 812-815
123. Im, Y. J., Lee, J. H., Park, S. H., Park, S. J., Rho, S. H., Kang, G. B., Kim, E., and Eom, S.
H. (2003) J. Biol. Chem. 278, 48099-48104
124. Im, Y. J., Park, S. H., Rho, S. H., Lee, J. H., Kang, G. B., Sheng, M., Kim, E., and Eom,
S. H. (2003) J. Biol. Chem. 278, 8501-8507
125. Fanning, A., Lye, M., Anderson, J., and Lavie, A. (2007) J. Biol. Chem. 282, 37710-37716
126. Ikemoto, M., Arai, H., Feng, D., Tanaka, K., Aoki, J., Dohmae, N., Takio, K., Adachi, H.,
Tsujimoto, M., Inoue, K. (2000) Proc.Natl. Acad. Sci. U. S. A. 97, 6538-6543
127. Kocher, O., Comella, N., Tognazzi, K., Brown, L. (1998) Lab. Invest. 78, 117-125
128. Nakamura, T., Shibata, N., Nishimoto-Shibata, T., Feng, D., Ikemoto, M., Motjima, K.,
Iso-o, N., Tsukamoto, K., Tsujimoto, M., Arai, H. (2005) Proc. Natl. Acad Sci. U.S.A. 102,
13404-13409
129. Custer, M., Spindler, B., Verrey, F., Murer H., Biber J. (1997) Am JPhysiolRenal Physiol;
273, F801-F806
130. Gisler, S., Stagljar, I., Traebert, M., Bacic, D., Biber, J., Murer, H. (2001) JBiol Chem 276,
9206-9213
131. Wang, S., Yue, H., Derin, R., Guggino, W., Li, M. (2000) Cell 103,169-179
132. Weinman, E., Cunningham, R., Wade, J., and Shenolikar, S. (2005) J. Physiol. 567,27-32
133. Wang, P., Wang, J., Xiao, Y., Murray, J., Novikoff, P., Angeletti, R., Orr, G., Lan, D.,
Silver, D., and Wolkoff, A. (2005) JBiol Chem 280, 30143-30149
134. Kocher, O., Cheresh, P., Lee, S. (1996) Am JPathol149, 493-500
135. Silver, D., Wang, N., and Vogel, S. (2003) JBiol Chem 278, 28528-28532
136. Silver, D.L. (2002) J. Biol. Chem. 277, 34042-34047
137. Mardones, P., Pilon, A., Bouly, M., Duran, D., Nishimoto, T., Arai, H., Kozarsky, K.,
Altayo, M., Miquel, J., Luc, G., Clavey, V., Staels, B., and Rigotti, A. (2003) J. Biol.
Chem. 278, 7884-7890
138. Niemeier, A., Kovacs, W., Strobl, W., Stangl, H. (2008) Atherosclerosis In Press
139. Kocher, O., Yesilaltay, A., Shen, C., Zhang, S., Daniels, K., Pala, R., Chen, J., and Krieger,
M. (2008) Biochim Biophys Acta. 1782, 310-316
140. Kocher, O., Yesilaltay, A., Cirovic, C., Pal, R., Rigotti, A., Krieger, M. (2003) J. Biol.
Chem. 278, 52820-52825
141. Yesilaltay, A., Kocher, O., Pal, R., Leiva, A., Quinones, V., Rigotti, A., and Krieger, M.
(2006) J Biol. Chem. 281, 28975-28980
142. Meyer, B., Caslake, M., McConnell, M., Packard, C. (2000) Atherosclerosis 153, 355-62
143. Herbert, P., Gotto, A., Fredrlckson, D. (1986) Arterioscler. Thromb. Vasc. Biol. 6, 79-87
144. Kocher, O., Pal, R., Roberts, M., Cirovic, C., Gilchrist, A. (2003) Mol Cell Biol 23,
1175-1180.
145. Pribanic, S., Gisler, S., Bacic, D., Madjdpour, C., Hernando, N., Sorribas, V., Gantenbein,
A., Biber, J., Murer, H., (2003) Am JPhysiolRenal Physiol 285, F784-F791
146. Gisler, S., Pribanic, S., Bacic, D., Forrer, P., Gantenbein, A., Sabourin, L., Tsuji, A., Zhao,
Z., Manser, E., Biber, J., Murer, H. (2003) Kidney Int 64, 1733-1745
147. Capuano, P., Bacic, D., Stange, G., Hernando, N., Kaissling, B., Pal, R., Kocher, O., Biber,
J., Wagner, C., Murer, H. (2005) Pflugers Arch 449, 392-402
148. Anzai, N., Miyazaki, H., Noshiro, R., Khamdang, S., Chairoungdua, A., Shin, H.,
Enomoto, A., Sakamoto, S., Hirata, T., Tomita, K., Kanai, Y., Endou, H. (2004) JBiol
Chem 279, 45942-45950
149. Kato, Y., Yoshida, K., Watanabe, C., Sai, Y., Tsuji, A. (2004) Pharm Res 21, 1886-1894
150. Miyazaki, H., Anzai, N., Ekaratanawong, S., Sakata, T., Shin, H., Jutabha, P., Hirata, T.,
He, X., Nonoguchi, H., Tomita, K., Kanai, Y., Endou, H. (2005) JAm Soc Nephrol 16,
3498-3506
151. Hillesheim, J., Riederer, B., Tuo, B., Chen, M., Manns, M., Biber, J., Yun, C., Kocher, O.,
Seidler, U. (2007) Pflugers Arch. 454, 575-86
152. Li, C., Krishnamurthy, P., Penmatsa, H., Marrs, K., Wang, X., Zaccolo, M., Jalink, K., Li,
M., Nelson, D., Schuetz, J., and Naren, A. (2007) Cell 131, 940-951
153. Kocher, O., Comella, N., Gilchrist, A., Pal, R., Tognazzi, K., Brown, L., Knoll, J. (1999) J
Biol Chem 79, 1161-1170.
154. Hegedus, T., Sessler, T., Scott, R., Thelin, W., Bakos, E., Varadi, A., Szabo, K., Homolya,
L., Milgram, S., Sarkadi, B. (2003) Biochem Biophys Res Commun. 302, 454-61
155. Sugiura, T., Kato, Y., Kubo, Y., Tsuji, A. (2006) Drug Metab. Pharmacokinet21, 375-383
156. Thomson, R., Wang, T., Thomson, B., Tarrats, L., Girardi, A., Mentone, S., Soleimani, M.,
Kocher, 0., and Aronson, P. (2005) Proc NatlAcadSci USA. 102, 13331-13336
157. Gentzsch, M., Cui, L., Mengos, A., Chang, B., Chen, J., Riordan, J. (2003) JBiol Chem
278, 6440-6449.
158. Gisler, S., Madjdpour, C., Bacic, D., Pribanic, S., Taylor, S., Biber, J., Murer, H. (2003)
Kidney Int 64, 1746-1754.
159. Cinar, A., Chen, M, Riederer, B., Bachmann, O., Wiemann, M., Manns, M., Kocher, O.,
Seidler, U. (2007) J. Physiol. 581, 1235-1246
160. Kato, Y., Sai, Y., Yoshida, K., Watanabe, C., Hirata, T., Tsuji, A. (2005) 67, 734-743
161. Sugiura, T., Kato, Y., Wakayama, T., Silver, D., Kubo, Y., Iseki, S., Tsuji, A. (2008) Drug
Metab Dispos. 36, 1181-8
162. Malmberg, E., Andersson, C., Gentzsch, M., Chen, J., Mengos, A., Cui, L., Hansson, G.,
Riordan, J. (2004) Cell Sci 117, 5535-5541
163. Navarro-Lerida, I., Martinez-Moreno, M., Ventoso, I., A'lvarez-Barrientos, A., and
Rodnguez-Crespo, I. (2007) Mol Biol Cell. 18, 2768-2777
164. Yesilaltay, A., Kocher, O., Rigotti, A., Krieger, M. (2005) Curr Opin Lipidol 16, 147-152
165. Lodish, H., Berk, A., Matsudaira, P., Kaiser, C., Krieger, M., Scott, M., Zipursky, S.L.,
Darnell, J. (2004) Molecular Cell Biology 5 th edition. New York: W.H. Freeman and
Company
Chapter Two
OVEREXPRESSION OF THE PDZ1 DOMAIN OF
PDZK1 BLOCKS THE ACTIVITY OF HEPATIC
SCAVENGER RECEPTOR, CLASS B, TYPE I (SRBI) BY ALTERING ITS ABUNDANCE AND
CELLULAR LOCALIZATION
Sara A. Fenske, Ayce Yesilaltay, Rinku Pal, Kathleen Daniels, Attilio
Rigotti, Monty Krieger, and Olivier Kocher
Adapted from: Sara A. Fenske, Ayce Yesilaltay, Rinku Pal, Kathleen Daniels, Attilio Rigotti,
Monty, Krieger, and Olivier Kocher. Overexpression of the PDZ1 Domain of PDZK1 Blocks the
Activity of Hepatic Scavenger Receptor, Class B, Type I (SR-BI) by Altering its Abundance and
Cellular Localization. Journal of Biological Chemistry, in press, with permission of the
American Society for Biochemistry and Molecular Biology, Inc.
This chapter is currently in press in the Journal of Biological Chemistry (Accepted June 10,
2008) and is the product of a collaborative group of investigators. I contributed the text and
figures 1, 2B & C, 4, and 5. All transgenic and non-transgenic mice were generated by Olivier
Kocher and technicians in his lab at the Beth Israel-Deaconess Medical Center and Harvard
Medical School (Rinku Pal, Kathleen Daniels). Olivier Kocher performed the
immunohistochemical analysis of SR-BI localization, and the immunoblotting analysis of hepatic
SR-BI protein levels in full-length PDZK1 transgenic mice. Ayce Yesilaltay performed initial
characterization of the full-length transgenic PDZK1 lines, including some plasma cholesterol
and FPLC studies. Attilio Rigotti and Ayce Yesilaltay performed experiments with hepatic
expression of full-length PDZK1 by adenovirus that confirmed the results from the transgenic
line. Attilio Rigotti and Olivier Kocher performed immunofluorescence analysis of SR-BI
intracellular localization that confirmed the immunohistochemistry results. Contributions to the
Materials and Methods section and figure legends and revisions to text were made by Olivier
Kocher. Revisions to text were contributed by Monty Krieger, Ayce Yesilaltay, and Attilio
Rigotti. All experiments were performed in the laboratories of Monty Krieger and Olivier
Kocher, who provided overall supervision. Attilio Rigotti also prepared adenovirus expression
vectors for many of the constructs described in this manuscript and I used these to generate
large-scale preps of these viruses. However, the stable transgenic animals became available more
quickly than expected, so they were used rather than the adenoviruses for most studies.
Abstract
PDZK1 is a four PDZ domain-containing scaffold protein that, via its first PDZ domain
(PDZ 1), binds to the C-terminus of the high-density lipoprotein (HDL) receptor scavenger
receptor, class B, type I (SR-BI). Abolishing PDZK1 expression in PDZK1 knockout (KO) mice
leads to a posttranscriptional, tissue-specific decrease in SR-BI protein level and an increase in
total plasma cholesterol carried in abnormally large HDL particles. Here we show that, while
hepatic overexpression of PDZK1 restored normal SR-BI protein abundance and function in
PDZK1 KO mice, hepatic overexpression of only the PDZ1 domain was not sufficient to restore
normal SR-BI function. In WT mice, overexpression of the PDZ domain overcame the activity
of the endogenous hepatic PDZKl, resulting in a 75% reduction in hepatic SR-BI protein levels
and intracellular mislocalization of the remaining SR-BI. As a consequence, the plasma
lipoproteins in PDZ1 transgenic mice resembled those in PDZK1 KO mice
(hypercholesterolemia due to large HDL). These results indicate that the PDZ1 domain can
control the abundance and localization, and therefore the function, of hepatic SR-BI, and that
structural features of PDZK1 in addition to its SR-BI-binding PDZ1 domain are required for
normal hepatic SR-BI regulation.
Introduction
The high density lipoprotein (HDL) receptor SR-BI (scavenger receptor, class B, type I)
plays a key role in lipoprotein metabolism (1) by mediating the cellular uptake of cholesteryl
esters from HDL and other lipoproteins into cells (2-7), via a mechanism called selective lipid
uptake (3, 8-10). SR-BI also mediates bi-directional flux of unesterified cholesterol between cells
and lipoproteins (11-14).
Most in vivo analyses of the physiological function of SR-BI have been conducted in mice.
SR-BI is highly expressed in the liver and steroidogenic tissues (adrenal gland, ovary and testis),
which exhibit the highest levels of HDL cholesterol uptake (3). Experimental manipulations of
murine SR-BI expression (e.g., hepatic overexpression, homozygous null gene knockout) can
lead to changes in total plasma cholesterol levels, the ratio of plasma unesterified-to-total
cholesterol (UC:TC), HDL structure, biliary cholesterol secretion, the amounts of cholesterol
stored in steroidogenic tissues, and susceptibility to atherosclerosis (15-27). Homozygous null
SR-BI knockout mice exhibit abnormally elevated (~2.2-fold) plasma cholesterol in large HDL
particles with a UC:TC ratio roughly double that of wild-type (WT) mice (19, 21). This
dyslipidemia is associated with female infertility and defects in the maturation and/or structure,
as well as reductions in the survival times of red blood cells (21, 28, 29,30).
To date, only one intracellular protein has been shown to interact directly with and
influence the function of SR-BI (31). This protein, PDZK1, regulates SR-BI expression in a
tissue-specific, post-transcriptional manner (32). PDZK1 is a scaffold protein containing four
PDZ protein interaction domains (Fig 1A, top), which bind to the carboxy termini of a number of
membrane transporter proteins, including ion channels (e.g., CFTR) and cell surface receptors
(33, 34). PDZKl's activity can be modulated by phosphorylation near its C-terminus (35). Its
most N-terminal PDZ domain, PDZ1, binds to the carboxy terminus of SR-BI (31, 36), but
apparently not to a minor, alternatively-spliced form of SR-BI called SR-BII, whose 39 residue
C-terminal sequence (encoded by alternatively spliced exon) differs from that of SR-BI (32,3741). Unlike the four C-terminal residues in murine SR-BI (EAKL), those in SR-BII (SAMA) are
not expected to bind to PDZ domains (42). Loss of SR-BI's C-terminal most amino acid
abolishes its interaction with the PDZ1 domain of PDZK1 (36).
PDZK1 is most highly expressed in the kidney and is also expressed, as is the case for SRBI, in the liver and intestines; but has very low expression in the adrenal gland, ovary, and testis,
in which SR-BI is abundantly expressed (3,31). Strikingly, PDZK1 knockout (KO) mice show a
dramatic, >95% decrease in SR-BI expression in the liver, a partial decrease in the small
intestine, but no change in steroidogenic tissues (32). As a consequence of the decrease in
hepatic SR-BI protein, PDZK1 KO mice exhibit abnormally high plasma cholesterol levels
(~-1.7-fold) transported in abnormally large HDL particles (32). These features are similar to,
though not as severe as, those found in SR-BI KO mice (19). We have previously shown that
hepatic overexpression of an SR-BI transgene in SR-BI/PDZK1 double knockout mice leads to
SR-BI expression on the cell surface and normal function (43). Thus, when SR-BI is on the cell
surfaces of hepatocytes at steady state levels similar to those in wild-type hepatocytes, it can
function normally without PDZK1 (43). The mechanism by which PDZK1 regulates the
abundance and/or localization of hepatic SR-BI in nontransgenic animals remains unclear.
PDZK1 includes three PDZ domains (PDZ2, PDZ3, and PDZ4) and a 66 residue C-terminal
tail (Figure lA), which are not involved in direct binding to SR-BI (31, 33). The role(s) of these
domains in the regulation of hepatic SR-BI are unknown. Nakamura et al have shown that
PDZKI's C-terminus and its phosphorylation are required for optimal PDZKl-transgene
mediated induction of increased SR-BI protein levels in cultured cells (35). It is possible that
PDZ2, PDZ3 and/or PDZ4 bind to other, as yet unidentified, cellular components involved in
SR-BI regulation. Other hepatic proteins (e.g., OATP1A1, (44)) have been shown to interact
with PDZKl's PDZ domains.
Here we have further analyzed the influence of one of the PDZ domains of PDZK1, PDZ 1,
on hepatic SR-BI abundance, localization and function in vivo. We have compared the effects of
transgenes encoding either the full-length PDZK1 or only the SR-BI-binding PDZ1 domain on
hepatic SR-BI protein expression and plasma lipoproteins in wild-type (WT) and PDZK1 KO
mice. We found that overexpressing full-length PDZK1 in PDZK1 KO mice restored normal
hepatic SR-BI protein levels and function, yet in WT mice had little, if any, effect on hepatic SRBI levels and function. However, hepatic overexpression of only the PDZ1 domain was not
sufficient to restore normal SR-BI function in PDZKl-deficient mice. In addition, in WT mice,
overexpression of the PDZ1 domain overcame the activity of the endogenous hepatic PDZK1,
resulting in a 75% reduction in hepatic SR-BI protein levels and intracellular mislocalization of
the remaining SR-BI. As a consequence the plasma lipoproteins resembled those in PDZK1 KO
mice (hypercholesterolemia, large HDL). Our results suggest that the PDZ 1 domain can control
both the abundance and intracellular localization of hepatic SR-BI and that normal regulation of
SR-BI by PDZK1 is likely to require that its other domains interact with other, as yet
unidentified, cellular components.
Experimental Procedures
Generation of PDZK1 and PDZ1 transgenic mice: PDZK1 and PDZl transgenic mice
were generated using the pLIV-LE6 plasmid, kindly provided by Dr. John M. Taylor (Gladstone
Institute of Cardiovascular Disease, University of California, San Francisco). The pLiv-LE6
plasmid contains the promoter, first exon, first intron, and part of the second exon of the human
apoE gene, and the polyadenylation sequence, and a part of the hepatic control region of the
apoE/C-I gene locus (45).
To generate the full-length PDZK1 transgenic mouse, a 2.3-kilobase DNA fragment
spanning the wild-type murine PDZK1 cDNA was subcloned between the KpnI and XhoI sites of
pLIV-LE6 plasmid. The PDZKl-coding region was confirmed by DNA sequencing. The new
construct harboring the PDZK1 gene, as well as the above-mentioned apoE/apoC-I control locus
elements, was linearized by SacII/SpeI digestion and the resulting 7.3-kilobase fragment was
used to generate transgenic mice using standard procedures (46).
To generate the PDZ transgenic mouse, a 400 bp DNA fragment containing the first 116
amino acids of PDZK 1, including its first PDZ domain, was generated by polymerase chain
reaction and subcloned between the KpnI and XhoI sites of pLIV-LE6 plasmid. The sequence of
the resulting plasmid was confirmed by DNA sequencing. The new construct harboring PDZ1 as
well as the apoE/apoC-I control locus elements was linearized by SacII/Spel digestion and the
resulting 5.4-kilobase fragment was used to generate transgenic mice using standard procedures
(46).
Founder animals for the PDZK1 or PDZ transgenes in an FVB/N genetic background were
identified by PCR performed on tail DNA using the following oligonucleotide primers: fulllength PDZK1 transgene, one at the 3'-end of the PDZK1 cDNA
(GCAGATGCCTGTTATAGAAGTGTGC) and one corresponding to the 3'-end of the human
apoE gene sequence included in the cloning vector (AGCAGATGCGTGAAACTTGGTGA);
PDZ1 transgene, one located within the first PDZ domain of PDZK1 cDNA
(CAATGGTGTCTTTGTCGACAAG) and the same 3'-primer used for the full length PDZK1
transgene. Founders expressing the PDZK1 or PDZ1 transgenes were crossed with PDZK1
knockout mice (129SvEv background). Heterozygous pups expressing the PDZK1 or PDZ1
transgene were crossed with wild-type and PDZK1 knockout mice to obtain mice with PDZK1
or PDZ transgene expression and non-transgenic wild-type and knockout control mice, thus
ensuring that the mixed genetic backgrounds of experimental and control mice in each founder
line are matched. Genotyping of PDZK1 knockout mice was performed as previously described
(47).
Transgene expression levels were determined in liver, kidney, adrenal gland and small
intestines by immunoblotting as described below. Expression was only observed in the liver and
kidney, with hepatic transgene expression approximately 4-fold higher than that seen in the
kidney. Expression of the PDZK1 and PDZ1 transgene did not alter the undetectable level of SRBI in the kidney.
Animals: All mice on a 25:75 FVB/N:129Sv genetic background were maintained on a normal
chow diet (47) and -6-13 week old male mice were used for experiments. Four PDZKl-Tg and
three PDZl-Tg founder lines were generated, all showing similar effects on plasma cholesterol
levels, respectively. Observations from animals derived from two of the four PDZKl-Tg and two
of the three PDZl-Tg expressing founders were pooled because transgene-driven protein
expression levels for these two sets of founders were similar. All procedures on transgenic and
non-transgenic mice were performed in accordance with the guidelines of the Beth Israel
Deaconess Medical Center and the Massachusetts Institute of Technology Committee on Animal
Care.
Blood and tissue sampling and processing: After a 4-hour fast, mice were anesthetized by IP
injection of 1.25% Avertin, and blood was collected by heart puncture with a heparinized
syringe. Plasma was separated from cells by two sequential centrifugations (15 and 10 min.,
2500 g) and stored at 40 C prior to analysis. Tissue samples, including liver, kidney, adrenal, and
small intestine were harvested and immediately frozen on dry ice and stored at -80o C. Frozen
tissue was finely chopped with a blade in SDS buffer (4% SDS, 20% glycerol, 100 mM Tris pH
6.8) and then sonicated on ice, boiled at 100 0 C for 5 minutes, and subjected to centrifugation at
16,000 x g for 5 minutes at room temperature. The protein concentrations of these lysate
supernatants were then determined using the bicinchoninic acid (BCA) assay (Pierce). Lysates
were then denatured at 100 0 C for 10 minutes in the presence of 2% SDS and 100mM 13mercaptoethanol immediately before fractionation by gel electrophoresis and analysis by
immunoblotting.
Analysis of plasma cholesterol and lipoproteins: Plasma samples from individual mice were
collected and analyzed for total cholesterol levels using a commercial kit (Wako Chemical USA,
Inc., Richmond, VA) before and after size fractionation by fast performance liquid
chromatography (FPLC). FPLC cholesterol profiles shown are from representative individual
mice. Total plasma cholesterol data from founders with similar hepatic transgene expression
levels were pooled.
Immunoblotting and immunoperoxidase analysis of tissues: For immunoblotting, protein
samples (-30 or 1.5 pg) from total tissue lysates were fractionated by SDS-PAGE, transferred to
nitrocellulose or polyvinylidene difluoride membranes and incubated with either a rabbit
polyclonal anti-SR-BI antipeptide antibody (mSR-BI4 95-112) (1:1000) or a rabbit polyclonal antiPDZK1 antipeptide antibody (1:5000-1:10000), followed by an anti-rabbit IgG conjugated to
horseradish peroxidase (Invitrogen, 1:10000), and visualized by ECL chemiluminescence (GE
Healthcare/Amersham, #RPN2132). The rabbit polyclonal anti-mSR-B1 495-112 antipeptide
antibody (prepared by Invitrogen) was generated using similar procedures and against the same
peptide as a previously described anti-mSR-B1495 antibody, and gives the same results as the antimSR-B1495 antibody (3, 43). The rabbit polyclonal antibody was prepared against a 30-mer
amino-terminal peptide from the murine PDZK1 protein sequence, coupled to keyhole limpet
hemocyanin (KLH) (Genemed Synthesis, South San Francisco, CA), and affinity purified.
Immunoblotting using polyclonal anti-E-COP (1:5000) (48) or anti-actin (1:500) (Sigma)
antibodies were used as loading controls. The relative amounts of proteins were determined by
quantitation using a Kodak Image Station 440 CF and Kodak ID software. Multiple independent
determinations of band intensities from serially diluted samples were made to ensure that the
intensities were both in the linear range of the detector and reproducible.
For immunoperoxidase analysis, livers were harvested, fixed and frozen. Sections (5 tm)
2 antibody and biotinylated anti-rabbit IgG, visualized by
were stained with the anti-mSR-B1 495-11
immunoperoxidase staining, and counterstained with Harris modified hematoxylin as described
previously (32).
Enzymatic Digestion of Tissue Lysates: Liver lysates (30 ýtg of protein) from WT animals with
or without the PDZ1 transgene were denatured at 100oC for 10 minutes in the presence of 0.5%
SDS and 1% P3-mercaptoethanol, and subsequently treated with 187.5 U of Peptide: NGlycosidase F (PNGase F) (in the presence of 50 mM sodium phosphate and 1% NP-40), or
1250 U of Endoglycosidase H (Endo H) (in the presence of 50 mM sodium citrate), or no
enzyme at 370 C for 3.5 hours (New England Biolabs). The treated lysates were then analyzed by
immunoblotting using the anti-mSR-B149 5-112 polyclonal antibody with chemiluminescence
visualization of the bands as described above.
Statistical Analysis: Data are shown as the means t standard deviation. Statistically significant
differences were determined by either pairwise comparisons of values using the unpaired t test,
with (if variances differed significantly) or without Welch's correction, or by one-way ANOVA
followed by the Tukey-Kramer multiple comparison post-test when comparing three or more sets
of data to each other. Mean values for experimental groups are considered statistically
significantly different for P < 0.05 for both types of tests.
Results
To determine the effects of expressing the full-length or a truncated form (PDZ1 domain) of
the PDZK1 protein on hepatic SR-BI protein levels and function, we generated two cDNA
constructs that encode either the full-length PDZK1 protein (designated 'PDZKl-Tg') or only
the N-terminus and PDZ1 domain ("PDZ1-Tg") (Figure lA). These constructs were used to
generate transgenic mice with liver and kidney-specific expression in both wild-type
(WT[PDZK1-Tg] or WT[PDZ1-Tg]) and PDZK1 KO (PDZK1 KO[PDZKl-Tg] or PDZK1
KO[PDZ1-Tg]) mice on a mixed FVB/129SvEv background. Transgene expression in the kidney
did not alter the undetectable expression of SR-BI in this organ (see Methods).
Hepatic levels of PDZK1 and PDZ1 proteins in nontransgenic and transgenic mice from two
founders each were determined by immunoblotting (typical result in Figure IB). Quantitative
analysis of multiple immunoblots showed that the steady state levels of transgene encoded
proteins were greater by approximately 21-fold in PDZK1-Tg-expressing and 24-fold in PDZ1Tg-expressing mice than that of endogenous PDZK1 in WT nontransgenic mice (Figure IB, note
there was lower total protein loading for samples from transgenic animals). Analysis by
immunoblotting also showed that the levels of endogenous hepatic PDZK1 in WT[PDZ 1-Tg]
mice were similar to those in nontransgenic WT mice (83+ 18 % of WT levels of endogenous
PDZK1, P = 0.339).
PDZK1 and PDZ1I
IA.
519
Wc
1
PDZK1 N
l
.1.6
SRB
Bid
I
1
PDZ1
-
N
116
C
I
B.Hepatic expression of proteins
Genotype: WT
KO
PDZK1-Tg:
-
+- +
PDZ1-Tg:
-
-
+-
75
PDZK1
o 50
-37
*
25
20
PDZ1
vo
15
E-COP•O
Loading (tg):
30
1.5
Figure 1. Hepatic expression of PDZK1 and PDZ1 transgenes.
A, Schematic diagrams of the proteins encoded by the PDZK1 (top) and PDZ1 (bottom)
transgenes. B, Immunoblot analysis of hepatic expression of PDZK1 and PDZ1 proteins in
PDZK1 and PDZl transgenic mice. Hepatic protein levels are shown in nontransgenic wild-type
(WT) and PDZK1 knockout (KO) mice (left two lanes), and PDKZI KO [PDZKl-Tg] and
PDZK1 KO[PDZl-Tg] mice (right two lanes). Liver lysates from mice with the indicated
genotypes and transgenes (30 [g or 1.5 ltg of protein per lane) were analyzed by
immunoblotting, and the bands corresponding to either PDZK1 (-60 kDa) or PDZ1 (~14 kDa)
were visualized by chemiluminescence. Size markers are indicated on the right. E-COP (~34 kDa
band, bottom) was used as a loading control. Replicate experiments with multiple exposures and
sample loading were used to determine the relative levels of expression of these proteins. Note
faint E-COP band visible in the last lane. Samples shown were all from a single gel, but
reordered for presentation purposes.*Indicates background bands seen in all samples.
Effects of the PDZK1-Tg on hepatic SR-BI expression and lipoprotein metabolism: In WT
mice, hepatic overexpression of PDZK1 had little effect on the steady state levels
(immunoblotting, Figure 2A, left half of the panel) or cell surface localization
(immunohistochemistry, Figure 3A and C) of hepatic SR-BI protein. As a consequence, in WT
mice there also was no influence of the PDZK1-Tg on plasma cholesterol levels (Figure 2B, left
panel) or the size distribution of lipoproteins (FPLC lipoprotein cholesterol profiles), in which
the bulk of the cholesterol is found in normal sized HDL particles (Figure 2C, white and gray
circles). In contrast, in PDZK1 KO mice, hepatic overexpression of PDZK1 corrected the
previously reported abnormal phenotypes related to SR-BI and lipoprotein metabolism. In
PDZK1 KO mice the PDZK1-Tg restored from <5% of wild-type (32) to normal wild-type levels
the steady-state abundance of hepatic SR-BI protein (immunoblotting, Figure 2A, right half of
the panel), which was properly localized on the surfaces of the hepatocytes
(immunohistochemistry, Figure 3B and D). As a consequence, in PDZK1 KO mice the PDZK1Tg restored plasma cholesterol levels from the ~1.7-fold elevation seen in nontransgenic PDKZ1
KO mice to those in wild-type controls (Figure 2B, right panel). The PDZKl-Tg also restored
the size distribution of lipoproteins from that with abnormally large HDL particles in the
nontransgenic PDZK1 KO animals to that with normal sized HDL seen in the nontransgenic WT
mice (Figure 2C, black and gray squares). Note that the peak of PDZK1 KO sample is shifted to
the left relative to that in WT plasma, indicating larger lipoproteins. Similar results were
obtained with an adenoviral construct used to overexpress full-length PDZK1 in the livers of
mice on a pure 129SvEv genetic background (not shown). Therefore, although hepatic
overexpression of PDZK1 has little effect on SR-BI and lipoprotein metabolism in WT mice, it
appears to fully complement the PDZK1 deficiency in PDZK1 KO mice with respect to hepatic
SR-BI protein levels, cellular localization and function in lipoprotein metabolism.
A. PDZK1 Tranagene
Genotype:
PDZK1-Tg: -
KO
WT
-1 +
+
Transgene
A.PDZK1
SR-BI -1
•
Actin -,
III
III
II
~~----A
I
I
-e
mMM
B. PDZK1-Tg Plasma Cholesterol
C. PDZK1-Tg Lipoprotein Cholesterol Profiles
nn
VLDL
25- I
II
IDL/LDL
HDL
II
E 20
0
o 152 10-
1 50
-o-WT
-o-WT + PDZKI-Tg
-'-KO
+ KO + PDZKI-Tg
MELVI0N
-1
o O.W
m
ill
iiiillil
iiiiiill
11 M I
I111
.
.
.
.
.
.
.
.- .
29 33 37
.
-
41
Fraction Number
Fraction Number
Figure 2. Effect of expression of the PDZK1 transgene on hepatic SR-BI protein levels (A)
and plasma lipoprotein cholesterol (B and C) in WT and PDZK1 KO mice.
A, Liver lysates (~30 ýtg of protein) from mice with the indicated genotypes, with (+) or without
(-) the PDZK1 transgene, were analyzed by immunoblotting, and SR-BI (~82 kDa band) was
visualized by chemiluminescence. Actin (~40 kDa) was used as a loading control. B and C.
Plasma was harvested from mice with the indicated genotypes and PDZK1 transgene. B, Total
plasma cholesterol levels were determined in individual samples by enzymatic assay, results
from the indicated numbers of animals (n) were pooled by genotype and normalized to the mean
value for WT plasma cholesterol (100% = 116.9 mg/dl). Independent WT and KO control
animals for each founder line were generated to ensure that the mixed genetic backgrounds for
experimental and control mice were matched. * Indicates the PDZK1 KO plasma cholesterol
levels were statistically significantly different (P <0.001) from those plasma cholesterol levels of
WT, WT[PDZKl-Tg], and PDZK1 KO[PDZKl-Tg] mice. C, Plasma samples (harvested as in
panel B) from individual animals were size-fractionated by FPLC, and the total cholesterol
content of each fraction was determined by an enzymatic assay. The chromatograms are
representative of multiple individually determined profiles. Approximate elution positions of
native VLDL, IDL/LDL and HDL particles are indicated by brackets and were determined as
previously described (19).
Figure 3. Immunohistochemical analysis of hepatic SR-BI in WT and PDZK1 KO
nontransgenic (A and B), PDZK1 transgenic (C and D), and PDZ1 transgenic (E and F)
mice. Livers from mice of the indicated genotypes and transgenes were fixed, frozen and
sectioned. The sections were then stained with a polyclonal anti-SR-BI antibody, and a
biotinylated anti-rabbit IgG secondary antibody and visualized by immunoperoxidase staining.
(Magnification x600).
Effects of the PDZ1-Tg on lipoprotein metabolism and hepatic SR-BI expression: In PDZK1
KO mice, 24-fold hepatic overexpression of the truncated PDZ1 protein had virtually no effect
on the abnormally high plasma cholesterol levels (Figure 4B, right panel) or the size distribution
of lipoproteins (FPLC lipoprotein cholesterol profiles), in which the bulk of the cholesterol is
found in abnormally large HDL particles (Figure 4C, black and gray squares). Thus, the Nterminal PDZ1 domain-containing region of PDZK1 is not sufficient to restore normal SR-BI
function in PDZK1 KO mice, suggesting that other portions of the PDZK1 protein must play
critical roles in regulating hepatic SR-BI. Strikingly, in WT mice we found that the PDZl-Tg
elevated plasma cholesterol levels (Figure 4B, left) and increased the size of the HDL particles
(Figure 4C, white and gray circles) to those observed in nontransgenic PDZK1 KO mice. We
therefore conclude that, PDZl-Tg acts as in a dominant negative fashion with respect to SR-BI
function in WT mice.
We then examined the effects of the PDZl-Tg on hepatic SR-BI protein abundance and
localization. Immunoblotting analysis (Figure 4A, left portion of the panel) shows that in WT
mice the PDZl-Tg lowered the steady-state hepatic SR-BI protein levels to 24±5% of that in
nontransgenic WT mice, yet the levels remained >5-fold higher than that in nontransgenic
PDZK1 KO mice. Thus, unlike the full-length PDZK1-Tg, in WT mice the PDZl-Tg partially
suppressed hepatic SR-BI protein expression. Initially it was somewhat surprising that this
partial suppression of hepatic SR-BI protein levels was accompanied by changes in plasma
lipoproteins equivalent to those seen in nontransgenic PDZK1 KO mice that have <5% of WT
hepatic SR-BI. However, immunohistochemical localization of the residual SR-BI in WT[PDZ1Tg] mice (Figure 3E) showed that most of the residual SR-BI was intracellular, with no
detectable receptor on the hepatocytes' surfaces. This result was confirmed by
immunofluorescence microscopy (data not shown). Thus, the absence of substantial amounts of
SR-BI on the sinusoidal surfaces of hepatocytes in WT[PDZl-Tg] mice appears to explain the
similarity of the lipoprotein levels in these mice and nontransgenic PDZK1 KO mice. In both
cases there was virtually no surface SR-BI to interact with circulating lipoproteins.
To determine if the intracellular mislocalization of the residual SR-BI in WT[PDZ1-Tg] mice
were due to a block in SR-BI trafficking in the early stages of the secretory pathway (ER to
medial Golgi), we compared the glycosylation state of the SR-BI protein in nontransgenic WT
and WT[PDZl-Tg] mice. We have previously shown that SR-BI is heavily glycosylated (11 Nlinked glycosylation sites) (49, 50). N-linked oligosaccharide chains on newly synthesized
glycoproteins in the ER are initially fully sensitive to cleavage by the enzyme endoglycosidase H
(EndoH), but enzymatic modifications that occur as the glycoprotein passes through the medial
Golgi convert many, but not all, of these chains to an EndoH resistant form (51). Virtually all Nlinked oligosaccharide chains on glycoproteins, both EndoH sensitive and EndoH resistant, can
be removed by the glycosidase Peptide: N-Glycanase F (PNGase F) (51). The fully matured
hepatic SR-BI protein from nontransgenic WT mice (immunoblotting of untreated and
glycosidase-treated liver lysates, Figure 5, left side of the panel) exhibited a pattern of
glycosidase sensitivity similar to that previously reported for SR-BI in cultured cells and the
adrenal gland (49). This SR-BI protein was fully sensitive to PNGase F (reduction in apparent
molecular weight from ~82 kDa (untreated) to ~55 kDa), yet only partially resistant to hydrolysis
by EndoH (electrophoretic mobility intermediate between the untreated and fully Ndeglycosylated forms). [Unidentified background bands are indicated with asterisks.] The results
for glycosidase analysis of hepatic SR-BI from WT[PDZ1-Tg] mice were virtually identical to
those from nontransgenic WT mice (although the lower SR-BI expression required longer
exposure times and correspondingly stronger background bands). Essentially all of the SR-BI
protein was partially EndoH resistant, and thus had passed through the medial Golgi. Therefore,
we conclude that the intracellular mislocalization of the residual hepatic SR-BI in WT[PDZl-Tg]
mice was not a consequence of a block in ER to medial Golgi intracellular trafficking.
Although in PDKZ1 KO mice the PDZl-Tg did not influence plasma cholesterol levels or the
lipoprotein profile (Figure 4B, right panel and C, squares), it did reproducibly increase the steady
state levels of hepatic SR-BI protein from less than 5% to 21±6% of nontransgenic WT levels
(Figure 4A, right). Figure 3F shows that this residual SR-BI was located intracellularly rather
than on the cell surface, and thus cannot function efficiently as a receptor for circulating HDL.
The mechanism by which hepatic overexpression of PDZ1 in PDZK1 KO mice partially restores
the steady state level of SR-BI protein, yet results in its mislocalization, remains uncertain (see
Discussion). It is noteworthy that the level of SR-BI protein was virtually the same in
WT[PDZ1-Tg] (24 ±5%) and PDZK1 KO[PDZl-Tg] (21±6%) mice. This similarity raises the
possibility that the overexpressed PDZ1 domain completely displaced the endogenous PDKZ1
protein's binding to SR-BI in WT[PDZl-Tg] livers.
A. PDZ1 Transagene
Genotype:
PDZ1-Tg: SR-BI-
WT
KO
+ - +
4l1 1
E-COP-B. PDZI-Tg Plasma Cholesterol
I
C. PDZI-Tg Upoprotein Cholesterol Profiles
305
- 25
.20
00 15
a"
-o-WT + PDZI-Tg
+KO
10
.C
0
S
-- KO + PDZI-Tg
5
9
13 17 21 25 29 33 37 41
Fraction Number
Figure 4. Effect of expression of the PDZ1 transgene on hepatic SR-BI protein levels (A)
and plasma lipoprotein cholesterol (B and C) in WT and PDZK1 KO mice. A, Liver lysates
(~-30 [g of protein) from mice with the indicated genotypes, with (+) or without (-) the PDZ1
transgene, were analyzed by immunoblotting, and SR-BI (-82 kDa band) was visualized by
chemiluminescence. e-COP (-34 kDa) was used as a loading control. Note the faint SR-BI band
in the nontransgenic PDZK1 KO lane. B and C. Plasma was harvested from mice with the
indicated genotypes and PDZ transgene. B, Total plasma cholesterol levels were determined in
individual samples by enzymatic assay, results from the indicated numbers of animals (n) were
pooled by genotype, and normalized to the mean value for WT plasma cholesterol (100% = 131.7
mg/dl). Independent WT and KO control animals for each founder line were generated to ensure
that the mixed genetic backgrounds for experimental and control mice are matched. * Indicates
the nontransgenic WT plasma cholesterol levels were statistically significantly different (P <
0.001) from those plasma cholesterol levels of WT[PDZl-Tg], PDZK1 KO and PDZK1
KO[PDZ1-Tg] mice. C, Plasma samples (harvested as in panel B) from individual animals were
size-fractionated by FPLC, and the total cholesterol content of each fraction was determined by
an enzymatic assay. The chromatograms are representative of multiple individually determined
profiles. Approximate elution positions of native VLDL, IDL/LDL and HDL particles are
indicated by brackets and were determined as previously described (19).
U
WT
Genotype:
U-
PDZ1 Transgene:
U-
U-
U-
U-
PNGase F:
u-u-.-.-
Endo H:
SR-BI (untreated)
MDa
75
-
Partially
Endo H Resistant
N-deglycosylated
50
ll
Exposure (min)
0.75
Figure 5. Immunoblot analysis of the effects of the PDZ1 transgene on the N-glycosylation
of hepatic SR-BI in WT mice. Liver lysates (30 [tg of protein) from WT animals with (+) or
without (-) the PDZ1 transgene were treated as indicated with PNGase F (187.5 U), Endo H
(1250 U), or no enzyme at 370 C for 3.5 hours, and then analyzed by immunoblotting using an
anti-SR-BI polyclonal antibody with chemiluminescence visualization of the bands. * Indicates
background bands seen in all samples, including in samples of nontransgenic PDZK1 KO lysates
(not shown). The lanes for samples from the PDZ transgenic mice (right) contained lower levels
of SR-BI protein and were therefore subjected to longer exposure times (5 vs. 0.75 min). As a
consequence the intensities of the background bands were higher than for the nontransgenic
samples on the left.
Discussion
The first PDZ domain, PDZ1, of the cytoplasmic adaptor protein PDZK1 binds to the Cterminus of SR-BI and as a consequence, PDZK1 controls hepatic SR-BI protein expression and
lipoprotein metabolism (31,32,36). Expression of full-length PDZK1 in the liver of PDZK1 KO
mice corrects their dramatic decrease in hepatic SR-BI protein levels and hypercholesterolemia,
without apparently altering SR-BI expression in other tissues. This suggests that PDZKl's effect
on lipoprotein metabolism is mediated principally by its control of SR-BI in liver.
When a transgene encoding a truncated form of PDZK1 primarily comprising only the SRBI-binding PDZ1 domain (PDZ1-Tg, Figure lA) was overexpressed in WT mice, it exhibited
dominant-negative activity and the mice, in several respects, resembled PDZK1 KO mice
(dramatically reduced cell surface expression of hepatic SR-BI protein, hypercholesterolemia).
The residual hepatic SR-BI protein in these transgenic animals (~25% of WT controls), which
was five-fold greater than that in nontransgenic PDZK1 KO mice (<5% of control), was
redistributed from the cell surface to the intracellular region. We infer based on PDZI's binding
to SR-BI (31,36), but have not demonstrated directly, that these effects were consequences of the
recombinant, truncated PDZ1 domain competing with endogenous PDZK1 for binding to SR-BI.
These results suggest that those portions of the PDZK1 molecule C-terminal to the PDZ1 domain
that are not known to bind directly to SR-BI play a critical role in mediating PDZKl's influence
on SR-BI. It seems likely that these other regions of PDZK1 interact with additional cellular
components to properly control SR-BI activity. It is possible that the phosphorylated C-terminus
of PDZK1 (35) or the other three PDZ domains (PDZ2-PDZ4), and their binding partners, may
play a critical role in regulating SR-BI. Additional putative PDZK1 interacting components
apparently are either not present in limiting amounts, or cannot interact with PDZK1 efficiently
unless it is bound to SR-BI, because overexpression of PDZK1 protein in the liver of WT mice
had virtually no effect on normal hepatic SR-BI levels and lipoprotein metabolism (no dominant
negative phenotypes observed; the excess PDZK1 did not titrate out other critical components).
There are several potential mechanisms by which full-length PDZK1 or truncated PDZ1
might influence both SR-BI protein abundance and intracellular localization. For example,
PDZK1 might inhibit degradation of hepatic SR-BI by binding to its C-terminus, directly
preventing access to proteolytic pathways (e.g. ubiquitination and/or proteasomes) or indirectly
by controlling SR-BI's intracellular trafficking (e.g., directing post-medial Golgi sorting to the
cell surface, inhibiting endocytosis from the cell surface, or promoting normal endocytic
recycling back to the cell surface) and preventing delivery to sites of degradation, or both. The
effects of expression of the PDZl-Tg in PDZK1 KO mice are compatible with both of these
mechanisms. The PDZ1-Tg increased by five-fold the steady-state levels of SR-BI compared to
those in the nontransgenic PDZK1 KO, raising the possibility that binding to SR-BI's C-terminus
may have interfered with degradation. In addition, the residual SR-BI in the livers of both
WT[PDZ1-Tg] and PDZK1 KO[PDZl-Tg] mice was mislocalized intracellularly, possibly due
to the inability of the truncated protein/SR-BI complex to interact with cellular components that
only bind to the complex when additional domains of PDZK1 are present.
In summary, PDZK1 appears to affect SR-BI protein levels through both binding to the Cterminus and through interactions with other cellular components. Future studies will be required
to identify these putative cellular components, the domains in PDZK 1 responsible for these
interactions and the mechanism by which they cooperate with PDZK1 to control SR-BI's
function.
References
1. Rigotti, A., Miettinen, H.E., Krieger, M. (2003) Endocr Rev. 24, 357-87
2. Acton, S. L., P. E. Scherer, et al. (1994). J. Biol. Chem. 269, 21003-9
3. Acton, S., A. Rigotti, Landshulz, K.T., Xu, S., Hobbs, H.H., Krieger, M. (1996) Science
271, 518-20
4. Out R, Kruijt JK, Rensen PC, Hildebrand RB, de Vos P, Van Eck M, Van Berkel TJ.
(2004) 279, 18401-6
5. Out R, Hoekstra M, de Jager SC, de Vos P, van der Westhuyzen DR, Webb NR, Van
Eck M, Biessen EA, Van Berkel TJ. (2005) J. Lipid Res. 46, 1172-81
6. Fu T, Kozarsky KF, Borensztajn J. (2003) J. Biol. Chem. 278, 52559-63
7. Van Eck M, Hoekstra M, Out R, Bos IS, Kruijt JK, Hildebrand RB, Van Berkel TJ.
(2008) J. Lipid Res. 49, 136-146
8. Glass C, Pittman RC, Weinstein DW, Steinberg D. (1983) Proc. Natl. Acad. Sci. USA 80,
5435-5439
9. Stein Y, Dabach Y, Hollander G, Halperin G, Stein 0. (1983) Biochim. Biophys. Acta.
752, 98-105
10. Reaven E, Chen YI, Spicher M, Azhar S. (1984) J. Clin. Invest. 74, 1384-1397
11. Ji, Y., Jian, B., Wang, N., Sun, Y., de la Llera Moya, M., Phillips, M. C., Rothblat, G. H.,
Swaney, J. B., and Tall, A. R. (1997) J. Biol. Chem. 272, 20982-20985
12. Jian, B., de la Llera-Moya M., Ji, Y., Wang, N., Phillips, M. C., Swaney, J. B., Tall, A.
R., and Rothblat, G, H. (1998) J. Biol. Chem. 273, 5599-5606
13. Zimetti F, Weibel GK, Duong M, Rothblat GH. (2006) J. Lipid Res. 47, 605-13
14. Treguier, M., Moreau, M., Sposito, A., Chapman, M.J., Huby, T. (2007) Biochim.
Biophys. Acta.. 1771, 129-38
15. Kozarsky, K.F., Donahee, M.H., Rigotti, A., Iqbal, S.N., Edelman, E.R., Krieger, M.
(1997) Nature 387, 414-417
16. Arai, T., Wang, N., Bezouevski, M., Welcch, C., Tall, A.R. (1999) J. Biol. Chem. 274,
12610-12615
17. Ueda, Y., et al. (2000) J. Biol. Chem. 274, 2366-2371.
18. Kozarsky, K.F., Donahee, M.H., Glick, J.M,, Krieger, M., Rader, D.J. (2000) Artioscler.
Thromb. Vasc. Biol. 20, 721-727
19. Rigotti, A., Trigatti, B.L., Penman, M., Rayburn, H., Herz, J., Krieger, M. (1997) Proc.
Natl. Acad. Sci. U.S.A. 94, 12610-12615
20. Mardones, P., Quinones, V., Amigo, L, Moreno, M., Miquel, J.F., Schwarz, M.,
Miettinen, H.E., Trigatti, B., Krieger, M., VanPatten, S., Cohen, D.E., Rigotti, A. (2001)
J. Lipid Res. 42, 170-180
21. Trigatti, B., Rayburn, H., Vinals, M., Braun, A., Miettinen, H., Penman, M., Hertz, M.,
Schrenzel, M., Amigo, L, Rigotti, A., Krieger M. (1999) Proc. Natl. Sci. U.S.A. 96,
9322-9327
22. Huszar, D., Varban, M.L., Rinninger, F., Feeley, R., Arai, T., Fairchild-Huntress, V.,
Donovan, M.J., Tall, A.R. (2000) Arterioscler. Thromb. Vasc. Biol. 20, 1068-1073
23. Van Eck, M., Twisk, J., Hoekstra, M., Van Rij, B. T., Van der Lans, C. A., Bos, I. S.,
Kruijt, J. K., Kuipers, F., and Van Berkel, T. J. (2003) J. Biol. Chem. 278, 23699-23705
24. Braun, A., Zhang, S., Miettinen, H. E., Ebrahim, S., Holm, T. M., Vasile, E., Post, M. J.,
Yoerger, D. M., Picard, M. H., Krieger, J. L., Andrews, N. C., Simons, M., and Krieger,
M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 7283-7288
25. Ji, Y., Wang, N., Ramakrishnan, R., Sehayek, E., Huszar, D., Breslow, J. L., and Tall, A.
R. (1999) J. Biol. Chem. 274, 33398-33402
26. Yesilaltay, A., Morales, M. G., Amigo, L., Zanlungo, S., Rigotti, A., Karackattu, S. L.,
Donahee, M. H., Kozarsky, K. F., and Krieger, M. (2006) Endocrinology147, 1577-1588
27. Ueda, Y., Royer, L., Gong, E., Zhang, J., Cooper, P. N., Francone, 0., and Rubin, E. M.
(1999) J. Biol. Chem. 274, 7165-7171
28. Holm, T.M., Braun, A., Trigatti, B.L., Brugnara, C., Sakamoto, M., Krieger, M.,
Andrews, N.C. (2002) Blood. 99, 1817-1824
29. Meurs, I., Hoekstra, M., van Wanrooij, E.J., Hildebrand, R.B., Kuiper, J., Kuipers, F.,
Hardeman, M.R., Van Berkel, T.J., Van Eck, M.. (2005). Exp. Hematol. 33, 1309-19
30. Miettinen, H.E, Rayburn, H., Krieger, M. (2001) J Clin Invest. 108, 1717-1722
31. Ikemoto, M., Arai, H., Feng, D., Tanaka, K., Aoki, J., Dohmae, N., Takio, K., Adachi,
H., Tsujimoto, M., Inoue, K. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6538-6543
32. Kocher, O., Yesilaltay, A., Cirovic, C., Pal, R., Rigotti, A., Krieger, M. (2003) J. Biol.
Chem. 278, 52820-52825
33. Kocher, O., Comella, N., Tognazzi, K., Brown, L. (1998) Lab. Invest. 78, 117-125
34. Yesilaltay, A., Kocher, O., Rigotti, A,. Krieger, M. (2005) Curr. Opin. Lipidol. 16,
147-52
35. Nakamura, T., Shibata, N., Nishimoto-Shibata, T., Feng, D., Ikemoto, M., Motjima, K.,
Iso-o, N., Tsukamoto, K., Tsujimoto, M., Arai, H. (2005) Proc. Natl. Acad. Sci. U.S.A.
102, 13404-13409
36. Silver, D.L. (2002) J. Biol. Chem. 277, 34042-34047
37. Webb, N.R., de Villiers, W.J., Connell, P.M., de Beer, F.C., van der Westhuyzen, D.R.
(1997) J. Lipid Res. 38, 1490-1495
38. Webb, N.R., Connell, P.M., Graf, G.A., Smart, E.J., de Villiers, W.J.S., de Beer, F.C.,
van der Westhuyzen, D.R. (1998) J. Biol. Chem. 273, 15241-15248
39. Eckhardt, E.R., Cai, L., Shetty, S., Zhao, Z., Szanto, A., Webb, NR., Van der
Westhuyzen, D.R. (2006) J. Biol. Chem. 281, 4348-53
40. Eckhardt, E.R., Cai, L., Sun, B., Webb, N.R., van der Westhuyzen, D.R. (2004) J. Biol.
Chem. 279, 14372-81
41. Zhang, X., Moor, A.N., Merkler, K.A., Liu, Q., McLean, M.P. (2007) Endocrinology
148, 5295-304
42. Hung, A.Y., Sheng, M. (2002) J. Biol. Chem. 277, 5699-702
43. Yesilaltay, A., Kocher, O., Pal, R., Leiva, A., Quinones, V., Rigotti, A., Krieger, M.
(2006) J. Biol. Chem. 281, 28975-80
44. Wang, P., Wang, J. J., Xiao, Y., Murray, J.W., Novikoff, P.M., Angeletti, R.H., Orr,
G.A., Lan, D., Silver, D.L., Wolkoff, A.W. (2005). J. Biol. Chem. 280, 30143-9
45. Simonet, W. S., Bucay, N., Lauer, S. J., and Taylor, J. M. (1993) J. Biol. Chem. 268,
8221-8229
46. Palmiter, R. D., and Brinster, R. L. (1986) Annu. Rev. Genet. 20, 465-499
47. Kocher, O., Pal, R., Roberts, M., Cirovic, C., and Gilchrist, A. (2003) Mol. Cell. Biol. 23,
1175-1180
48. Guo, Q., Penman, M., Trigatti, B.L., Krieger, M. (1996) J. Biol. Chem. 271,
11191-11196
49. Babitt, J., Trigatti, B., Rigotti, A., Smart, E.J., Anderson, R.G., Xu, S., Krieger, M.
(1997) J. Biol. Chem. 272, 13242-9
50. Vinals, M., Xu, S., Vasile, E., Krieger, M. (2003) J. Biol. Chem. 278, 5325-5332
51. Maley, F., Trimble, R.B., Tarentino, A.L., Plummer, T.H., Jr. (1989) Anal. Biochem. 180:
195-204
Footnotes
We thank Joel Lawitts from the BIDMC transgenic facility, S. Xu for generating and
112 antibody, and H. Lodish and D. Sabatini for helpful
characterizing the anti-mSR-BI 495discussions. Supported by grants from the National Institutes of Health to OK (HL077780) and
MK (HL64737, HL52212 and HL66105) and FONDECYT to AR (1070634).
* Abbreviations used are: HDL, high density lipoprotein; SR-BI, scavenger receptor, class B,
type I; LDL, low density lipoprotein; UC, unesterified cholesterol; TC, total cholesterol; PDZ,
postsynaptic density protein (PSD-95)/Drosophila disc large tumor suppressor (dlg)/tight
junction protein (ZO 1); Tg, transgenic; KO, knockout; FPLC, fast performance liquid
chromatography; apoE, apolipoprotein E; apoC-I, apolipoprotein C-I, VLDL, very low density
lipoprotein; IDL, intermediate density lipoprotein.
Chapter Three
HEPATIC CELL-SURFACE LOCALIZATION OF
THE HIGH-DENSITY LIPOPROTEIN RECEPTOR,
SR-BI, IS CONTROLLED BY THE FIRST THREE
PDZ DOMAINS OF PDZK1
Sara A. Fenske1, Ayce Yesilaltay', Rinku Pal 2, Kathleen Daniels 2, Caroline Barker', Attilio Rigotti 3,
Monty Krieger' and Olivier Kocher 2
From the 'Department of Biology, Massachusetts Institute of Technology, Room 68-483, 77
Massachusetts Avenue, Cambridge, MA 02139, 2 Department of Pathology, Beth IsraelDeaconess Medical Center and Harvard Medical School, 330 Brookline Avenue, Boston, MA
02215, 3Departamento de Gastroenterologia, Facultad de Medicina, Pontificia Universidad
Catdlica, Marcoleta 367, Santiago, Chile
This chapter will serve as the first draft of a manuscript to be submitted for publication. I
contributed the text and figures 1, 2, 4, and 5. All transgenic and non-transgenic mice were
generated by Olivier Kocher and technicians in his lab at the Beth Israel-Deaconess Medical
Center and Harvard Medical School (Rinku Pal, Kathleen Daniels). Olivier Kocher performed
the immunohistochemical analysis of SR-BI localization. Caroline Barker and Ayce Yesilaltay
helped with immunoblotting and sample preparation. Contributions to the Materials and Methods
section and figure legends were contributed by Olivier Kocher. Minor revisions to text were
contributed by Monty Krieger. All experiments were performed in the laboratories of Monty
Krieger and Olivier Kocher, who provided overall supervision. Attilio Rigotti also prepared
adenovirus expression vectors for many of the constructs described in this manuscript and I used
these to generate large-scale preps of these viruses. However, the stable transgenic animals
became available more quickly than expected, so they were used rather than the adenoviruses for
most studies.
Abstract
PDZK1 is a four PDZ domain-containing scaffold protein that binds to the C-terminus of
scavenger receptor class B, type I (SR-BI), the high-density lipoprotein (HDL) receptor, by its
first PDZ domain (PDZ I). Loss of PDZK1 expression in PDZK1 knockout (KO) mice leads to a
post-transcriptional, tissue-specific decrease in SR-BI protein level and an increase in total
plasma cholesterol carried in abnormally large HDL particles, which can be reversed by hepatic
PDZK1 transgene expression. Transgenic overexpression of only the PDZ 1 domain of PDZK1 in
the liver is sufficient to partially restore SR-BI abundance, but the SR-BI protein is mislocalized
intracellularly and therefore does not restore normal SR-BI function in PDZK1 KO mice,
indicating that other structural features of PDZK1 are necessary for normal SR-BI function. To
further elucidate the roles that various features of PDZK1 play in regulating hepatic SR-BI
function, we explored the effects that transgenic expression of three truncation mutants of
PDZK1 have on hepatic SR-BI protein abundance, localization and function. Overexpression of
pTEM-Tg, which excludes the three C-terminal most amino acids that compose a putative PDZbinding motif, was able restore normal hepatic SR-BI function in PDZK1 KO mice, indicating
that this motif is not necessary. As was the case for the PDZ 1-Tg, expression of a transgene
encoding a truncated protein containing the first and second PDZ domains (PDZ1.2-Tg) in
PDZK1 KO mice was not able to restore hepatic SR-BI cell-surface localization or function in
PDZK1 KO mice, but was able to partially restore SR-BI abundance. Expression of a transgene
encoding the first, second and third PDZ domains (PDZ1.2.3-Tg) in PDZK1 KO mice resulted in
partial restoration of SR-BI protein abundance and the expression of some of the restored SR-BI
protein on the cell surface. As a consequence there was partially restored SR-BI function in these
PDZ 1.2.3-Tg mice, as demonstrated by a small, but statistically significant, decrease in their
abnormally high plasma cholesterol levels. Thus, we conclude that the first three PDZ domains
of PDZK1 are able to control the localization, and therefore function, of hepatic SR-BI; but that
other structural features C-terminal to this domain in PDZK1 are required for normal SR-BI
function.
Introduction
SR-BI (scavenger receptor, class B, type I) plays a significant role in lipoprotein metabolism
as the high-density lipoprotein (HDL) receptor (1). Through a mechanism called selective
uptake, (3, 8-10), SR-BI mediates the uptake of cholesteryl esters from HDL and other
lipoproteins into cells (2-7), as well as the bi-directional movement of unesterified cholesterol
between cells and lipoproteins (11-14).
SR-BI is most highly expressed in the liver and steroidogenic tissues, which exhibit the
highest levels of HDL selective cholesterol uptake (3). Deficiency of SR-BI in SR-BI knockout
(KO) mice leads to elevated (-2.2-fold) plasma cholesterol levels, transported in abnormally
large HDL particles with an unesterified cholesterol: total cholesterol ratio roughly double that of
wild-type (WT) mice (19, 21). This dyslipidemia is a consequence of the reduced uptake of
cholesterol from plasma HDL by the liver, and can be reversed by hepatic SR-BI transgene
expression (26, 25, 27, 15).
The intracellular protein, PDZK1, has been shown to interact directly with SR-BI to
influence its function (31). PDZK1 regulates SR-BI expression in a tissue specific, posttranscriptional manner (32). PDZK1 is most highly expressed in the kidney and, like SR-BI, is
expressed in the liver and intestines; but has very low expression in the steroidogenic tissues, in
which SR-BI is abundantly expressed (3,31). PDZK1 KO mice show a dramatic, > 95%
reduction in hepatic SR-BI protein levels, a partial decrease in SR-BI abundance in the small
intestine, but no change in steroidogenic tissues (32). Due to this dramatic decrease in hepatic
SR-BI protein levels, PDZK1 KO mice exhibit abnormally high plasma cholesterol (-1.7-fold),
which is transported in abnormally large HDL particles (32). This effect on plasma lipoprotein
metabolism in PDZK1 KO mice is similar to, though not as severe as, those changes found in
SR-BI KO mice (19). We have previously demonstrated that hepatic overexpression of a murine
SR-BI transgene in SR-BI/PDZK1 double knockout mice results in cell-surface expression and
normal function of SR-BI (45). Therefore, SR-BI is able to function normally without PDZK1
provided it is localized on the cell-surface at steady state levels similar to those in wild-type
hepatocytes (45). However, the mechanism by which PDZK1 regulates hepatic SR-BI abundance
and/or localization in nontransgenic animals remains unclear.
PDZK1 is a four PDZ-domain containing scaffold protein (Fig lA, top) that binds to the
carboxy termini of numerous membrane-associated transporter proteins, including ion channels
(e.g., CFTR) and cell surface receptors (33, 34). Its N-terminal most PDZ domain, PDZ1, binds
to the C-terminus of SR-BI (31, 36), but ostensibly not to SR-BII, a minor, alternatively-spliced
form of SR-BI whose 39 residue C-terminal sequence differs from that of SR-BI (32,37-41, 44).
Deletion of SR-BI's final C-terminal amino acid abolishes its interaction with the PDZ 1 domain
of PDZK1 (36).
Previously, we showed that hepatic overexpression of full-length PDZK1 in PDZK1deficient mice restored normal hepatic SR-BI protein levels and function, but had little, if any,
effect on hepatic SR-BI in WT mice (42). However, hepatic overexpression of a truncated
mutant of PDZK1, comprising primarily the PDZ I1domain of PDZK1, was not sufficient to
restore normal SR-BI function in PDZK1 KO mice. In WT mice, overexpressing the PDZl
domain in hepatocytes resulted in plasma lipoproteins that resembled those in PDZK1 KO mice
(hypercholesterolemia, large HDL), due to a 75% reduction in hepatic SR-BI protein levels, and
intracellular mislocalization of the remaining SR-BI protein (42). These results suggested that
the PDZ 1 domain can control both the abundance and intracellular localization of hepatic SR-BI
and that normal regulation of SR-BI by PDZK1 is likely to require that its other structural
features interact with other, as yet unidentified, cellular components.
The three PDZ domains C-terminal to PDZ (PDZ2, PDZ3, and PDZ4), and PDZKI's 66
residue C-terminal tail (Figure lA) are apparently not involved in direct binding to SR-BI (31,
33). The role(s) of these features in the regulation of hepatic SR-BI are unknown. It is possible
that PDZ2, PDZ3 and/or PDZ4 bind to other, as yet unidentified, cellular components involved
in SR-BI regulation. Other hepatic proteins (such as OATPlA1, (46)) have been shown to
interact with PDZKI's PDZ domains. Nakamura et al have shown that PDZKI's C-terminus and
its phosphorylation are required for optimal PDZK1-transgene mediated induction of increased
SR-BI protein levels in cultured cells (35). Additionally, PDZK1 has a putative PDZ-interacting
motif at its C-terminus (the final three residues: Thr - Glu - Met) (31,33). PDZK1 is known to
form heterodimers with other PDZ proteins (NHERF 1, NHERF2), through interactions between
PDZKI's PDZ domains and the target proteins' C-termini (43). It is conceivable that PDZK1
might form hetero- or homodimers through this PDZ-binding motif.
Here we have analyzed the impact of the PDZ2 and PDZ3 domains, and the C-terminal
putative PDZ-binding motif of PDZK1 on the abundance, localization, and function of hepatic
SR-BI in vivo. We compared the effects of expressing three transgenes encoding the following
PDZK1 truncation mutants in WT and PDZK1 KO mice: PDZ1.2 (primarily composed of the
first, which binds the C-terminus of SR-BI, and the second PDZ domains of PDZK1), PDZ1.2.3
(primarily composed of the first, second, and third PDZ domains of PDZK1) and pTEM
(composed of the entire PDZK1 protein, except for the final three amino acids, TEM). We found
that hepatic overexpression of pTEM-Tg in PDZK1 KO mice restored normal hepatic SR-BI
protein levels and function, and had little effect on SR-BI function in WT mice. Hepatic
expression of PDZ1.2-Tg did not affect SR-BI abundance or function in WT mice. In PDZK1
KO mice, the PDZ1.2 protein acted similarly to the PDZ1 protein in that SR-BI protein levels
were partially restored, though the SR-BI protein was mislocalized intracellularly, resulting in no
change in plasma cholesterol levels. Hepatic expression (8-fold overexpression) of PDZ1.2.3-Tg
in WT mice did not change SR-BI expression or function. However, in PDZK1 KO mice,
expression of PDZ1.2.3-Tg resulted in a small decrease in plasma cholesterol levels. This was
accompanied by an increase in hepatic SR-BI protein levels, and at least a partial restoration of
steady-state SR-BI cell surface localization. Our results suggest that the first three domains of
PDZK1 play a role in the proper localization of SR-BI on the cell surface, but that other
structural features of the PDZK1 protein between the PDZ3 domain and the final three amino
acids of PDZK1 are required for normal regulation of hepatic SR-BI function.
Experimental Procedures
Generation of PDZ1.2, PDZ1.2.3, and pTEM transgenic mice: PDZ1.2, PDZ1.2.3, and
pTEM transgenic mice were generated using the pLIV-LE6 plasmid, kindly provided by Dr.
John M. Taylor (Gladstone Institute of Cardiovascular Disease, University of California, San
Francisco). The pLiv-LE6 plasmid contains the promoter, first exon, first intron, and part of the
second exon of the human apoE gene, and the polyadenylation sequence, and a part of the
hepatic control region of the apoE/C-I gene locus (47).
To generate PDZ1.2 transgenic mice, a 700 bp DNA fragment containing the first 220 amino
acids of murine PDZK1 was subcloned between the KpnI and XhoI sites of the pLIV-LE6
plasmid. To generate PDZ 1.2.3 transgenic mice, a 1.1 kilobase (kb) DNA fragment containing
the first 359 amino acids of PDZK1 was subcloned between the KpnI and XhoI sites of the pLIVLE6 plasmid. To generate pTEM transgenic mice, a 1.6 kb DNA fragment containing the first
516 amino acids of PDZK1 (the entirety of murine PDZK1 except for the last 3 amino acids) was
subcloned between the KpnI and XhoI sites of the pLIV-LE6 plasmid. The sequences of the
resulting plasmids were confirmed by DNA sequencing. The new constructs harboring the
PDZ 1.2, PDZ1.2.3, and pTEM genes, as well as the above-mentioned apoE/apoC-I control locus
elements, were linearized by Sacll/Spel digestion and the resulting 5.7 kb (PDZ1.2), 6.1 kb
(PDZ1.2.3), and 6.6 kb (pTEM) fragments were used to generate transgenic mice using standard
procedures (48).
Founder animals for the PDZ1.2, PDZ1.2.3, and pTEM transgenes in an FVB/N genetic
background were identified by PCR performed on tail DNA using the following oligonucleotide
primers: for the PDZ1.2 and PDZ 1.2.3 transgenes, one primer corresponding to the PDZK1
cDNA sequence (CAATGGTGTCTTTGTCGACAAG) and one corresponding to the 3'-end of
the human apoE gene sequence included in the cloning vector
(AGCAGATGCGTGAAACTTGGTGA); for the pTEM transgene, one primer corresponding to
the PDZK1 cDNA sequence (GAGGCAGCTGGCTTGAAGAAC) and the same 3'-primer used
for the PDZ1.2 and PDZ1.2.3 transgenes. Founders expressing the PDZ1.2, PDZ1.2.3, or pTEM
transgenes were crossed with PDZK1 KO mice (129SvEv background). Heterozygous pups
expressing the PDZ 1.2, PDZ1.2.3, or pTEM transgene were crossed with WT and PDZK1 KO
mice to obtain mice with PDZ1.2, PDZ1.2.3, or pTEM transgene expression and non-transgenic
WT and PDZK1 KO control mice, thus ensuring that the mixed genetic backgrounds of
experimental and control mice in each founder line are matched. PDZK1 KO mice were
genotyped as previously described (49).
We previously published that transgene expression using the pLiv-LE6 vector leads to liver
and kidney specific expression, with higher expression in the liver. Expression of full-length
PDZK1 and a truncation mutant had no effect on the undetectable level of SR-BI in the kidney
(42).
Animals: All mice on a 25:75 FVB/N: 129SvEV genetic background were maintained on a
normal chow diet (49) and -6-15 week old male mice were used for experiments. Three
independent founder lines for each of the transgenes - pTEM-Tg, PDZ1.2-Tg, and PDZ1.2.3-Tg -
were generated, all showing similar effects on plasma cholesterol levels within each transgene
set. Observations from animals derived from two of the three pTEM-Tg, PDZ1.2-Tg, and
PDZ1.2.3-Tg expressing founders were pooled because plasma cholesterol and SR-BI protein
abundance and localization results were virtually identical. All procedures on transgenic and
non-transgenic mice were performed in accordance with the guidelines of the Beth Israel
Deaconess Medical Center and the Massachusetts Institute of Technology Committee on Animal
Care.
Blood and tissue sampling, processing, and analysis: Plasma and liver samples were collected
and processed and total plasma cholesterol levels and individual size fractionated fast
performance liquid chromatography (FPLC) cholesterol profiles were obtained as previously
described (42). Results of total plasma cholesterol data from founders with similar plasma
cholesterol levels (see above) were pooled.
For immunoblotting, protein samples (-30 or 10 tg) from total liver lysates were fractionated
by SDS-PAGE, transferred to polyvinylidene difluoride membranes and incubated with either a
rabbit polyclonal anti-SR-BI antipeptide antibody (mSR-B1495'11 2) (1:1000) or a rabbit polyclonal
anti-PDZK1 antipeptide antibody (1:20000) (42), followed by an anti-rabbit IgG conjugated to
horseradish peroxidase (Invitrogen, 1:10000), and visualized by ECL chemiluminescence (GE
Healthcare/Amersham, #RPN2132). Immunoblotting using polyclonal anti-E-COP (1:5000) (50)
antibody was used as loading control. The relative amounts of proteins were determined by
quantitation using a Kodak Image Station 440 CF and Kodak 1D software. Multiple independent
determinations of band intensities from serially diluted samples were made to ensure that the
intensities were both in the linear range of the detector and reproducible.
Immunoperoxidase analysis: Livers were harvested, fixed, frozen, and 5 [Im sections were
stained with the anti-mSR-B1495 -112 antibody and biotinylated anti-rabbit IgG, visualized by
immunoperoxidase staining, and counterstained with Harris modified hematoxylin, as described
previously (32).
Statistical Analysis: Data are shown as the means _ standard deviation. Statistically significant
differences were determined by either pairwise comparisons of values using the unpaired t test,
with (if variances differed significantly) or without Welch's correction, or by one-way ANOVA
followed by the Tukey-Kramer multiple comparison post-test when comparing three or more sets
of data to each other. Mean values for experimental groups are considered statistically
significantly different for P < 0.05 for both types of tests.
Results
To determine the effects of expressing three truncated forms (PDZ1.2, PDZ1.2.3, and pTEM)
of the PDZK1 protein on hepatic SR-BI protein levels and function, we generated three cDNA
constructs that encoded the N-terminus and PDZ1 and PDZ2 domains ('PDZ 1.2-Tg'), or the Nterminus and PDZ1, PDZ2, and PDZ3 domains ('PDZ1.2.3-Tg'), or the entire PDZK1 protein
except for the last three amino acids comprising a putative PDZ-binding motif ('pTEM-Tg'
(Figure lA). These constructs were used to generate transgenic mice with liver and kidneyspecific expression in both wild-type (WT [PDZ1.2-Tg], WT [PDZ1.2.3-Tg], WT [pTEM-Tg])
and PDZK1 knock-out (PDZK1 KO [PDZ1.2-Tg], PDZK1 KO [PDZ1.2.3-Tg], or PDZK1 KO
[pTEM-Tg]) mice on a mixed FVB/129SvEv background. In a previous report, we found that
transgene expression of full-length and a dominant-negative truncated form of PDZK1 (PDZ 1) in
the kidney did not alter the undetectable levels of SR-BI in this organ (42), and therefore is
unlikely to affect SR-BI in these cases either.
Hepatic levels of PDZK1, PDZ 1.2, PDZ 1.2.3 and pTEM proteins in nontransgenic and
transgenic mice from two founders each were determined by immunoblotting (typical result in
Figure 1B). Estimations of transgenic protein levels compared to levels of endogenous PDZK1 in
WT nontransgenic mice were made from multiple immunoblots. The steady-state levels of
transgene-encoded proteins in PDZ1.2-Tg expressing mice were 5.5 t 1.6-fold (founder line
833) and 1.3 + 0.3-fold (founder line 836) higher than the endogenous levels of PDZK1 in
nontransgenic WT mice (Figure 1B, lanes 3 and 4, and top right-hand panels). In PDZ1.2.3-Tg
expressing mice, the steady-state levels of transgenic protein were 7.9 . 3.4-fold higher than
(founder line 644) and 17% _ 3% (959 founder line) of endogenous PDZK1 levels in
nontransgenic WT mice (Figure IB, lanes 5 and 6, and middle right-hand panels). In pTEM-Tg
expressing mice, the transgenic protein is expressed 44.3 t 10.5-fold higher (founder line 6656)
and 24.6 ± 6.2-fold (founder line 6658) higher than endogenous PDZK1 levels in nontransgenic
WT mice (Figure IB, lanes 7 and 8, and bottom right-hand panels). Analysis by immunoblotting
also showed that the levels of endogenous hepatic PDZK1 in WT [PDZ1.2-Tg] were slightly, but
statistically significantly, lower than those in nontransgenic WT mice (69 ± 14% of WT levels of
endogenous PDZK1, P = 0.0176), and in WT [PDZ1.2.3-Tg] mice, PDZK1 levels were similar
to those in nontransgenic WT mice (98 _ 22% of WT levels of endogenous PDZK1, P = 0.7534).
Thus overexpression of PDZ1.2-Tg, but not PDZ1.2.3-Tg, appears capable of affecting
endogenous PDZK1 levels via an unknown mechanism.
A. Full-length and Truncated PDZK1 Proteins
Truncation Mutants:
%C
PDZK1
(SR-Bl
Bldlng
I
220
PDZ1.2 1
-C
1Q_
1
I
~PDZ1.2.3
-C
N
359
36
I
pTEM N
A38w
B. Hepatic expression of proteins
IKo I
PD
Transgene:
PDZI
none
W
I
Genotype:
PDZ1.2
PDZ1.2.3
pTEM
KO WT IKO WT KO WT
Foundr
kDa
I
Ko
-KO
PDZ1.2
-ts
PDZKI or
pTEM
644
969
WV
PZ1.23
*t·l
8-COPW
PDZ1.2
4
:1
-
-COP
_-
-15
83
Founder:
Expmeaion
Lawn:
833
1 (Wr)
1
2
644
5.5*1.6
7.9* 3.4
3
5
4
oundwr: I
ee
ame
6656
6
44.3*10.5
7
I8
-COP
Fig. 1. Hepatic expression of PDZ1.2, PDZ1.2.3 and pTEM transgenes. A, Schematic
diagrams of the proteins encoded by the PDZ1.2 (top), PDZ1.2.3 (middle), and pTEM (bottom)
transgenes. B, Immunoblot analysis of hepatic expression of PDZ1.2, PDZ1.2.3, and pTEM
proteins in PDZl.2, PDZ1.2.3, and pTEM transgenic mice. Hepatic protein levels are shown in
nontransgenic wild-type (WT) and PDZK1 knockout (KO) mice (lanes 1 and 2), WT [PDZ1.2Tg] and PDKZI KO [PDZ1.2-Tg] mice (lanes 3 and 4), WT[PDZ1.2.3-Tg] and PDZK1 KO
[PDZ1.2.3-Tg] mice (lanes 5 and 6), and WT [pTEM-Tg] and PDZK1 KO [pTEM-Tg] mice
(lanes 7 and 8, left panel). Liver lysates from mice with the indicated genotypes and transgenes
(10 ýtg of protein per lane) were analyzed by immunoblotting, and the bands corresponding to
PDZK1 (-60 kDa), PDZl.2 (~26 kDa), PDZl.2.3 (~37 kDa), or pTEM (-60 kDa) were
visualized by chemiluminescence. Size markers are indicated on the right. e-COP (-34 kDa
band) was used as a loading control. Comparisons of transgene expression levels between
multiple founders for each transgene are shown in the panels on the right. PDZ1.2-Tg expression
(top right panels) is 5.5 t 1.6-fold (founder line 833) and 1.3 ± 0.3-fold (founder line 836) higher
than endogenous levels of PDZK1 in non-transgenic WT livers. PDZ1.2.3-Tg expression (middle
right-hand panels) is 7.9 t 3.4-fold (founder line 644) higher than WT endogenous levels of
PDZK1 and 17% t 3% (founder line 959) of WT endogenous levels of PDZK1. pTEM-Tg
expression (bottom right-hand panels) is 44.3 ± 10.5-fold (founder line 6656) and 24.6 + 6.2-fold
(founder line 6658) higher than WT endogenous levels of PDZK1. Replicate experiments with
multiple exposures and sample loading were used to determine the relative levels of expression
of these proteins. Samples shown in adjacent panels were all from a single exposure of a single
gel, but reordered for clarity of presentation. *Indicates background bands seen in all samples.
Effects of the pTEM-Tg on hepatic SR-BI expression and lipoprotein metabolism: In
WT mice, hepatic overexpression of pTEM resulted in no statistically significant change in
steady-state levels of SR-BI in either founder (immunoblotting, Figure 2A, top half of the panel).
As in non-transgenic WT mice, the majority of the steady-state SR-BI protein was localized on
the cell surface in both founders (immunohistochemistry, representative image in Figure 3C). In
WT [pTEM-Tg] mice, there was a small, but statistically significant, decrease in plasma
cholesterol levels compared to non-transgenic controls when cholesterol values from both
founders were combined (Figure 2B, left panel). A similar, but not statistically significant,
decrease was seen in each of the founders individually. No change was observed in the size
distribution of lipoproteins (FPLC lipoprotein cholesterol profiles), in which the bulk of the
cholesterol was found in normal-sized HDL particles (Figure 2C, white and gray circles). These
results suggest that the very high overexpression of the pTEM-Tg in WT mice results in a slight
increase in SR-BI function; however further studies would be required to test this.
In PDZK1 KO mice, hepatic overexpression of pTEM corrected the previously reported
abnormal phenotypes related to SR-BI and lipoprotein metabolism. In PDZK1 KO mice the
pTEM-Tg restored the steady-state abundance of hepatic SR-BI protein from <5% of wild-type
(32) to normal wild-type levels (immunoblotting, Figure 2A, bottom half of the panel), which
was properly localized on the surfaces of the hepatocytes (immunohistochemistry, representative
image in Figure 3D). Consequently, in PDZK1 KO mice, the pTEM-Tg restored plasma
cholesterol levels from the -1.7-fold elevation seen in nontransgenic PDKZ1 KO mice to those
in seen in wild-type controls (Figure 2B, right panel). The pTEM-Tg also restored the lipoprotein
size distribution in PDZK1 KO [pTEM-Tg] from that with abnormally large HDL particles in the
nontransgenic PDZK1 KO animals to that with normal-sized HDL seen in the nontransgenic WT
mice (Figure 2C, black and gray squares). Note that the peak in the PDZK1 KO sample is shifted
to the left relative to that in WT plasma, indicating larger lipoprotein particles. Therefore,
overexpression of pTEM leads to normal SR-BI protein levels in both WT and PDZK1 KO mice,
and fully complements the PDZK1 deficiency in PDZK1 KO mice with respect to hepatic SR-BI
protein levels, cellular localization and function in lipoprotein metabolism. This indicates that the
final three amino acids (TEM), a putative PDZ-interacting motif, are not required for apparently
normal PDZKl-mediated SR-BI protein expression, localization, and function.
A. pTEM-Tg SR-BI protein levels
B. pTEM-Tg Plasma Cholesterol
WT
KO
n=14
200.
n=14 n=19*
n=14
100.
pTEM-Tg:
-
r
- I + I
I
- I
C. pTEM-Tg Upoprotein Cholesterol Profiles
VLDL
30
IDLLDL
I
I
i
HDL
25
20
0a
O 15
0
WT +pTEM-Tg
10+KO
3I KO +
pTEM-Tg
5
0
w
- --·---
r-----r------
5
9
r-
V
- · 7 - - -r~
~- I - - - · --
- ·-
' - ·-
-
~T -
13 17 21 25 29 33 37 41
Fraction Number
Fig. 2. Effects of expression of the pTEM transgene on hepatic SR-BI protein levels (A) and
plasma lipoprotein cholesterol (B and C) in WT and PDZK1 KO mice.
A, Liver lysates (-30 ýtg of protein) from mice with the indicated genotypes, with (+) or
without (-) the pTEM transgene, were analyzed by immunoblotting, and SR-BI (~82 kDa band)
was visualized by chemiluminescence. e-COP (~-34 kDa) was used as a loading control.
Replicate experiments with multiple exposures and sample loading were used to determine the
relative levels of expression of SR-BI. WT and WT [pTEM-Tg] samples shown were all from a
single gel, but reordered for clarity of presentation. B and C, Plasma was harvested from mice
with the indicated genotypes and pTEM transgene. B, Total plasma cholesterol levels were
determined in individual samples by enzymatic assay, and results from the indicated numbers of
animals (n) were pooled by genotype. Independent WT and KO control animals for each founder
line were generated to ensure that the mixed genetic backgrounds for experimental and control
mice were matched. * Indicates the PDZK1 KO plasma cholesterol levels were statistically
significantly different (P < 0.001) from those plasma cholesterol levels of WT, WT
[pTEM-Tg],
and PDZK1 KO [pTEM-Tg] mice. * Indicates that the WT [pTEM-Tg] plasma cholesterol levels
were statistically significantly different from those plasma cholesterol levels of WT
(P < 0.05),
PDZK1 KO (P< 0.001), and PDZK1 KO[pTEM-Tg] (P < 0.001) mice. C, Plasma samples
(harvested as in panel B) from individual animals were size-fractionated by FPLC, and the total
cholesterol content of each fraction was determined by an enzymatic assay. The chromatograms
are representative of multiple individually determined profiles. Approximate elution positions of
native VLDL, IDL/LDL and HDL particles are indicated by brackets and were determined as
previously described (19).
Fig. 3. Immunohistochemical analysis of hepatic SR-BI in WT and PDZK1 KO
nontransgenic (A and B), pTEM transgenic (C and D), PDZ1.2 transgenic (E and F), and
PDZ1.2.3 transgenic mice.
Livers from mice of the indicated genotypes and transgenes were fixed, frozen and sectioned.
The sections were then stained with a polyclonal anti-SR-BI antibody, and a biotinylated antirabbit IgG secondary antibody and visualized by immunoperoxidase staining. (Magnification
x600). The images shown of staining in transgenic animals come from the following founder
lines: panel C and D - 6656, panel E - 836, panel F - 833, panel G and H - 644. Images are
representative of the staining patterns observed in all founder lines for each transgene.
Effects of the PDZ1.2-Tg and the PDZ1.2.3-Tg on lipoprotein metabolism and hepatic
SR-BI expression: In WT mice, we found that hepatic expression of PDZ1.2-Tg and PDZ1.2.3Tg did not lead to a statistically significant change in plasma cholesterol levels (Figures 4B and
5B, left panels) or the size distributions of lipoproteins (FPLC lipoprotein cholesterol profiles,
Figures 4C and 5C, white and gray circles). This suggested that these transgenes might not alter
SR-BI activity in WT mice. Indeed, when we examined the effects of the PDZ1.2-Tg and the
PDZ1.2.3-Tg on hepatic SR-BI protein abundance [immunoblotting analysis (Figures 4A and
5A, top half of the panels)] and localization [immunohistochemistry, Figure 3E and G)] in WT
mice, we observed no affects in the transgenic WT mice on SR-BI relative to nontransgenic WT
mice.
In PDZK1 KO mice, -5-fold hepatic overexpression of the truncated PDZ1.2 protein in
founder line 833 and approximately endogenous levels of PDZ 1.2 in founder line 836 had
virtually no effect on the abnormally high plasma cholesterol levels (Figure 4B, right panel) or
the size distribution of lipoproteins (FPLC lipoprotein cholesterol profiles), in which the bulk of
the cholesterol was found in abnormally large HDL particles (Figure 4C, black and gray
squares). These results are similar to those observed for hepatic overexpression of the PDZ1
protein, which was not sufficient to restore normal SR-BI function in PDZK1 KO mice (42).
However, -8-fold overexpression of PDZ1.2.3-Tg in founder line 644 and expression of
PDZ1.2.3-Tg at 17% of endogenous levels of PDZK1 in founder line 959 led to a small decrease
in the abnormally high plasma cholesterol levels (Figure 5B, left panel), though this change was
not discernable in the size distribution of lipoproteins (FPLC lipoprotein cholesterol profiles), in
which the bulk of the cholesterol was found in abnormally large HDL particles (Figure 5C, black
and gray squares). A virtually identical reduction in plasma cholesterol levels was observed in
both founder lines of PDZK1 KO [PDZ1.2.3-Tg] mice considered independently. However, this
reduction in cholesterol levels was not statistically significant in founder line 959, but was in
founder line 644 (P < 0.01) and the reduction was significant when cholesterol data from both
founders were combined (P < 0.001). Thus, the N-terminal PDZ 1 and PDZ2 domain-containing
region of PDZK1 is not sufficient to restore SR-BI function in PDZK1 KO mice, whereas protein
containing the first three PDZ domains of PDZK1 can partially restore SR-BI function.
When we examined hepatic SR-BI protein levels and abundance, we found that, even though
PDZ 1.2-Tg had virtually no effect on the abnormally high plasma cholesterol levels in PDZK1
KO mice, SR-BI protein levels in PDKZ1 KO mice expressing the PDZ1.2-Tg increased from
<5% to 12 ± 5% of nontransgenic WT levels (immunoblotting, Figure 4A, lower panel).
However, the majority of the detectable steady-state hepatic SR-BI protein in PDZK1 KO
[PDZ 1.2-Tg] mice was not localized on the cell surface, but was instead localized intracellularly
(immunohistochemistry, representative image in Figure 3F). This intracellular localization would
prohibit SR-BI function by preventing interaction with plasma HDL particles. These results in
PDZK1 KO [PDZl.2-Tg] mice are similar to those previously observed in PDZK1 KO [PDZ1Tg] mice (42), although the increase in intracellular SR-BI with the PDZ1.2-Tg was only about
half that with the PDZ1-Tg (12 _ 5% of WT in PDZK1 KO [PDZ1.2-Tg] versus 21 ± 6% of WT
in PDZK1 KO [PDZI-Tg].
In PDZK1 KO mice expressing the PDZ1.2.3-Tg, which exhibited a small decrease in plasma
cholesterol levels, we observed an increase in hepatic SR-BI abundance from < 5% to 30 ± 7%
of nontransgenic WT levels (immunoblotting, Figure 5A, lower panel). However, unlike
hepatocytes in PDZK1 KO [PDZ1-Tg] (42) and PDZK1 KO [PDZ1.2-Tg] (this study) mice, at
least some of the SR-BI protein in PDZK1 KO [PDZ1.2.3-Tg] hepatocytes can be seen on the
cell surface (immunohistochemistry, representative image in Figure 3H). This cell-surface
localization of SR-BI could account for the small decrease in plasma cholesterol levels that is
observed in PDZK1 KO mice expressing the PDZ1.2.3-Tg (Figure 5B). Thus, we conclude that
the first three PDZ domains of PDZK1, when expressed together on a truncated PDZK1 protein,
exhibit partial PDZK1 function in that PDZl.2.3 is not only able to partially restore SR-BI
abundance, as can PDZ1 and PDZ1.2, but also is able to restore partial cell-surface localization
of SR-BI, and therefore partial SR-BI function.
Fig. 4. Effects of expression of the PDZ1.2 transgene on hepatic SR-BI protein levels (A)
and plasma lipoprotein cholesterol (B and C) in WT and PDZK1 KO mice. A, Liver lysates
(-30 [tg of protein) from mice with the indicated genotypes, with (+) or without (-) the PDZl.2
transgene, were analyzed by immunoblotting, and SR-BI (-82 kDa band) was visualized by
chemiluminescence. E-COP (-34 kDa) was used as a loading control. Note the faint SR-BI band
in the nontransgenic PDZK1 KO lane. Replicate experiments with multiple exposures and
sample loading were used to determine the relative levels of expression of SR-BI. All bands in
adjacent panels were from a single gel. WT and WT [PDZ1.2-Tg] data were all from a single gel,
but reordered for clarity of presentation. B and C, Plasma was harvested from mice with the
indicated genotypes and PDZ1.2 transgene. B, Total plasma cholesterol levels were determined
in individual samples by enzymatic assay, and results from the indicated numbers of animals (n)
were pooled by genotype. Independent WT and KO control animals for each founder line were
generated to ensure that the mixed genetic backgrounds for experimental and control mice were
matched. t Indicates the nontransgenic WT plasma cholesterol levels were not statistically
significantly different from those plasma cholesterol levels of WT [PDZ1.2-Tg]. $ Indicates
PDZK1 KO plasma cholesterol levels were not statistically significantly different from those
plasma cholesterol levels of PDZK1 KO [PDZl.2-Tg] mice. WT and WT [PDZl.2-Tg] plasma
cholesterol levels were statistically significantly different (P < 0.01) from those plasma
cholesterol levels of PDZK1 KO and PDZK1 KO [PDZl.2-Tg] mice. C, Plasma samples
(harvested as in panel B) from individual animals were size-fractionated by FPLC, and the total
cholesterol content of each fraction was determined by an enzymatic assay. The chromatograms
are representative of multiple individually determined profiles. Approximate elution positions of
native VLDL, IDL/LDL and HDL particles are indicated by brackets and were determined as
previously described (19).
Fig. 5. Effect of expression of the PDZ1.2.3 transgene on hepatic SR-BI protein levels (A)
and plasma lipoprotein cholesterol (B and C) in WT and PDZK1 KO mice. A, Liver lysates
83
(~-30 [gg of protein) from mice with the indicated genotypes, with (+) or without (-) the PDZ1.2.3
transgene, were analyzed by immunoblotting, and SR-BI (-82 kDa band) was visualized by
chemiluminescence. e-COP (-34 kDa) was used as a loading control. Note the faint SR-BI band
in the nontransgenic PDZK1 KO lane. Replicate experiments with multiple exposures and
sample loading were used to determine the relative levels of expression of SR-BI. All samples in
adjacent panels shown were from a single gel. WT and WT [PDZl.2.3-Tg] samples shown were
all from a single gel, but reordered for clarity of presentation. B and C, Plasma was harvested
from mice with the indicated genotypes and PDZ1.2.3 transgene. B, Total plasma cholesterol
levels were determined in individual samples by enzymatic assay, and results from the indicated
numbers of animals (n) were pooled by genotype. Independent WT and KO control animals for
each founder line were generated to ensure that the mixed genetic backgrounds for experimental
and control mice are matched. * Indicates the nontransgenic PDZK1 KO plasma cholesterol
levels were statistically significantly different (P < 0.001) from those plasma cholesterol levels of
WT, WT [PDZl.2.3-Tg], and PDZK1 KO [PDZ1.2.3-Tg] mice. * Indicates PDZK1 KO
[PDZ1.2.3-Tg] plasma cholesterol levels were statistically significantly different (P< 0.001)
from those plasma cholesterol levels of WT, WT [PDZl.2.3-Tg], and PDZK1 KO mice. C,
Plasma samples (harvested as in panel B) from individual animals were size-fractionated by
FPLC, and the total cholesterol content of each fraction was determined by an enzymatic assay.
The chromatograms are representative of multiple individually determined profiles. Approximate
elution positions of native VLDL, IDL/LDL and HDL particles are indicated by brackets and
were determined as previously described (19).
Discussion
The first PDZ domain, PDZ1, of the cytoplasmic adaptor protein PDZK1 binds to the Cterminus of SR-BI and, as a consequence, PDZK1 controls hepatic SR-BI protein expression and
lipoprotein metabolism (31,32,36). However, the roles of the other PDZ domains and structural
features of PDZK1 in controlling SR-BI function are not well understood. Expression of the
truncation mutant pTEM (pTEM-Tg, Figure 1A) in the liver of PDZK1 KO mice corrects the
dramatic decrease in hepatic SR-BI protein levels and hypercholesterolemia. This indicates that
the putative PDZ-binding motif of PDZK1 is not necessary for PDZK1-dependent, normal SRBI expression and function. In WT mice, overexpression of pTEM-Tg resulted in a small
decrease in plasma cholesterol levels, possibly because of an increase in SR-BI activity, although
no difference in SR-BI protein levels was observed. It's not clear how pTEM-Tg overexpression
increased SR-BI activity nor how this might have been due to the absence of the PDZ-binding
motif. This putative increase in SR-BI activity was not observed when full-length PDZK1 was
overexpressed in wild-type (WT [PDZK1-Tg]) mice (42). However, the pTEM-Tg is expressed
at higher levels than the PDZKl-Tg was (25-44-fold versus 21-fold overexpression respectively)
(42). It is possible that PDZK1-Tg, if overexpressed at the same levels as was pTEM-Tg, might
give the same result. Similarly, due to the high overexpression of the pTEM protein, we cannot
draw any conclusion as to whether or not pTEM is as potent a regulator of SR-BI as PDZK1.
The substantial overexpression of pTEM in our transgenic animals relative to endogenous
PDZK1 in WT mice might have compensated for any intrinsic reduced activity due to the loss of
the three C-terminal residues.
When two transgenes encoding truncated forms of PDZK1 primarily comprising the SR-BIbinding PDZ1 domain and the second PDZ domain (PDZ1.2-Tg, Figure LA), or the first, second,
and third domains (PDZ1.2.3-Tg, Figure 1A) were expressed in WT mice, they exhibited no
dominant-negative activity. This result differs from that of the previously published PDZK1
truncation mutant, PDZ 1, which exhibited a dominant negative phenotype when overexpressed
in WT mice (42). However, PDZl.2-Tg expression levels (5.5 and 1.3-fold overexpression in the
two independent founder strains compared to endogenous PDZK1 levels) and PDZl.2.3-Tg
expression levels (7.9-fold overexpressed and 17% in the two independent founder strains
compared to endogenous levels of PDZK1) are much lower than that in PDZl-Tg expressing
mice (-24-fold overexpressed). It is possible that higher levels of PDZ1.2-Tg and/or PDZ1.2.3Tg overexpression might result in a dominant negative phenotype in WT mice, as their
transgenic expression levels may be too low to present such a phenotype. PDZ1.2-Tg expression
in WT mice did result in a small decrease in endogenous PDZK1 levels, but this decrease was
apparently not enough to affect SR-BI protein levels significantly. Whether the PDZ1.2-Tg
would be able to act as a dominant negative through this mechanism were it expressed at higher
levels is unknown. We did note that in some animals the SR-BI protein levels in WT [PDZ 1.2Tg] and WT [PDZ1.2.3-Tg] mice appeared lower than in nontransgenic WT mice, but mouse to
mouse variation were sufficiently large that the differences were not statistically significant.
When expressed in PDZK1 KO mice, the PDZ1.2.3-Tg was able to partially complement the
defect in SR-BI function, in that, as was the case with the PDZ1-Tg and PDZ 1.2-Tg, it partially
restored hepatic SR-BI protein abundance, but, unlike the PDZ -Tg and PDZ1.2-Tg, the
PDZ 1.2.3-Tg was also able to restore steady-state cell-surface localization of SR-BI, and
therefore reduce slightly, though significantly, the abnormally high plasma cholesterol levels.
These results suggest that the third PDZ domain of PDZK1, when expressed in the context of the
first two PDZ domains, can influence steady-state SR-BI cell-surface localization. It is possible
that an unknown cellular component that binds to the PDZ3 domain of PDZK1 is involved in
transporting SR-BI to the cell surface, maintaining stable SR-BI cell-surface localization and/or
preventing abnormally rapid removal of SR-BI from the cell surface.
These results also suggest that those portions of PDZK1 between the PDZ3 domain and the
C-terminus play an important role in controlling the abundance, localization and function of SRBI. PDZ1.2.3 was able to restore only partially SR-BI cell-surface localization, abundance and
function. It seems likely that other cellular components that interact with PDZK1 through the
PDZ4 domain or some feature of the C-terminal tail, such as the phosphorylation site on the Cterminus (35), are critical for normal SR-BI protein levels and function.
Previously, we have proposed several potential mechanisms by which binding of full-length
PDZK1 to SR-BI might influence both SR-BI protein abundance and intracellular localization
(42). For example, PDZK1 binding might inhibit degradation of hepatic SR-BI via one or more
mechanisms. PDZK1 might directly prevent access to proteolytic pathways (e.g. blocking
ubiquitination of the C-terminus of SR-BI and degradation by proteasomes). It might indirectly
prevent proteolysis by preventing delivery to sites of degradation by controlling SR-BI's
intracellular trafficking (e.g. promoting stable cell surface localization by directing post-medial
Golgi sorting to the cell surface, inhibiting endocytosis from the cell surface, or promoting
normal endocytic recycling back to the cell surface). These potential mechanisms are consistent
with our analyses of PDZK1 KO [PDZl-Tg] (42), PDZK1 KO [PDZ1.2-Tg], and PDZK1 KO
[PDZ1.2.3-Tg] mice.
In summary, PDZK1 appears to affect hepatic SR-BI protein levels through binding to SRBI's C-terminus and SR-BI localization, at least in part, through interactions involving its third
PDZ domain, possibly with other cellular components. However, interactions between structural
features on PDZKl, located between the PDZ3 domain and PDZKI's putative PDZ-binding
motif, and other cellular components appear to be critical for normal SR-BI function. Future
studies will be required to identify which structural features of PDZK1 are responsible for these
interactions, their putative cellular component binding partners, and the mechanism(s) by which
they cooperate with PDZK1 to control SR-BI's function.
References
1. Rigotti, A., Miettinen, H.E., Krieger, M. (2003) Endocr Rev. 24, 357-87
2. Acton, S. L., P. E. Scherer, et al. (1994). J. Biol. Chem. 269, 21003-9
3. Acton, S., A. Rigotti, Landshulz, K.T., Xu, S., Hobbs, H.H., Krieger, M. (1996) Science
271, 518-20
4. Out R, Kruijt JK, Rensen PC, Hildebrand RB, de Vos P, Van Eck M, Van Berkel TJ.
(2004) 279, 18401-6
5. Out R, Hoekstra M, de Jager SC, de Vos P, van der Westhuyzen DR, Webb NR, Van
Eck M, Biessen EA, Van Berkel TJ. (2005) J. Lipid Res. 46, 1172-81
6. Fu T, Kozarsky KF, Borensztajn J. (2003) J. Biol. Chem. 278, 52559-63
7. Van Eck M, Hoekstra M, Out R, Bos IS, Kruijt JK, Hildebrand RB, Van Berkel TJ.
(2008) J. LipidRes. 49, 136-146
8. Glass C, Pittman RC, Weinstein DW, Steinberg D. (1983) Proc.Natl. Acad. Sci. USA 80,
5435-5439
9. Stein Y, Dabach Y, Hollander G, Halperin G, Stein O. (1983) Biochim. Biophys. Acta.
752, 98-105
10. Reaven E, Chen YI, Spicher M, Azhar S. (1984) J Clin. Invest. 74, 1384-1397
11. Ji, Y., Jian, B., Wang, N., Sun, Y., de la Llera Moya, M., Phillips, M. C., Rothblat, G. H.,
Swaney, J. B., and Tall, A. R. (1997) J Biol. Chem. 272, 20982-20985
12. Jian, B., de la Llera-Moya M., Ji, Y., Wang, N., Phillips, M. C., Swaney, J. B., Tall, A.
R., and Rothblat, G, H. (1998) J. Biol. Chem. 273, 5599-5606
13. Zimetti F, Weibel GK, Duong M, Rothblat GH. (2006) J. Lipid Res. 47, 605-13
14. Treguier, M., Moreau, M., Sposito, A., Chapman, M.J., Huby, T. (2007) Biochim.
Biophys. Acta.. 1771, 129-38
15. Kozarsky, K.F., Donahee, M.H., Rigotti, A., Iqbal, S.N., Edelman, E.R., Krieger, M.
(1997) Nature 387, 414-417
16. Arai, T., Wang, N., Bezouevski, M., Welcch, C., Tall, A.R. (1999) J Biol. Chem. 274,
12610-12615
17. Ueda, Y., et al. (2000) J. Biol. Chem. 274, 2366-2371.
18. Kozarsky, K.F., Donahee, M.H., Glick, J.M,, Krieger, M., Rader, D.J. (2000) Artioscler.
Thromb. Vasc. Biol. 20, 721-727
19. Rigotti, A., Trigatti, B.L., Penman, M., Rayburn, H., Herz, J., Krieger, M. (1997) Proc.
Natl. Acad Sci. U.S.A. 94, 12610-12615
20. Mardones, P., Quinones, V., Amigo, L, Moreno, M., Miquel, J.F., Schwarz, M.,
Miettinen, H.E., Trigatti, B., Krieger, M., VanPatten, S., Cohen, D.E., Rigotti, A. (2001)
J. LipidRes. 42, 170-180
21. Trigatti, B., Rayburn, H., Vinals, M., Braun, A., Miettinen, H., Penman, M., Hertz, M.,
Schrenzel, M., Amigo, L, Rigotti, A., Krieger M. (1999) Proc. Natl. Sci. U.S.A. 96, 93229327
22. Huszar, D., Varban, M.L., Rinninger, F., Feeley, R., Arai, T., Fairchild-Huntress, V.,
Donovan, M.J., Tall, A.R. (2000) Arterioscler. Thromb. Vasc. Biol. 20, 1068-1073
23. Van Eck, M., Twisk, J., Hoekstra, M., Van Rij, B. T., Van der Lans, C. A., Bos, I. S.,
Kruijt, J. K., Kuipers, F., and Van Berkel, T. J. (2003) J. Biol. Chem. 278, 23699-23705
24. Braun, A., Zhang, S., Miettinen, H. E., Ebrahim, S., Holm, T. M., Vasile, E., Post, M. J.,
Yoerger, D. M., Picard, M. H., Krieger, J. L., Andrews, N. C., Simons, M., and Krieger,
M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 7283-7288
25. Ji, Y., Wang, N., Ramakrishnan, R., Sehayek, E., Huszar, D., Breslow, J. L., and Tall, A.
R. (1999) J. Biol. Chem. 274, 33398-33402
26. Yesilaltay, A., Morales, M. G., Amigo, L., Zanlungo, S., Rigotti, A., Karackattu, S. L.,
Donahee, M. H., Kozarsky, K. F., and Krieger, M. (2006) Endocrinology 147, 1577-1588
27. Ueda, Y., Royer, L., Gong, E., Zhang, J., Cooper, P. N., Francone, 0., and Rubin, E. M.
(1999) J. Biol. Chem. 274, 7165-7171
28. Holm, T.M., Braun, A., Trigatti, B.L., Brugnara, C., Sakamoto, M., Krieger, M.,
Andrews, N.C. (2002) Blood. 99, 1817-1824
29. Meurs, I., Hoekstra, M., van Wanrooij, E.J., Hildebrand, R.B., Kuiper, J., Kuipers, F.,
Hardeman, M.R., Van Berkel, T.J., Van Eck, M.. (2005). Exp. Hematol. 33, 1309-19
30. Miettinen, H.E, Rayburn, H., Krieger, M. (2001) J Clin Invest. 108, 1717-1722
31. Ikemoto, M., Arai, H., Feng, D., Tanaka, K., Aoki, J., Dohmae, N., Takio, K., Adachi,
H., Tsujimoto, M., Inoue, K. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6538-6543
32. Kocher, O., Yesilaltay, A., Cirovic, C., Pal, R., Rigotti, A., Krieger, M. (2003) J. Biol.
Chem.278, 52820-52825
33. Kocher, O., Comella, N., Tognazzi, K., Brown, L. (1998) Lab. Invest. 78, 117-125
34. Yesilaltay, A., Kocher, O., Rigotti, A,. Krieger, M. (2005) Curr. Opin. Lipidol. 16,
147-52
35. Nakamura, T., Shibata, N., Nishimoto-Shibata, T., Feng, D., Ikemoto, M., Motjima, K.,
Iso-o, N., Tsukamoto, K., Tsujimoto, M., Arai, H. (2005) Proc.Natl. Acad. Sci. U.S.A.
102, 13404-13409
36. Silver, D.L. (2002) J. Biol. Chem. 277, 34042-34047
37. Webb, N.R., de Villiers, W.J., Connell, P.M., de Beer, F.C., van der Westhuyzen, D.R.
(1997) J. LipidRes. 38, 1490-1495
38. Webb, N.R., Connell, P.M., Graf, G.A., Smart, E.J., de Villiers, W.J.S., de Beer, F.C.,
van der Westhuyzen, D.R. (1998) J. Biol. Chem. 273, 15241-15248
39. Eckhardt, E.R., Cai, L., Shetty, S., Zhao, Z., Szanto, A., Webb, NR., Van der
Westhuyzen, D.R. (2006) J Biol. Chem. 281, 4348-53
40. Eckhardt, E.R., Cai, L., Sun, B., Webb, N.R., van der Westhuyzen, D.R. (2004) J. Biol.
Chem. 279, 14372-81
41. Zhang, X., Moor, A.N., Merkler, K.A., Liu, Q., McLean, M.P. (2007) Endocrinology
148, 5295-304
42. Fenske, S., Yesilaltay, A., Pal, R., Daniels, K., Rigotti, A., Krieger, M., Kocher, O.
(2008) J Biol. Chem. In Press, DOI 10.1074/jbc.M800029200
43. Gisler SM, Pribanic S, Bacic D, Forrer P, Gantenbein A, Sabourin LA, Tsuji A, Zhao ZS,
Manser E, Biber J & Murer H (2003) Kidney Int 64, 1733-1745
44. Hung, A.Y., Sheng, M. (2002) J. Biol. Chem. 277, 5699-702
45. Yesilaltay, A., Kocher, O., Pal, R., Leiva, A., Quinones, V., Rigotti, A., Krieger, M.
(2006) J. Biol. Chem. 281, 28975-80
46. Wang, P., Wang, J. J., Xiao, Y., Murray, J.W., Novikoff, P.M., Angeletti, R.H., Orr,
G.A., Lan, D., Silver, D.L., Wolkoff, A.W. (2005). J. Biol. Chem. 280, 30143-9
47. Simonet, W. S., Bucay, N., Lauer, S. J., and Taylor, J. M. (1993) J. Biol. Chem. 268,
8221-8229
48. Palmiter, R. D., and Brinster, R. L. (1986) Annu. Rev. Genet. 20, 465-499
49. Kocher, O., Pal, R., Roberts, M., Cirovic, C., and Gilchrist, A. (2003) Mol. Cell. Biol. 23,
1175-1180
50. Guo, Q., Penman, M., Trigatti, B.L., Krieger, M. (1996) J. Biol. Chem. 271,
11191-11196
FOOTNOTES
We thank Joel Lawitts from the BIDMC transgenic facility, and H. Lodish and D. Sabatini for
helpful discussions. Supported by grants from the National Institutes of Health to OK
(HL077780) and MK (HL64737, HL52212 and HL66105) and FONDECYT to AR (1070634).
# Abbreviations used are: HDL, high density lipoprotein; SR-BI, scavenger
receptor, class B,
type I; LDL, low density lipoprotein; UC, unesterified cholesterol; TC, total cholesterol; PDZ,
postsynaptic density protein (PSD-95)/Drosophila disc large tumor suppressor (dlg)/tight
junction protein (ZO 1); Tg, transgenic; KO, knockout; FPLC, fast performance liquid
chromatography; apoE, apolipoprotein E; apoC-I, apolipoprotein C-I, VLDL, very low density
lipoprotein; IDL, intermediate density lipoprotein
Chapter Four
DETERMINING THE EFFECTS OF EXPRESSING
THREE PDZK1 MUTANTS (PDZ1.2.3.4, MUT2,
AND PDZ2.3.4) ON HEPATIC SR-BI FUNCTION.
This chapter summarizes work that is in intermediate stages of completion. I contributed the text,
tables 1-4, and figures 2, 4, and 5. All transgenic and non-transgenic mice were generated by
Olivier Kocher and technicians in his lab at the Beth Israel-Deaconess Medical Center and
Harvard Medical School (Rinku Pal, Kathleen Daniels). I cloned PDZK1 truncation mutant
constructs into the appropriate plasmid, and Attilio Rigotti used these plasmids to prepare
adenovirus expression vectors. I used these adenoviruses to generate large-scale preps of these
viruses. Adelina Duka (from Vassilis Zannis's lab at Boston University) performed tail vein
injections of adenoviruses. I collected all plasma samples except for a few MUT2 and
PDZ1.2.3.4 samples, which were collected and analyzed by Ayce Yesilaltay. Caroline Barker
and Ayce Yesilaltay helped with immunoblotting and sample preparation for MUT2 and
PDZ1.2.3.4 mice. Contributions to the Materials and Methods section and figure legends were
contributed by Olivier Kocher. Minor revisions to text were contributed by Monty Krieger. All
experiments were performed in the laboratories of Monty Krieger and Olivier Kocher, who
provided overall supervision.
In Chapters 2 and 3, the results of expressing the first three PDZ domains of PDZK1 (in the form
of the PDZ1, PDZ1.2, and PDZ1.2.3 truncation mutants) on hepatic SR-BI protein abundance,
localization and function were presented. The influence of the C-terminal PDZ-binding motif for
PDZK1 regulation of hepatic SR-BI was also examined through the expression of the pTEM
truncation mutant. In addition to those constructs discussed in Chapters 2 and 3, I have been
involved in examining the effects of several other mutations of PDZK1. The results of these
studies are currently in intermediate stages of completion. Here I briefly summarize progress on
these studies, which will be continued by others in the Krieger lab and by our collaborators.
PDZ1.2.3.4
One PDZK1 truncation mutant, PDZ1.2.3.4, comprises all four PDZ domains (amino acids 1461), but is missing the C-terminal tail (Figure 1). As discussed in the introduction, a previous
study of PDZK1 regulation of SR-BI abundance found a possible role for phosphorylation of
PDZK1 at a serine near its C-terminus (1). As discussed in chapters 2 and 3, expression of the
PDZK1 truncation mutants PDZ1, PDZ1.2, and PDZl.2.3 in the livers of PDZK1 KO mice
demonstrated that these PDZ domains are not sufficient to restore normal SR-BI protein
abundance and localization, and therefore not sufficient to restore normal hepatic SR-BI
function. In contrast, expression of the pTEM truncation mutant was able to restore normal SRBI protein levels and function in PDZK1 KO mice. These results clearly indicate that some
structural feature of PDZK1 located between the PDZ3 domain and the final three C-terminal
residues is necessary for normal expression of hepatic SR-BI. To determine whether this required
structural feature is the PDZ4 domain and/or a feature located on the C-terminal tail, such as a
phosphorylation site, the PDZ1.2.3.4 truncation mutant encoded by a transgene was expressed in
the livers of WT and PDZK1 KO mice.
(Phosphorylation Site)
519
\
-C
PDZK1
vutatuve
PDZBinding Motif)
(SR-BI Binding)
461
-C
PDZ1.2.3.4
(SR-BI Binhding)
(Phosphorylation Site)
5 19
MUT2
ut
CPDZ-
utative PDZ-
Binding Motif)
Ala2OTyr
(Phosphorylation Site)
PDZ2.3.4
\444
C
1
N-
tative PDZBinding Motif)
Figure 1. Structures of PDZK1, the truncation mutants PDZ1.2.3.4 and PDZ2.3.4, and the
point mutant MUT2. Schematic diagrams of the proteins encoded by the PDZK1 (top),
PDZ1.2.3.4 (middle), and PDZ2.3.4 (bottom) transgenes.
Two PDZ1.2.3.4 founder lines were generated, 1159 and 1163. Plasma cholesterol levels
were determined for both founder lines and the results are summarized in Table 1. The size
distribution profile of lipoproteins in PDZ1.2.3.4-Tg mice was also determined by fast
performance liquid chromatography (Figure 2).
PDZ 1.2.3.4 Founder:
WT
WT [PDZ1.2.3.4-Tg]
PDZK1 KO
PDZK1 KO
[PDZ1.2.3.4-Tg]
1159
138.1± 12.82
1163
124.7±- 17.97
n= 13
n= 11
141.2+ 15.56
n= 13
214.0-± 21.23*
n= 12
142.1 - 10.12
n=6
108.1± 18.44
n= 11
157.0
n= 1
129.7± 18.33
n=2
Table 1. Effect of PDZ1.2.3.4-Tg on plasma cholesterol levels in two founder lines.
Plasma cholesterol levels for each genotype in each founder are shown as the mean + the
standard deviation. Total plasma cholesterol levels were determined in individual samples by
enzymatic assay, and results from the indicated numbers of animals (n) were pooled by
genotype. Independent WT and KO control animals for each founder line were generated to
ensure that the mixed genetic backgrounds for experimental and control mice were matched. *
Indicates that cholesterol levels in PDZK1 KO mice were statistically significantly different from
those in all other genotypes in founder line 1159 (P<0.001 for PDZK1 KO vs. WT, WT
[PDZ1.2.3.4-Tg], PDZK1 KO [PDZl.2.3.4-Tg]).
Acl
305
30
E25
SC 20
0
S15
0
.5
10
05
0
1
5
9
13
17 21 25 29
Fraction Number
33
37
41
Figure 2. Effect of expression of the PDZ1.2.3.4 transgene on plasma lipoprotein
cholesterol profiles in WT and PDZK1 KO mice from founder 1159. Plasma was harvested
from mice with the indicated genotypes and PDZ1.2.3.4 transgene. Plasma samples from
individual animals were size-fractionated by FPLC, and the total cholesterol content of each
fraction was determined by an enzymatic assay. The chromatograms are representative of
multiple individually determined profiles. Similar results for WT and WT + [PDZ1.2.3.4-Tg]
were seen for founder 1163 (no FPLCs have yet been performed on KO and KO + [PDZ1.2.3.4Tg] for 1163). Approximate elution positions of native VLDL, IDL/LDL and HDL particles are
indicated by brackets and were determined as previously described (2).
Though the results are still preliminary, it appears that expression of the PDZ1.2.3.4-Tg
in PDZK1 KO mice restores normal hepatic SR-BI function. Although there are too little data to
draw any conclusions from founder line 1163, expression of PDZ1.2.3.4-Tg in PDZK1 KO mice
results in a statistically significant decrease in plasma cholesterol levels (P<0.001, PDZK1 KO
vs. PDZK1 KO [PDZl.2.3.4-Tg]) similar to those in non-transgenic WT mice (P>0.05, WT vs.
PDZK1 KO [PDZ 1.2.3.4-Tg]) (Table 1). Expression of PDZ1.2.3.4-Tg in PDZK1 KO mice in
founder line 1159 also restored the lipoprotein size distribution from that seen in PDZK1 KO
mice to that seen in non-transgenic WT mice (Figure 2, black and gray squares). Expression of
PDZ1.2.3.4-Tg had little effect on plasma cholesterol levels (Table 1) and lipoprotein size
(Figure 2, white and gray circles) in WT mice in both 1159 and 1163 founder lines.
Quantitation of PDZ1.2.3.4-Tg expression in these founder lines is incomplete, however,
preliminary studies suggest that PDZ1.2.3.4 is expressed at levels approximately 8-10 fold
higher than endogenous PDZK1 in founder line 1159, and at approximately 15-30% of
endogenous PDZK1 levels in founder line 1163 (data not shown). In preliminary blots, SR-BI
levels appear to be similar to endogenous WT levels in WT [PDZ1.2.3.4-Tg] (data not shown),
but SR-BI protein abundance in PDZK1 KO [PDZ1.2.3.4-Tg] mice has not yet been examined.
Subcellular localization of SR-BI in these mice, by immunohistochemistry, has also not yet been
determined.
If the PDZl.2.3.4-Tg is able to restore normal SR-BI protein abundance, localization and
function in both founders, this would demonstrate that expression of PDZKl's four PDZ
domains is sufficient, and that the C-terminal tail is not necessary, for hepatic SR-BI expression.
In chapters two and three, it was found that expression of the PDZ1 domain is sufficient to
partially restore SR-BI protein levels, and that expression of the first three PDZ domains is
sufficient to partially restore SR-BI protein levels, cell-surface localization, and function.
Therefore, these results would imply that interactions between the PDZ2, PDZ3, and PDZ4
domains of PDZK1 and other cellular components regulate SR-BI's cell-surface localization and
abundance. This, of course, does not mean that interactions through the C-terminal tail are not
involved in regulating hepatic SR-BI, only that they are not necessary for normal levels of SR-BI
expression. It is possible that the C-terminal tail of PDZK1 influences activities of SR-BI that we
have not examined and/or that it primarily influences other cellular proteins, but not SR-BI.
MUT1 and MUT2
Two transgenic constructs were generated that contain point mutations in the PDZ1 domain
of PDZK1 intended to abrogate binding to the C-terminus of SR-BI. As discussed previously, it
seems probable that PDZKI's interactions with other cellular components might be necessary for
normal regulation of hepatic SR-BI. Therefore, expressing a form of PDZK1 that can no longer
bind SR-BI via the PDZ1 domain, but has three other functional PDZ domains and a wild-type
C-terminal tail, might result in a dominant negative phenotype in WT mice due to competition
for these other required cellular components; thereby demonstrating a need for these interactions.
The MUT1 construct contains a Lysine 14 to Alanine mutation located near the loop that
connects the PA-P1B strands of PDZ1 that coordinates the carboxylate group at the very Cterminus of the peptide ligand. This lysine is highly conserved between PDZKI's PDZ domains,
and therefore might play an important role in binding to the C-terminal ligands. The MUT2
construct contains a Tyrosine 20 to Alanine mutation located within the conserved Gly-Tyr-GlyPhe sequence within the loop connecting the PA-PB strands of PDZ1 that coordinates the
carboxylate group at the very C-terminus of the peptide ligand. This Gly-Tyr/Leu-Gly-Phe
sequence is very highly conserved in PDZ domains in many different PDZ proteins, and plays a
critical role in target sequence recognition (3).
These constructs, along with several others, were expressed as glutathione-S-transferase
(GST) fusion proteins and tested for the ability to bind the SR-BI 30-mer C-terminal peptide
bound to beads by our collaborator, Olivier Kocher (Figure 3). While MUT1 binding the Cterminal peptide was detected at similar levels as wild-type PDZK1, MUT2 binding to the Cterminal peptide was not detected. As a control of binding specificity, binding to a peptide
comprising the SR-BI C-terminus minus the final three residues (the PDZ-binding motif) was
examined, and it was determined that none of the GST-fusion proteins bound to this peptide.
Therefore, the point mutation in MUT2 appeared to inhibit PDZK1 binding to SR-BI, but the
point mutation in MUT1 did not.
WT
120 kD
MUT1 MTfUT2
WT
MUT1 MUT2
-
-
85 kD -
GST-PDZK1
Acetylated BSA
60kkD
SR-BI 30-mer Cterminal peptide
SR-BI 27-mer Cterminal peptide minus
AKL
Figure 3. In vitro binding of PDZK1 point mutants to the SR-BI C-terminal peptide.
Point mutations introduced into the PDZl domain of PDZK1 were tested for their ability to bind
the C-terminus of SR-BI. Purified PDZKl/GST-fusion proteins were incubated with bead-bound
biotinylated SR-BI C-terminal 30-mer peptides (with or missing the final three amino acids of
the PDZ-binding motif). The beads were washed and then boiled in SDS sample buffer. Samples
were analyzed by SDS-PAGE electrophoresis and visualized by Coomassie blue staining.
These point mutation constructs were then used to generate transgenes for expression in the
livers of both WT and PDZK1 KO mice. Three founder lines were generated for each construct.
The MUT1 founder lines were 952, 953, and 954. The MUT2 founder lines were 694, 695, and
696. Plasma cholesterol levels were assayed in all founder lines and the results are summarized
in Tables 2 (MUT1) and 3 (MUT2). The size distribution profile of lipoproteins in MUT2-Tg
expressing mice was also determined by fast performance liquid chromatography (Figure 4).
MUT IFounder:
WT
952
129.9± 13.68
953
126.0± 15.10
954
136.9± 17.01
n=9
n=3
n=14
128.0+ 17.11
150.2+ 21.79
122.5+ 13.19
n=9
n=6
n=9
PDZK1 KO
211.2±- 15.62*
n=4
160.1 + 22.16 *
221.4±t 24.52'
n=11
196.5± 17.281
200.8+ 20.90'
n=6
130.4+ 19.79
[MUT1-Tg]
n=4
n = 11
n= 13
WT [MUT1-Tg]
PDZK1 KO
Table 2. Effect of MUT1-Tg expression on plasma cholesterol levels in three founder
lines. Plasma cholesterol levels for each genotype in each founder are shown as the mean ± the
standard deviation. Total plasma cholesterol levels were determined in individual samples by
enzymatic assay, and results from the indicated numbers of animals (n) were pooled by
genotype. Independent WT and KO control animals for each founder line were generated to
ensure that the mixed genetic backgrounds for experimental and control mice were matched.
*Indicates that cholesterol levels in PDZK1 KO mice were statistically significantly different
from all other genotypes (P<0.001 for WT and WT[MUT1-Tg], P<0.01 for PDZK1 KO[MUT1Tg]). * Indicates that cholesterol levels in PDZK1 KO[MUT1-Tg] mice were statistically
significantly different from all other genotypes (P<0.05 for WT and WT[MUT1-Tg]). Y Indicates
that cholesterol levels in PDZK1 KO mice were statistically significantly different from all other
genotypes (P<0.001 for WT and WT[MUT1-Tg], P<0.05 for PDZK1 KO[MUTI-Tg]). I
Indicates that cholesterol levels in PDZK1 KO[MUT1-Tg] mice were statistically significantly
different from all other genotypes (P<0.0001 for WT and WT[MUT1-Tg]). T Indicates that
cholesterol levels in PDZK1 KO mice were statistically significantly different from all other
genotypes (P<0.001 for WT, WT[MUT1-Tg], and PDZK1 KO[MUT1-Tg]).
Results shown in Table 2 indicate that, in at least one founder line (954), MUT 1 is able to
complement the PDZK1 KO phenotype, and restore normal plasma cholesterol levels. In founder
lines 952 and 953, expression of MUT1-Tg in PDZK1 KO mice resulted in a statistically
significant difference with PDZK1 KO mice (P<0.01 and P<0.05 respectively), though these
cholesterol levels were not as low as in WT mice (P>0.05). No statistically significant difference
was seen in WT vs. WT [MUT1-Tg] plasma cholesterol levels in any of the founder lines. These
results suggest that the MUT 1 point mutation does not affect PDZKl's ability to regulate hepatic
SR-BI function in vivo. These results are consistent with the in vitro observation that MUT1 and
PDZK1 can bind to the C-terminus of SR-BI. It is unclear why MUT1 fully restored normal
plasma cholesterol levels in founder line 954, but only partial complementation was seen in
PDZK1 KO [MUT1-Tg] mice in founder lines 952 and 953. This may be due to differences in
transgenic expression levels between these founder lines, but quantitation of MUT 1 expression
levels has not yet been performed, nor quantitation of SR-BI protein levels.
PDZK1 KO
694
129.6±+20.89
n=13
119.6± 15.72
n=11
198.8± 17.99*
695
141.2+ 22.70
n=5
136.4± 18.18
n=18
207.7± 23.27*
696
131.9± 21.48
n=10
123.0± 20.23
n=11
119.3± 26.36
PDZK1 KO
[MUT2-Tg]
168.1 ± 25.32*
n= 10
169.3± 27.15
n=7
139.8± 24.73
n =4
MUT2 Founder:
WT
WT [MUT2-Tg]
n= 13
n=25
n=2
Table 3: Effect of MUT2-Tg on plasma cholesterol levels in three founder lines. Plasma
cholesterol levels for each genotype in each founder are shown as the mean + the standard
deviation. Total plasma cholesterol levels were determined in individual samples by enzymatic
assay, and results from the indicated numbers of animals (n) were pooled by genotype.
Independent WT and KO control animals for each founder line were generated to ensure that the
mixed genetic backgrounds for experimental and control mice were matched. *Indicates the
PDZK1 KO cholesterol levels were statistically significantly different from that found in all
other genotypes within the same founder (PDZK1 KO vs. PDZK1 KO [MUT2-Tg]: P<0.01;
PDZK1KO vs. WT and WT [MUT2-Tg]: P<0.001). *Indicates that cholesterol levels in PDZK1
KO [MUT2-Tg] mice were statistically significantly different that cholesterol levels in all other
genotypes (PDZK1 KO [MUT2-Tg] vs. WT and WT [MUT2-Tg]: P<0.001). YIndicates that
plasma cholesterol levels in PDZK1 KO [MUT2-Tg] mice were statistically significantly
different from WT [MUT2-Tg] mice, P<0.01.
II
30
30
E 25
€
B 20
-15
10
o
5
1
5
9
13
17 21 25 29
Fraction Number
33
37
41
Fig. 4. Effect of expression of the MUT2 transgene on plasma lipoprotein cholesterol
profiles in WT and PDZK1 KO mice from founder 694. Plasma was harvested from mice
with the indicated genotypes and MUT2 transgene. Plasma samples from individual animals
were size-fractionated by FPLC, and the total cholesterol content of each fraction was
determined by an enzymatic assay. The chromatograms are representative of multiple
individually determined profiles. Similar results all genotypes were seen for founder 695. Similar
results for WT and WT[MUT2-Tg] were seen for founder 696. Approximate elution positions of
native VLDL, IDL/LDL and HDL particles are indicated by brackets and were determined as
previously described (2).
Results shown in Table 3 and Figure 4 indicate that expression of MUT2-Tg does not affect
plasma cholesterol levels nor the size distribution of lipoproteins in WT mice (Figure 4, white
and gray circles). No dominant negative effect on SR-BI function was seen in WT [MUT2-Tg] in
any of the founder lines. Initial estimations of MUT2-Tg expression levels indicate that MUT2 is
expressed at levels approximately 5-fold higher than endogenous PDZK1 protein in all three
founders (data not shown), which may be too low to effectively compete with endogenous
PDZK1 for binding partners and thus exhibit a dominant negative phenotype. SR-BI protein
abundance in these livers remains to be determined.
Expression of MUT2-Tg in PDZK1 KO mice resulted in a partial restoration of SR-BI
function in two of the three founder lines (founder line 696 has too few animals to draw any
conclusions). In both the 694 and 695 lines, plasma cholesterol levels in PDZK1 KO [MUT2-Tg]
100
were statistically significantly different from those in PDZK1 KO mice (P<0.01 for both 694 and
695). That the MUT2-Tg appears to be overexpressed approximately 5-fold but does not fully
restore SR-BI function indicates that the MUT2 protein is not as potent a regulator of SR-BI as
wild-type PDZK1. These results suggest the point mutation in the PDZ1 domain of MUT2-Tg
may not have fully inhibited binding to the C-terminus of SR-BI. Rather, it may have only
reduced the ability of PDZK1 to bind SR-BI (e.g., lower binding affinity). Alternatively, the
MUT2-Tg may have been able to influence SR-BI function in PDZK1 KO mice through
interactions with other cellular components, without binding directly to SR-BI. Further binding
studies investigating the kinetics of MUT2 binding to the C-terminus of SR-BI may be required
to elucidate the mechanism. It is interesting to note that a point mutation within a highlyconserved region of the PDZ domain, the binding loop that coordinates the carboxylate at the Cterminus of the target protein, may not have completely inhibited binding. This indicates that the
structural features behind recognition and binding of C-terminal ligands by different PDZ
domains requires greater investigation
PDZ2.3.4 and Adenovirus Production
In addition to using point mutations to inhibit binding of PDZK1 to SR-BI, we also generated
a truncation mutant of PDZK1 missing the first PDZ domain (the domain that binds the Cterminus of SR-BI). This truncation mutant, called PDZ2.3.4, contains the first four amino acids
at the N-terminus of PDZK1, and PDZ2, PDZ3, PDZ4, and the C-terminal tail of PDZK1 (see
Figure 1). This construct was used to generate two transgenic founder lines. However, no
PDZ2.3.4 protein expression was detected by immunoblotting in the livers of these mice, though
mRNA message was detected by RT-PCR.
In addition to transgenic mice, adenoviral vectors were generated to express full-length
PDZK1 and various truncation mutants of PDZK1. I, with the help of collaborators, generated
adenoviral vectors for the hepatic expression of the PDZ2.3.4 truncation mutant, as well as
adenoviral vectors encoding PDZ1, PDZ1.2, PDZ1.2.3, pTEM, and full-length PDZK1. Given
how rapidly the transgenic lines for many of these constructs became available, these adenoviral
vectors were not utilized. However, because transgenic mice stably expressing the PDZ2.3.4
protein could not be generated, the PDZ2.3.4 adenovirus was used to express this truncation
mutant in the livers of WT and PDZK1 KO mice and to study its effect on hepatic SR-BI
function.
PDZ2.3.4 adenovirus (Ad.PDZ2.3.4), along with full-length WT PDZK1 and empty vector
control adenoviruses (Ad.PDZK1 and Ad. EAl respectively), were introduced by tail vein
injection into 5 WT and 5 PDZK1 KO mice each on day 0. Plasma samples were collected from
mice prior to injection. On day 4, plasma and tissue samples were collected and analyzed. Three
uninjected control WT mice treated similarly as injected mice were also collected.
Immunoblotting was used to determine the expression level of PDZK1 and PDZ2.3.4 proteins.
All WT mice injected with PDZ2.3.4 or PDZK1 adenovirus had high PDZK1 or PDZ2.3.4
protein levels as determined by immunoblotting (protein levels not quantitated) (Figure 5). Of
the five PDZK1 KO mice injected with Ad.PDZK1, three exhibited expression levels similar to
those seen in the injected WT mice. Of the five PDZK1 KO mice injected with Ad.PDZ2.3.4,
one exhibited expression levels similar to that seen the injected WT mice. Three PDZK1 KO
[Ad.PDZ234] mice exhibited significantly lower expression levels (data not shown).
101
SE
d.P
Genotype:
AdV:
None
Ad. EM
d.PDZ2.3.4
I.AdPDZKI I Ad.PDZ2.3.4
75-
-PDZK1
--- PDZ2.3.4
50
3725-
Figure 5. Hepatic expression of PDZK1 and PDZ2.3.4 by adenovirus in WT mice. Liver
lysates (~30 Rg of protein) from mice with the indicated genotypes injected with the indicated
adenovirus, were analyzed by immunoblotting, and PDZK1 (~60 kDa band) and PDZ2.3.4
(~-55kDa) was visualized by chemiluminescence.
The effect that expression of these proteins by adenovirus had on plasma cholesterol levels is
summarized in Table 4. Not surprisingly, expression of PDZK1 by adenovirus in PDZK1 KO
mice resulted in normal cholesterol levels. As was the case for the empty vector control,
expression of PDZ2.3.4 in both WT and PDZK1 KO mice did not significantly alter plasma
cholesterol levels, even in those individual animals with high levels of PDZ2.3.4 expression.
102
Adenovirus:
Ad.EA1
Plasma Collected:
Day 0
Day 4
Ad.PDZK1
Day 0
Day 4
Ad.PDZ2.3.4
Day 0
Day 4
None
Day 0
Day 4
WT
103.3 ± 16.94
n=5
107.3 ± 24.70
n=5
96.90 ± 17.76
n=5
76.23 ± 16.42
n=5
107.4 ± 16.42
n=5
97.82 ± 18.92
n=5
91.19 ± 7.439
n=3
87.50 ± 7.236
n= 3
PDZK1 KO
239.7 t 19.40
n=5
231.7 ± 24.70
n=5
241.7 ± 15.58
n=5
145.8 ± 50.99
n=5
229.2 ± 19.63
n=5
214.1 ± 16.90
n=5
*
Table 4. Effect of Ad.EA1, Ad.PDZK1, Ad.PDZ2.3.4 hepatic expression on plasma
cholesterol levels in WT and PDZK1 KO mice. Plasma cholesterol levels for each genotype
before and after injection of Ad.EA1, Ad.PDZK1, and Ad.PDZ2.3.4 are shown as the mean ± the
standard deviation. Total plasma cholesterol levels were determined in individual samples by
enzymatic assay, and results from the indicated numbers of animals (n) were pooled by
genotype, adenovirus and condition. *Indicates that cholesterol levels in PDZK1 KO mice before
injection of Ad.PDZK1 versus after is statistically significantly different, P=0.0095).
Given that our work with other PDZK1 truncation mutants suggests that interactions between
the PDZ domains C-terminal to PDZ1 and other cellular components are involved in SR-BI
protein abundance and localization, it seemed likely that overexpression of the PDZ2, PDZ3, and
PDZ4 domains might compete for these interactions, thereby giving a dominant negative
phenotype. It is unclear why PDZ2.3.4 does not exhibit an effect on hepatic SR-BI function in
WT mice. It's possible that either PDZ2.3.4 is not expressed at high enough concentrations, or
that the local concentration near the membrane is not high enough to effectively compete with
endogenous PDZK1 because of PDZ2.3.4's inability to bind SR-BI. [PDZK1 recruitment to the
plasma membrane may require binding to PDZ1 target proteins, such as SR-BI.] It's also
possible that the PDZ2.3.4 construct encodes a protein that does not properly fold, and therefore
is not functional.
103
Experimental Procedures
Generation of PDZ1.2.3.4, MUT1, MUT2, PDZ2.3.4 transgenic mice: PDZ1.2.3.4, MUT1,
MUT2, PDZ2.3.4 transgenic mice were generated using the pLIV-LE6 plasmid, kindly provided
by Dr. John M. Taylor (Gladstone Institute of Cardiovascular Disease, University of California,
San Francisco). The pLiv-LE6 plasmid contains the promoter, first exon, first intron, and part of
the second exon of the human apoE gene, and the polyadenylation sequence, and a part of the
hepatic control region of the apoE/C-I gene locus (4). PDZ1.2.3.4, MUTI and MUT2 transgenic
mice were generated and genotyped as described previously in chapters 2 and 3. Two founder
lines were generated for PDZ1.2.3.4, and three founder lines each were generated for MUT1 and
MUT2.
Animals: All mice on a 25:75 FVB/N: 129Sv genetic background were maintained on a normal
chow diet (5) and ~6-12 week old male mice were used for experiments. All procedures on
transgenic and non-transgenic mice were performed in accordance with the guidelines of the
Beth Israel Deaconess Medical Center and the Massachusetts Institute of Technology Committee
on Animal Care.
Blood and tissue sampling, processing, and analysis: Plasma and liver samples were collected
and processed and total plasma cholesterol levels and individual size fractionated fast
performance liquid chromatography (FPLC) cholesterol profiles were obtained as previously
described in chapters 2 and 3.
Immunoblotting: protein samples from total liver lysates were fractionated by SDS-PAGE,
transferred to polyvinylidene difluoride membranes and incubated with either a rabbit polyclonal
anti-SR-BI antipeptide antibody (mSR-B1495-112) (1:1000) or a rabbit polyclonal anti-PDZK
antipeptide antibody (1:20000) (JBC, 2008), followed by an anti-rabbit IgG conjugated to
horseradish peroxidase (Invitrogen, 1:10000), and visualized by ECL chemiluminescence (GE
Healthcare/Amersham, #RPN2132). Immunoblotting using polyclonal anti-E-COP (1:5000) (6)
antibody was used as loading control.
Production of PDZK1 point-mutants and in vitro binding studies: A plasmid containing the
complete PDZK1 cDNA was used for these experiments. Single amino acid mutations were
produced using the Quick-Change II site-directed mutagenesis kit from Stratagene (Cedar Creek,
TX). Non-mutated PDZK1, MUTI (Alal4Lys) and MU2 (Ala20Tyr) were subcloned into
pGEX-4T-3 vector (Pharmacia), in order to produce the corresponding GST-fusion proteins.
Biotinylated peptides corresponding to the carboxy terminus of SR-BI were obtained from
Genemed Synthesis, Inc. (San Francisco, CA): an SR-BI 30mer terminal peptide and an SR-BI
27mer terminal peptide missing the last three carboxy terminal amino acids known to be
necessary for the interaction with the first PDZ domain of PDZKI: AKL (negative control).
Peptides (0.5 mg) were incubated with avidin-agarose beads (0.5 ml in PBS) for 2 hours at room
temperature. Unbound peptide was washed away with PBS. The Bead-peptide complexes (0.2
ml) were incubated with 6 mg of wild-type or mutated GST-PDZK1 fusion proteins overnight at
370C, washed with PBS, boiled in DTT-containing SDS loading buffer and analyzed by SDS gel
electrophoresis. Proteins were visualized using Coomassie blue staining.
104
RT-PCR ofPDZ2.3.4-Tg mRNA: Tissue sampling, RNA extraction and RT-PCR was performed
on samples from PDZ2.3.4-Tg mice as previously described (7).
Statistical Analysis: Data are shown as the means _--standard deviation. Statistically significant
differences were determined by either pairwise comparisons of values using the unpaired t test,
with (if variances differed significantly) or without Welch's correction, or by one-way ANOVA
followed by the Tukey-Kramer multiple comparison post-test when comparing three or more sets
of data to each other. Comparisons of plasma cholesterol levels before and after injection of
adenoviruses were performed by the paired t test. Mean values for experimental groups are
considered statistically significantly different for P < 0.05 for both types of tests.
Generation of Adenoviral Constructs: Full-length PDZK1 and five truncation mutant
constructs of PDZK1 were generated by PCR, cloned into the pShuttle-CMV vector, and
sequenced. Primers used for these procedures were the same as those used to generate the
transgenic constructs. These constructs include PDZK1, the PDZl domain alone; PDZ1.2;
PDZ1.2.3; PDZ2.3.4; and a deletion of the 3 C-terminal amino acids that comprise a PDZbinding domain (pTEM) (see Figure 1). Expression of all constructs was verified by transient
transfection in HEK293 cell (Fugene 6 Transfection reagent, Roche) and/or by adenovirus
expression. Cell lysates were prepared by resuspending cells in SDS lysis buffer (4% SDS, 20%
glycerol, 100 mM Tris, pH 6.8) in the presence of protease inhibitors, boiling at 1000 C for 5
min, followed centrifugation at 16,000xg for 5 min at 40 C for 5 min. The protein concentrations
of these lysate supernatants were then determined using the bicinchoninic acid (BCA) assay
(Pierce). Lysates were then denatured at 1000 C for 10 minutes in the presence of 2% SDS and
100mM P3-mercaptoethanol immediately before fractionation by gel electrophoresis and analysis
by immunoblotting. Immunoblotting analysis was performed as described for transgenic mice,
except for the use of a chicken anti-PDZK1 polyclonal antibody (1:300) and a horseradish
peroxidase-conjugated anti-chicken IgG antibody (1:10,000).
Generating, Amplifying, Purifying, and Injecting Adenoviruses: PDZK1, PDZ1, PDZ1.2,
PDZ1.2.3, PDZ2.3.4 and pTEM constructs were inserted into the EAl adenovirus vector as
previously described (36). These adenoviral vectors were grown and amplified in HEK293 cell
cultures, purified by Cesium Chloride gradient, and viral concentration estimated by OD 2 60
readings as previously described (9). Purified Ad.PDZ1.2, Ad.PDZ2.3.4, Ad.PDZKl, and
Ad.EA1 were stored at -800 C. Ad.PDZ1, Ad.PDZ1.2.3, and Ad.pTEM are in intermediate stages
of amplification.
Ad.PDZ2.3.4, Ad.PDZK1, and Ad.EA1 were injected into 5 WT and 5 PDZK1 KO mice (3-6
months old) each by tail vein injection (1xl0 1 viral particles per injection) on Day 0. Plasma was
collected before injection, and plasma and tissues were collected on Day 4 and analyzed as
previously described in Chapters 2 and 3.
105
References
1. Nakamura, T., Shibata, N., Nishimoto-Shibata, T., Feng, D., Ikemoto, M., Motjima, K.,
Iso-o, N., Tsukamoto, K., Tsujimoto, M., Arai, H. (2005) Proc. Natl. Acad. Sci. U.S.A.
102, 13404-13409
2. Rigotti, A., Trigatti, B. L., Penman, M., Rayburn, H., Herz, J., and Krieger, M. (1997)
Proc. Natl. Acad. Sci. U. S. A. 94, 12610-12615
3. Doyle, D., Lee, A., Lewis, J., Kim, E., Sheng, M., and MacKinnon, R. (1996) Cell 85,
1067-1076
4. Simonet, W. S., Bucay, N., Lauer, S. J., and Taylor, J. M. (1993) J. Biol. Chem. 268,
8221-8229
5. Kocher, O., Pal, R., Roberts, M., Cirovic, C., and Gilchrist, A. (2003) Mol. Cell Biol. 23,
1175-118
6. Guo, Q., Penman, M., Trigatti, B. L., and Krieger, M. (1996) J. Biol. Chem. 271,
11191-11196
7. Kocher, O., Yesilaltay, A., Cirovic, C., Pal, R., Rigotti, A., Krieger, M. (2003) J. Biol.
Chem. 278, 52820-52825
8. Silver, D. L. (2002) J. Biol. Chem. 277, 34042-34047
9. Kozarsky, K., Donahee, M., Rigotti, A., Iqbal, S., Edelman, E., and Krieger, M. (1997)
Nature 387, 414-417
106
Chapter Five
CONCLUSIONS AND FUTURE INVESTIGATIONS
107
108
Summary of Findings
CPDZK1 is a four PDZ-domain containing cytoplasmic adaptor protein that binds the
SR-BI
terminus of the HDL receptor SR-BI by its first PDZ domain (1). PDZK1 regulates
Loss of
expression in a tissue-specific manner, via an unknown post-transcriptional mechanism.
PDZK1 expression in vivo results in a dramatic reduction in hepatic SR-BI protein levels, but
only a mild reduction in SR-BI abundance in the intestines, and no change in steroidogenic
tissues (2). Given that PDZK1 comprises multiple structural features not known to interact
its Cdirectly with SR-BI, including three PDZ domains, at least one phosphorylation site on
terminal tail, and a putative PDZ-binding motif at its C-terminus; it seems probable that
116
components mediated by these domains might play a role in
interactions with other cellular
PDZKl-dependent regulation of hepatic SR-BI expression.
(Phosphorylation Site)
PDZK1
-c
-
W
519
utative PDZBinding Motif)
(SR-BI Bli(ding)
116
-C
POZI
(SR-BI Bilding)
220
PDZ1.2
C
W
(SR-BI Bliding)
220
PDZI.2.3 I
359
-C
l
(SR-BI BiQlng)
PDZ1.2.3.4
(SR-BI
.
-l
.
461
-C
Bilading)
(Phosphorylation
MUT2
1
N
W
W
W
utatlve PDZBinding Motif)
Ala20Tyr
PDZ2.3.4
Sig
MC
Site)
1
N-
(Phosphorvlatlon Site)
/
l
\
44
IC
utative PDZBinding Motif)
Figure 1. Diagrams of wild-type and mutant PDZK1 protein structures.
109
The objective of the work detailed in this thesis was to tease out the roles that these
various structural features play in regulating hepatic SR-BI through the expression of multiple
PDZK1 truncation mutants in the livers of WT and PDZK1 KO mice (Figure 1). This work has
been a collaborative effort between the Krieger lab at MIT and the Kocher lab at BIDMC.
First (in Chapter 2), transgenic overexpression of full-length PDZK1 in the livers of
PDZK1 KO mice was shown to complement their defect in SR-BI function. SR-BI in these mice
was restored to normal protein levels and localization, and the plasma cholesterol levels and
lipoprotein distribution were restored from the high levels seen in nontransgenic PDZK1 KO
mice (carried in abnormally large HDL particles) to the levels and distribution observed in
nontransgenic WT mice. We did not observe any change in SR-BI protein levels, localization or
function in WT mice overexpressing PDZK1 (~21-fold above endogenous PDZK1 levels in
nontransgenic WT mice).
A 24-fold overexpression of the PDZ1 domain of PDZK1 (the domain that binds the Cterminus) in the livers of PDZK1 KO mice was shown to partially restore SR-BI abundance.
However, this SR-BI protein was mislocalized intracellularly. As a consequence, this increase in
SR-BI abundance did not affect the high plasma cholesterol levels or the abnormal lipoprotein
size distribution. Furthermore, overexpression of PDZ1 in the livers of WT mice displayed a
dramatic increase in plasma cholesterol levels carried in abnormally large HDL particles, a
phenotype virtually identical to that seen in PDZK1 KO mice. This loss of function was
accompanied by a decrease in SR-BI protein abundance to levels similar to that observed in
PDZK1 KO [PDZl-Tg] mice. As seen in PDZK1 KO [PDZl-Tg] mice, the SR-BI protein in WT
[PDZ1-Tg] mice was mislocalized intracellularly. These results suggest that binding of the PDZ1
domain to SR-BI affected SR-BI abundance and localization, but was not sufficient for normal
SR-BI function. Thus, structural features of PDZK1 in addition to the PDZ1 domain are
necessary for normal PDZKl-dependent regulation of SR-BI.
Effects of expression of the PDZ1.2-Tg (composed of the first and second PDZ domains
of PDZK1), PDZ1.2.3-Tg, and pTEM-Tg (which lacks the final three amino acids constituting a
putative PDZ-binding motif) on hepatic SR-BI in WT and PDZK1 KO mice were investigated
next (in Chapter 3). The effects of overexpression of pTEM-Tg in the livers of PDZK1 KO mice
on SR-BI were similar to overexpression of full-length PDZK1, indicating that the C-terminal
PDZ-binding motif was not necessary for normal PDZKl-dependent SR-BI expression,
localization, and function. Overexpression of pTEM-Tg in WT mice resulted in a small decrease
in plasma cholesterol levels, without a significant increase in SR-BI protein levels or a change in
localization. Whether this was due to an increase in SR-BI activity is not clear, nor is it known
how pTEM might facilitate an increase in SR-BI activity. While overexpression of the PDZK1Tg did not result in such a decrease in plasma cholesterol levels, it is important to note that the
pTEM-Tg is overexpressed at higher levels (24-44-fold overexpression) than the PDZKl-Tg (21fold overexpression).
Unlike expression of the PDZl-Tg in WT mice, expression of PDZl.2-Tg and PDZl.2.3Tg in WT mice did not result in a dominant negative phenotype. PDZ1.2-Tg expression in WT
mice did result in a small, but statistically significant, decrease in endogenous PDZK1 protein
levels. It is not known what the mechanism behind this effect on PDZK1 protein level is, though
110
one might speculate that PDZ1.2 and endogenous PDZK1 interact (form heterodimers) which
causes the endogenous PDZK1 protein to be unstable. It is also not clear if PDZl.2 might have
been able to affect SR-BI expression through a decrease in endogenous levels of PDZK1 had
PDZ1.2 been expressed at higher levels. Similarly, PDZ1.2.3-Tg expression may have been too
low to exhibit a dominant negative phenotype. As was the case with PDZ 1-Tg expression,
expression of the PDZl.2-Tg and PDZ1.2.3-Tg in the livers of PDZK1 KO mice partially
restored SR-BI abundance. Also, as in PDZK1 KO [PDZ1-Tg] mice, the SR-BI protein that was
present in PDZK1 KO [PDZl.2-Tg] mice was mislocalized intracellularly. In contrast, PDZK1
KO [PDZ1.2.3-Tg] mice exhibited a marked increase in steady-state cell-surface localization,
which was accompanied by a small, but statistically significant, decrease in plasma cholesterol
levels. These results demonstrated that the expression of the third PDZ domain of PDZK1, in the
context of the first two PDZ domains, can influence the intracellular localization of SR-BI, and
suggested that cellular components that bind to these domains could also play a role in SR-BI's
intracellular localization. Furthermore, we conclude from these investigations that a structural
feature or features C-terminal to the PDZ three domain (but N-terminal to the PDZ-binding
motif) is required for normal SR-BI regulation, and that these structural features likely influence
hepatic SR-BI regulation through their interactions with other cellular components.
The results of these studies lead to the question: what structural features C-terminal to
PDZ3 on PDZK1 are required for normal SR-BI expression and function? We have begun to
explore this question by generating the PDZ1.2.3.4 transgene and expressing it in the livers of
WT and PDZK1 KO mice. Though our results are preliminary, the cholesterol data from these
mice indicate that expression of all four PDZ domains of PDZK1 does not result in a change in
plasma cholesterol levels or lipoprotein size distribution in WT mice, but does restore the plasma
cholesterol levels and lipoprotein size distribution to normal in PDZK1 KO mice. If these results
bear out, and further investigations demonstrate that PDZ1.2.3.4 restores normal hepatic SR-BI
abundance, localization and function in PDZK1 KO mice, this would indicate that the first four
PDZ domains of PDZK1, expressed without the C-terminal tail, are sufficient to restore normal
hepatic SR-BI function. This would suggest that those cellular components that bind to the fourth
domain play a critical role in PDZK 1-dependent regulation of hepatic SR-BI. It would also
suggest that the C-terminal tail of PDZK1 is not necessary for hepatic SR-BI expression and
function.
We have also begun the analysis of additional mutants of PDZK1 that lack the ability to
bind the C-terminus SR-BI (the point mutant MUT2, and the truncation mutant PDZ2.3.4) (in
Chapter 4). Results from these experiments are not conclusive at this time, but may also prove
informative with additional work.
There are several models that could explain why the PDZl.2.3 transgene resulted in
partial restoration of hepatic SR-BI protein abundance and localization in PDZK1 KO mice, but
overexpression of the PDZ1.2.3.4 transgene resulted in normal SR-BI function, and therefore
likely expression and localization. For example, protein interactions through both the PDZ3 and
PDZ4 domains of PDZK1 might be crucial for normal SR-BI expression and localization. But if
PDZ4 and its bound protein are required to stabilize the interaction between PDZ3 and its
partner, this might explain why PDZ1.2.3 gave partial restoration of SR-BI expression and
localization. Additionally, dimerization of PDZK1 may play a role in its regulation of hepatic
111
SR-BI, and might explain the partial restoration of hepatic SR-BI expression and localization in
PDZ1.2.3-Tg mice. Though the C-terminal PDZ-binding motif of PDZK1 is not necessary for
hepatic SR-BI expression, PDZ domains are known to dimerize through other less common
mechanisms, such as by binding internal sequences or through interactions between the 13A
strands of their individual PDZ domains (3-7). Though there is no evidence that PDZK1
homodimerizes, other PDZ proteins are known to form homodimers (3). If homodimerization of
PDZK1 were required for normal SR-BI localization and expression, it is possible that PDZ1.2.3
gave partial restoration of SR-BI expression and localization because this truncation mutant is
able to weakly dimerize. However, if PDZ1.2.3.4 is capable of dimerizing tightly, this would
result in the full restoration hepatic SR-BI function seen in preliminary results. Investigations
into whether or not PDZK1 is found in a homodimeric form would give insight into this possible
model.
There are a number of points in the life of an SR-BI protein that PDZK1 may exert its
effect on hepatic SR-BI abundance and regulation. Expression of PDZ1 results in increased
hepatic SR-BI protein levels, presumably through binding to the C-terminus of SR-BI. This
suggests that binding of the PDZ1 domain to SR-BI may result in greater SR-BI protein stability,
possibly by blocking degradation of SR-BI in the endoplasmic reticulum or by blocking
degradation in the late endosome or lysosome. If SR-BI is degraded in the late endosome or
lysosome, it may get there either by direct transport, or by endocytosis of SR-BI from the plasma
membrane. PDZK1 may affect hepatic SR-BI expression and localization by targeting SR-BI to
the cell surface or by affecting its endocytosis (blocking endocytosis or promoting recycling
back to the cell surface).
In addition, it is important to note that hepatocytes are polarized cells, and hepatic SR-BI
is found mainly on the basolateral surface (8). It is possible that the localization of SR-BI to the
basolateral surface, not just to the plasma membrane, is necessary for normal protein levels.
Localization of proteins to the apical/ canalicular surface of hepatocytes is maintained by direct
transport of an apical protein from the Trans Golgi Network (TGN) to the apical membrane, or,
more commonly, by transcytosis of apical proteins from the basolateral surface, through the early
endosome and a subapical compartment, to the apical/canalicular surface (9). PDZ proteins have
been shown to play a role in the localization of proteins in polarized cells (10). In fact, loss of
PDZK1 is known to result in the mislocalization of hepatic Oatplal to an intracellular
compartment, rather than the basolateral surface, where it is normally localized (11). It is
possible that loss of PDZK1 results in loss of basolateral localization of hepatic SR-BI, leading
to increased endocytosis/ transcytosis and degradation. Interestingly, PDZK1 binds proteins
localized to the apical brush border surface in kidney cells, but binds SR-BI and Oatplal, both
basolateral proteins, in hepatocytes (1, 8, 11). Therefore, there may not be an intrinsic sorting
signal on PDZK1 for the apical or basolateral surfaces, but localization of PDZK1 may be due
solely to protein interactions (10). This again brings up the possibility that interactions between
PDZK1 and other proteins may affect hepatic SR-BI localization.
Future Investigations
From the results in all the transgenic lines examined in this thesis, it seems very likely
that interactions between PDZK1 and other proteins via the PDZ domains are likely to play a
crucial role in regulating hepatic SR-BI. Therefore, the next logical question is: what proteins in
112
the liver, in addition to SR-BI, bind hepatic PDZK1 and, together with PDZK1, control SR-BI
expression and localization? Given that expression of the first three PDZ domains of PDZK1
have been shown to control hepatic SR-BI levels and localization, it seems likely that other
proteins, interacting with the PDZ3 and possibly PDZ2 domains, play a key role in regulating
SR-BI cell-surface localization. Additionally, our initial results suggest that expression of all four
PDZ domains of PDZK1 is sufficient to restore hepatic SR-BI function. Proteins that interact
with the PDZ4 domain might play a critical role in regulating hepatic SR-BI. Identifying these
proteins will give insight into the mechanisms behind PDZKI's regulation of SR-BI. In addition,
insights into binding partners of PDZK1 in the liver might shed light on the post-transcriptional
mechanisms by which ciprofibrate, the PPARcc agonist, and an atherogenic diet containing
cholate and high levels of cholesterol suppress PDZK1 and SR-BI protein levels (12, 13).
Elucidation of these mechanisms may provide good drug targets for increasing hepatic SR-BI
expression and HDL-mediated reverse cholesterol transport.
It would also be valuable to further explore what role, if any, the C-terminal tail (amino
acids 455 - 519) of PDZK1 plays in the regulation of hepatic SR-BI. Previous work by
Nakamura et al. demonstrated a correlation between increased phosphorylation of PDZK1 and an
increase in hepatic SR-BI and PDZK1 protein levels in WT rats (14). If our preliminary results
from the PDZ1.2.3.4-Tg mice bear out, then this phosphorylation is not necessary for normal SRBI function, at least in the context of an overexpressed PDZ1.2.3.4 protein. However, even if this
is true, it is possible that phosphorylation of PDZK1 might be used to integrate as yet unknown
signaling pathways in the liver into the PDZK -dependent post-transcriptional regulation SR-BI.
Furthermore, it is unclear what roles PDZK1's structural features play in the PDZK 1dependent activation of eNOS via SR-BI and HDL. In a study by Zhu et al, knock-down of
PDZK1 abundance or expression of a PDZ1.2 equivalent in WT endothelial cells was found to
inhibit activation of Src by SR-BI/HDL. Src is a known player in the activation of eNOS by SRBI/HDL (15). Therefore, some structural feature or features of PDZK1 C-terminal to the PDZ2
domain is necessary for SR-BI/HDL-mediated eNOS activation. Expression of the truncation
mutants examined in this thesis in endothelial cells would give greater insight into the
mechanism behind this pathway for eNOS activation. Given that PDZK1 regulates endothelial
SR-BI in a different manner than hepatic SR-BI, it is quite possible that the structural features
that are key to regulating SR-BI function in these two tissues would differ. For example, though
we conclude from our studies of pTEM-Tg expression that the putative PDZ-binding motif at the
C-terminus of PDZK1 is not necessary for normal hepatic SR-BI expression on the cell-surface
and function, this does not preclude a role for hetero- or homodimerization of PDZK1 through
this motif in other PDZK 1-dependent mechanisms, such as regulating SR-BI in endothelial cells.
These PDZK1 truncation mutants could also be used to examine their effects on other
PDZK1 binding partners. PDZK1 is known to affect the intracellular localization and activity of
a hepatic organic anion transporter, Oatplal (11). PDZK1 also binds numerous proteins in the
intestines, kidneys, and cell lines (eg. CFTR) (see Table 2 in Introduction) (16). By expressing
these truncation mutants, it might be possible to discern how PDZK 1 affects these proteins and
what structural features of PDZK 1 are involved in the regulation of these hepatic and nonhepatic proteins.
113
Finally, PDZK1 does not affect SR-BI expression and function equally in all tissues. Loss of
PDZK1 expression results in a moderate (50%) decrease in SR-BI abundance in intestinal
epithelial cells, and no change in SR-BI expression, localization or function in steroidogenic
tissue, such as the adrenal gland, ovaries and testes (2). It is not known if this lack of PDZK1dependence for SR-BI expression is due to some intrinsic difference in the mechanism of
regulation of SR-BI between cell types. However, it is attractive to speculate that other 'PDZKllike' adaptor proteins might be at work in these extrahepatic tissues and that these adaptor
proteins act as a partial or full substitute for PDZK1. Identification of such adaptor proteins
would provide greater insight into the mechanisms behind extrahepatic SR-BI regulation.
114
References
1. Ikemoto, M., Arai, H., Feng, D., Tanaka, K., Aoki, J., Dohmae, N., Takio, K., Adachi,
H., Tsujimoto, M., Inoue, K. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6538-6543
2. Kocher, O., Yesilaltay, A., Cirovic, C., Pal, R., Rigotti, A., Krieger, M. (2003) J. Biol.
Chem. 278, 52820-52825
3. Hung, A. and Sheng, M. (2002) JBiol Chem. 277, 5699-5702
4. Hillier, B. J., Christopherson, K. S., Prehoda, K. E., Bredt, D. S., and Lim, W. A. (1999)
Science 284, 812-815
5. Im, Y. J., Lee, J. H., Park, S. H., Park, S. J., Rho, S. H., Kang, G. B., Kim, E., and Eom,
S. H. (2003) J Biol. Chem. 278, 48099-48104
6. Im, Y. J., Park, S. H., Rho, S. H., Lee, J. H., Kang, G. B., Sheng, M., Kim, E., and Eom,
S. H. (2003) J Biol. Chem. 278, 8501-8507
7. Fanning, A., Lye, M., Anderson, J., and Lavie, A. (2007) J. Biol. Chem. 282, 3771037716
8. Rigotti, A., Miettinen, H. E., and Krieger, M. (2003) Endocr. Rev. 24, 357-387
9. Wan, L., Boyer, J.L. (2004) Hepatology 39, 892-899
10. Brone, B., Eggermont, J. (2005) J Cell Physiol 288, C20-C29
11. Zhu, W., Saddar, S., Seetharam, D., Chambliss, K., Longoria, C., Silver, D., Yuhanna, I.,
Shaul, P., and Mineo, C. (2008) Circ. Res. 102, 480-487
12. Mardones, P., Pilon, A., Bouly, M., Duran, D., Nishimoto, T., Arai, H., Kozarsky, K.,
Altayo, M., Miquel, J., Luc, G., Clavey, V., Staels, B., and Rigotti, A. (2003) J. Biol.
Chem. 278, 7884-7890
13. Niemeier, A., Kovacs, W., Strobl, W., Stangl, H. (2008) Atherosclerosis In Press
14. Nakamura, T., Shibata, N., Nishimoto-Shibata, T., Feng, D., Ikemoto, M., Motjima, K.,
Iso-o, N., Tsukamoto, K., Tsujimoto, M., Arai, H. (2005) Proc. Natl. Acad. Sci. U.S.A.
102, 13404-13409
15. Wang, P., Wang, J., Xiao, Y., Murray, J., Novikoff, P., Angeletti, R., George A. Orr, Lan,
D., Silver, D., Wolkoff, A. (2005) J. Biol. Chem. 280, 30143-30149
16. Yesilaltay, A., Kocher, O., Rigotti, A. and Krieger, M. (2005) Curr Opin Lipidol 16,
147-152
115
116
APPENDIX 1
ISOLATING GENES RELATED TO
THE FUNCTION OF SR-BI, AN HDL
RECEPTOR
The work described in this appendix was performed during my first three years in the
Krieger Lab. After a lack of positive results, this project was deemed too risky, and was
discontinued in favor of a different project. I performed all of the experiments described, except
for generating the transduced MX-mSR-BI cell line, which was done by Roger Lawrence, a
former member of Robert Rosenberg's lab.
117
118
Summary
As discussed in the introduction and later chapters, the mechanisms behind regulation of
SR-BI-mediated lipid uptake are not clear. Though PDZK1 has been shown to regulate SR-BI in
the liver, it is not clear how SR-BI protein function is regulated in other tissues. Are there other
adaptor proteins that influence SR-BI function in extrahepatic tissues? Are there other proteins
necessary for SR-BI-mediated lipid uptake and efflux? What proteins control SR-BI's trafficking
and localization? To gain a better understanding of the mechanisms underlying SR-BI function, I
attempted to identify gene products and pathways that are necessary for SR-BI to function in the
cell using somatic cell genetics. SR-BI-expressing Chinese hamster ovary (CHO) cell mutants
were generated and mutants that lacked SR-BI-mediated lipid uptake from HDL were isolated.
To generate an SR-BI expressing cell line, LDL receptor-deficient CHO cells, called
LDLA7 cells, were transduced with the pMX-mSR-BI retrovirus vector. LDL receptor-deficient
cells were employed to allow SR-BI-mediated uptake of lipid from LDL particles to be examined
in any mutants generated. These cells were subcloned and tested for mSR-BI cDNA copy
number by Southern blot. To reduce the likelihood of isolating mutants in the SR-BI gene, an
LDLA7 [MX-mSR-BI] subclone (called MX8) that contained multiple copies (at least three) of
the SR-BI gene was used. These cells also exhibited high SR-BI selective uptake activity, as
determined by Dil uptake from DiI-labeled HDL by flow cytometry. DiI is a fluorescent lipid
and is a good surrogate for cholesteryl ester when analyzing lipid uptake from HDL (1).
Eighteen independently mutagenized populations were generated and sorted. The
mutagenesis was performed with ethyl methanesulfonate (EMS), which is known to generate
predominately point mutations. Since the functional loss of a protein with a broad function
(affecting more proteins than just SR-BI) could be lethal, it is preferable to have temperaturesensitive mutants; and creating point mutations with EMS increases the likelihood of this. To
isolate mutants in SR-BI-mediated lipid uptake, mutagenized cells were incubated at 39.50C (the
non-permissive temperature), labeled with DiI-HDL, and sorted by fluorescence-activated cell
sorting (FACS). Cells were sorted for low DiI uptake by collecting the least fluorescent cells
(-0. 1% of untreated MX8 cell intensity). By sorting for uptake negative cells at the nonpermissive temperature before looking for SR-BI uptake activity at the permissive temperature,
this allowed for the isolation of both temperature-sensitive and non-temperature-sensitive
mutants. From the eighteen original mutagenized populations, three mutant populations were
isolated that exhibited a loss of Dil-uptake. These mutants were not temperature-sensitive, and
all had lost SR-BI cell surface expression (determined by fluorescent antibody labeling), and had
little or no SR-BI expression in total cell lysates (determined by immunoblotting). One
subcloned mutant cell population, MX8B-2, showed no detectable SR-BI protein expression by
metabolic labeling. Another mutant subclone, MX8F-2, had reduced SR-BI expression, and the
remaining SR-BI protein was Endoglycosidase -H sensitive, indicating that there was no defect
in endoplasmic reticulum to medial Golgi transport. The phenotype in these cells was rescued by
transient transfection of the SR-BI gene. The third mutant, MX8D, which was not subcloned, had
an even greater reduction in SR-BI expression, and, again, all of the SR-BI protein was EndoH
sensitive. Therefore, it was determined that the loss of or great reduction in SR-BI expression in
these mutants was due to a defect within the pMX-SR-BI gene, and probably not due to a
mutation in proteins affecting SR-BI-mediated lipid uptake.
119
Due to the lack of positive results, the large amount of time it took to attempt new
approaches, and the generally risky nature of the project, this project was not continued.
Experimental Procedures
Generation of MX8 cells and Mutant Isolation: LDLA7 CHO cells were transduced by
pMX-mSR-BI retrovirus as previously described (2), and subcloned. To test for the number of
SR-BI cDNA copies, genomic DNA from subcloned CHO cells was isolated and doubledigested (15 ýtg DNA/reaction) with Sph I (25 units) (cuts once within mSR-BI cDNA) and Mfe
I (50 units) (does not cut within mSR-BI cDNA) or Bcl I (cuts once within mSR-BI cDNA) and
BsiW I (does not cut within mSR-BI cDNA). Digested DNA was run on a 0.7% TBE agarose gel
(with a Lambda/ HindIII marker), depurinated with 0.25 M hydrochloric acid, denatured in a 1.5
M NaC1, 0.5 M NaOH solution, and transferred to Hybond N+ nylon membrane (Amersham) by
capillary blotting. 32 P-dCTP-labeled probe (corresponding to nucleotides 1180-1600 of the mSRBI cDNA sequence) was generated using the Ready-To-Go DNA labeling beads (Amersham) kit
and protocol. Hybridization of probe to the blot was performed using ExpressHyb Hybridization
solution and protocol (Clonetech), and detected by autoradiography.
To mutagenize the cells, MX8 cells were set at approximately 400,000 per T75 flask on
day 0, and incubated overnight at 340 C in Hams F12 medium + glutamine (2 mM), penicillin
(100 units/ml), streptomycin (100 pg/ml) and 5% (v/v) fetal bovine serum (Medium A). On day
1, cells were incubated with Medium A + 400 ýtg/ml EMS for -20 hours. Media was then
removed and cells were washed extensively (5xl0mls phosphate buffered saline (PBS). Medium
A was added and cells were allowed to recover and grow for 12-15 days at 340 C.
To isolate mutants by FACS sorting, LDLA7 and MX8 cells (mutagenized populations
and controls) were set at approximately 2.5 x 106/100 mm dish on day 0 and incubated at 340 C.
On day 1, the cells were switched to the non-permissive temperature (39.5o C) and incubated for
12 hours before labeling with DiI-HDL (5-10 ptg/ml) in Hams F12 + glutamine (2 mM),
penicillin (100 units/ml), streptomycin (100 pg/ml) + 5% fatty-acid free bovine serum albumin
or 3% newborn calf lipoprotein deficient serum (Medium B) for 1.5 hrs at 39.5' C. Cells were
washed, trypsinized, and resuspended in HEPES + penicillin (100 units/ml), streptomycin (100
pg/ml) + 5% fatty-acid free bovine serum albumin or 3% newborn calf lipoprotein deficient
serum. Cells were sorted by FACS and the least fluorescent cells (-0. 1% of untreated MX8 cell
intensity) were collected in Medium A. These cells were then cultured at 340 C before sorting
again. Populations enriched in mutants were subcloned by sorting directly into 96-well plates at
I cell/ well.
FACS Analysis of Mutants: Sorted mutagenized populations were analyzed by FACS to
examine their DiI-HDL uptake activity and SR-BI cell-surface localization. DiI-HDL uptake
analysis was performed as described for sorting, except incubations at both 39.5' C and 340 C
were performed to determine if mutants were temperature-sensitive. SR-BI cell-surface
localization analysis was performed by incubating cells with an anti-SR-BI antibody, KKBI,
which binds the extracellular domain of SR-BI (3) (at 1:1000 in Medium B) at 39.50 C or 34' C
120
for 1 hour, followed by an incubation with a FITC-conjugated goat anti-rabbit IgG (1:1000 in
Medium B) for 1 hour.
Immunoblotting, Pulse-labeling and Endoglycosidase-H analysis: Immunoblotting
was performed as described in Chapters 2, 3, and 4. Endoglycosidase-H analysis was performed
as described in Chapter 2. Metabolic labeling of cells was performed as previously described (4).
References
1. Acton, S., Rigotti, A., Landshulz, K., Xu, S., Hobbs, H., Krieger, M. (1996) Science 271,
518-520
2. Gu, X., Lawrence, R., Krieger, M. (2000) J. Biol. Chem. 275, 9120-9130
3. Gu, X., Kozarsky, K., and Krieger, M. (2000) J. Biol. Chem. 275, 29993-30001
4. Hobbie, L., Fisher, A., Lee, S., Flint, A., Krieger, M. (1994) J Biol. Chem. 269, 2095820970
121