Molecular Studies of Longevity-Associated Genes in Yeast and Mammalian Cells
by
Gregory Liszt
B.S. Molecular, Cellular, and Developmental Biology
Yale University
Submitted to the Department of Biology
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY IN BIOLOGY
at the
Massachusetts Institute of Technology
February, 2006
©2005 by Gregory Liszt. All rights reserved.
The author hereby grants to MIT permission to reproduce
and distribute publicly paper and electronic copies of this
thesis document in whole or in part.
I
\
Signature of Author
1
";'-V
Certified by
-
of Biology
1-/~'epartment
x
Leonard Guarente
Novartis Professor of Biology
Thesis Supervisor
byEm.,
" Accepted
Stephen Bell
Chairman, Biology Graduate Committee
.A
. A. U. IT ,, , ,,
,,, -
I MASSACHusEtTTS INS'-"T!iE'
OF TECHNOLOGY
I
Ii
NnVnv 4 9flfnsi
1
LIBRARIES
ARCHIVES
Molecular Studies of Longevity-Associated Genes in Yeast and Mammalian Cells
by
Gregory Liszt
Submitted to the Department of Biology on
October 25, 2005 in Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy in Biology
ABSTRACT
Aging is a complex process affecting diverse organisms from bacteria to humans.
Despite strong evolutionary arguments against the conservation of a single mechanism of
aging, a variety of conserved single gene mutations have been found to extend life span
and stave off aging in several different species. The study of these mutations yields
important insights into the biology of aging.
In Saccharomyces cerevisiae, aging can be studied by mutations that extend the
replicative potential of mother cells. With successive cell divisions, instability at the
rDNA locus and extrachromosomal rDNA circle accumulation exponentially increase the
likelihood of senescence and mortality. Aging can be forestalled by caloric restriction, a
regimen that increases the activity of Sir2p, an NAD-dependent protein deacetylase and
important regulator of aging in yeast and some metazoans. Caloric restriction activates
respiration, reducing cellular NADH levels and relieving the competitive inhibition of
Sir2p by this metabolite.
SSD1 promotes longevity by a Sir2p-independent mechanism that affects neither
ERC formation nor rDNA silencing. Ssdlp directly represses the translation of the
mitochondrial and cell wall glycoprotein Uthl.
This repression, which requires a
physical interaction between Ssdlp and the 5'-UTR of the UTH1 mRNA, is necessary
and sufficient to account for diverse effects of Ssdlp on cell integrity, stress resistance,
and life span.
Future studies should determine whether Ssdl plays a role in the
maintenance of longevity in higher organisms.
Mammalian genomes contain seven Sir2 homologs (SIRT1-7) involved in diverse
processes including fat and muscle cell differentiation, p53- and FOXO-dependent
apoptosis, stress resistance, and DNA-damage repair. Mouse SIRT6, a nuclear protein, is
3
broadly expressed throughout the body and displays a robust auto-ADPribosyltransferase activity unique among Sir2 family members. SIRT7, a nucleolar
homolog of Sir2, physically interacts with RNA polymerase I (Pol I), colocalizing with
the Pol I complex at the transcribed regions of the rDNA.
SIRT7 activates rDNA
transcription by an enzymatic mechanism, suggesting a novel model coordinating cellular
energy status with ribosome biogenesis via changes in SIRT7 activity.
Thesis Supervisor: Leonard Guarente
Title: Novartis Professor of Biology, MIT
4
DEDICATION
This thesis is dedicated to my parents, Miki and Harvey Liszt.
5
ACKNOWLEDGEMENTS
First, I thank my thesis advisor Leonard Guarente for his guidance, wisdom, patience and
understanding, all of which were indispensable to my success in graduate school. I am very lucky
to have had you as a teacher.
I would also like to thank my thesis committee: Rick Young, Peter Sorger, Paul Garrity,
and David Sinclair.
I thank Matt Kaeberlein for scientific insight, project ideas, collaboration, and general
inspiration.
Profound thanks go to the members of Crooked Still (Rushad Eggleston, Corey DiMario,
and Aoife O'Donovan) for inspiring me musically and making these years in grad school so
unbelievable and adventurous.
Special thanks go to Ethan Ford for constantly sharing his insights, teaching me so many
lab techniques, collaborating with me scientifically, and keeping me company for so many years.
We had a good run of it.
Special thanks also go to Nick Bishop, whose passion for the science of aging and
beatboxing skills have always kept me inspired. Sorry to have abandoned you so close to the end.
And thanks for the help with the Xmas Rap.
Thanks to Andy Tolonen, my roommate, classmate, running partner, and good friend.
Thanks to Kayvan Zainabadi for scientific insights and personal advice.
Thanks to Martin Kurtev for always bringing life to the lab when no one else was around.
I would also like to thank the entire Guarente lab for scientific and social camaraderie
over the last six years. I have been lucky to share the company of so many brilliant and helpful
people. Especially my collaborators, Matt Kaeberlein, Su-Ju Lin, Ethan Ford, and Martin Kurtev,
without whom I would never have finished this thesis.
Thanks to Sarah Buckley for being a great UROP.
Thanks to all the musicians who have enriched my life here in Boston, especially Jake
Armerding, Casey Driessen, the Wayfaring Strangers, and everyone from the Cantab.
And most importantly, thanks to my family: Miki and Harvey Liszt, for their profound
love and support; Jeff, for all that plus being a best friend; Danielle, for being such an inspiring
future sister-in-law; Nonni for being such an amazing person and loving grandmother; and Aunt
Mimi and Uncle Bev for always being there for me.
6
TABLE OF CONTENTS
Title
1
Abstract
3
Dedication
5
Ackowledgements
6
Table of Contents
7
Chapter 1:
11
Introduction - Genetic Pathways of Aging from Yeast to Mammals
Why study aging in model organisms?
12
Aging in Yeast
14
Early Studies
Extrachromosomal rDNA Circles: A Cause of Aging
Sir2p, a Central Regulator of Aging
Caloric Restriction and the Regulation of Sir2p
Polymorphisms Affecting Aging
Chronological Aging
Conservation of Aging Pathways in Metazoans
Insulin/IGF-1 Pathway
14
17
19
23
27
32
33
33
Sir2 and Calorie Restriction
35
Other Sirtuins
Summary and Conclusions
39
41
References
43
Figures
54
Chapter 2:
61
Ssdlp Directly Represses Translation of Uthlp to Increase Longevity,
Stress Resistance, and Cell Wall Stability in Saccharomyces cerevisiae
Summary
Introduction
Materials and Methods
62
63
66
Results
72
Discussion
References
77
85
Tables and Figures
91
7
Chapter 3:
107
Mouse Sir2 Homolog SIRT6 is a Nuclear ADP-Ribosyltransferase
Summary
Introduction
108
109
Materials and Methods
112
Results
Discussion
References
Figures
117
123
126
130
Chapter 4:
143
Conclusions
Ssdlp and Uthlp
144
Sir2 and CR
SIRT6 and SIRT7
References
147
148
150
Appendix A:
153
Saccharomyces cerevisiae SSDI-V Promotes Longevity by a Sir2pIndependent Mechanism
Summary
Introduction
Materials and Methods
Results
Discussion
References
Tables and Figures
154
155
157
159
165
169
174
8
Appendix B:
193
Calorie Restriction Extends Life Span by Lowering the Level of NADH
Summary
Introduction
194
195
Results and Discussion
Materials and Methods
References
Tables and Figures
197
201
204
207
Appendix C:
212
The Mammalian Sir2 Protein SIRT7 is an Activator of RNA
Polymerase I Transcription
Summary
213
Results and Discussion
214
Materials and Methods
References
222
227
Figures
230
9
10
Chapter 1
IntroductionGenetic Pathways of Aging from Yeast to
Mammals
11
WHY STUDY AGING IN MODEL ORGANISMS?
Although we all possess an intuitive understanding of what it means to age, the
scientific study of aging has proven notoriously complex.
Aging, after all, is
characterized by the modification or breakdown of nearly every system within an
organism, and distinguishing the important changes from the unimportant ones poses a
daunting problem. Indeed, aging differs drastically from most other basic biological
processes in that aging is primarily a nonadaptive trait, conferring no benefit to the
individual. As such traits arise precisely because of the lack of natural selection, there is
no reason to believe that natural selection would conserve a particular mechanism of
aging throughout evolution.
For this reason, the study of aging in model organisms, which began in earnest in
the 1990's, was met with skepticism (and even some ridicule). In the wild, very few
organisms even survive to reach old age (reviewed in (Kirkwood, 2005), instead dying of
causes such as predation, starvation, cold, accident, etc. Therefore, throughout evolution
very little pressure has selected for alleles that confer benefits late in life. Evolutionary
theory thus holds that aging should consist of the incidental failure of several systems
rather than the onset of a specific program controlled by particular genes.
The discovery of numerous conserved single gene mutations slowing aging and
extending life span thus opened a rift between evolutionary theory and experimental
reality. As a result, the control of aging has been rethought in evolutionary terms, and is
now commonly regarded as possessing significant adaptive benefit. Which is not to say
that aging results from the execution of a specific genetic program, merely that the
generalized decay of aging can be prevented by means that have evolved over time.
12
Consider the case of dietary restriction, discussed in detail later in this chapter: This
intervention, which entails reducing excess food consumption, has been shown to extend
the life span of a variety of organisms (Guarente and Picard, 2005; Merry, 2002), likely
involving by activating a conserved genetic mechanism. One hypothesis explaining this
finding is that organisms with the ability to stave off aging and postpone reproduction
during times of nutrient scarcity are at a tremendous selective advantage over those that
maintain a constant rate of aging under such conditions. Consistent with this hypothesis,
calorie-restricted rodents show signs of increased physiologic maintenance function and
reduced reproduction (Weindruch et al., 2002), both of which would prime them for
Darwinian success should food conditions improve and their physiology return to normal.
This chapter details several of the main advances in model systems aging
research, also addressing the extent to which genetic control of aging is conserved
between species. Genomic stability, metabolism, and stress resistance appear as common
themes in aging from yeast to mammals. In metazoans, control of these processes is
superimposed against hormonal signaling pathways, with endocrine regulation emerging
as a key means of regulating the rate of aging.
In the chapters that follow, the goal of the research is two-fold: first, to arrive at a
more complete understanding of aging in the unicellular model organism Saccharomyces
cerevisiae, and second, to begin to apply the knowledge of yeast aging to the more
complex mammalian systems.
13
AGING IN YEAST
Early studies
Background:
Over 45 years ago, Mortimer and Johnston made the observation that was to
become the basis for the application of genetic analysis to the study of aging. Observing
the repeated divisions of individual yeast mother cells, these scientists noted that in a
genetically identical population of yeast, each cell ceased to divide after giving birth to a
finite number of daughter cells (Mortimer and Johnston, 1959). For a given strain of
yeast, the likelihood of mortality increased exponentially with increasing numbers of cell
divisions.
When Mortimer and Johnston plotted their data, they made a striking
observation: that the mortality curve for a population of yeast closely resembled the
mortality curves for many other organisms, including humans (Figure 1). The study of
yeast aging was born.
In the decades that followed, radical advances characterized the study of yeast
biology. On the forefront of genetic research, yeast provided an invaluable model system
for the investigation of such basic biological processes as the cell division cycle, the
secretory pathway, and the DNA damage response, among many others. However, it was
not until the 1990's that the powerful tools of molecular biology, combined with the
resources of the fully sequenced yeast genome, were applied to the study of yeast aging
(Sinclair et al., 1998).
Budding yeast reproduce by asymmetric cell division, with a pre-existing mother
cell giving birth to a smaller daughter cell consisting predominantly of newly-synthesized
materials (Guthrie and Fink, 1991). Practically, this asymmetry of cell division enables
14
the microscopic separation of mother and daughter cells upon completion of cytokinesis,
forming the experimental basis of the yeast life span assay. Mean and maximum lifespan
are relatively constant for a given strain, although different strains of yeast vary
drastically over a mean life span range of less than 15 generations to greater than 30
(Sinclair et al, 1998). This initial finding demonstrated a strong genetic influence on
longevity, and encouraged the search for single gene mutations affecting the rate of
aging.
Age-relatedchanges:
Aging in yeast is accompanied by a battery of phenotypic changes, ranging from
obvious changes in cell size (Mortimer and Johnston, 1959) to more subtle differences in
transcription and protein localization (Kennedy et al., 1997; Mortimer and Johnston,
1959; Smeal et al., 1996). Mortimer and Johnston hypothesized, a priori, that the onset
of senescence is caused when cell volume reaches some upper limit (Mortimer and
Johnston, 1959). Three lines of evidence now refute that hypothesis. First, inducing an
increase in size by temporary G1 arrest fails to shorten life span (Kennedy et al, 1994).
Second, populations of old senescent cells span a wide range of sizes, defying a critical
prediction of Mortimer and Johnston's hypothesis (G.L., unpublished observation).
Finally, of the multitude of single gene changes known to extend life span, very few
affect cell size (Bitterman et al., 2003).
Age-dependent changes in cell surface characteristics also accompany the journey
into yeast old age. Notably, each round of cell division leads to the deposition of a chitin
bud scar on the surface of the mother (but not the daughter) cell. These bud scars can be
stained with calcofluor white, permitting visualization under a microscope and enabling
15
the determination of cell age. Early hypotheses attributing bud scar accumulation as the
cause of aging have now been generally refuted (Sinclair et al., 1998), mostly on the
grounds that induced chitin accumulation on the cell surface does not curtail life span
(Egilmez and Jazwinski, 1989). Also, theoretical models of the yeast cell surface
estimate that the cell wall can accommodate more than three times the number of bud
scars than usually accumulate over the course of normal aging (Sinclair et al., 1998).
The first molecular phenotype associated with aging in S. cerevisiae was a loss of
transcriptional silencing (Smeal et al., 1996), and it was the characterization of this
phenotype that ultimately led to the discovery of SIR2 as a central regulator of yeast
aging (Kaeberlein et al., 1999). Haploid yeast cells typically exist as one of two distinct
mating types, known as MATa and MATa, determined by the sequence of the gene
expressed at the MAT locus. Although mating type information is only expressed from
the single allele present at the MAT locus, haploid yeast harbor silenced copies of both
mating type alleles, present at HM loci (Guthrie and Fink, 1991). Under normal
conditions, silencing of these loci is accomplished by the SIR (Silent Information
Regulator) protein complex, consisting of Sir2p, Sir3p, and Sir4p (Gottschling et al.,
1990; Ivy et al., 1986; Rine and Herskowitz, 1987). The SIR complex also directs
silencing at telomeres (Gottschling et al., 1990), where gene expression is abolished over
telomeric repeats and nearby subtelomeric regions. Sir2p, the catalytic component of this
complex, is an NAD+ dependent protein deacetylase (Imai et al., 2000; Landry et al.,
2000b; Smith et al., 2000), and is discussed at length later on in this chapter.
Progressive sterility has been shown to affect aging yeast mother cells (Muller,
1985), and this phenotype is now known to be attributable to changes in the localization
16
of the SIR complex (Smeal et al., 1996). This molecular phenotype of aging is most
likely an effect of the aging process rather than a cause, as deletion of the HM loci cures
age-related sterility without extending cellular life span (Kaeberlein et al., 1999; Smeal et
al., 1996). Interestingly, telomeric silencing is lost with age (Kim et al., 1996), and this
loss of silencing correlates with the absence of the SIR complex. The current explanation
for these findings is that the SIR complex relocalizes to the nucleolus to counteract the
nucleolar instability that eventually limits mother cell division (Kennedy et al., 1997;
Sinclair et al., 1998; Sinclair and Guarente, 1997). Supporting this model, the long-lived
SIR4-42 mutant constitutively relocalizes the entire SIR complex to the nucleolus, even
in young cells, thereby forestalling nucleolar fragmentation and prolonging life span
(Kennedy et al., 1997).
Extrachromosomal rDNA Circles: a Cause of Aging
The first molecular cause of aging to be determined for yeast synthesized these
findings and provided a rationale for the importance of the nucleolus in cellular
senescence (Sinclair and Guarente, 1997). The yeast nucleolus houses the rDNA, a
tandem array of 150-200 repeated copies of the genes encoding ribosomal RNA (rRNA).
Each 9.1 kb repeat encodes a 35S rRNA and a 5S rRS and 5S rRNAs are transcribed in
opposing directions, after which the 35S RNA is processed into mature 25S, 18S, and
5.8S rRNA molecules (reviewed in (Nomura, 2001). According to current evidence, the
stalling of the replication fork within the rDNA triggers the induction of homologous
recombination, as DNA repair enzymes recognize this feature and process it into a double
stranded break (Kim and Wang, 1989; Park et al., 1999). Homologous recombination
17
between neighboring rDNA repeats has been shown to result in excision of circular
molecules containing one or more complete copies of the rDNA unit (Park et al., 1999),
each one of which directs its own replication through the presence of three ARS
consensus sequences. Of these three potential origins of replication, it is estimated that
an average of one fires each S phase (Miller and Kowalski, 1993). Importantly, the same
extrachromosomal rDNA circles (ERCs) that multiply exponentially with each successive
round of cell division predominantly fail to segregate to daughter cells, instead
accumulating in mother cells at levels approaching 1000 copies per cell (Sinclair and
Guarente, 1997). This number of ERCs contains a quantity of DNA roughly equivalent
to all the rest of the yeast genome.
Several lines of experimental analysis have supported an ERC model of aging,
indicating that ERC accumulation is not just a hallmark of yeast aging but actually a
cause. First, the ectopic release of an ERC in young cells accelerates the onset of
senescence, demonstrating that formation of an ERC is limiting for life span (Defossez et
al., 1999; Sinclair and Guarente, 1997). Second, mutation of the rDNA unidirectional
replication fork block component Foblp eliminates ERC formation and extends life span
(Defossez et al., 1999). Indeed, most mutations extending the yeast life span in a strainindependent manner correlate with reduced ERC levels and can be rationalized by their
effects on ERC formation and accumulation (Kaeberlein et al., 2005).
18
Sir2p, a central regulator of aging
Geneticanalysis:
Multiple studies from the last six years have established an important role for
Sir2p as a central regulator of aging (Anderson et al., 2003a; Kaeberlein et al., 1999; Lin
et al., 2000; Lin et al., 2002). While the other members of the SIR complex indirectly
affect aging through modulation of silencing at the HM loci and telomeres (Kaeberlein et
al., 1999), Sir2 plays an independent role in establishing rDNA heterochromatin (Bryk et
al., 1997) and repressing the unequal crossing-over responsible for ERC formation
(Kobayashi et al., 2004) and, hence, normal aging. At the nucleolus, Sir2p acts within
the RENT (regulator of nucleolar silencing and telophase exit) complex, whose other
members Netlp, Cdc14p, and Nanl (Ghidelli et al., 2001; Shou et al., 2001) have not
been implicated in the aging process. The initial observation that SIR2/sir2 heterozygous
diploids displayed an intermediate life span between those of the two homozygotes
suggested that Sir2p dosage might be limiting for life span (Kaeberlein et al., 1999).
Indeed, addition of a single extra copy of SIR2 extends life span of multiple strains by up
to 40%, while the deletion of SIR2 shortens life span by approximately 50% in several
strain backgrounds (Kaeberlein et al., 2005; Kaeberlein et al., 1999). Consistent with the
ERC model of aging, SIR2 levels correlate not only with life span but also with ERC
levels and rate of marker gene loss by rDNA recombination. Interestingly, a recent study
indicates that Sir2p influences not the overall rate of rDNA recombination, but rather the
relative frequency of unequal sister chromatid crossing over between different rDNA
repeats, hence creating the appearance of increased total recombination in rDNA marker
loss and ERC accumulation assays (Kobayashi et al., 2004).
19
Providing further support for the role of Sir2p in ERC-mediated aging, genetic
analysis has shown that fobl deletion and SIR2 overexpression fail to additively increase
life span, and are therefore likely to affect aging through the same pathway (Kaeberlein et
al., 1999). By a similar token, fobl deletion restores wild type life span to a sir2 mutant,
most likely by rescuing the increased ERC formation caused by sir2 mutation.
Biochemistry:
Due to its ability to promote silencing, Sir2p was long suspected of possessing
histone deacetylase activity. Despite the fact that Sir2p levels were known to correlate
with histone deacetlylation at targeted areas of the yeast genome (Braunstein et al., 1993;
Grunstein, 1997; Jenuwein and Allis, 2001) attempts to demonstrate an in vitro
deacetylation activity for Sir2p met with years of failure. In 1999, however, major strides
were made in the enzymology of Sir2p and its metazoan homologs.
Initially, Sir2p and
several homologs were found to possess an ADP-ribosyltransferase activity, catalyzing
the breakdown of a nicotinamide adenine dinucleotide (NAD) substrate and the addition
of an ADP-ribose moiety to target proteins (Frye, 1999; Tanny et al., 1999). However,
this reaction was soon overshadowed by the discovery of a more robust NAD-dependent
histone deacetylase activity present in yeast Sir2p as well as its closest mouse homolog,
SIRT1 (Imai et al., 2000; Landry et al., 2000b; Smith et al., 2000). In yeast, this activity
is essential for the maintenance of silencing and life span, as mutations abolishing
deacetylation generally eliminate silencing in vivo and shorten life span (Imai et al.,
2000). Interestingly, some mutations in conserved residues of.Sir2p affect in vitro
histone deacetylase activity and in vivo silencing differently (Armstrong et al., 2002),
20
suggesting that Sir2p might influence silencing by deacetylating non-histone substrates
within the cell. Despite this inconsistency, Sir2p has been shown to display a substrate
preference for lysine 16 of the histone H4 (Imai et al., 2000; Landry et al., 2000b; Smith
et al., 2000), a tail residue critical for silencing.
Several unique features characterize the Sir2p enzymatic reaction. Unlike other
histone deacetylases, the Sir2, or Class III, deacetylases are not inhibited by trichostatin
A (Imai et al., 2000). Histone deacetylation by Sir2p also cannot proceed without NAD,
nor can other nicotinamide adenine dinucleotides such as NADH, NADP, or NADPH
substitute for NAD (Imai et al., 2000). In fact, NADH and nicotinamide both function as
effective inhibitors of Sir2p catalytic activity, providing an effective mechanism for
regulating Sir2p function in vivo (Anderson et al., 2003a; Bitterman et al., 2002; Lin et
al., 2004). The enzymology of NADH inhibition is discussed in detail in Appendix 2,
along with the in vivo consequences of this inhibition in calorie-restricted cells.
The requirement of NAD for the Sir2 enzymatic reaction is also unexpected for
thermodynamic reasons. The deacetylation reaction catalyzed by trichostatin A-sensitive
HDACs, a simple hydrolysis reaction, is energetically favorable, begging the question of
why Sir2 would couple such a reaction to the breakdown of NAD, a metabolically
important compound (Bitterman et al., 2003). Curiously, NAD is not a cofactor in the
Sir2-catalyzed reaction but is actually consumed by it, with hydrolysis of a glycosidic
bond occurring between the nicotinamide and ADP-ribose moieties. The complete
reaction catalyzed by Sir2 encompasses two hydrolysis steps that are likely coupled
(Landry et al., 2000a; Min et al., 2001; Tanner et al., 2000). In the first of these, the
aforementioned glycosidic bond within NAD is hydrolyzed, releasing a predicted 8.2kcal
21
of free energy per mol (Moazed, 2001). Subsequently, the C-N bond between the acetyl
group and lysine is hydrolyzed in a deacetylation reaction that occurs with 1:1
stoichiometry. The final peculiarity of this reaction is that Sir2 catalyzes the transfer of
the acetyl group to the ADP-ribose cleaved from NAD, resulting in the formation of Oacetyl ADP-ribose (AAR) (Jackson and Denu, 2002; Liou et al., 2005; Tanner et al.,
2000).
Thus, the Sir2 reaction produces two major products in addition to deacetylated
lysine: nicotinamide and AAR. While Sir2p is generally believed to influence silencing
through the deacetylation of histone H4, it is formally possible that any of these three
products of the Sir2 reaction could be required for creation and maintenance of the
silenced state. Nicotinamide, a precursor of nicotinic acid in the cell, has been shown to
strongly inhibit Sir2 enzymatic activity (Bitterman et al., 2002; Jackson et al., 2003) even
doing so in several in vivo contexts, discussed below. The function of O-acetyl ADP
ribose, however, has been somewhat elusive. This molecule was originally proposed to
trigger some sort of signal transduction cascade, as metabolic instability of the type it
displays is a hallmark of many signal transduction initiatiors (Jackson and Denu, 2002).
Experimentally, injection of AAR has been shown to block cell cycle progression of
Xenopus oocytes (Borra et al., 2002), consistent with this model.
More recently,
however, AAR has been shown to play an integral role in the assembly of the SIR
complex in yeast, promoting the association of multiple copies of Sir3p with Sir2p/Sir4p
and inducing important structural changes in this complex as a result (Liou et al., 2005).
22
Caloric Restriction and the Regulation of Sir2p
Requirement of SIR2 and NAD+ in CR
The question of how Sir2 is regulated emerged at the forefront of aging research
with the observation that this protein is required for life span extension induced by caloric
restriction (Lin et al., 2000). For almost 70 years, it has been known that decreasing the
amount of food consumed by laboratory rodents significantly lengthens their life span
and promotes youthful vigor (McCay et al., 1989). Studies have since shown that
variation of calorie content was the critical factor retarding the aging process (Masoro,
1984a; Masoro, 1984b; Weindruch et al., 1988), and calorie restriction (CR), as it has
come to be known, is now known to extend life span of diverse species ranging from
yeast (Lin et al., 2000) to possibly even primates (Ingram et al., 2004). In yeast, CR can
be accomplished by two different methods: reducing the glucose content of the growth
media or inducing genetic mutations that decrease cellular glucose uptake or utilization.
Both methods have succeeded in extending replicative life span, likely by the same
mechanism (Kaeberlein et al., 2004b; Lin et al., 2000), as both methods combined do not
synergize to give an even longer life span.
Of the dozens of genes ever reported to extend the yeast life span, those that
mimic CR have shown most consistent effect on life span across multiple strain
backgrounds (Kaeberlein et al., 2005). Yeast utilize glucose as a preferred source of
carbon, tightly regulating the expression of a variety of cell surface glucose transporters
of different substrate affinity depending on the concentration of glucose present in the
growth media (Ozcan and Johnston, 1999; Rolland et al., 2001). Once inside the cell,
glucose is phosphorylated by hexokinase to yield glucose-6-phosphate, a critical substrate
23
in glycolysis. Deletion of HXK2, one of the three genes encoding hexokinase enzymes,
extends life span by a mechanism that does not synergize with caloric restriction
(Kaeberlein et al., 2004b; Lin et al., 2000). This result has been interpreted to mean that
hxk2A mimics low glucose, a very plausible conclusion given that other genetic
mutations predicted to reduce carbon flow through glycolysis also fail to synergize with
hxk2A (Lin et al., 2000).
The cyclic AMP (cAMP)-dependent protein kinase plays a critical role in the
cellular response to glucose, increasing in activity when glucose is prevalent and
decreasing when glucose in the extracellular medium is depleted (reviewed in (Thevelein
and de Winde, 1999). Several mutations reducing PKA signaling activity significantly
increase life span, and at least one mutation causing constitutive activation of PKA
shortens life span by 40% (Lin et al., 2000). Mutation of the adenylate cyclase (Cdc35p)
and the GTP-GDP exchange factor Cdc25p both fall into the former category, and the
temperature sensitive cdc25-10 allele has been used as a genetic model for CR in several
studies (Lin et al., 2000; Lin et al., 2002).
In order to address the question of whether CR extends life span by a regulated
mechanism, Lin and coworkers investigated a possible role for Sir2p in this process.
Several lines of evidence now point to a key role for Sir2p in coordinating CR with an
extension of life span. First, CR fails to extend the life span of both sir2A and sir2A
foblA mutants, indicating that Sir2p activity is necessary in order for CR to extend life
span (Lin et al., 2000). Second, Nptlp, a component of the predominant cellular pathway
of NAD biosynthesis, is also required for CR, presumably to make NAD available as a
co-substrate for Sir2p under food-restricted conditions (Lin et al., 2000). Third, CR
24
increases Sir2 activity at the rDNA, increasing silencing, decreasing recombination, and
reducing ERC accumulation, all three of which are tightly associated with life span
extension by Sir2p (Lin et al., 2000; Lin et al., 2002).
Two models of Sir2p activation
Very interestingly, CR causes an increase in respiration necessary and sufficient
to extend life span in a Sir2p-dependent fashion (Lin et al., 2002). In the presence of
sufficient glucose concentrations, yeast cells rely on anaerobic fermentation for energy,
even though this process is far less energy-efficient than respiration. Under conditions of
CR, however, cells undergo a shift from fermentation to respiration, with the Hap4p
transcription factor directing the expression of key genes required for this shift (Forsburg
and Guarente, 1989). Overexpression of Hap4p in cells grown on glucose mimics CR by
the criteria established for other genetic CR models (Lin et al., 2002). Like these other
models, Hap4p overexpression requires Sir2p to extend life span. The exact mechanism
by which increased respiration is translated into an increase in Sir2p activity is still
controversial, although electron transport per se is definitely required upstream of Sir2p
in the pathway. Yeast cells lacking cytochrome 1 (Cytlp), an essential component of the
mitochondrial electron transport chain, fail to exhibit an extension of life span or an
increase in Sir2p activity when subjected to conditions of CR (Lin et al., 2002).
The metabolic shift to respiration induced by CR has been shown to cause an
increase in the NAD/NADH ratio, although by decreasing NADH levels (Lin et al.,
2004), not increasing NAD levels as originally predicted (Anderson et al., 2003b). As
presented in detail in Appendix B, NADH, a key electron donor in respiration,
25
competitively inhibits Sir2p activity, such that a decrement in cellular NADH accounts
for a significant increase in Sir2p activity during CR. In agreement with this model,
overexpressing NADH dehydrogenase is sufficient to increase Sir2p activity and extend
life span (Lin et al., 2004).
The major competing model explaining Sir2p activation by CR relies on a similar
principle of relief-of-inhibition, although in this case the proposed inhibitor reduced by
CR is nicotinamide, not NADH (Anderson et al., 2003a; Anderson et al., 2003b).
Mechanistically, this model invokes changes in a key NAD salvage pathway enzyme to
account for a reduction in nicotinamide when extracellular glucose is reduced (Anderson
et al., 2002). This regimen results in upregulation of the nicotinamidase Pnclp, which
converts nicotinamide into nicotinic acid, a compound that does not inhibit Sir2p
(Bitterman et al., 2002). Consistent with this model, CR largely fails to extend life span
when PNC1 is deleted. Also consistent with this model, overexpression of PNC1
dramatically extends yeast life span in a Sir2p-dependent manner, and PNC1overexpressors do not live any longer when calorie restricted (Anderson et al., 2003a).
Interestingly, Pnclp is induced by several other life-extending conditions, including high
osmolarity, mild heat stress, and low amino acid concentrations (Anderson et al., 2003a),
although of these, only high osmolarity has been experimentally proven to mimic calorie
restriction (Kaeberlein et al., 2002).
Sir2-independent effects of CR:
A recent report indicates that one particularly long-lived yeast strain, BY4742,
demonstrates a Sir2-independent life span extension under CR (Kaeberlein et al., 2004b).
26
The authors found that CR elicited a greatly extended life span from sir2A foblA
mutants, and that CR synergized with fobl deletion or SIR2-overexpression to create the
longest-lived yeast strains ever reported. This interesting finding suggests that CR may
activate more than one pathway affecting life span, raising the question of whether this
new pathway bears any mechanistic similarity to the one already described. Notably, a
study by another group investigating the Sir2-independent effects of CR has implicated
Hst2p, the closest yeast Sir2 homolog, as a key player in the process (Lamming et al.,
2005). Overexpression of HST2 suppresses rDNA recombination, promotes rDNA
silencing, and extends life span. Deletion of this gene largely abrogates the effect of CR
in a sir2A foblA background, thus likely accounting for the Sir2p-independent effects of
CR observed in the original study. Interestingly, Hstlp, another Sir2p homolog, plays a
residual role in CR in the absence of Sir2p and Hst2p (Lamming et al., 2005), suggesting
that Sir2 family members display a certain degree of flexibility in their roles within the
cell. These results have raised the possibility that in other organisms multiple members
of the Sir2 family might cooperate to promote longevity and survival in response to
moderate food shortages. The Sir2p response to yeast CR is diagrammed in Figure 2.
Natural polymorphisms affecting yeast aging
As strain-dependent genetic differences account for much of the controversy
surrounding the Sir2-independent effects of CR, it now becomes relevant to discuss the
two examples of naturally polymorphic loci known to affect the aging process. These
two loci, MPT5 (also known in some studies as UTH4 or PUF5) and SSDI, bear several
striking similarities to one another. Both MPT5 and SSDI are large genes characterized
27
by numerous polymorphisms in common laboratory strains (Kennedy et al., 1997; Sutton
et al., 1991; Uesono et al., 1997). Both encode RNA-binding proteins that act in parallel
to affect cell wall integrity, high temperature growth, and life span, as well as other
global processes (Kaeberlein and Guarente, 2002). Both interact genetically with a wide
array of mutations in diverse genes, and both function as post-transcriptional regulators
(Gerber et al., 2004; Kaeberlein et al., 2004a; Tadauchi et al., 2001).
Mpt5p,a polymorphicrepressorof translation
The first genetic screen for long-lived mutants in yeast identified mutations in
four complementation groups that rescued the stress sensitivity and short life span of the
starting strain (Kennedy et al., 1995). These complementation groups, termed UTH1-4,
have formed the basis for many subsequent aging studies. In the course of analysis of the
UTH mutants, cloning of UTH4 revealed it to be allelic to MPT5, and also led to the
observation that the unmutagenized strain used in the screen actually contained a Cterminal truncation of MPT5, resulting in a hypomorphic Mpt5 protein product (Kennedy
et al., 1997). Deletion of MPT5 shortens life span by 50%, and overexpression extends
life span by up to 40% (Kennedy et al., 1995; Kennedy et al., 1997), underscoring the
importance of this post-transcriptional regulator in the aging process. Cells lacking
Puf5p/Mpt5p/Uth4p display increased telomeric silencing, decreased rDNA silencing,
and an aberrant distribution of Sir3p in the absence of Sir4p (Gotta et al., 1997). In the
absence of SSDI-V, mpt5 mutant cells also suffer from several deficiencies associated
with a weakened cell wall, including sensitivity to calcofluor white, sensitivity to sodium
28
dodecyl sulfate (SDS), and sorbitol-remedial temperature sensitivity (Kaeberlein and
Guarente, 2002).
Furthermore, in strains lacking SSD1-V, mpt5A is synthetically lethal in
combination with deletion of either SBF or CCR4 (Kaeberlein and Guarente, 2002). SBF,
a transcriptional activator consisting of the cell-cycle regulated proteins Swi4p and
Swi6p, plays an important role in cell cycle-regulated transcription of the G1 cyclins
CLN and CLN2 (Nasmyth and Dirick, 1991) and also acts downstream of protein kinase
C (Pkclp) to promote cell wall biosynthesis (Igual et al., 1996). Ccr4p, a component of
the cytoplasmic deadenylase complex (Thore et al., 2003; Tucker et al., 2002) as well as
a different transcriptional complex, is also required for PKC 1-dependent transcriptional
regulation of multiple genes required for proper cell wall structure (Chang et al., 1999).
Genetic analysis suggests that Mpt5p, Ssdlp, and Pkclp define three parallel pathways to
ensure cell wall integrity (Kaeberlein and Guarente, 2002).
Mpt5p contains an RNA-binding domain homologous to that of the Drosophila
PUMILIO protein, a translational repressor important for positional patterning in the
developing embryo (Parisi and Lin, 2000). Of the five PUMILIO family members in
yeast, Mpt5p was the first to be characterized as a post-transcriptional regulator
(Tadauchi et al., 2001). Mpt5p has been shown to bind to sequence elements in the 3'
UTR of the HO endonuclease (Tadauchi et al., 2001), a protein catalyzing the critical
DNA strand cleavage step of haploid mating type switching. The binding of Mpt5p
results in repression of HO translation, and Mpt5p is believed to exert a similar effect on
other mRNAs to which it binds (Gerber et al., 2004; Tadauchi et al., 2001). Indeed, a
recent study systematically identified RNA targets of the yeast PUMILIO family of
29
proteins (Pufl-5p), uncovering a novel mechanism whereby specific RNA-binding
proteins physically associate with functionally related groups of target RNA molecules to
regulate their post-transcriptional properties (Gerber et al., 2004). This same study
identified consensus binding sites for three of the five PUF proteins in yeast, finding that
binding motifs typically resided within the 3'-UTRs of target genes, although a
significant quantity were found within ORFs or, rarely, the 5'UTR.
SSDI, anotherRNA bindingprotein
Naturally occurring polymorphisms of the SSD1 gene fall into two phenotypic
classes: active SSDI-V alleles and hypomorphic ssdl-d alleles, classified on the basis of
their ability to suppress mutations in the Sit4p phosphatase (Sutton et al., 1991). SSDI-V,
which suppresses sit4A, has also been isolated as a suppressor of diverse genetic
mutations affecting the cell wall, PKA activity, TOR-signaling, and RNA metabolism
(summarized in (Kaeberlein et al., 2004a)). Addition of SSD1-V dramatically extends
lifespan of ssdl-d strains by a novel, as yet uncharacterized mechanism. This mechanism
is Sir2p-independent, affecting neither rDNA silencing nor ERC formation, two
processes linked to yeast aging (Kaeberlein et al., 2004a). Significantly, addition of
SSD1-V is the only intervention ever shown to extend the life span of a sir2AfoblA
double mutant. Although SSD1 is highly conserved from yeast to humans, little is known
of its biochemical function. SSD1 is discussed in detail in Chapter 2 as well as Appendix
A.
30
Homologsof MPT5 and SSD1 in multicellularorganisms
Both Mpt5p and Ssdlp are very highly conserved proteins, although the metazoan
homologs of Mpt5p are far better characterized than those of Ssdlp. Interestingly, there
are several conceptual similarities linking Mpt5p to its Drosophila and C. elegans
homologs PUMILIO and FBF. These three homologs are all translational repressors that
bind conserved sequence elements found in the 3'-UTR. And all three proteins possess
the eight consecutively repeated PUMILIO homology domains conferring RNA binding
activity and defining the PUF family.
Early in embryogenesis, the Drosophila
PUMILIO protein binds maternal
hunchback mRNA to repress hunchback translation at the posterior pole by a mechanism
also requiring the NANOS protein (Parisi and Lin, 2000).
In addition to this
developmental role, PUMILIO is required for the maintenance of germ line stem cells in
Drosophila (Forbes and Lehmann, 1998; Lin and Spradling, 1997). C. elegans FBF,
which regulates germ cell fate through a repressive interaction with GLD-1 mRNA, is
also required for germ line stem cell maintenance in this organism (Crittenden et al.,
2002). Thus, both PUMILIO and FBF promote continued cell divisions and delay the
onset of an alternate state of differentiation and developmental potency.
Intriguingly,
Mpt5p also conforms to this common theme, using specific targeted translational
repression to prolong cell divisions and maintain potential to produce young cells. The
metazoan homologs of Ssdlp still await characterization and may provide likely
candidates for regulators of development and cell fate analogous to those of the PUF
family.
31
Chronological Aging in Yeast
An alternative means of defining and measuring yeast life span is to assess the
survival of cells maintained in a non-dividing state. This parameter is known as
chronological aging, as it correlates survival with time as measured in days rather than
cell division cycles. The most common assay for chronological aging is a post-diauxic
survival test in which cells grown to the post-diauxic phase are kept in culture, and
viability is measured at successive time points by the plating of cells and measurement of
colony formation. Aging under these conditions appears to be largely attributable to
damage from reactive oxygen species (ROS), as mutations in catalase and superoxide
dismutase accelerate the loss of viability (Longo et al., 1996; Longo et al., 1999) and
mutations increasing paraquat resistance prolong survival under post-diauxic conditions
(Fabrizio et al., 2003; Fabrizio et al., 2001). Only two genes have so far been reported to
increase both post-diauxic aging and replicative aging, and these genes are SCH9 and
CYR] (Fabrizio et al., 2004; Fabrizio et al., 2001). SCH9 encodes a serine/threonine
kinase that acts in parallel to components of the PKA pathway to affect stress resistance
and response to glucose. CYR] encodes adenylate cyclase, which produces cAMP in
response to glucose uptake by a mechanism described above. This process is essential
for PKA activity, a reduction of which is known to increase stress resistance by
downstream activation of the Msn2p and Msn4p transcription factors (Rolland et al.,
2001).
By this token, the dual effects of cyrl mutation on replicative and post-diauxic
aging can be rationalized by downstream activation of stress response genes (predicted to
prolong survival in non-dividing cells) and respiration-dependent activation of Sir2p
32
(predicted to prolong replicative life span). It is not clear whether sch9A requires Sir2p in
order to extend replicative life span, but it has been shown that sch9 mutation extends
chronological life span by a mechanism requiring Sod2p (Fabrizio et al., 2003).
Interestingly, the effects of sch9A on replicative life span are very well conserved
between several different yeast strains (Kaeberlein et al., 2005), and this gene, like FOB],
displays a defect in HOTl-dependent recombination when mutated (Defossez et al.,
1999). It is therefore possible that sch9A might promote longevity by correcting a defect
similar to that corrected by deletion of FOB].
Future studies should aim to integrate
SCH9 into existing genetic pathways of aging.
CONSERVATION OF YEAST AGING PATHWAYS IN METAZOANS
A critical question facing the model systems approach to aging is to what extent
findings from such model systems are conserved across phyla. Intriguingly, the last
several years have provided numerous reports confirming that aging and longevity genes
can, in fact, affect similar aspects of the aging process in very distantly related species.
Insulin/IGF-1 pathway
Sch9, like Sir2, has been shown to affect aging in at least two species whose last
common ancestor existed a whopping one billion years ago (Guarente and Picard, 2005).
The kinase domain of Sch9p is highly conserved, showing 47-49% identity to its closest
worm homologs AKT-1 and AKT-2. AKT-1 and AKT-2 act downstream of the DAF-2
insulin receptor homolog, regulating longevity, stress resistance and the diapause state in
33
response to a conserved PI-3 kinase signaling cascade (Guarente and Kenyon, 2000;
Paradis and Ruvkun, 1998). Depending on the severity of the mutation, defects in genes
of the DAF-2 pathway cause either dauer formation or extended adult life span, with
more mild mutations generally favoring the latter result (Johnson, 1990; Kenyon et al.,
1993). The longevity of daf-2 mutants is known to require several genes, including DAF16 (a forkhead/winged helix transcription factor), heat shock protein HSF-1, and the
AMP-dependent kinase AAK-2 (Garigan et al., 2002; Henderson and Johnson, 2001; Hsu
et al., 2003; Lee et al., 2001; Lin et al., 2001; Morley and Morimoto, 2004). The
insulin/IGF-1 pathway, like the PKA and Sch9 pathways in yeast, normally
downregulates nutrient storage and stress responses (Kenyon, 2005). It is therefore
especially interesting that mutating such a pathway would extend life span in both
species, as it implies not only conservation of specific aging genes but conservation of an
overall approach to regulating the aging process (Figure 3).
Other mutations in the insulin/IGF-1 pathway have been shown to extend life
span in worms, flies, and even mice. In Drosophila, mutations of the insulin/IGF-l
receptor increase life span by variable amounts of up to 80% (Tatar et al., 2001).
Similarly, mutations in the downstream chico insulin receptor substrate (IRS-1) extend
life span by up to 40% (Clancy et al., 2001; Tu et al., 2002a; Tu et al., 2002b). Although
no experiments have yet linked these phenotypes to the DAF-16 homolog FOXO, it is
strongly predicted that extension of life span in IRS and insulin/IGF-1 receptor mutants
requires FOXO activation. FOXO overexpression has been shown to extend fly life span
(Giannakou et al., 2004), and the FOXO transcription factor is known to lie downstream
34
of insulin/IGF-1 signaling for at least one other phenotype, namely reduced cell division
(Junger et al., 2003).
In mammals, the analogous genetic pathways are far more complex, but similar
results have nonetheless been reported. In mice, which have distinct receptors for insulin
and IGF-1, female mutants heterozygous for the IGF-1 receptor live about 30% longer
than wild type controls (Holzenberger et al., 2003). Also, mice lacking the insulin
receptor in adipose tissue display an 18% life span increase compared to controls (Bluher
et al., 2003). Taken together, these results suggest that through evolution both the insulin
and IGF- 1 pathways have retained an influence on life span regulation.
Similar to the case of Drosophila, a downstream connection to FOXO is also
strongly suspected but has yet to be demonstrated for long-lived mouse insulin and IGF-1
mutants. FOXO transcription factors act downstream of insulin and IGF-1 to effect
changes in metabolism (Burgering and Kops, 2002; Kops et al., 2002), so it is
conceivable that they play a similar role in the pathways affecting aging. A recent study
has shown that p66shc mutation, which increases stress resistance as well as organismal
longevity (Migliaccio et al., 1999), requires FOXO proteins, at least in order to confer
cellular resistance to stress (Nemoto and Finkel, 2002).
SIR2 and Calorie Restriction
In C. elegans, Sir2 ortholog Sir2.1 extends life span, albeit by a mechanism
differing from the one at work in yeast cells. Worms likely do not age as a result of ERC
accumulation, as no such accumulation has ever been observed in this predominantly
post-mitotic organism (Guarente lab, unpublished data). Life span extension by Sir2.1
35
instead requires the forkhead transcription factor DAF-16, as DAF-16 mutants live the
same length regardless of Sir2.1 levels (Tissenbaum and Guarente, 2001). DAF-16, a
key downstream element in the insulin-like signaling pathway, is therefore likely to act
downstream of Sir2.1 as well. Unpublished results from our lab indicate that this is
indeed the case (Ala Berdichevsky, personal communication). These findings in worms
are especially interesting in light of recent studies uncovering interactions between
mammalian SIRT1 and FOXO proteins homologous to the C. elegans DAF-16 (Brunet et
al., 2004; Motta et al., 2004; van der Horst et al., 2004). These results are discussed in
detail later on in this chapter.
Studies from Drosophila melanogaster support a conserved role for Sir2 in the
response to CR, a surprising finding considering the vast evolutionary distance between
yeast and fruit flies. In flies, food restriction is accomplished by limiting the yeast
content of the flies' diet, and this intervention succeeds in extending life span
significantly (Clancy et al., 2002). Several lines of evidence support the claim that Sir2
upregulation plays an indispensable role in the fly response to CR. Caloric restriction in
flies increases Sir2 mRNA levels (Rogina et al., 2002), and the overexpression of Sir2
using a UAS/Gal4 driver is sufficient to extend life span (Rogina and Helfand, 2004).
This extension of life span does not synergizes with CR, suggesting that the two
treatments constitute only one pathway (Rogina and Helfand, 2004). Further support for
this model comes from experiments with the Sir2-activator resveratrol, which, like CR,
extends life span in wild type but not Sir2 mutant flies (Rogina and Helfand, 2004; Wood
et al., 2004). Like overexpression of Sir2, resveratrol treatment fails to further extend the
long life span of CR flies.
36
These findings hint at a conserved role for Sir2 proteins in life span regulation,
especially in response to CR. A significant effort now exists to establish a role for Sir2 in
the mammalian response to calorie restriction, and to determine to what extent, if any,
findings from lower organisms apply to the more sophisticated mammalian systems. To
that end, numerous studies have already defined a role for mammalian Sir2 in the
promotion of cell survival and division in the face of potentially apopotic stresses
(reviewed in (Blander and Guarente, 2004; Guarente and Picard, 2005). Mammalian
genomes contain seven Sir2 homologs , termed sirtuins (SIRTs). Of these, SIRT1,
orthologous to the yeast Sir2, is the best characterized and has the broadest substrate
specificity (Blander and Guarente, 2003). A nuclear protein, SIRT1 deacetylates several
non-histone substrates in vivo, including MyoD, p53, and FOXO transcription factors,
thereby affecting cell differentiation and survival under stress (Brunet et al., 2004; Motta
et al., 2004; North and Verdin, 2004).
In mammals, FOXO transcription factors mediate the metabolic output of IGF-1
and insulin pathways and also play a key role in the apoptotic response to stress. SIRT1
has been shown by several groups to deacetylate FOXO 1, FOXO3, and FOXO4 (Brunet
et al., 2004; Daitoku et al., 2004; Motta et al., 2004; van der Horst et al., 2004), thereby
repressing FOXO-mediated apoptosis. Strangely, there are also reports of FOXO target
genes activated by SIRT1 (Brunet et al., 2004; Daitoku et al., 2004; van der Horst et al.,
2004), although no mechanism has yet been established to explain these findings.
These FOXO studies are not the only reports linking SIRT1 to regulation of the
insulin pathway in mice.
Very recent work has also defined a role for SIRT
in
pancreatic 13-cells,where it enhances insulin secretion in response to glucose, improving
37
glucose tolerance (Moynihan et al., 2005). It is not yet known whether these conditional
mutants overexpressing SIRT1 in B-cells show an extension in life span.
Recently, mouse SIRT1 was reported to promote the mobilization of fatty acids in
white adipose tissue by repressing PPARy, linking Sir2 proteins to the physiology of
caloric restriction in mammals (Picard et al., 2004). Several lines of evidence suggest
that fat storage in the white adipose tissue (WAT) may play an important role in
mammalian aging. Both the FIRKO mice (Bluher et al., 2003) and C/EBPB knock-in
mice (Chiu et al., 2004), both genetically engineered to be lean, live longer than controls.
These observations can be rationalized in the context of CR where WAT, a known
endocrine tissue secreting such important hormones as leptin and adiponectin, shrinks in
size as cells lose fat in response to lowered food intake. WAT therefore provides a likely
candidate for a diet sensor that could then secrete hormones adjusting the rate of aging in
the organism as a whole.
Although appealing, this model is not without its inconsistencies. Notably, when
leptin-deficient ob/ob mice are subjected to CR, these mice live as long as wild type CR
animals, even though the ob/ob mice are fatter than not only wild type CR animals, but
wild type animals fed an ad libitum diet (Harrison et al., 1984). Also, one report
comparing animals within each CR or ad libitum group describes a slight positive
correlation between body fat and longevity within each group (Bertrand et al., 1980).
Both of these findings fail to support a key prediction of the WAT model of aging, which
is that reduction of WAT should correlate with extended life span.
Nevertheless, SIRT1 has been shown to negatively regulate the fat cell
differentiation of 3T3-L1 pre-adipocytes (Picard et al., 2004).
38
This effect is explained
by the observation that SIRT1 binds to the PPARy negative cofactors NCoR and SMRT
and can be found at the promoters of fat-specific genes containing PPARy binding sites
(Picard et al., 2004). In animals, SIRT1 also plays a role in the mobilization of fat
following fasting. In SIRT1 heterozygous knockouts, lipolysis of triglycerides and
release of free fatty acids into the blood was reduced (Picard et al., 2004), although some
mechanistic details of this process are still uncharacterized (Bordone and Guarente,
2005), such as how a decrease in food uptake activates SIRT1 in animals.
In cultured cells, acute nutrient withdrawal activates FOXO3- and p53-dependent
transcription of SIRT1, whose levels consequently increase (Nemoto et al., 2004).
Interestingly, p53 and FOXO3 physically interact in response to nutrient stress, and the
induction of SIRT1 depends on two p53 binding sites located in the SIRT1 upstream
sequence. In rats, caloric restriction increases levels of SIRT1 (Cohen et al., 2004b),
inhibiting stress-induced
apoptosis by a mechanism involving Ku70 and Bax.
Specifically, deacetylation of Ku70 by SIRT1 allows this DNA repair protein to bind to
and inactivate Bax, a proapoptotic factor (Cohen et al., 2004a; Cohen et al., 2004b).
Other sirtuins
Of the remaining SIRTs (SIRT2-7), an in vivo substrate has only been
identified for the cytoplasmic SIRT2 (North et al., 2003). This substrate, -tubulin, is
specifically deacetylated by SIRT2 (North et al., 2003), although the biological
consequences of this reaction are unclear. While the archetypal yeast Sir2p is generally
believed to be a histone deacetylase, most mammalian sirtuins are non-nuclear
(Michishita et al., 2005), strongly suggesting that they act on non-histone substrates.
39
Using sequence similarity, eukaryotic Sir2 genes have been divided into four
broad phylogenetic classes (Frye, 2000), known as classes I-IV (Figure 1). SIRT1,
SIRT2, and SIRT3 are class I, SIRT4 is class II, and SIRT5 falls within the
predominantly prokaryotic class III. Finally, mammalian SIRT6 and SIRT7, are class IV
sirtuins (Frye, 2000). In vitro studies indicate that human SIRT1, 2, 3, and 5 possess
NAD-dependent histone deacetylase activity (North et al., 2003), whereas SIRT4, 6, and
7 fail to deacetylate 3 H-labeled acetylated histone H4 peptide (North et al., 2003). The
lack of detectable deacetylase activity in these SIRTs may result from their specificity for
targets other than those tested, or it may indicate an enzymatic activity other than
deacetylation inherent in these sirtuins.
To further our understanding of the Sir2 family of proteins in mammals, we
have undertaken research on the molecular characteristics and functions of the two class
IV sirtuins SIRT6 and SIRT7. As we present in Chapter 3 and Appendix C, SIRT6 and
SIRT7 are both nuclear proteins, with SIRT7 found exclusively in the nucleolar
subcompartment.
While SIRT6 displays an auto-ADP-ribosyltransferase
activity
uncharacteristic of Sir2 family members, SIRT7 apparently lacks this activity. SIRT7,
however, plays a unique role as an activator of RNA polymerase I transcription,
physically interacting with the Pol I complex and promoting transcription through the
greater association of this complex with the rDNA.
40
Summary and Conclusions
Many organisms appear to possess a genetically conserved mechanism by which
to forestall aging in response to environmental cues. In yeast, this mechanism hinges on
Sir2p, whose activity at the rDNA is essential for longevity. Interestingly, the
characterization of Sir2 in yeast has led to several insights about aging in other
organisms, and it now seems likely that Sir2 proteins play a conserved role in the
response to calorie restriction in flies and even mammals.
And Sir2 is not the only longevity-associated
gene implicated in a conserved
pathway regulating aging. Notably, the insulin/IGF-l hormonal signaling pathway can
be mutated to forestall aging in worms, flies and mice, suggesting that current studies
have only scratched the surface of a vast network of aging-regulatory genes that also
coordinate energy homeostasis, stress resistance, and reproduction.
The mission of the field is now to continue the molecular characterization of
longevity genes in model systems while simultaneously applying our current knowledge
to mammalian systems. With this goal in mind, we present the research of this thesis.
Chapter 2 and Appendix A aim to deepen the understanding of yeast aging, providing a
model for the action of SSD1-V, one of only two natural polymorphisms known to affect
this process. Appendix B visits the issue of Sir2p regulation by calorie restriction,
providing evidence that an increase in the cellular NAD/NADH ratio, occurring via a
decrease in NADH, results in activation of Sir2p and extension of life span.
Finally, Chapter 3 and Appendix C present the first characterizations of class IV
sirtuins, SIRT6 and SIRT7. In light of the recent finding that multiple sirtuins can
41
collaborate to extend life span in yeast, it is especially interesting to know to what extent
the role of Sir2 has been conserved and distributed among its various homologs.
42
REFERENCES
Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., Cohen, H., Lin, S. S., Manchester,
J. K., Gordon, J. I., and Sinclair, D. A. (2002). Manipulation of a nuclear NAD+ salvage pathway
delays aging without altering steady-state NAD+ levels. J Biol Chem 277, 18881-18890.
Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., and Sinclair, D. A. (2003a).
Nicotinamide and PNC 1 govern lifespan extension by calorie restriction in Saccharomyces
cerevisiae. Nature 423, 181-185.
Anderson, R. M., Latorre-Esteves, M., Neves, A. R., Lavu, S., Medvedik, O., Taylor, C., Howitz,
K. T., Santos, H., and Sinclair, D. A. (2003b). Yeast life-span extension by calorie restriction is
independent of NAD fluctuation. Science 302, 2124-2126.
Armstrong, C. M., Kaeberlein, M., Imai, S. I., and Guarente, L. (2002). Mutations in
Saccharomyces cerevisiae gene SIR2 can have differential effects on in vivo silencing phenotypes
and in vitro histone deacetylation activity. Mol Biol Cell 13, 1427-1438.
Bertrand, H. A., Lynd, F. T., Masoro, E. J., and Yu, B. P. (1980). Changes in adipose mass and
cellularity through the adult life of rats fed ad libitum or a life-prolonging restricted diet. J
Gerontol 35, 827-835.
Bitterman, K. J., Anderson, R. M., Cohen, H. Y., Latorre-Esteves, M., and Sinclair, D. A. (2002).
Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of
yeast sir2 and human SIRT1. J Biol Chem 277, 45099-45107.
Bitterman, K. J., Medvedik, O., and Sinclair, D. A. (2003). Longevity regulation in
Saccharomyces cerevisiae: linking metabolism, genome stability, and heterochromatin. Microbiol
Mol Biol Rev 67, 376-399, table of contents.
Blander, G., and Guarente, L. (2004). The Sir2 family of protein deacetylases. Annu Rev
Biochem 73, 417-435.
Bluher, M., Kahn, B. B., and Kahn, C. R. (2003). Extended longevity in mice lacking the insulin
receptor in adipose tissue. Science 299, 572-574.
Bordone, L., and Guarente, L. (2005). Calorie restriction, SIRT1 and metabolism: understanding
longevity. Nat Rev Mol Cell Biol 6, 298-305.
Borra, M. T., O'Neill, F. J., Jackson, M. D., Marshall, B., Verdin, E., Foltz, K. R., and Denu, J.
M. (2002). Conserved enzymatic production and biological effect of O-acetyl-ADP-ribose by
silent information regulator 2-like NAD+-dependent deacetylases. J Biol Chem 277, 1263212641.
Braunstein, M., Rose, A. B., Holmes, S. G., Allis, C. D., and Broach, J. R. (1993). Transcriptional
silencing in yeast is associated with reduced nucleosome acetylation. Genes Dev 7, 592-604.
43
Brunet, A., Sweeney, L. B., Sturgill, J. F., Chua, K. F., Greer, P. L., Lin, Y., Tran, H., Ross, S. E.,
Mostoslavsky, R., Cohen, H. Y., et al. (2004). Stress-dependent regulation of FOXO transcription
factors by the SIRT deacetylase. Science 303, 2011-2015.
Bryk, M., Banerjee, M., Murphy, M., Knudsen, K. E., Garfinkel, D. J., and Curcio, M. J. (1997).
Transcriptional silencing of Tyl elements in the RDN1 locus of yeast. Genes Dev 11, 255-269.
Burgering, B. M., and Kops, G. J. (2002). Cell cycle and death control: long live Forkheads.
Trends Biochem Sci 27, 352-360.
Chang, M., French-Cornay, D., Fan, H. Y., Klein, H., Denis, C. L., and Jaehning, J. A. (1999). A
complex containing RNA polymerase II, Paflp, Cdc73p, Hprlp, and Ccr4p plays a role in protein
kinase C signaling. Mol Cell Biol 19, 1056-1067.
Chiu, C. H., Lin, W. D., Huang, S. Y., and Lee, Y. H. (2004). Effect of a C/EBP gene
replacement on mitochondrial biogenesis in fat cells. Genes Dev 18, 1970-1975.
Clancy, D. J., Gems, D., Hafen, E., Leevers, S. J., and Partridge, L. (2002). Dietary restriction in
long-lived dwarf flies. Science 296, 319.
Clancy, D. J., Gems, D., Harshman, L. G., Oldham, S., Stocker, H., Hafen, E., Leevers, S. J., and
Partridge, L. (2001). Extension of life-span by loss of CHICO, a Drosophila insulin receptor
substrate protein. Science 292, 104-106.
Cohen, H. Y., Lavu, S., Bitterman, K. J., Hekking, B., Imahiyerobo, T. A., Miller, C., Frye, R.,
Ploegh, H., Kessler, B. M., and Sinclair, D. A. (2004a). Acetylation of the C terminus of Ku70 by
CBP and PCAF controls Bax-mediated apoptosis. Mol Cell 13, 627-638.
Cohen, H. Y., Miller, C., Bitterman, K. J., Wall, N. R., Hekking, B., Kessler, B., Howitz, K. T.,
Gorospe, M., de Cabo, R., and Sinclair, D. A. (2004b). Calorie restriction promotes mammalian
cell survival by inducing the SIRT1 deacetylase. Science 305, 390-392.
Crittenden, S. L., Bernstein, D. S., Bachorik, J. L., Thompson, B. E., Gallegos, M., Petcherski, A.
G., Moulder, G., Barstead, R., Wickens, M., and Kimble, J. (2002). A conserved RNA-binding
protein controls germline stem cells in Caenorhabditis elegans. Nature 417, 660-663.
Daitoku, H., Hatta, M., Matsuzaki, H., Aratani, S., Ohshima, T., Miyagishi, M., Nakajima, T.,
and Fukamizu, A. (2004). Silent information regulator 2 potentiates Foxo 1-mediated transcription
through its deacetylase activity. Proc Natl Acad Sci U S A 101, 10042-10047.
Defossez, P. A., Prusty, R., Kaeberlein, M., Lin, S. J., Ferrigno, P., Silver, P. A., Keil, R. L., and
Guarente, L. (1999). Elimination of replication block protein Fob extends the life span of yeast
mother cells. Mol Cell 3, 447-455.
Egilmez, N. K., and Jazwinski, S. M. (1989). Evidence for the involvement of a cytoplasmic
factor in the aging of the yeast Saccharomyces cerevisiae. J Bacteriol 171, 37-42.
44
Fabrizio, P., Liou, L. L., Moy, V. N., Diaspro, A., SelverstoneValentine, J., Gralla, E. B., and
Longo, V. D. (2003). SOD2 functions downstream of Sch9 to extend longevity in yeast. Genetics
163,35-46.
Fabrizio, P., Pletcher, S. D., Minois, N., Vaupel, J. W., and Longo, V. D. (2004). Chronological
aging-independent replicative life span regulation by Msn2/Msn4 and Sod2 in Saccharomyces
cerevisiae. FEBS Lett 557, 136-142.
Fabrizio, P., Pozza, F., Pletcher, S. D., Gendron, C. M., and Longo, V. D. (2001). Regulation of
longevity and stress resistance by Sch9 in yeast. Science 292, 288-290.
Forbes, A., and Lehmann, R. (1998). Nanos and Pumilio have critical roles in the development
and function of Drosophila germline stem cells. Development 125, 679-690.
Forsburg, S. L., and Guarente, L. (1989). Identification and characterization of HAP4: a third
component of the CCAAT-bound HAP2/HAP3 heteromer. Genes Dev 3, 1166-1178.
Frye, R. A. (1999). Characterization of five human cDNAs with homology to the yeast SIR2
gene: Sir2-like proteins (sirtuins) metabolize NAD and may have protein ADP-ribosyltransferase
activity. Biochem Biophys Res Commun 260, 273-279.
Frye, R. A. (2000). Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins.
Biochem Biophys Res Commun 273, 793-798.
Garigan, D., Hsu, A. L., Fraser, A. G., Kamath, R. S., Ahringer, J., and Kenyon, C. (2002).
Genetic analysis of tissue aging in Caenorhabditis elegans: a role for heat-shock factor and
bacterial proliferation. Genetics 161, 1101-1112.
Gerber, A. P., Herschlag, D., and Brown, P. 0. (2004). Extensive association of functionally and
cytotopically related mRNAs with Puf family RNA-binding proteins in yeast. PLoS Biol 2, E79.
Ghidelli, S., Donze, D., Dhillon, N., and Kamakaka, R. T. (2001). Sir2p exists in two
nucleosome-binding complexes with distinct deacetylase activities. Embo J 20, 4522-4535.
Giannakou, M. E., Goss, M., Junger, M. A., Hafen, E., Leevers, S. J., and Partridge, L. (2004).
Long-lived Drosophila with overexpressed dFOXO in adult fat body. Science 305, 361.
Gotta, M., Strahl-Bolsinger, S., Renauld, H., Laroche, T., Kennedy, B. K., Grunstein, M., and
Gasser, S. M. (1997). Localization of Sir2p: the nucleolus as a compartment for silent information
regulators. Embo J 16, 3243-3255.
Gottschling, D. E., Aparicio, O. M., Billington, B. L., and Zakian, V. A. (1990). Position effect at
S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63, 751-762.
45
Grunstein, M. (1997). Molecular model for telomeric heterochromatin in yeast. Curr Opin Cell
Biol 9, 383-387.
Guarente, L., and Kenyon, C. (2000). Genetic pathways that regulate ageing in model organisms.
Nature 408, 255-262.
Guarente, L., and Picard, F. (2005). Calorie restriction--the SIR2 connection. Cell 120, 473-482.
Guthrie, C., and Fink, G. R. (1991). Guide to yeast genetics and molecular biology (San Diego:
Academic Press).
Harrison, D. E., Archer, J. R., and Astle, C. M. (1984). Effects of food restriction on aging:
separation of food intake and adiposity. Proc Natl Acad Sci U S A 81, 1835-1838.
Henderson, S. T., and Johnson, T. E. (2001). daf-16 integrates developmental and environmental
inputs to mediate aging in the nematode Caenorhabditis elegans. Curr Biol 11, 1975-1980.
Holzenberger, M., Dupont, J., Ducos, B., Leneuve, P., Geloen, A., Even, P. C., Cervera, P., and
Le Bouc, Y. (2003). IGF- 1 receptor regulates lifespan and resistance to oxidative stress in mice.
Nature 421, 182-187.
Hsu, A. L., Murphy, C. T., and Kenyon, C. (2003). Regulation of aging and age-related disease
by DAF-16 and heat-shock factor. Science 300, 1142-1145.
Igual, J. C., Johnson, A. L., and Johnston, L. H. (1996). Coordinated regulation of gene
expression by the cell cycle transcription factor Swi4 and the protein kinase C MAP kinase
pathway for yeast cell integrity. Embo J 15, 5001-5013.
Imai, S., Armstrong, C. M., Kaeberlein, M., and Guarente, L. (2000). Transcriptional silencing
and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403, 795-800.
Ingram, D. K., Anson, R. M., de Cabo, R., Mamczarz, J., Zhu, M., Mattison, J., Lane, M. A., and
Roth, G. S. (2004). Development of calorie restriction mimetics as a prolongevity strategy. Ann
N Y Acad Sci 1019,412-423.
Ivy, J. M., Klar, A. J., and Hicks, J. B. (1986). Cloning and characterization of four SIR genes of
Saccharomyces cerevisiae. Mol Cell Biol 6, 688-702.
Jackson, M. D., and Denu, J. M. (2002). Structural identification of 2'- and 3'-O-acetyl-ADPribose as novel metabolites derived from the Sir2 family of beta -NAD+-dependent
histone/protein deacetylases. J Biol Chem 277, 18535-18544.
Jackson, M. D., Schmidt, M. T., Oppenheimer, N. J., and Denu, J. M. (2003). Mechanism of
nicotinamide inhibition and transglycosidation by Sir2 histone/protein deacetylases. J Biol Chem
278, 50985-50998.
46
Jenuwein, T., and Allis, C. D. (2001). Translating the histone code. Science 293, 1074-1080.
Johnson, T. E. (1990). Increased life-span of age-I mutants in Caenorhabditis elegans and lower
Gompertz rate of aging. Science 249, 908-912.
Junger, M. A., Rintelen, F., Stocker, H., Wasserman, J. D., Vegh, M., Radimerski, T., Greenberg,
M. E., and Hafen, E. (2003). The Drosophila forkhead transcription factor FOXO mediates the
reduction in cell number associated with reduced insulin signaling. J Biol 2, 20.
Kaeberlein, M., Andalis, A. A., Fink, G. R., and Guarente, L. (2002). High osmolarity extends
life span in Saccharomyces cerevisiae by a mechanism related to calorie restriction. Mol Cell Biol
22, 8056-8066.
Kaeberlein, M., Andalis, A. A., Liszt, G. B., Fink, G. R., and Guarente, L. (2004a).
Saccharomyces cerevisiae SSD1-V confers longevity by a Sir2p-independent mechanism.
Genetics 166, 1661-1672.
Kaeberlein, M., and Guarente, L. (2002). Saccharomyces cerevisiae MPT5 and SSD1 function in
parallel pathways to promote cell wall integrity. Genetics 160, 83-95.
Kaeberlein, M., Kirkland, K. T., Fields, S., and Kennedy, B. K. (2004b). Sir2-independent life
span extension by calorie restriction in yeast. PLoS Biol 2, E296.
Kaeberlein, M., Kirkland, K. T., Fields, S., and Kennedy, B. K. (2005). Genes determining yeast
replicative life span in a long-lived genetic background. Mech Ageing Dev 126, 491-504.
Kaeberlein, M., McVey, M., and Guarente, L. (1999). The SIR2/3/4 complex and SIR2 alone
promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev 13,
2570-2580.
Kennedy, B. K., Austriaco, N. R., Jr., and Guarente, L. (1994). Daughter cells of Saccharomyces
cerevisiae from old mothers display a reduced life span. J Cell Biol 127, 1985-1993.
Kennedy, B. K., Austriaco, N. R., Jr., Zhang, J., and Guarente, L. (1995). Mutation in the
silencing gene SIR4 can delay aging in S. cerevisiae. Cell 80, 485-496.
Kennedy, B. K., Gotta, M., Sinclair, D. A., Mills, K., McNabb, D. S., Murthy, M., Pak, S. M.,
Laroche, T., Gasser, S. M., and Guarente, L. (1997). Redistribution of silencing proteins from
telomeres to the nucleolus is associated with extension of life span in S. cerevisiae. Cell 89, 381391.
Kenyon, C. (2005). The plasticity of aging: insights from long-lived mutants. Cell 120, 449-460.
Kenyon, C., Chang, J., Gensch, E., Rudner, A., and Tabtiang, R. (1993). A C. elegans mutant that
lives twice as long as wild type. Nature 366, 461-464.
47
Kim, R. A., and Wang, J. C. (1989). A subthreshold level of DNA topoisomerases leads to the
excision of yeast rDNA as extrachromosomal rings. Cell 57, 975-985.
Kim, S., Villeponteau, B., and Jazwinski, S. M. (1996). Effect of replicative age on
transcriptional silencing near telomeres in Saccharomyces cerevisiae. Biochem Biophys Res
Commun 219, 370-376.
Kirkwood, T. B. (2005). Understanding the odd science of aging. Cell 120, 437-447.
Kobayashi, T., Horiuchi, T., Tongaonkar, P., Vu, L., and Nomura, M. (2004). SIR2 regulates
recombination between different rDNA repeats, but not recombination within individual rRNA
genes in yeast. Cell 117, 441-453.
Kops, G. J., Dansen, T. B., Polderman, P. E., Saarloos, I., Wirtz, K. W., Coffer, P. J., Huang, T.
T., Bos, J. L., Medema, R. H., and Burgering, B. M. (2002). Forkhead transcription factor
FOXO3a protects quiescent cells from oxidative stress. Nature 419, 316-321.
Lamming, D. W., Latorre-Esteves, M., Medvedik, O., Wong, S. N., Tsang, F. A., Wang, C., Lin,
S. J., and Sinclair, D. A. (2005). HST2 mediates SIR2-independent life-span extension by calorie
restriction. Science 309, 1861-1864.
Landry, J., Slama, J. T., and Sternglanz, R. (2000a). Role of NAD(+) in the deacetylase activity
of the SIR2-like proteins. Biochem Biophys Res Commun 278, 685-690.
Landry, J., Sutton, A., Tafrov, S. T., Heller, R. C., Stebbins, J., Pillus, L., and Sternglanz, R.
(2000b). The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases.
Proc Natl Acad Sci U S A 97, 5807-5811.
Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human
ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.
Lin, H., and Spradling, A. C. (1997). A novel group of pumilio mutations affects the asymmetric
division of germline stem cells in the Drosophila ovary. Development 124, 2463-2476.
Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans
longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145.
Lin, S. J., Defossez, P. A., and Guarente, L. (2000). Requirement of NAD and SIR2 for life-span
extension by calorie restriction in Saccharomyces cerevisiae. Science 289, 2126-2128.
Lin, S. J., Ford, E., Haigis, M., Liszt, G., and Guarente, L. (2004). Calorie restriction extends
yeast life span by lowering the level of NADH. Genes Dev 18, 12-16.
48
Lin, S. J., Kaeberlein, M., Andalis, A. A., Sturtz, L. A., Defossez, P. A., Culotta, V. C., Fink, G.
R., and Guarente, L. (2002). Calorie restriction extends Saccharomyces cerevisiae lifespan by
increasing respiration. Nature 418, 344-348.
Liou, G. G., Tanny, J. C., Kruger, R. G., Walz, T., and Moazed, D. (2005). Assembly of the SIR
complex and its regulation by O-acetyl-ADP-ribose, a product of NAD-dependent histone
deacetylation. Cell 121, 515-527.
Longo, V. D., Gralla, E. B., and Valentine, J. S. (1996). Superoxide dismutase activity is essential
for stationary phase survival in Saccharomyces cerevisiae. Mitochondrial production of toxic
oxygen species in vivo. J Biol Chem 271, 12275-12280.
Longo, V. D., Liou, L. L., Valentine, J. S., and Gralla, E. B. (1999). Mitochondrial superoxide
decreases yeast survival in stationary phase. Arch Biochem Biophys 365, 131-142.
Masoro, E. J. (1984a). Food restriction and the aging process. J Am Geriatr Soc 32, 296-300.
Masoro, E. J. (1984b). Nutrition as a modulator of the aging process. Physiologist 27, 98-101.
McCay, C. M., Crowell, M. F., and Maynard, L. A. (1989). The effect of retarded growth upon
the length of life span and upon the ultimate body size. 1935. Nutrition 5, 155-171; discussion
172.
Merry, B. J. (2002). Molecular mechanisms linking calorie restriction and longevity. Int J
Biochem Cell Biol 34, 1340-1354.
Michishita, E., Park, J. Y., Burneskis, J. M., Barrett, J. C., and Horikawa, I. (2005).
Evolutionarily Conserved and Nonconserved Cellular Localizations and Functions of Human
SIRT Proteins. Mol Biol Cell.
Migliaccio, E., Giorgio, M., Mele, S., Pelicci, G., Reboldi, P., Pandolfi, P. P., Lanfrancone, L.,
and Pelicci, P. G. (1999). The p66shc adaptor protein controls oxidative stress response and life
span in mammals. Nature 402, 309-313.
Miller, C. A., and Kowalski, D. (1993). cis-acting components in the replication origin from
ribosomal DNA of Saccharomyces cerevisiae. Mol Cell Biol 13, 5360-5369.
Min, J., Landry, J., Sternglanz, R., and Xu, R. M. (2001). Crystal structure of a SIR2 homologNAD complex. Cell 105, 269-279.
Moazed, D. (2001). Common themes in mechanisms of gene silencing. Mol Cell 8, 489-498.
Morley, J. F., and Morimoto, R. I. (2004). Regulation of longevity in Caenorhabditis elegans by
heat shock factor and molecular chaperones. Mol Biol Cell 15, 657-664.
49
Mortimer, R. K., and Johnston, J. R. (1959). Life span of individual yeast cells. Nature 183, 17511752.
Motta, M. C., Divecha, N., Lemieux, M., Kamel, C., Chen, D., Gu, W., Bultsma, Y., McBurney,
M., and Guarente, L. (2004). Mammalian SIRT represses forkhead transcription factors. Cell
116, 551-563.
Moynihan, K. A., Grimm, A. A., Plueger, M. M., Bernal-Mizrachi, E., Ford, E., Cras-Meneur, C.,
Permutt, M. A., and Imai, S. (2005). Increased dosage of mammalian Sir2 in pancreatic beta cells
enhances glucose-stimulated insulin secretion in mice. Cell Metab 2, 105-117.
Muller, I. (1985). Parental age and the life-span of zygotes of Saccharomyces cerevisiae. Antonie
Van Leeuwenhoek 51, 1-10.
Nasmyth, K., and Dirick, L. (1991). The role of SWI4 and SWI6 in the activity of G1 cyclins in
yeast. Cell 66, 995-1013.
Nemoto, S., Fergusson, M. M., and Finkel, T. (2004). Nutrient availability regulates SIRT1
through a forkhead-dependent pathway. Science 306, 2105-2108.
Nemoto, S., and Finkel, T. (2002). Redox regulation of forkhead proteins through a p66shcdependent signaling pathway. Science 295, 2450-2452.
Nomura, M. (2001). Ribosomal RNA genes, RNA polymerases, nucleolar structures, and
synthesis of rRNA in the yeast Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol
66, 555-565.
North, B. J., Marshall, B. L., Borra, M. T., Denu, J. M., and Verdin, E. (2003). The human Sir2
ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Mol Cell 11, 437-444.
North, B. J., and Verdin, E. (2004). Sirtuins: Sir2-related NAD-dependent protein deacetylases.
Genome Biol 5, 224.
Ozcan, S., and Johnston, M. (1999). Function and regulation of yeast hexose transporters.
Microbiol Mol Biol Rev 63, 554-569.
Paradis, S., and Ruvkun, G. (1998). Caenorhabditis elegans Akt/PKB transduces insulin receptorlike signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes Dev 12, 24882498.
Parisi, M., and Lin, H. (2000). Translational repression: a duet of Nanos and Pumilio. Curr Biol
10, R81-83.
50
Park, P. U., Defossez, P. A., and Guarente, L. (1999). Effects of mutations in DNA repair genes
on formation of ribosomal DNA circles and life span in Saccharomyces cerevisiae. Mol Cell Biol
19, 3848-3856.
Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., Machado De Oliveira, R.,
Leid, M., McBurney, M. W., and Guarente, L. (2004). Sirtl promotes fat mobilization in white
adipocytes by repressing PPAR-gamma. Nature 429, 771-776.
Rine, J., and Herskowitz, I. (1987). Four genes responsible for a position effect on expression
from HML and HMR in Saccharomyces cerevisiae. Genetics 116, 9-22.
Rogina, B., and Helfand, S. L. (2004). Sir2 mediates longevity in the fly through a pathway
related to calorie restriction. Proc Natl Acad Sci U S A 101, 15998-16003.
Rogina, B., Helfand, S. L., and Frankel, S. (2002). Longevity regulation by Drosophila Rpd3
deacetylase and caloric restriction. Science 298, 1745.
Rolland, F., Winderickx, J., and Thevelein, J. M. (2001). Glucose-sensing mechanisms in
eukaryotic cells. Trends Biochem Sci 26, 310-317.
Shou, W., Sakamoto, K. M., Keener, J., Morimoto, K. W., Traverso, E. E., Azzam, R., Hoppe, G.
J., Feldman, R. M., DeModena, J., Moazed, D., et al. (2001). Netl stimulates RNA polymerase I
transcription and regulates nucleolar structure independently of controlling mitotic exit. Mol Cell
8, 45-55.
Sinclair, D., Mills, K., and Guarente, L. (1998). Aging in Saccharomyces cerevisiae. Annu Rev
Microbiol 52, 533-560.
Sinclair, D. A., and Guarente, L. (1997). Extrachromosomal rDNA circles--a cause of aging in
yeast. Cell 91, 1033-1042.
Smeal, T., Claus, J., Kennedy, B., Cole, F., and Guarente, L. (1996). Loss of transcriptional
silencing causes sterility in old mother cells of S. cerevisiae. Cell 84, 633-642.
Smith, J. S., Brachmann, C. B., Celic, I., Kenna, M. A., Muhammad, S., Starai, V. J., Avalos, J.
L., Escalante-Semerena, J. C., Grubmeyer, C., Wolberger, C., and Boeke, J. D. (2000). A
phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein
family. Proc Natl Acad Sci U S A 97, 6658-6663.
Sutton, A., Immanuel, D., and Arndt, K. T. (1991). The SIT4 protein phosphatase functions in
late G1 for progression into S phase. Mol Cell Biol 11, 2133-2148.
Tadauchi, T., Matsumoto, K., Herskowitz, I., and Irie, K. (2001). Post-transcriptional regulation
through the HO 3'-UTR by Mpt5, a yeast homolog of Pumilio and FBF. Embo J 20, 552-561.
51
Tanner, K. G., Landry, J., Sternglanz, R., and Denu, J. M. (2000). Silent information regulator 2
family of NAD- dependent histone/protein deacetylases generates a unique product, -O-acetylADP-ribose. Proc Natl Acad Sci U S A 97, 14178-14182.
Tanny, J. C., Dowd, G. J., Huang, J., Hilz, H., and Moazed, D. (1999). An enzymatic activity in
the yeast Sir2 protein that is essential for gene silencing. Cell 99, 735-745.
Tatar, M., Kopelman, A., Epstein, D., Tu, M. P., Yin, C. M., and Garofalo, R. S. (2001). A
mutant Drosophila insulin receptor homolog that extends life-span and impairs neuroendocrine
function. Science 292, 107-110.
Thevelein, J. M., and de Winde, J. H. (1999). Novel sensing mechanisms and targets for the
cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol Microbiol 33, 904918.
Thore, S., Mauxion, F., Seraphin, B., and Suck, D. (2003). X-ray structure and activity of the
yeast Pop2 protein: a nuclease subunit of the mRNA deadenylase complex. EMBO Rep 4, 11501155.
Tissenbaum, H. A., and Guarente, L. (2001). Increased dosage of a sir-2 gene extends lifespan in
Caenorhabditis elegans. Nature 410, 227-230.
Tu, M. P., Epstein, D., and Tatar, M. (2002a). The demography of slow aging in male and female
Drosophila mutant for the insulin-receptor substrate homologue chico. Aging Cell 1, 75-80.
Tu, M. P., Yin, C. M., and Tatar, M. (2002b). Impaired ovarian ecdysone synthesis of Drosophila
melanogaster insulin receptor mutants. Aging Cell 1, 158-160.
Tucker, M., Staples, R. R., Valencia-Sanchez, M. A., Muhlrad, D., and Parker, R. (2002). Ccr4p
is the catalytic subunit of a Ccr4p/Pop2p/Notp mRNA deadenylase complex in Saccharomyces
cerevisiae. Embo J 21, 1427-1436.
Uesono, Y., Toh-e, A., and Kikuchi, Y. (1997). Ssdlp of Saccharomyces cerevisiae associates
with RNA. J Biol Chem 272, 16103-16109.
van der Horst, A., Tertoolen, L. G., de Vries-Smits, L. M., Frye, R. A., Medema, R. H., and
Burgering, B. M. (2004). FOXO4 is acetylated upon peroxide stress and deacetylated by the
longevity protein hSir2(SIRT1). J Biol Chem 279, 28873-28879.
Weindruch, R., Kayo, T., Lee, C. K., and Prolla, T. A. (2002). Gene expression profiling of aging
using DNA microarrays. Mech Ageing Dev 123, 177-193.
Weindruch, R., Naylor, P. H., Goldstein, A. L., and Walford, R. L. (1988). Influences of aging
and dietary restriction on serum thymosin alpha 1 levels in mice. J Gerontol 43, B40-42.
52
Wood, J. G., Rogina, B., Lavu, S., Howitz, K., Helfand, S. L., Tatar, M., and Sinclair, D. (2004).
Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature 430, 686-689.
53
FIGURES
Figure 1. Survival curves from distantly related species display similar shapes. Typical
mortality data from Homo sapiens (Sinclair et al., 1998), Mus musculus, Caenorhabditis
elegans (Tissenbaum and Guarente, 2001), and S. cerevisiae (Kaeberlein et al., 1999) are
presented. This figure adapted from Matt Kaeberlein, Genetic Analysis of Longevity in
Saccharomyces cerevisiae, Graduate Thesis, MIT 2002. Reproduced here by permission.
54
HUMAN
MOUSE
100
90
100
90
80
80
70
'f: 70
_
:; 60
~60
~50
~50
>40
a:
'~ 40
aJ
::::>30
20
CJ)
10
30
20
10
o
o
o
1‫סס‬oo
-30000
20000
0
300
Days
WORM
1200
YEAST REPLICATIVE
100
100
90
80
90
_ 70
_
~8O
~
600
900
Days
80
70
~60
50
~50
~::;) 40
"J) 30
.~ 40
:J
0030
20
10
20
10
o
o
5
10
15
Days
20
o
25
FIGURE 1
55
o
10
20
Generation
30
40
Figure 2. Caloric restriction (CR) in yeast increases budding life span by activating
Sir2p. Two separate mechanisms relieve inhibition of Sir2p (and its homolog Hst2p) to
promote rDNA stability and longevity. CR also induces a Sir2p- and Hst2p-independent
extension of life span by an unknown mechanism.
56
Yeast
Caloric Restriction
V
ft Respiration
f NAD+/NADH
Ratio
9
A
Sir2p (and Hst2)
Activity
rDNA Stability
LONGEVITY
FIGURE 2
57
ft Pnclp
IL
Nicotinamide
Figure 3. Components of the insulin/IGF- 1 signaling pathway promote life span in
yeast, worms, flies, and mice. Details of each pathway are described in the text.
Question marks indicate plausible regulatory connections within each pathway, also
discussed in the text.
58
5W-
~
U:
59/
0
0
t~~~
0
.
c
_
el)
C
c~~
75~~~~~~~~u
5
C..-
05
~
\ \
L
\
8_~~~5
CR
59
60
Chapter2
Ssdlp Directly Represses Translation of
Uthlp to Increase Longevity,
Stress Resistance, and Cell Wall Stability in
Saccharomyces cerevisiae
This chapter will be submitted for publication. The authors are Gregory Liszt, Matt
Kaeberlein, Sarah Buckley, and Leonard Guarente. I contributed Figures lc, Figure 4,
Figure 5, Figure 6, and Figure 7, and all unpublished observations referred to in the text.
I also developed the mechanistic model and wrote the manuscript.
61
SUMMARY
In yeast, natural polymorphisms at the SSDI locus strongly affect aging, stress
resistance, pathogenicity, and cell wall integrity. The active SSD1-V allele promotes
longevity by a novel mechanism independent
of rDNA recombination
and
extrachromosomal rDNA circle (ERC) formation, two processes tightly linked to known
pathways of yeast aging. Here, we report that Ssdlp, an RNA-binding protein, strongly
represses the in vivo translation of Uthlp, one of the original proteins implicated in the
yeast aging process. Deletion of UTH1 from ssdl-d cells phenocopies the addition of
SSD1-V, causing a long life span and unique stress resistance profile. Furthermore,
SSD1-V and uthlA both suppress mutations in several apparently unrelated genes
including MPT5, SIT4, and CCR4. Uthlp levels are significantly reduced in SSD1-V
cells, although the level of the UTH1 message is not influenced by SSD1 under normal
growth conditions.
Ssdlp physically interacts with the UTH1 mRNA, and these
molecules can be copurified from cells.
Interestingly, this interaction depends on
sequence elements in the 5'-UTR of UTH1. SSD1-V cells lacking the 5'-UTR of UTH1
fail to show repression of Uthlp and phenotypically resemble ssdl-d cells. These results
demonstrate that the direct translational repression of Uthlp by Ssdlp is necessary and
sufficient to account for several phenotypic hallmarks of SSD1-V cells. These results also
suggest that many of the defects of ssdl-d cells arise from a misregulation of Uthlp.
62
INTRODUCTION
In Saccharomyces cerevisiae, dividing mother cells undergo an aging process that
limits their replicative potential and induces pronounced changes in cell morphology,
metabolism, genomic stability, transcriptional silencing, and the cell wall (Bitterman et
al., 2003; Sinclair et al., 1998). Mutations that extend the yeast replicative life span have
been used to study aging, and several of these mutations have led to the discovery of
conserved mechanisms regulating aging in such diverse organisms as worms, flies, and
even mice (Guarente and Picard, 2005; Kenyon, 2005).
With successive cell divisions, instability at the rDNA locus and
extrachromosomal rDNA circle (ERC) accumulation exponentially increase the
likelihood of senescence and mortality in yeast mother cells (Sinclair and Guarente,
1997). Aging can be forestalled by caloric restriction, a regimen that increases the
activity of Sir2p (Anderson et al., 2003; Lin et al., 2000; Lin et al., 2004; Lin et al.,
2002), an important regulator of aging in yeast and some metazoans (Kaeberlein et al.,
1999; Rogina and Helfand, 2004; Tissenbaum and Guarente, 2001; Wood et al., 2004).
SSD1 is a polymorphic locus affecting diverse cellular processes including high
temperature growth, cell integrity (Kaeberlein and Guarente, 2002), pathogenicity
(Wheeler et al., 2003), and mother-cell aging (Kaeberlein et al., 2004a). Naturally
occurring polymorphisms of the SSD1 gene fall into two phenotypic classes: active
SSD1-V alleles and inactive ssdl-d alleles, classified on the basis of their ability to
suppress mutations in the Sit4p phosphatase. SSD1-V, which suppresses sit4A lethality,
has also been isolated as a suppressor of diverse genetic mutations affecting the cell wall
stability, protein kinase A activity, TOR-signaling, and mRNA transcription and
63
processing (summarized in (Kaeberlein et al., 2004a). Addition of SSDI-V dramatically
extends lifespan of ssdl-d
strains by a novel, as yet uncharacterized mechanism
(Kaeberlein et al., 2004a). This mechanism is Sir2p-independent, affecting neither rDNA
silencing nor ERC formation, two processes linked to yeast aging (Kaeberlein et al.,
2004a). Although SSDI is well conserved from yeast to humans, little is known of its
biochemical function. A previous study has demonstrated that Ssdlp, a cytoplasmic
protein, can bind RNA in vitro (Uesono et al., 1997), but it is not known whether this
activity is physiologically significant.
RNA binding proteins have been shown to regulate a variety of posttranscriptional processes including mRNA localization and stability, translation and
splicing (Kuersten and Goodwin, 2003). RNA-binding proteins feature prominently in
metazoan development, often as repressors of translation (Dreyfuss et al., 2002;
Johnstone and Lasko, 2001; Maniatis and Reed, 2002; Mazumder et al., 2003). For
example, early in embryogenesis, the Drosophila PUMILIO protein binds maternal
hunchback mRNA via sequence elements in the 3' untranslated region (UTR), repressing
hunchback translation at the posterior pole by a mechanism also requiring the NANOS
protein (Parisi and Lin, 2000).
Similarly, the precise control of translation and
localization results in highly regulated expression of other mRNAs including BICOID,
OSCAR, and NANOS itself (Johnstone and Lasko, 2001). In C. elegans, the RNAbinding protein GLD-1 influences several germ cell fate decisions by repressing the
translation of numerous maternal mRNAs, often in a spatially dependent manner (Jan et
al., 1999; Lee and Schedl, 2001; Lee and Schedl, 2004; Marin and Evans, 2003; Mootz et
al., 2004; Xu et al., 2001). Interestingly, GLD-1 also represses translation of CEP-l/p53
64
to affect germ cell apoptosis in response to DNA damage (Schumacher et al., 2005). The
translation of the GLD-1 message is, in turn, regulated by the RNA-binding protein FBF
(fem-3 mRNA Binding Factor; (Crittenden et al., 2002; Zhang et al., 1997). FBF consists
of two nearly identical proteins, both of which contain the eight consecutively repeated
PUMILIO-homology domains required for RNA-binding activity in the Drosophila
protein (Zamore et al., 1997).
Notably, a recent study systematically identified RNA targets of the yeast
PUMILIO-FBF family of proteins (Pufl-5p), uncovering a novel mechanism whereby
specific RNA-binding proteins physically associate with functionally related groups of
target RNA molecules to regulate their post-transcriptional properties (Gerber et al.,
2004).
The best characterized
of the five yeast Pumilio family members is
Puf5/Mpt5/Uth4, a protein important for pheromone response (Chen and Kurjan, 1997),
life span regulation (Kennedy et al., 1995; Kennedy et al., 1997), and cell wall integrity
(Kaeberlein and Guarente, 2002). Deletion of MPT5 shortens life span by 50%, and
overexpression extends life span by up to 40% (Kennedy et al., 1997), underscoring the
importance of this post-transcriptional regulator in the aging process. Cells lacking
Puf5/Mpt5/Uth4 display increased telomeric silencing, decreased rDNA silencing, and an
aberrant distribution of Sir3p in the absence of Sir4p (Gotta et al., 1997). In the absence
of SSDI-V, mpt5A mutant cells also suffer from several deficiencies associated with a
weakened cell wall, including sensitivity to calcofluor white (CFW), sensitivity to
sodium dodecyl sulfate (SDS), and sorbitol-remedial temperature sensitivity (Kaeberlein
65
and Guarente, 2002). Genetic analysis suggests that Mpt5p, Ssdlp, and Pkclp define
three parallel pathways to ensure cell wall integrity.
Uthlp is a member of a family of proteins specific to fungi, known as the SUN
family of proteins because its members include Simlp, Uthlp, and Nca3p as well as the
more recently identified Sun4p (Mouassite et al., 2000b). The UTHI gene was originally
identified as a loss-of-function suppressor of the short life span and stress sensitivity
caused by a C-terminal truncation of Mpt5p (Kennedy et al., 1995). Subsequent studies
have shown that deletion of UTHI increases life span, resistance to peroxides (Bandara et
al., 1998), and resistance to starvation- and rapamycin-induced autophagy (Kissova et al.,
2004). Uthlp localizes to the outer mitochondrial membrane and the cell wall, and has
been shown to be highly glycosylated (Velours et al., 2002).
We noticed that deletion of UTHI, like addition of SSDI-V, suppresses the cell
wall defects and short life span of an mpt5A ssdl-d mutant. This similarity between
SSD1-V and uthlA prompted us to further investigate the relationship between these two
genes. Here, we present evidence that Ssdlp directly represses Uthlp, and by that
repression effects large changes in stress resistance, life span, and cell wall integrity.
MATERIALS AND METHODS
Strains and genetic techniques.
The strains used in this study are listed in Table 1. All strains
were derived from either PSY316 (described in (Park et al., 1999) or W303R (described in (Mills
et al., 1999). W303R has previously been shown to carry the ssdl-d2 allele (Sutton et al., 1991).
PSY316 contains an ssdl-d nonsense mutation predicted to truncate Ssdlp at codon 132
(Nicholas Bishop, personal communication).
Yeast transformations were accomplished using the
66
lithium acetate method (Gietz et al., 1992). Genetic crosses, sporulation, and tetrad analysis were
carried out by standard techniques (Sherman and Hicks, 1991). Marker segregation in viable
spore clones was used to infer the genotype of inviable spore clones from the same tetrad
whenever possible. The ccr4::HIS3, swi6::TRPI, mpt5::LEU2, and mptS::HIS3 disruptions were
generated using plasmids described in (Kaeberlein and Guarente, 2002). All other gene deletions
were done by transforming cells with PCR-amplified disruption constructs. For each gene
disruption, the entire open reading frame (ORF) was removed except for SWI4 disruption, which
was done'by replacing the first 2kb of the SWI4 ORF with HIS3. All disruptions were verified
phenotypically, by PCR, or both. The SSD1-V integrating plasmids p406SSD1 and p405SSD1, as
well as the ARS-CEN variants of those plasmids (p416SSD1 and p415SSD1) were previously
described (Kaeberlein and Guarente, 2002). Unless otherwise indicated, all SSDI-V strains
contain SSD1-V integrated at the marker locus and still carry the ssdl-d allele at the native locus.
Deletion of ssdl-d does not affect any of the phenotypes tested, including life span, growth at
30°C, 37°C, or 40°C, or sensitivity to calcofluor white, paraquat or hydrogen peroxide
(Kaeberlein and Guarente, 2002; Kaeberlein et al., 2004b).
A yeast strain of the BY4741 background containing a tandem affinity purification (TAP)
tag integrated in-frame at the 3' end of the SSD1 gene was obtained from OpenBiosystems
(Ghaemmaghami et al., 2003). The following primers were used to PCR amplify a region of
SSD1-TAP encompassing the final 1785 bp of the SSD1 ORF as well as the entire affinity tag:
TAAGGGATAACAATTTTCTTT
(forward
primer)
and
TTTGCGGCCGCGAAAGAGTTACTCAAGAATAA (reverse primer). This PCR product was
digested with BstBI and NotI and ligated into plasmid p416SSDl cut with the two same enzymes.
The resulting plasmid p416SSD1-TAP was transformed into PSY316AR, and expression of an
active fusion protein was confirmed by phenotype and Western blot using a rabbit polyclonal
anti-TAP antibody (OpenBiosystems).
67
The UTH]TERMNATOR::ADHTERMNATOR-kanMX6 replacement was constructed by one-step
PCR-mediated gene disruption as follows.
Plasmid pFA6-3HA-kanMX6
was used as a template
to generate the disruption construct, as this plasmid contains the ADHTERMINATOR
sequence
(Longtine et al., 1998). This sequence was amplified with the following primers incorporating
regions flanking the UTH1 terminator sequence (indicated in uppercase):
TTCAGTTACTTCTGGTTCTGCTAACTTTGTCTTCTACTAGacttctaaataagcgaattt (forward)
TGTTATATAATATGCTATATATGATAATATCTAGTGGTATgaattcgagctcgtttaaac (reverse).
This construct was transformed into strain GLY3002 and gene replacement was verified by PCR.
Spot Assays. Calcofluor white (Fluorescence Brightener 28, Sigma), hydrogen peroxide, and
paraquat (Methyl Viologen, Sigma) were added at the designated concentrations to cooled
(<60°C), premixed YPD containing 3% agar (w/v). Plates were dried at 37°C and used for serial
dilution spot assays the same day. These assays were performed by first growing cells overnight
in YPD at 30°C, then diluting cultures back 50-fold in fresh YPD and allowing to grow for an
additional 3-4 hours. For each strain, a series of 10-fold dilutions was prepared in fresh YEP over
a range of concentrations from 10-' to 10-5 relative to the initial culture. Spots of 5[tL from each
dilution series were then plated to the appropriate media using a multi-channel pipettor.
Western Blotting. Total protein extracts from yeast were prepared as described (Kushnirov,
2000) by brief NaOH treatment followed by boiling in optimized SDS sample buffer.
From 2.5
O.D. units of cells, 50[tL SDS-solubilized proteins were prepared, a 10[tL quantity of which was
used for Western analysis. Samples were resolved by SDS-PAGE on a 4-15% Tris-HCl gradient
gel (Bio-Rad), transferred to nitrocellulose membrane and blocked using 4% nonfat dry milk in
PBS with 0.1% Tween-20 (PBS-T). Uthlp was detected by incubation with rabbit polyclonal
anti-Uthlp antisera diluted 1: 2,500 in PBS-T. This antibody, a generous gift from S. Manon, has
been characterized previously (Velours. et al., 2002). Peroxidase-conjugated donkey anti-rabbit
IgG secondary antibody (Amersham Biosciences) was used at a dilution of 1: 10,000.
68
Chemiluminescent detection was achieved by incubation with the ECL reagent (Amersham
Biosciences).
Blots were stripped for 20 minutes in 50 ° C stripping buffer (62.5 mM Tris-HCl
pH 7.5, 2% SDS, 100 mM beta-mercaptoethanol)
and reprobed with anti-c tubulin as a loading
control.
Northern Blotting. Total cellular RNA was prepared and purified using the Qiagen Rneasy kit
according to the manufacture's instructions.
Briefly, cells were grown to early log phase, and 2.5
O.D. units of cells were harvested and resuspended in 2 mL buffer Y1 (M sorbitol, 0.1M EDTA
pH 7.4, 0.1%
-mercaptoethanol, 100 U/mL zymolyase 100-T). Cells were incubated at 30° C
for 25 minutes to create spheroplasts.
Subsequently, spheroplasts were lysed, and the lysate was
applied to a Qiagen Rneasy column, washed three times and eluted two times in 30 [tL Rnase-free
water each time. Final RNA concentrations were measured by spectrophotometer,
and samples
were concentrated in a speed-vac evaporator and resuspended in Rnase-free water at a final
concentration of 3tg/tL.
For each sample, 12 [tg total RNA (4[tL) was mixed with three
volumes of formaldehyde loading buffer (Ambion) and denatured for 15 minutes at 65° C.
Ethidium bromide was added to a final concentration of 10 [tg/mL, and samples were run on a
formaldehyde denaturing gel (1 % Agarose, lx MOPS, 0.6 M formaldehyde).
The gel was run at
100 V for 2.5 hours in gel running buffer (lx MOPS, 0.2 M formaldehyde), bands were
visualized and photographed under UV light, and the gel was transferred overnight to GeneScreen
membrane (NEN) by capillary transfer in o10X
SSC buffer as described (Ausubel, 1999).
Membranes were UV-crosslinked two times in a Stratagene Stratalinker and prehybridized for
one hour at 42° C in pre-warmed UltaHybe solution (Ambion). During this period, the PrimeIt
Random Primer labeling kit (Stratagene) was used to generate
corresponding
32
p radiolabeled probe
to a 350 bp region of the UTH1 ORF. Blots were probed overnight and on the
next day washed twice under both low stringency (2x SSC, 0.1% SDS; 5 minutes at room
temperature) and high stringency (0.2x SSC, 0.1% SDS; 15 minutes at 42 ° C) conditions.
69
Blots
were analyzed by autoradiography, stripped for 10 minutes in 5% SDS at 95 ° C, and reprobed for
ADHI by the same method.
Affinity purifications. TAP purifications were conducted essentially as described (Gerber et al.,
2004) with a few modifications.
A 1 L YPD culture of cells grown to O.D. 0.7 at 30 ° C was
harvested by centrifugation, washed twice with ice cold buffer A (20 mM Tris-HC pH 8.0, 140
mM Kcl, 1.8 mM MgC12, 0.1% NP-40, 0.02 mg/mL heparin) and resuspended in 5 mL buffer B
(buffer A plus 0.5mM DTT, 20 U/mL DNAse I, 100 U/mL RnaseOut (Invitrogen), 0.2 mg/mL
heparin, and protease inhibitors (Roche)). Cells were subjected to glass bead lysis and whole cell
extracts were incubated with 400[tL (50% (v/v)) IgG-agarose beads (Sigma) for 4h at 4 C.
Beads were washed four times for 15 min each wash at 4 ° C in buffer C (20 mM Tris-HCl ph 8.0,
140 mM Kcl, 1.8 mM MgC12, 0.5 mM DTT, 0.01% NP-40, 10 U/mL RnaseOut).
TAP-tagged
Ssdlp was released from the beads by cleavage with 100 U of TEV protease for 1.5 h at 16 ° C
with gentle periodic agitation. RNA was isolated from final eluates as well as whole cell extracts
using the Rneasy kit (Qiagen).
Final RNA concentrations
were determined
spectrophotometric measurement.
RT-PCR. One Step RT-PCR (Qiagen) was performed on RNA purified from whole cell extracts
and final TEV eluates. Each reaction was first optimized on 500 ng whole cell RNA to determine
the most effective number of PCR cycles for gene detection. The following primers were used:
UTHI forward-TCGGCGTCTCCCAGATCAAAG,UTHI reverseCCGTCTGCGTTGACGTACTG,
ACT1 forward-ATTCTGAGGTTGCTGCTT,
AACTCTCAATTCGTTGTAGA,
CBKI forward-
ATGTATAATAGCAGCACCA,
TGCACCTGCTCCAGCGGACA,
ACT] reverse-
CBKI reverse- ATCATCTGATTTGAAGCTG,
NCA3 forward-
NCA3 reverse-AGTAGTAGCCATCCTTACAT.
Reactions were carried out in a 50 [tL volume of the following composition: 1X OneStep RTPCR Buffer (Qiagen) containing 400 [tM of each dNTP, 0.6 [tM each primer, 5 units Rnasin, 500
70
by
ng template RNA (or equivalent volume from mock IP samples), and 2 [tL OneStep RT-PCR
Enzyme Mix (Qiagen).
RT-PCR cycles were as follows: 30 min at 50°C (reverse transcription); 15 min at 95°C (initial
PCR activation step); either 30 (ACT]) or 35 (CBKI, UTH1, NCA3) cycles of the following three
steps: 30 sec at 94°C (denaturation); 1 min at 65°C (annealing); 1 minute at 72°C (extension); 10
minute final extension.
71
RESULTS
We have previously found that SSD1-V suppresses the short life span and cell
wall defects caused by deletion of MPT5 in an ssdl-d background (Kaeberlein and
Guarente, 2002). To determine whether uthlA would have a similar effect on these
mpt5A phenotypes, we deleted UTH1 from ssdl-d mpt5A cells. As expected, mpt5A
alone severely impaired growth at 37 ° C and caused dose-dependent sensitivity to the cell
wall-perturbing agent calcofluor white (CFW) (Figure 1A). Strikingly, when UTHI was
also deleted from these cells, they grew well at 37 ° C and nearly as well as wild type cells
in the presence of CFW (Figure 1A). Similar to what is observed in UTH1 MPT5 SSDI-
V cells (Kaeberlein and Guarente, 2002), uthlA MPTS ssdl-d cells are more resistant to
CFW than UTH1 MPTS ssdl-d cells. Thus, deletion of UTH1 behaves phenotypically
like addition of SSD1-V, with both modifications strongly promoting cell integrity.
Spurred by this finding, we sought to identify other phenotypic similarities
between uthlA and SSD1-V cells. Uthlp was originally cloned by complementation of
the sensitivity to paraquat displayed by uthl mutant cells (Kennedy et al., 1995).
Paraquat generates superoxide radicals, suggesting that cells lacking Uthlp are sensitive
to oxidative stress. However, this view is complicated by the fact that uthlA also causes
resistance to hydrogen peroxide (Bandara et al., 1998; Kennedy et al., 1995). We were
interested in determining what effect, if any, SSD1-V would have on resistance to these
oxidative agents. As expected, uthlA in strain PSY316 resulted in resistance to hydrogen
peroxide and sensitivity to paraquat (Figure 2). Very similarly, addition of SSDI-V
caused resistance to hydrogen peroxide and sensitivity to paraquat, demonstrating that
both SSD1-V and Uthlp affect the oxidative stress response of cells.
72
During the course of our analysis, we observed that SSD1-V and uthlA cells both
have a greater maximum growth temperature than ssdl-d cells. Strain PSY316, which
harbors the ssdl-d allele, is unable to grow at 40° C; however, both SSD1-V and uthlA
cells grow very well at this temperature (Figure 2). This phenotype could be the result of
a strengthened cell wall, or could reflect some other function shared by these proteins.
We next examined the relative and combined effects of SSD1-V and uthlA on life
span. Like SSD1-V, uthlA extends wild type ssdl-d life span. SSD1-V UTH1 cells have
a much longer life span than ssdl-d uthl cells, suggesting that uthlA has a weaker
longevity-promoting effect than addition of SSD1-V (Figure C). Interestingly, SSD1-V
uthlA cells have a life span comparable to ssdl-d uthlA cells and shorter than those of
the SSD1-V UTH1 genotype. These results indicate that the shorter-lived uthl mutation is
epistatic to SSDI-V with respect to life span.
We sought to establish a genetic relationship between UTH1 and SSD1. SBF, a
transcriptional activator consisting of the cell-cycle regulated proteins Swi4p and Swi6p,
acts downstream of protein kinase C (Pkclp) to promote cell wall biosynthesis (Igual et
al., 1996). Ccr4p, a component of the cytoplasmic deadenylase complex (Thore et al.,
2003; Tucker et al., 2002) also functions in an RNA Polymerase II-containing complex
required for PKCl-dependent transcriptional regulation of multiple genes required for
proper cell wall structure (Chang et al., 1999). Mutation of either CCR4 or SBF is lethal
in combination with mutation of MPT5 in an ssdl-d or ssdlA background (Kaeberlein
and Guarente, 2002). In order to determine whether uthlA, like addition of SSD1-V,
would suppress this synthetic lethality, we generated the following diploid mutants in a
W303R (ssdl-d) background: ccr4A/CCR4 mpt5A/MPT5 uthlA/UTH]; swi4A/SWI4
73
mpt5A/MPT5 uthlA/UTHI; swi6A/SWI6 mpt5A/MPTS uthlA/UTH1. These strains were
sporulated, tetrads were dissected, and the genotypes of the surviving spores were
determined. While ccr4A mpt5A ssdl-d UTH1, swi4A mpt5A ssdl-d UTH1 and swi6A
mpt5A ssdl-d UTH1 spores were never viable, we were able to recover ccr4A mpt5A
ssdl-d uthlA, swi4A mpt5A ssdl-d uthlA and swi6A mpt5A ssdl-d uthlAcells (Table 2).
Deletion of UTH1 also partially rescued the growth defects and sensitivity to CFW
caused by mutation of CCR4 or SBF (data not shown). These results suggest that Uthlp
acts as a negative regulator of cell integrity in a pathway parallel to Mpt5p. Moreover,
these results underline the striking similarity between mutation of UTH1 and addition of
SSD1-V.
We therefore wished to determine whether this similarity extended to processes
other than cell integrity and life span. SSD1-V was first defined based on its ability to
confer viability to a strain carrying a mutation in SIT4. In order to test whether uthlA
could also confer viability to a sit4A mutant, a sit4A/SIT4 ssdl-d/ssdl-d uthlA/UTHI
doubly heterozygous diploid was sporulated and tetrads were analyzed. The results are
compiled in Table 2 and shown in Figure 3. As expected, 0/21 sit4A ssdl-d UTH1 spore
clones were able to form viable colonies, confirming that sit4A and ssdl-d
are
synthetically lethal. In contrast, 14/14 sit4A ssdl-d uthlA spore clones formed colonies
(Table 2), indicating that uthlA is an effective suppressor of the sit4A ssdl-d synthetic
lethality. Like sit4A SSD1-V UTH1 cells, sit4A ssdl-d uthlA cells are slow growing, but
are capable of vegetative growth indefinitely (Figure 3). Interestingly, maximal benefit
to the sit4A cells appears to be obtained by either SSD 1-V or mutation of UTH1, as sit4A
74
SSD1-V uthlA cells display no greater growth advantage compared to sit4A ssdl-d uthlA
and sit4A SSD1-V UTHI mutants (Figure 3).
Taken together, these results suggest a model whereby Ssdlp represses Uthlp to
affect cell integrity, life span, and stress resistance. Using Western blot analysis, we
tested this possibility by comparing Uthlp levels in SSDI1-V and ssdl-d strains (Figure
4a). SSDI-V and ssdl-d cells grown in rich media were harvested during early-, mid-, and
late-log phase, and protein extracts were subjected to Western blotting. As reported
(Velours et al., 2002), a rabbit polyclonal antibody specific to Uthlp predominantly
recognized a thick band of approximately 60 KDa corresponding to glycosylated Uthlp
(Figure 4a). This band was absent from extracts of uthlA cells. Importantly, SSD1-V
caused a dramatic reduction in Uthlp levels in all growth phases without significantly
affecting the levels of P-tubulin. Similar results were obtained from cells grown at 37° C
(data not shown), indicating that SSD -V represses Uthlp under a wide variety of culture
conditions. Interestingly, in the absence of SSDI-V, Uthlp was upregulated during latelog phase growth, while in the presence of SSDI-V Uthlp remained barely detectable as
nutrients in the culture became exhausted (Figure 4a).
To determine whether SSDI-V repressed Uthlp at the transcriptional level, we
performed Northern analysis on ssdl-d and SSDI-V cells. During log phase growth,
UTHI mRNA levels were unchanged by SSDI-V (Figure 4b), despite the fact that this
allele caused a striking reduction in Uthl protein. During late-log phase, as glucose was
depleted from the growth medium, UTHI mRNA levels decreased significantly in SSDIV cells but not in ssdl-d cells (Figure 4b). All blots were stripped and reprobed for
ADHI expression to demonstrate equal RNA loading. From these data, we conclude that
75
under normal growth conditions, SSDI-V reduces Uthl protein expression without
decreasing UTH1 mRNA levels. The repression of Uthlp by SSD1-V under these
conditions must therefore be post-transcriptional.
Under conditions of high culture
density and reduced glucose availability, SSDI-V further reduces Uthlp expression by a
mechanism that decreases the prevalence of the UTHI mRNA.
As all phenotypic analyses (including life span assays) were conducted under
early log phase growth conditions, we sought to explain the regulation of Uthlp by Ssdlp
under these circumstances.
Two possible models might account for the post-
transcriptional repression of the Uthl protein by Ssdlp. By the first model, Ssdlp would
reduce Uthlp by lowering that protein's stability, making it more susceptible to
degradation. To test this possibility, early-log phase ssdl-d and SSDI-V cells were
treated with 100 ug/mL cycloheximide to inhibit protein synthesis.
Proteins were
extracted by boiling in modified SDS-sample buffer before cycloheximide treatment and
every 70-seconds subsequently. Samples were then subjected to Western blotting, and
Uthlp was detected using an anti-Uthlp polyclonal antibody. We observed that Uthlp
decayed with identical kinetics in cycloheximide-treated cells of both the ssdl-d and
SSDI-V genotypes (Figure 5), indicating that the observed decrease in Uthlp in log phase
SSDI-V cells was not the result of accelerated protein degradation. In both cases, an
initially rapid period of degradation (Figure 5a) was followed by a very long period
(>2hr) during which continued protein decay was undetectable (Figure 5b). Over the first
225 seconds, decay in both ssdl-d and SSDI-V strains occurred with a half-life time
constant of approximately one minute, very short even for a yeast protein (Beyer et al.,
2004; Varshavsky, 1996). Following this period, a fraction of the existing Uthlp in the
76
cell remained stable for hours. Importantly, this unusual protein stability profile applied
to cells of both ssdl-d and SSD1-V genotypes, leading us to conclude that SSDI-V does
not repress Uth lp at the level of protein stability.
A second model postulates that SSDI, an RNA-binding protein, might be acting
as a post-transcriptional repressor by inhibiting the translation of the UTHI message. In
order to purify ribonucleoparticles associated with Ssdlp, a single-copy plasmid
containing the SSDI1-Vgene fused to an in-frame C-terminal tandem affinity purification
(TAP) tag sequence was transformed into strain PSY316AR. The same plasmid lacking
the TAP tag sequence was used to obtain transformants of strain PSY316AR to provide a
control for non-specific enrichment during the purification process. Affinity purifications
were performed from these two strains using agarose-IgG beads under conditions
previously described to preserve protein-RNA interactions (Gerber et al., 2004). RNA
was then isolated from purified TEV protease-eluted protein samples by column
chromatography using the Qiagen Rneasy kit. From SSD1-TAP cells, we obtained
between 0.2-0.6 [tg RNA per 1 L of starting culture (data not shown), a result comparable
to what has been reported for other yeast RNA binding proteins (Gerber et al., 2004). We
did not obtain a significant quantity of RNA from the final elution of untagged control
samples, suggesting that the RNA fraction obtained from Ssdlp-TAP cells consisted of
RNA molecules specifically associated with the tagged protein.
To confirm this finding and to test for a specific physical association between
Ssdlp-TAP and UTHI mRNA, purified RNA fractions were probed for several candidate
genes using RT-PCR. Primers specific to -actin, encoded by ACT], detected that gene's
cDNA in input but not affinity-purified RNA preparations from both tagged and untagged
77
strains, indicating that this abundant transcript was not significantly associated with
Ssdlp-TAP or control fractions.
Similar results were obtained when extracts were
probed for the UTHI family member NCA3 and the unrelated CBK1, encoding a kinase
whose protein product physically interacts with Ssdlp (Ho et al., 2002; Racki et al.,
2000). When used to probe total cellular RNA fractions from Ssdlp-TAP and mock
affinity purified eluates, each pair of primers detected a band, confirming the efficacy of
these primer pairs in the RT-PCR reaction. However, of the four genes analyzed, only
primers specific to UTH1 succeeded in amplifying a product from Ssdlp-TAP purified
fractions. This UTH] band was sequenced to confirm that it represented the predicted
gene (not shown). This band was absent from the TEV eluate of untagged extracts.
These results indicate that the UTH1 mRNA physically associates with Ssdlp-TAP, and
that this association is specific, as Ssdlp-TAP fails to stably associate with the abundant
ACT1 transcript or the NCA3 or CBKl transcripts.
To identify the region of UTH1 mediating this interaction and to ask whether this
interaction is required for the regulation of Uthlp by Ssdlp, mutants were generated
substituting the upstream region (including the 5'-UTR) or the downstream region
(including the 3'-UTR) of the ADH1 gene for that of UTH1 (Figure 7). These mutations
were first analyzed in an SSD1-V background to determine whether either substitution
affected the regulation of Uthlp by Ssdlp. Surprisingly, substitution of the 3'-UTR of
UTH1 did not hinder the repressive effects of Ssdlp on Uthlp (Figure 7b), and SSD1-V
UTHl
3
rUTR::ADH
3 UTRcells grew as well as SSD1-V cells at 40°C (Figure 7c). However,
substitution of the promoter and 5'-UTR of UTHI with a truncated, less active form of
the ADHI promoter and its 5'-UTR did abolish the repression by Ssdlp, also severely
78
limiting the ability of these cells to grow at 40°C (Figure 7). Therefore, we conclude that
repression of Uthlp by Ssdlp requires the 5' upstream region of UTH1, and that this
repression is required for the SSDI-V phenotype of high temperature growth.
Preliminary results from affinity co-purification experiments indicate that the
substitution of the UTHI promoter and upstream region abolishes the physical interaction
between Ssdlp and the UTH1 mRNA. Validation of these results will be included upon
submission of this manuscript.
DISCUSSION
Here, for the first time, we provide a molecular mechanism to explain the action
of Ssdlp, a highly conserved protein with diverse effects on yeast physiology. Several
lines of evidence now lead us to conclude that Ssdlp directly represses Uthlp by a posttranscriptional mechanism, and this repression is necessary and sufficient to account for
vast effects of Ssdlp on life span, cell integrity, high temperature growth, and stress
resistance. First, deletion of UTHI can effectively compensate for the null ssdl]-d allele,
restoring longevity, increased cell wall stability, resistance to high temperature, and the
unusual combination of peroxide resistance and paraquat sensitivity. Second, deletion of
UTHI, like addition of SSDI-V, suppresses several genetic mutations in an ssdl-d
background, including the lethalities caused by mpt5 swi4 ssdl-d, mpt5 swi6 ssdl-d, mpt5
ccr4 ssdl-d, and sit4 ssdl-d genotypes. These findings demonstrate that abrogation of
Uthlp expression is sufficient to recapitulate widely varying phenotypes associated with
SSDI -V.
79
Additional data show that not only is Uthlp reduction sufficient to vary stress
resistance, life span, and cell wall stability in a manner reminiscent of SSDI-V, Uthlp is
actually strongly reduced SSDI1-Vcells. This downregulation occurs without a significant
effect on UTHI mRNA levels under normal culture conditions, pointing to a posttranscriptional mechanism of repression. Indeed, Ssdlp-TAP forms a specific physical
association with the UTHI mRNA in vivo, and this association is required for the proper
repression of Uthlp translation.
SSDI-V
cells in which this interaction has been
abrogated by replacement of the UTH] 5' UTR fail to resist oxidative stress and high
temperature, indicating that downregulation of Uthlp is required for these phenotypic
hallmarks of SSD -V cells.
A previous study established that Ssdlp possesses an in vitro RNA binding
activity, mediated by a central domain within the protein (Uesono et al., 1997). For the
first time, our results link this activity to the biological function of Ssdlp, raising the
possibility that Ssdlp may regulate other transcripts in addition to that of UTH.
Consistent with this possibility, Ssdlp-TAP co-purified with significant amounts of RNA
even in mutants in which the interaction with UTHI was apparently abolished
(preliminary data, not shown). Future experiments should aim to systematically identify
transcripts bound by Ssdlp in vivo, as these represent likely candidates for posttranscriptional co-regulation by Ssdlp.
The majority of mRNA-protein interactions characterized to date occur via
sequence elements in the 3' UTR of the bound mRNA (Gerber et al., 2004; Kuersten and
Goodwin, 2003). However, our data indicate that the interaction between Ssdlp and
UTH1 depends on sequence elements within the 5' UTR of UTHI, and possibly
80
additional elements located elsewhere within the UTHI mRNA. So far, we have been
unable to identify the precise nucleotide sequence sufficient to direct Ssdlp binding to an
mRNA (our unpublished observations), possibly because of a requirement for additional
sequence or structural characteristics within the ORF or even the 3' UTR. Interestingly,
for the three yeast Pumilio family members for which consensus binding sites have been
determined (Puf3-5), a significant fraction of these motifs reside within the open reading
frames (ORFs) of target genes. We therefore cannot rule out the possibility that the
UTH1 ORF contains additional sequence elements or structural characteristics required to
direct Ssdlp binding to the mRNA. Perhaps a comprehensive identification of Ssdlp
targets will also yield insight into the potentially complex issue of the sequence
specificity of Ssdlp.
While Ssdlp likely acts as post-transcriptional repressor of Uthlp during normal
growth conditions, presence of Ssdlp results in a dramatic reduction in UTHI mRNA
levels at the onset of the diauxic shift. Incidentally, we have also observed a similar
reduction in UTHI mRNA in SSDI-V cells treated with rapamycin (G.L. ad L.G.,
unpublished observations), used in some studies as a mimic of starvation (Albig and
Decker, 2001; Reinke et al., 2004). This Ssdlp-induced reduction in UTHI message
could result from indirect effects of Ssdlp on transcription under these conditions.
Alternatively, Ssdlp might specifically target UTHI mRNA for decay as starvation sets
in and the cellular mechanisms favoring RNA decay over synthesis and translation begin
to predominate. Both starvation and rapamycin treatment have been shown to activate
mRNA turnover via the nonsense mediated decay pathway, destabilizing particular RNAs
81
(Albig and Decker, 2001). Determination of the effect of Ssdlp on the half-life of UTHI
mRNA would help distinguish between these two possibilities.
Mutation of UTHI results in a shorter life span extension than SSDI-V, and is
epistatic to SSDI-V for life span. One possible explanation for this is that mutation of
UTHI results in two opposing effects on life span, and a maximum life span is only
obtained at an optimal level of the protein. Consistent with this model, SSD1-V cells do
maintain a low level of Uthlp that might be responsible for their increased longevity
compared to uthl null mutants. Although studies of Uthlp have primarily focused on the
benefits conferred by the absence of this protein, there are reports indicating that uthlA
mutants have subtle defects in mitochondrial function stemming from slightly reduced
synthesis of critical mitochondrial proteins (Camougrand et al., 2000; Mouassite et al.,
2000b). It is possible that these defects somehow begin to curtail life span past a certain
very old age.
Remaining members of the SUN family of proteins can compensate for the loss of
any individual SUN protein to some extent. This is evidenced by the fact that double
mutations within this family typically show much more severe phenotypes than single
mutations (Camougrand et al., 2000; Mouassite et al., 2000b). Consistent with this
notion, we have observed by transcriptional profiling that the SUN family member NCA3
is strongly induced by either uthlA or addition of SSDI-V (Kaeberlein et al., 2004a),
possibly as a means of compensating for the loss of its homolog in both cases. It is
interesting to note that Nca3p, although 63% identical to Uthlp, appears to be regulated
very differently, showing induction rather than repression as a result of Ssdlp. This gene
82
therefore provided an excellent negative control in the purification of RBPs associated
with Ssdlp-TAP in vivo.
Exactly how Uthlp affects so many cellular processes has been the subject of
several studies (Bandara et al., 1998; Camougrand et al., 2003; Camougrand et al., 2000;
Kissova et al., 2004), but still remains a significant mystery. Effects on cell wall stability
and structure could conceivably be mediated directly by Uthlp, which is not only
partially localized to the cell wall but also bears some homology to a B-glucosidase of
Candida wickerhamii (Mouassite et al., 2000a; Velours et al., 2002). No enzymatic
activity has yet been shown for Uthlp. And while effects of uthlA on stress resistance
have been hypothesized to account for its extension of replicative life span (Camougrand
et al., 2004), we feel this is unlikely to be the case, as genetic modifications made
specifically to increase peroxide resistance are insufficient to extend life span (Van
Zandycke et al., 2002). Moreover, superoxide sensitivity resulting from mutation of
superoxide dismutase generally causes a shortened life span (Fabrizio et al., 2004). A
deletion of UTH1 was found to increase resistance to death induced by the ectopic
expression of the mammalian apoptosis protein Bax (Camougrand et al., 2003). As yeast
have been shown to display a form of cell death resembling apoptosis in some ways
(Madeo et al., 2002), it is possible that dysregulation of Uthlp in ssdl-d cells shortens
life span by increasing susceptibility to this form of death in very old cells.
While Uthlp repression accounts for many phenotypes seen in SSD1-V cells,
there is also evidence that Ssdlp has Uthlp-independent roles in the cell. Even in a
UTHI mutant with the ADHI 5' UTR substituting for the endogenous 5'UTR, there still
is a small effect on high temperature growth and stress resistance caused by SSDl-V,
83
despite the lack of Uthlp repression in this strain. This residual effect likely results from
a parallel activity of Ssdlp affecting these two phenotypes. Furthermore, we have
observed an SSDI1-Vgenetic interaction that is not recapitulated in uthlA cells. Namely,
deletion of components of the Cbklp kinase complex, required for cell morphogenesis
and the transcription of daughter-specific genes, is lethal in combination with SSD1-V but
not with uthlA (G.L. and L.G., unpublished observations).
Ssdlp now becomes the second translational repressor implicated in the
coordinated maintenance of yeast longevity, cell integrity, and stress resistance. The first
such protein, Mpt5p, has many well-studied homologs in metazoans including Drosophila
PUMILIO and C. elegans FBF, both of which are specific repressors of translation.
Several studies now indicate a conserved role for these homologs in the maintenance of
germ line stem cells in Drosophila (Forbes and Lehmann, 1998; Lin and Spradling, 1997)
and C. elegans (Crittenden et al., 2002). Thus, both PUMILIO and FBF promote
continued cell divisions and delay the onset of an alternate state of differentiation and
developmental potency.
Intriguingly, Mpt5p and Ssdlp also conform to this common
theme, using specific targeted translational repression to prolong cell divisions and
maintain potential to produce young cells. The metazoan homologs of Ssdlp still await
characterization and may provide likely candidates for regulators of development and cell
fate analogous to those of the PUF family.
84
References:
Albig, A. R., and Decker, C. J. (2001). The target of rapamycin signaling pathway regulates
mRNA turnover in the yeast Saccharomyces cerevisiae. Mol Biol Cell 12, 3428-3438.
Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., and Sinclair, D. A. (2003).
Nicotinamide and PNC 1 govern lifespan extension by calorie restriction in Saccharomyces
cerevisiae. Nature 423, 181-185.
Ausubel, F. M. (1999). Short protocols in molecular biology: a compendium of methods from
Current protocols in molecular biology, 4th edn (New York: Wiley).
Bandara, P. D., Flattery-O'Brien, J. A., Grant, C. M., and Dawes, I. W. (1998). Involvement of
the Saccharomyces cerevisiae UTH1 gene in the oxidative-stress response. Curr Genet 34, 259268.
Beyer, A., Hollunder, J., Nasheuer, H. P., and Wilhelm, T. (2004). Post-transcriptional expression
regulation in the yeast Saccharomyces cerevisiae on a genomic scale. Mol Cell Proteomics 3,
1083-1092.
Bitterman, K. J., Medvedik, O., and Sinclair, D. A. (2003). Longevity regulation in
Saccharomyces cerevisiae: linking metabolism, genome stability, and heterochromatin. Microbiol
Mol Biol Rev 67, 376-399, table of contents.
Camougrand, N., Grelaud-Coq, A., Marza, E., Priault, M., Bessoule, J. J., and Manon, S. (2003).
The product of the UTH1 gene, required for Bax-induced cell death in yeast, is involved in the
response to rapamycin. Mol Microbiol 47, 495-506.
Camougrand, N., Kissova, I., Velours, G., and Manon, S. (2004). Uthlp: a yeast mitochondrial
protein at the crossroads of stress, degradation and cell death. FEMS Yeast Res 5, 133-140.
Camougrand, N. M., Mouassite, M., Velours, G. M., and Guerin, M. G. (2000). The "SUN"
family: UTH1, an ageing gene, is also involved in the regulation of mitochondria biogenesis in
Saccharomyces cerevisiae. Arch Biochem Biophys 375, 154-160.
Chang, M., French-Cornay, D., Fan, H. Y., Klein, H., Denis, C. L., and Jaehning, J. A. (1999). A
complex containing RNA polymerase II, Paflp, Cdc73p, Hprlp, and Ccr4p plays a role in protein
kinase C signaling. Mol Cell Biol 19, 1056-1067.
Chen, T., and Kurjan, J. (1997). Saccharomyces cerevisiae Mpt5p interacts with Sst2p and plays
roles in pheromone sensitivity and recovery from pheromone arrest. Mol Cell Biol 17, 34293439.
Crittenden, S. L., Bernstein, D. S., Bachorik, J. L., Thompson, B. E., Gallegos, M., Petcherski, A.
G., Moulder, G., Barstead, R., Wickens, M., and Kimble, J. (2002). A conserved RNA-binding
protein controls germline stem cells in Caenorhabditis elegans. Nature 417, 660-663.
85
Dreyfuss, G., Kim, V. N., and Kataoka, N. (2002). Messenger-RNA-binding
messages they carry. Nat Rev Mol Cell Biol 3, 195-205.
proteins and the
Fabrizio, P., Pletcher, S. D., Minois, N., Vaupel, J. W., and Longo, V. D. (2004). Chronological
aging-independent replicative life span regulation by Msn2/Msn4 and Sod2 in Saccharomyces
cerevisiae. FEBS Lett 557, 136-142.
Forbes, A., and Lehmann, R. (1998). Nanos and Pumilio have critical roles in the development
and function of Drosophila germline stem cells. Development 125, 679-690.
Gerber, A. P., Herschlag, D., and Brown, P. 0. (2004). Extensive association of functionally and
cytotopically related mRNAs with Puf family RNA-binding proteins in yeast. PLoS Biol 2, E79.
Ghaemmaghami, S., Huh, W. K., Bower, K., Howson, R. W., Belle, A., Dephoure, N., O'Shea, E.
K., and Weissman, J. S. (2003). Global analysis of protein expression in yeast. Nature 425, 737741.
Gietz, D., St Jean, A., Woods, R. A., and Schiestl, R. H. (1992). Improved method for high
efficiency transformation of intact yeast cells. Nucleic Acids Res 20, 1425.
Gotta, M., Strahl-Bolsinger, S., Renauld, H., Laroche, T., Kennedy, B. K., Grunstein, M., and
Gasser, S. M. (1997). Localization of Sir2p: the nucleolus as a compartment for silent information
regulators. Embo J 16, 3243-3255.
Guarente, L., and Picard, F. (2005). Calorie restriction--the SIR2 connection. Cell 120, 473-482.
Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A., Taylor, P.,
Bennett, K., Boutilier, K., et al. (2002). Systematic identification of protein complexes in
Saccharomyces cerevisiae by mass spectrometry. Nature 415, 180-183.
Igual, J. C., Johnson, A. L., and Johnston, L. H. (1996). Coordinated regulation of gene
expression by the cell cycle transcription factor Swi4 and the protein kinase C MAP kinase
pathway for yeast cell integrity. Embo J 15, 5001-5013.
Jan, E., Motzny, C. K., Graves, L. E., and Goodwin, E. B. (1999). The STAR protein, GLD-1, is
a translational regulator of sexual identity in Caenorhabditis elegans. Embo J 18, 258-269.
Johnstone, O., and Lasko, P. (2001). Translational regulation and RNA localization in Drosophila
oocytes and embryos. Annu Rev Genet 35, 365-406.
Kaeberlein, M., Andalis, A. A., Liszt, G. B., Fink, G. R., and Guarente, L. (2004a).
Saccharomyces cerevisiae SSD1-V confers longevity by a Sir2p-independent mechanism.
Genetics 166, 1661-1672.
86
Kaeberlein, M., and Guarente, L. (2002). Saccharomyces cerevisiae MPT5 and SSD1 function in
parallel pathways to promote cell wall integrity. Genetics 160, 83-95.
Kaeberlein, M., Kirkland, K. T., Fields, S., and Kennedy, B. K. (2004b). Sir2-independent life
span extension by calorie restriction in yeast. PLoS Biol 2, E296.
Kaeberlein, M., McVey, M., and Guarente, L. (1999). The SIR2/3/4 complex and SIR2 alone
promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev 13,
2570-2580.
Kennedy, B. K., Austriaco, N. R., Jr., Zhang, J., and Guarente, L. (1995). Mutation in the
silencing gene SIR4 can delay aging in S. cerevisiae. Cell 80, 485-496.
Kennedy, B. K., Gotta, M., Sinclair, D. A., Mills, K., McNabb, D. S., Murthy, M., Pak, S. M.,
Laroche, T., Gasser, S. M., and Guarente, L. (1997). Redistribution of silencing proteins from
telomeres to the nucleolus is associated with extension of life span in S. cerevisiae. Cell 89, 381391.
Kenyon, C. (2005). The plasticity of aging: insights from long-lived mutants. Cell 120, 449-460.
Kissova, I., Deffieu, M., Manon, S., and Camougrand, N. (2004). Uthlp is involved in the
autophagic degradation of mitochondria. J Biol Chem 279, 39068-39074.
Kuersten, S., and Goodwin, E. B. (2003). The power of the 3' UTR: translational control and
development. Nat Rev Genet 4, 626-637.
Kushnirov, V. V. (2000). Rapid and reliable protein extraction from yeast. Yeast 16, 857-860.
Lee, M. H., and Schedl, T. (2001). Identification of in vivo mRNA targets of GLD-1, a maxi-KH
motif containing protein required for C. elegans germ cell development. Genes Dev 15, 24082420.
Lee, M. H., and Schedl, T. (2004). Translation repression by GLD- 1 protects its mRNA targets
from nonsense-mediated mRNA decay in C. elegans. Genes Dev 18, 1047-1059.
Lin, H., and Spradling, A. C. (1997). A novel group of pumilio mutations affects the asymmetric
division of germline stem cells in the Drosophila ovary. Development 124, 2463-2476.
Lin, S. J., Defossez, P. A., and Guarente, L. (2000). Requirement of NAD and SIR2 for life-span
extension by calorie restriction in Saccharomyces cerevisiae. Science 289, 2126-2128.
Lin, S. J., Ford, E., Haigis, M., Liszt, G., and Guarente, L. (2004). Calorie restriction extends
yeast life span by lowering the level of NADH. Genes Dev 18, 12-16.
87
Lin, S. J., Kaeberlein, M., Andalis, A. A., Sturtz, L. A., Defossez, P. A., Culotta, V. C., Fink, G.
R., and Guarente, L. (2002). Calorie restriction extends Saccharomyces cerevisiae lifespan by
increasing respiration. Nature 418, 344-348.
Longtine, M. S., McKenzie, A., 3rd, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A.,
Philippsen, P., and Pringle, J. R. (1998). Additional modules for versatile and economical PCRbased gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953-961.
Madeo, F., Herker, E., Maldener, C., Wissing, S., Lachelt, S., Herlan, M., Fehr, M., Lauber, K.,
Sigrist, S. J., Wesselborg, S., and Frohlich, K. U. (2002). A caspase-related protease regulates
apoptosis in yeast. Mol Cell 9, 911-917.
Maniatis, T., and Reed, R. (2002). An extensive network of coupling among gene expression
machines. Nature 416, 499-506.
Marin, V. A., and Evans, T. C. (2003). Translational repression of a C. elegans Notch mRNA by
the STAR/KH domain protein GLD-1. Development 130, 2623-2632.
Mazumder, B., Seshadri, V., and Fox, P. L. (2003). Translational control by the 3'-UTR: the ends
specify the means. Trends Biochem Sci 28, 91-98.
Mills, K. D., Sinclair, D. A., and Guarente, L. (1999). MEC 1-dependent redistribution of the Sir3
silencing protein from telomeres to DNA double-strand breaks. Cell 97, 609-620.
Mootz, D., Ho, D. M., and Hunter, C. P. (2004). The STAR/Maxi-KH domain protein GLD-1
mediates a developmental switch in the translational control of C. elegans PAL-1. Development
131, 3263-3272.
Mouassite, M., Camougrand, N., Schwob, E., Demaison, G., Laclau, M., and Guerin, M. (2000a).
The 'SUN' family: yeast SUN4/SCW3 is involved in cell septation. Yeast 16, 905-919.
Mouassite, M., Guerin, M. G., and Camougrand, N. M. (2000b). The SUN family of
Saccharomyces cerevisiae: the double knock-out of UTH1 and SIM1 promotes defects in nucleus
migration and increased drug sensitivity. FEMS Microbiol Lett 182, 137-141.
Parisi, M., and Lin, H. (2000). Translational repression: a duet of Nanos and Pumilio. CuffrrBiol
10, R81-83.
Park, P. U., Defossez, P. A., and Guarente, L. (1999). Effects of mutations in DNA repair genes
on formation of ribosomal DNA circles and life span in Saccharomyces cerevisiae. Mol Cell Biol
19, 3848-3856.
Racki, W. J., Becam, A. M., Nasr, F., and Herbert, C. J. (2000). Cbklp, a protein similar to the
human myotonic dystrophy kinase, is essential for normal morphogenesis in Saccharomyces
cerevisiae. Embo J 19, 4524-4532.
88
Reinke, A., Anderson, S., McCaffery, J. M., Yates, J., 3rd, Aronova, S., Chu, S., Fairclough, S.,
Iverson, C., Wedaman, K. P., and Powers, T. (2004). TOR complex 1 includes a novel
component, Tco89p (YPL180w), and cooperates with Ssdlp to maintain cellular integrity in
Saccharomyces cerevisiae. J Biol Chem 279, 14752-14762.
Rogina, B., and Helfand, S. L. (2004). Sir2 mediates longevity in the fly through a pathway
related to calorie restriction. Proc Natl Acad Sci U S A 101, 15998-16003.
Schumacher, B., Hanazawa, M., Lee, M. H., Nayak, S., Volkmann, K., Hofmann, E. R.,
Hengartner, M., Schedl, T., and Gartner, A. (2005). Translational repression of C. elegans p53 by
GLD-1 regulates DNA damage-induced apoptosis. Cell 120, 357-368.
Sinclair, D., Mills, K., and Guarente, L. (1998). Aging in Saccharomyces cerevisiae. Annu Rev
Microbiol 52, 533-560.
Sinclair, D. A., and Guarente, L. (1997). Extrachromosomal rDNA circles--a cause of aging in
yeast. Cell 91, 1033-1042.
Sutton, A., Immanuel, D., and Arndt, K. T. (1991). The SIT4 protein phosphatase functions in
late G1 for progression into S phase. Mol Cell Biol 11, 2133-2148.
Thore, S., Mauxion, F., Seraphin, B., and Suck, D. (2003). X-ray structure and activity of the
yeast Pop2 protein: a nuclease subunit of the mRNA deadenylase complex. EMBO Rep 4, 11501155.
Tissenbaum, H. A., and Guarente, L. (2001). Increased dosage of a sir-2 gene extends lifespan in
Caenorhabditis elegans. Nature 410, 227-230.
Tucker, M., Staples, R. R., Valencia-Sanchez, M. A., Muhlrad, D., and Parker, R. (2002). Ccr4p
is the catalytic subunit of a Ccr4p/Pop2p/Notp mRNA deadenylase complex in Saccharomyces
cerevisiae. Embo J 21, 1427-1436.
Uesono, Y., Toh-e, A., and Kikuchi, Y. (1997). Ssdlp of Saccharomyces cerevisiae associates
with RNA. J Biol Chem 272, 16103-16109.
Van Zandycke, S. M., Sohier, P. J., and Smart, K. A. (2002). The impact of catalase expression
on the replicative lifespan of Saccharomyces cerevisiae. Mech Ageing Dev 123, 365-373.
Varshavsky, A. (1996). The N-end rule: functions, mysteries, uses. Proc Natl Acad Sci U S A 93,
12142-12149.
Velours, G., Boucheron, C., Manon, S., and Camougrand, N. (2002). Dual cell wall/mitochondria
localization of the 'SUN' family proteins. FEMS Microbiol Lett 207,165-172.
89
Wheeler, R. T., Kupiec, M., Magnelli, P., Abeijon, C., and Fink, G. R. (2003). A Saccharomyces
cerevisiae mutant with increased virulence. Proc Natl Acad Sci U S A 100, 2766-2770.
Wood, J. G., Rogina, B., Lavu, S., Howitz, K., Helfand, S. L., Tatar, M., and Sinclair, D. (2004).
Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature 430, 686-689.
Xu, L., Paulsen, J., Yoo, Y., Goodwin, E. B., and Strome, S. (2001). Caenorhabditis elegans
MES-3 is a target of GLD-1 and functions epigenetically in germline development. Genetics 159,
1007-1017.
Zamore, P. D., Williamson, J. R., and Lehmann, R. (1997). The Pumilio protein binds RNA
through a conserved domain that defines a new class of RNA-binding proteins. Rna 3, 14211433.
Zhang, B., Gallegos, M., Puoti, A., Durkin, E., Fields, S., Kimble, J., and Wickens, M. P. (1997).
A conserved RNA-binding protein that regulates sexual fates in the C. elegans hermaphrodite
germ line. Nature 390, 477-484.
90
TABLES AND FIGURES
Table 1. Yeast strains used in this study.
Strain
Relevant Genotype
W303R
MKY1324
MKY641
MKY643
MKD133
PSY316AR
MATa ADE2::RDNI ade2 his3 leu2 trpl ura3 ssdl-d2 RAD5
W303R mpt5::LEU2
W303R mpt5::LEU2 uthl::URA3
W303R mpt5::LEU2 uthl::TRPI
W303R/W303R MATa/a ccr4::HIS3/CCR4 mpt5::LEU2/MPT5
uthl ::TRP/UTH1
W303R/W303R MATa/a swi4::HIS3/SWI4 mpt5::LEU2/MPT5
uthl ::TRP/UTH1
W303R/W303R MATa/a swi6::HIS3/SWI6mpt5::LEU2/MPT5
uthl ::TRP/UTH1
MATa ADE2::RDN1 ade2-101 his3-A200 leu2-3,112 lys2-801, ura3-52, ssdl-d
GLY3002
GLY3003
PSY316AR SSD1-V/LEU2
PSY316AR SSD1-V/URA3
MKD 134
MKD194.
GLY3004
PSY316AR uthl ::HIS3
MKY2132
PSY316AR uthl::URA3
MKD212
MKD202
MKD213
PSY316AR/PSY316AR MATa/a sit4::HIS3/SIT4 uthl ::URA3/UTH1
PSY316AR/PSY316ARMATa/a sit4::HIS3/SIT4 SSD1-V/URA3
PSY316AR/PSY316ARMATa/a sit4::HIS3/SIT4 uthl::URA3/UTH1 SSD1-
GLY3101
GLY3102
GLY30 17
V/LEU2
PSY316AR p416SSD1
PSY316AR p416SSD1-TAP
TERINATOR-kanMX6
PSY3 16AR SSD1- V/LEU2 UTH1 TERMINATOR::ADH1
GLY3018
PSY316AR SSD1-V/LEU2 UTHlPROMOTER::ADHl
pRooTER*
91
TABLE2. Spore clone viability. Tetrads were dissected onto YPD and
incubated at 30°. Spore clones that failed to form visible colonies after 4 days
were examined microscopically to verify inviability. Numbers in parentheses
give the total number of representative spores analyzed.
-
Spore Genotype
mpt5 ccr4 ssdl-d UTH1
mpt5 ccr4 SSDI1-VUTHI
mpt5 ccr4 ssdl-d uthl
Spore Clone Percent Viability
-
083(23)
83 (6)
83 (6)
mpt5 swi4 ssdl-d UTH1
0 (74)
mpt5 swi4 SSD1-V UTH1
84 (79)
mpt5 swi4 ssdl-d uthl
30 (20)
mpt5 swi6 ssdl-d UTH1
0 (65)
mpt5 swi6 SSD1-V UTH1
100 (10)
mpt5 swi6 ssdl-d uthl
67 (18)
sit4 ssdl-d UTH1
0 (21)
sit4 SSD1-V UTH1
100 (15)
sit4 ssdl-d uthl
100 (14)
sit4 SSD1-V uthl
100 (7)
92
Figure 1. Effect of UTH1 on cell integrity and life span.
(A) 5 RLaliquots of 10-fold serial dilutions were plated onto the designated
media and cultured at 30°C or 37°C for 2 days, as indicated.
(B) Life spans were determined for PSY316(*), PSY316uthl (), PSY316mpt5
(A), and PSY316mpt5 uthl (X). Mean life spans and number of cells analyzed
were: PSY316 21.9 (n=40), PSY316 uthl 26.4 (n=40), PSY316 mpt5 8.9 (n=40), and
PSY316 mpt5 uthl 19.2 (40).
(C) Life spans were determined for PSY316 (*), PSY316 uthl (), PSY316 SSD1-
V (A), and PSY316uthl SSD1-V (X). Mean life spans and number of cells
analyzed were: PSY316 19.4 (n=40), PSY316 uthl 23.6 (n=40), PSY316 SSD1-V 34.0
(n=40), and PSY316 mpt5 SSD1-V 24.4 (40).
93
A
37°C
0.025 mglmL CFW
0.05 mglmL CFW
c
B
__ PSY376 (79.4)
__ PSY376 (27.9)
-+-PSY376 uth7 (26.4)
-.-PSY376 mptS (8.9)
-M-PSY376 mptS uth7 (79.2)
0.8
-+-PSY376uth7
0.8
-.-PSY376
(23.6)
SSD7-V (34.0)
-M-PSY316 uthl SSD1-V (24.4)
CI>
~ 0.6
0.6
:>
c:
o
"B
~ 0.4
0.4
0.2
0.2
o
o
o
10
30
20
40
so
o
20
40
Generation
Generation
FIGURE 1
94
60
80
Figure 2. SSD1-Vand UTH1 both regulate resistance to oxidative damage and
growth at high temperature. 10 pL aliquots of 10-fold serial dilutions were
plated onto the designated media and cultured at 30°C or 40°C for 2 days, as
indicated. H20 2 indicates YPD prepared with hydrogen peroxide. PQ indicates
YPD prepared with paraquat.
95
o
2mM
==
3mM
N
N
SmM
FIGURE 2
96
Figure 3. Mutation of UTH1 suppresses the lethality caused by deletion of
SIT4.
(A) Strain MKD213was sporulated and tetrads were dissected onto YPD.
Growth after 4 days at 30° is shown. Genotypes are shown for sit4 ssdl-d UTH1
(0), sit4 ssdl-d uthl (A), sit4 SSD1-V UTH (),
and sit4 SSD1-V uthl (<>)spore
clones.
(B) Spore clones were streaked onto YPD and cultured at 30°C. The pictures
show cell growth after 3 days.
97
A
B
FIGURE 3
98
Figure 4. Effects of SSD1-V on Uthlp and UTH1 mRNA levels. Cells of the
indicated genotypes were grown in YPD and harvested at early log phase
(OD600=0.6), mid-log phase (OD600=2.O),or late-log phase (OD600=4.5).
(A) Protein extracts were prepared and analyzed by SDS-PAGEfollowed by
Western blotting. Blots were probed with rabbit polyclonal anti-Uthlp, then
stripped and reprobed with mouse monoclonal antibody specific for beta-
tubulin.
(B) Total RNA was extracted from the indicated samples and subjected to
Northern blotting. Blots were probed with 3 2 P-labelledcDNA corresponding to
UTH1 (top panel) or ADH1 (bottom panel).
99
A.
Uthl p
Tub2p
,~
early
log
late
log
B.
UTHl
i
x
>
~
'
?~~''''c<
:'"
:,
~
"-
'i1
early-log
~>- •.
¥
ADHl
1'
late-log
FIGURE 4
100
Figure 5. SSD1 does not affect Uthlp decay kinetics.
Early-log phase cells harboring the either the ssdl-d or SSD1-V allele were treated
with 100 Rg/mL cycloheximide to inhibit protein synthesis. Samples were
harvested at the given time points, and extracts were prepared by boiling cells in
modified SDS sample buffer (Kushnirov, 2000).
(A) Rate of Uthlp decay was assessed by Western blotting using rabbit antisera
specific to Uthlp. Decay of Tub2p, included here as a control, was undetectable
over this time period.
(B) Over 120 minute time course, a fraction of Uthlp resists degradation in both
SSD1-V and ssdl-d cells.
101
Duration
cycloheximide
treatment:
Uthlp
ssdl-d
SSD1-V
].It;II.'.'m.'.'
'. '1..'1
..'1'.:.1J.,......•...............
:~.\
'.I.' ''.'.~.'..'.. .\.'
."""""""""""","
/.",l
i.e,.
x.•.•.•..•..•
Duration
cycloheximide
treatment:
Uthlp
SSD1-V
ssdl-d
FIGURE 5
102
Figure 6. Ssdlp specifically associates with UTH1 mRNA in vivo.
Yeast cells expressing either Ssdlp-TAP or Ssdlp (mock IP) were grown to
OD600=0.6 and harvested. Cell extracts were prepared by glass bead lysis and
immunoprecipitated using rabbit IgG agarose beads. RNA purified from the
supernatant and pellet fractions was subjected to RT-PCR using primers specific
to UTH1, ACT1, CBK1, and NCA3. RT-PCR reactions were performed on two
different starting volumes of RNA input to confirm that amplification occurred
within a linear range.
103
UTHl
input
1
5
IP
1
IJL input
5
Mock IP
UTHl
ACTl
1
input
IP
input
5
1
1
5
IP
1
5
5
JlL input
.5
IJL input
SSD1-TAP
IP
CBKl
NCA3
1
input
IP
input
5
1
1
5
SSD1-TAP
IP
FIGURE 6
104
IP
5
1
Figure 7. Repression of Uthlp by Ssdlp is necessary for growth at high
temperature and requires the UTH1 5' UTR. (A) Two mutations were constructed:
the tUTHI::tADHI replacement substituted the downstream terminator sequence and 3'UTR of ADHI for that of UTH. The pUTHI :.pADHI * substitution replaced the
promoter and 5'UTR of UTHI with a truncated, weakened promoter from ADHI. (A)
These mutants were assayed for growth at 41°C and (B) the effects of each mutation on
Uthlp expression was compared in ssdl-d and SSDI-V cells.
105
B.
A.
YPD 30' C
ssdl-d
uthl
tUTHl ::tADH1SSD1-V
pUTHl ::pADHl *SSD1-V
FIGURE 7
106
Chapter3
Mouse Sir2 Homolog SIRT6 is a Nuclear
ADP-Ribosyltransferase
This chapter was published in the Journal of Biological Chemistry, Volume 280, Issue
22, pages 21313-20. The authors were Gregory Liszt, Ethan Ford, Martin Kurtev, and
Leonard Guarente. I contributed all figures except Figure 2a and Figure 4a. I also wrote
the manuscript.
107
SUMMARY
Members of the Sir2 family of NAD-dependent protein deacetylases regulate
diverse cellular processes including aging, gene silencing, and cellular differentiation.
Here, we report that the distant mammalian Sir2 homolog SIRT6 is a broadly expressed,
predominantly nuclear protein. Northern analysis of embryonic samples and multiple
adult tissues reveals mSIRT6 mRNA peaks at day El 1I,persisting into adulthood in all
eight tissues examined. At the protein level, mSIRT6 is readily detectable in the same
eight tissue types, with the highest levels in muscle, brain and heart.
Subcellular
localization studies using both C- and N-terminal GFP fusion proteins show mSIRT6GFP to be a predominantly nuclear protein.
Indirect immunofluorescence using
antibodies to two different mSIRT6 epitopes confirms that endogenous mSIRT6 is also
largely nuclear. Consistent with previous findings, we do not observe any NAD+
dependent protein deacetylase activity in preparations of mSIRT6. However, purified
recombinant mSIRT6 does catalyze the robust transfer of radiolabel from
32 P-NAD to
mSIRT6. Two highly conserved residues within the catalytic core of the protein are
required for this reaction. This reaction is most likely mono-ADP ribosylation, as only
the modified form of the protein is recognized by an antibody specific mono-ADP-ribose.
Surprisingly, we observe that the catalytic mechanism of this reaction is intra-molecular,
with individual molecules of mSIRT6 directing their own modification. These results
provide the first characterization of a Sir2 protein from phylogenetic class IV.
108
INTRODUCTION
Members of the Sir2 family of enzymes, conserved from bacteria to man,
utilize oxidized nicotinamide adenine dinucleotide (NAD+) as a cosubstrate in the
deacetylation of a wide variety of proteins, thereby regulating diverse processes including
aging, genomic silencing, recombination, cell fate, and metabolism (Blander and
Guarente, 2004). In yeast, the archetypal Sir2p localizes to chromatin sites at the
telomeres, rDNA, and silent mating type loci, facilitating genomic silencing through the
deacetylation of lysines within the histone H3 and H4 tails (Gasser and Cockell, 2001).
In this context, yeast Sir2p promotes mother cell longevity by repressing rDNA
recombination and formation of toxic extra-chromosomal rDNA circles (Bitterman et al.,
2003; Hekimi and Guarente, 2003). Overexpression of Sir2p extends yeast lifespan
(Kaeberlein et al., 1999), and Sir2p activity increases in response to caloric restriction
(Lin et al., 2004), contributing to the resultant extension of life span (Lin et al., 2000).
Intriguingly, Sir2 orthologues in worm and fly also promote longevity, though probably
by different molecular mechanisms (Rogina and Helfand, 2004; Tissenbaum and
Guarente, 2001; Wood et al., 2004).
Mammalian genomes contain seven Sir2 homologs, termed sirtuins (SIRTs).
Of these, SIRT1, orthologous to the yeast Sir2, is the best characterized and has the
broadest substrate specificity (North and Verdin, 2004). A nuclear protein, SIRT1
deacetylates several substrates in vivo, including MyoD, p53, and FOXO transcription
factors, thereby affecting cell differentiation and survival under stress (Brunet et al.,
2004; Motta et al., 2004; North and Verdin, 2004). Recently, mouse SIRT1 was reported
to promote the mobilization of fatty acids in white adipose tissue by repressing PPARy,
109
linking Sir2 proteins to the physiology of caloric restriction in mammals (Picard et al.,
2004).
Of the remaining SIRTs (SIRT2-7), an in vivo substrate has only been
identified for the cytoplasmic SIRT2 (North et al., 2003). This substrate, -tubulin, is
specifically deacetylated by SIRT2 (North et al., 2003), although the biological
consequences of this reaction are unclear.
Yeast Sir2 and its orthologues, including mouse SIRT1 and bacterial CobB,
catalyze the tightly-coupled cleavage of NAD+ and protein deacetylation, producing
nicotinamide and 2-O-acetyl-ADP-ribose reaction products (Sauve and Schramm, 2004).
While Sir2 proteins are generally thought to be NAD-dependent protein deacetylases,
most also display a less robust mono-ADP-ribosyltransferase activity in vitro (Frye,
1999; Tanner et al., 2000; Tanny et al., 1999; Tanny and Moazed, 2001). Mutations in
phylogenetically conserved residues within the catalytic core of Sir2 and SIRT1 have
failed to separate the two enzymatic activities (Armstrong et al., 2002). The initial
observation that ADP-ribosylation by Sir2 is stronger on acetylated substrates (Imai et al.,
2000), combined with subsequent mechanistic studies (Tanner et al., 2000; Tanny and
Moazed, 2001), has led to the conclusion
that the deacetylase
and
phosphoribosyltransferase activites of Sir2 proteins are coupled (Sauve and Schramm,
2004).
Using sequence similarity, eukaryotic Sir2 genes have been divided into four
broad phylogenetic classes (Frye, 2000), known as classes I-IV (Figure 1). SIRT1,
SIRT2, and SIRT3 are class I, SIRT4 is class II, and SIRT5 falls within the
predominantly prokaryotic class III. Finally, mammalian SIRT6 and SIRT7, are class IV
110
sirtuins (Frye, 2000). In vitro studies indicate that human SIRT1, 2, 3, and 5 possess
NAD-dependent histone deacetylase activity (North et al., 2003), whereas SIRT4, 6, and
7 fail to deacetylate
3 H-labeled
acetylated histone H4 peptide (North et al., 2003). The
lack of detectable deacetylase activity in these SIRTs may result from their specificity for
targets other than those tested, or it may indicate an enzymatic activity other than
deacetylation inherent in these sirtuins.
Mono-ADP-ribosylation is emerging as a common mechanism of reversible
protein modification within mammalian cells.
Originally described as the acting
mechanism for specific bacterial toxins, ADP-ribosylation is typically performed by
separate families of intra- and extracellular enzymes in vertebrates (Corda and Di
Girolamo, 2003). Known targets of the intracellular class of enzymes include molecular
chaperone GRP78/BiP, translational elongation factor 2, and -subunit of heterotrimeric
G-proteins
(Corda and Di Girolamo, 2003).
Extracellular
mammalian ADP-
ribosyltransferases, generally found in cells of the immune system, modify substrates
important for the immune response, as well as integrin ca7 and the antimicrobial peptide
defensin (Corda and Di Girolamo, 2003). In most known cases, ADP-ribosylation of
arginine residues results in reversible inactivation of the substrate protein (Riese et al.,
2002), although this modification may enhance certain enzymatic functions within the
substrate (Weng et al., 1999).
In this report, we characterize the tissue-specific expression, subcellular
localization, and in vitro enzymatic activity of mouse SIRT6. This investigation, the first
detailed study of a Class IV sirtuin, reveals mouse SIRT6 to be a widely expressed,
predominantly nuclear protein with a robust auto-ADP-ribosyltransferase activity.
111
MATERIALS AND METHODS
Multiple sequence alignments Sequences of mouse proteins SIRT1, SIRT4, SIRT5, and SIRT6, as well as yeast Sir2p
were
obtained
from
the
Proteome
(https://proteome.incyte.com/control/tools/proteome).
BioKnowledge®
Library
Core domains were aligned by
ClustalW using software from the DNASTAR package.
PlasmidconstructionIMAGE clone 1259892, which contains the mouse SIRT6 cDNA, was obtained from
ATCC. The mSIRT6 coding sequence was amplified by PCR and cloned into the EcoRI
and BamHI sites of pEGFP-N1 and the BglII and EcoRI sites of pEGFP-C2, creating
pmSIRT6-EGFP and pEGFP-mSIRT6. respectively.
Similarly, the mSIRT6 coding
sequence was amplified by PCR and cloned into the NheI and BamHI sites of pET28a
(Novagen) and pET-GST (gift from Robert Marciniak,) creating pET28a-6xHis-SIRT6
and pET-GST-SIRT6. pET28a-6xHis-mSIRT6-S56A and pET28a-6his-SIRT6-H133Y
were created using the Strataene QuikChange site directed mutagenesis kit according to
the manufacturer's instructions. PET-GST-SIRT6 (274-355) was created by amplifying
the portion of the mSIRT6 cDNA corresponding to amino acids 274-355 and ligating into
pET-GST cut with NheI and BamHI.
Multiple tissue Northern blots Probe containing the SIRT6 open reading frame was created using the PrimeIt Random
Primer Labeling kit (Stratagene) according to the manufacturer's instructions. This
32
p_
labeled fragment was used to probe Stratagene Multiple Tissue Northern Blots
112
(Stratagene) according to the manufacturer's instructions. The blots were then stripped
and reprobed with the actin probe included in the kit.
AntibodyproductionpET28a-6xHis-mSIRT6
and pET-GST-mSIRT6 (274-355) were transformed into
BL21(DE3)-Codon Plus-RP cells (Stratagene),and inoculated into 4 or 2 liter cultures of
LB (50 mg/ml kanamycin, 35 mg/ml chloramphenicol), respectively. The cells were
grown at 37 ° C to an optical density of 0.7. Protein expression was induced by the
addition of IPTG to a final concentration of 0.4 mM for 2 h, and the cells were harvested
by centrifugation.
The cells containing the pET28a-6xHis-mSIRT6 plasmid were resuspended in
lysis buffer (0.1 M NaH2 PO4, 10mM Tris, 8 M urea, pH 8.0) and lysed by freezing in
liquid N2 . The lysate was centrifuged at 19,000 rpm in a Sorvall SS-34 rotor. The
supernatant was incubated with 4 ml of Ni-NTA agarose (Stratagene) for 3 h at 4 ° C,
loaded onto a column, and washed extensively with wash buffer (0.1 M NaH2PO4, 10
mM Tris, 8 M urea, pH 6.4). The purified protein was eluted with elution buffer (0.1 M
NaH 2PO4 , 10 mM Tris, 8M urea, pH 3.0) in 1.5 ml fractions. The pH was neutralized by
the immediate addition of 100 ml 1 M Tris base. The fractions containing protein were
pooled and dialyzed against PBS. This protein was sent to Covance Reseach Bioproducts
for antibody production.
The cells containing the pET-GST-SIRT6 (274-355) plasmid were resuspended in
PBSTG (PBS, 0.1% Tween-20, 10% glycerol, 1 mM DTT) and 0.1 g lysozyme,
incubated at 37° C for 20 min, and frozen in liquid N2 . The lysis was completed by
sonication and the lysate was centrifuged at 19,000 rpm for 30 min. The supernatant was
113
incubated with 4 ml GST-agarose (Sigma) for 3 h at 4° C and loaded onto a column. The
column was washed extensively with PBSTG and the protein was eluted with elution
buffer (50 mM Tris, 10 mM glutathione, pH 7.5). Fractions containing protein were
dialyzed against PBS and sent to Covance Reseach Bioproducts for antibody production.
The antibodies were affinity purified as follows. Aliquots of the proteins used to
generate the antibodies were attached tol ml NHS-activated sepharose columns
(Amersham) according to the manufacturer's instructions. 10 ml of the final bleed of
each antibody was combined with 10 ml antibody wash buffer (20 mM Hepes, pH 7.5,
150 mM NaCl, 0.1% Tween-20) and applied to the column. Each column was washed
extensively with antibody wash buffer and the antibody was eluted with 100 mM glycine
pH 2.5. The pH was neutralized by the addition of 1/10 volume of 1 M Hepes-KOH, pH
7.5. The antibodies were then subjected to a second round of affinity purification, but
this time the anti-mSIRT6 (full length) antibody was applied to the SIRT6 (274-355)
column and the anti-mSIRT6(274-355) antibody was applied to the SIRT6(full length)
column.
Western blot analysis Homogenized mouse tissues from four mice of the FVB genetic background were
obtained as a generous gift from L. Bordone, MIT. From these samples, SDS-solubilized
proteins were prepared (Kain et al., 1994), equal amounts of which were used for
Western analysis.
For Western detection, samples were resolved on 4-15% Tris-HCl gradient gels
(Bio-Rad), transferred to PVDF membrane, and blocked using 4% nonfat dry milk in
PBS with 0.1% Tween-20 (PBS-T). Primary anti-mSIRT6 antibody was diluted 1:400 in
114
PBS-T before incubation with membranes. Rabbit anti-ADP-ribose antibody (Kain et al.,
1994), a generous gift from H. Hilz, was used at a 1:100 dilution in PBS-T. Anti-actin
C4 (Sigma) was used as a loading control (1:5,000) in multiple tissue Western blots.
Secondary antibodies were goat anti-rabbit or sheep anti-mouse horseradish peroxidaseconjugated antibodies (1:10,000). Chemiluminescent detection was achieved by
incubation with the ECL reagent (Amersham Biosciences).
Immunofluorescenceand GFP microscopy
NIH 3T3 cells were grown in Dulbecco's Modified Eagle's Medium for 48 hours on
gelatin-treated 18mm circular glass coverslips in 6-well plates. Cells were fixed for 10
minutes with 4% paraformaldehyde and washed twice with PBS, then permeablized by 3
minute treatment with 0.2% Triton X-100. Coverslips were gently washed twice with
PBS and blocked with 10% BSA for 15 minutes, transferred to a rack, and washed in
PBS. Affinity purified primary antibody was added at a 1:100 dilution. Staining
proceeded for 45 minutes, and cells were then washed twice for 5 minutes in fresh PBS.
FITC-conjugated chicken anti-rabbit IgG was diluted in 1% BSA and incubated with
coverslips for 45 minutes. Coverslips were mounted with VectaShield mounting media
containing 4',6-diamidino-2-phenyindole, dilactate (Vector, Burlingame, CA).
Microscopy was performed on a Nikon Eclipse E500 fluorescence microscope. Digital
images were obtained using a SPOT RT CCD camera and software using identical
exposure times for comparable samples.
NIH 3T3 cells were transfected with 5 g of each GFP construct using FuGene 6
(Roche) according to manufacturer's instructions. Cells were grown for 48 hours on
glass coverslips. Samples were fixed, DAPI-stained, and visualized as described above.
115
Purificationof recombinantSIRT6protein
BL21(DE3)-Codon Plus-RP E. coli (Stratagene) were transformed with the mSIRT6
expression plasmids. Protein purifications were performed essentially as described for
antibody purification. Briefly, fusion protein expression was induced in 0.4 mM IPTG at
37° C for 1 h. The induced 6 x His-tagged proteins were purified with Ni-NTA agarose
beads (Qiagen) under native conditions. The control eluate was prepared from a bacterial
clone carrying pET28a vector alone. GST-tagged proteins were purified by a similar
method, with affinity purification accomplished with glutathione agarose beads (Pierce).
Control eluate for GST-tagged proteins was prepared from bacteria carrying pET28-GST.
Aliquots of recombinant proteins were stored at -70 ° C.
ADP-ribosylationassaysand detectionof ADP-ribosylatedproteins ADP ribosylation assays were performed essentially as described (Imai et al., 2000), with
minor modifications. Reactions were performed in 50 [tL total volume containing 5 g
recombinant SIRT6 in 50 mM Tris-HCl, pH 8.0 (at 22°C), 150 mM NaCl, 10 mM DTT,
1 uM unlabeled NAD, and 8 Ci of NAD 5'-[- 32 P]triphosphate (800 Ci mmol-1,
Amersham Pharmacia). Reactions also contained 2.5 pg core histones as indicated. For
reactions containing both His-tagged and GST-tagged recombinant SIRT6 protein, 2.5 ug
of each protein were added. Prior to SDS-PAGE analysis, all reactions were purified
from unincorporated 32 P-NADusing Micro Bio-Spin chromatography columns (Bio-Rad)
with a 6,000 Da exclusion limit. Gels were transferred to PVDF membrane before
autoradiography and subsequent immunoblot analysis. Blots were stained with
Coomassie, and the Coomassie-stained bands and Western signals were aligned to verify
that the radioactive bands were SIRT6.
116
Quantitation of ADP-ribosylationADP-ribosylation
modifications.
reactions were performed as above, but with the following
Total reaction volume was 40 FL, including approximately 0.5
protein, 0.8 L of 6.25 gM
32 P-NAD,and 4
g
gL 10 gM NAD. Purified reaction products
were separated by SDS-PAGE, and BSA standards of 5 jtg, 2
g, 0.8
g, 0.4
g, and 0.1
jg were included on the same gel. SIRT6 protein concentrations in each lane were
determined by comparison to these standards upon Coomassie staining.
Gel was
analyzed by autoradiography, and radioactive SIRT6 bands were excised. Radioactivity
was determined by scintillation counting on a Beckman LS 6500 Liquid Scintillation
Counter. A standard curve relating NAD quantity to radioactivity was generated by
scintillation counting of known pmol quantities of 32 P-NADdiluted to reflect the ratio of
unlabeled to labeled NAD in the original reaction. This curve was used to estimate pmol
NAD incorporated in SIRT6 bands. For each band, pmol of NAD was divided by pmol
of SIRT6. This final value reflects the molar ratio of total incorporated ADP-ribose to
SIRT6.
RESULTS
mSIRT6 expression in mice and embryos
To determine the expression pattern of mSIRT6, we analyzed RNA extracts from
eight adult mouse tissues by Northern blotting (Fig. 2a). Using a cDNA probe
corresponding to the 5' region of mSIRT6, expression of mSIRT6 mRNA was observed
in every tissue type tested (Fig. 2a). Confirming the predictions of sequence analysis
117
(Frye, 2000), mSIRT6 was detected as a single 1.0 Kb transcript, suggesting that this
gene is not found in alternate splice forms. When normalized to actin, the highest levels
of mSIRT6 mRNA were seen in the brain, heart, and liver, with the lowest expression
level observed in skeletal muscle.
To evaluate mSIRT6 levels during development, we probed Northern blots of
RNA from four mouse embryonic stages from E7 to E17 (Fig. 2b). Mouse SIRT6
transcript was readily detectable in all embryonic samples, reaching a peak at E 1.
Having established the prevalence of mSIRT6 message in embryonic and adult
tissues, we wished to determine the distribution of mSIRT6 protein. Affinity-purified
antiserum specific to mSIRT6 was used to probe Western blots of proteins isolated from
eight adult murine tissue types (Fig. 2c). For each tissue type, samples from four
individual animals were obtained and analyzed by immunoblot. As illustrated in Figure
2c, mSIRT6 protein was detectable in all tissue types as a single 40 KDa band. As
expected from Northern analysis, levels were high in brain, liver, and heart when
normalized to actin protein levels. Surprisingly, mSIRT6 protein was most strongly
expressed in muscle (Fig. 2c), despite the relative paucity of its transcript in this tissue.
This observation might indicate increased mSIRT6 transcript stability in muscle, or an
enhanced rate of translation in this tissue type relative to others tested.
Visualization of mSIRT6-GFP in nuclei
In order to observe the subcellular localization of mSIRT6, we engineered two
GFP-fusion expression vectors under the control of the CMV promoter. Both a Cterminal (mSIRT6-GFP) and an N-terminal (GFP-mSIRT6) fusion construct were
transfected into NIH 3T3 cells grown on glass coverslips. Samples were cultured for 48
118
hours, at which point they were fixed, washed and DAPI-stained to reveal nucleic acids.
Fluorescence microscopy of cells harboring each GFP-fusion construct showed strong
localization of mSIRT6-GFP to the nucleus, accompanied by diffuse cytoplasmic
staining, as judged by colocalization of DAPI-stained nuclei (Fig. 3a). As expected,
transfection of GFP alone caused intense fluorescence throughout the cytoplasm and
nucleus.
Indirect immunofluorescence of mSIRT6
To visualize endogenous levels of mSIRT6, affinity-purified rabbit antisera to two
different mSIRT6 antigens
were used to probe NIH 3T3 cells by indirect
immunofluorescence. As a control, cells were incubated without primary antibody and
subsequently stained with DAPI and Cy-3 conjugated anti-rabbit IgG. Very faint
background staining was seen throughout the cytoplasm and nucleus in these control
samples (Fig. 3b). Strikingly, mSIRT6 showed strong staining predominantly in the
nucleus (Fig. 3b), regardless of which anti-mSIRT6 antibody was used in the primary
incubation.
In both cases, endogenous mSIRT6 appeared to be excluded from the
nucleolus.
Importantly, immunofluorescence and GFP-localization studies revealed the same
predominantly nuclear localization pattern for mSIRT6. We therefore conclude that the
majority of mSIRT6 is found in the nucleus, while a small fraction may be localized to
the cytoplasm.
mSIRT6 catalyzes the transfer of
3 2
p
from a 32 P--NADdonor
Of the seven mammalian Sir2 homologs, only SIRT1, SIRT2, SIRT3, and SIRT5
have been shown to have NAD+-dependent protein deacetylase activity in vitro (North et
119
al., 2003). Consistent with published reports, we did not observe any protein deacetylase
activity of mouse or human SIRT6 using a variety of experimental conditions and
potential substrates (data not shown).
Several sirtuins also possess a mono-ADP-ribosyltransferase activity (Tanny et
al., 1999). We therefore sought to test whether mSIRT6 could catalyze the transfer of
radiolabel from
32
P--NAD*to histones, an assay of ADP-ribosyltransferase
activity. Six-
histidine-tagged human SIRT1 and mSIRT6 were expressed in E. coli and purified by
chromatography. Equal amounts of hSIRT1 and mSIRT6 were incubated with 32 P-NAD+
in the presence and absence of core histones (Fig. 4a). Whereas hSIRT1 transferred label
efficiently to histones, mSIRT6 failed to do so (Fig. 4a). However, mSIRT6 catalyzed
the robust transfer of label to itself, regardless of whether histones were present in the
reaction (Fig. 4a). Control extracts purified from E. coli containing vector alone
possessed no detectable activity under these conditions (data not shown).
We wished to determine if
32
p
transfer stimulated by mSIRT6 required the
catalytic activity of the enzyme. Two point mutations in highly-conserved residues
within mSIRT6 core domain were introduced by site-directed mutagenesis (Figure 1).
The histidine residue at position 133 was changed to tyrosine (mSIRT6-H133Y), a
mutation previously demonstrated to abolish enzymatic activity in human and yeast Sir2
proteins (Frye, 1999; Tanny et al., 1999). In a separate construct, the phylogenetically
invariant serine residue at position 56 was mutated to alanine (mSIRT6-S56A).
Serine 56
is buried deep in the active site of the enzyme, and does not appear to be structurally
important (Finnin et al., 2001). Both mutant proteins were expressed in E coli, purified,
and incubated in the presence of
32 P-NAD+
as described above. Unincorporated NAD
120
was removed by chromatography column. Proteins were separated by SDS-PAGE,
transferred to nitrocellulose membrane, and exposed to film. Whereas wild type mSIRT6
efficiently transferred
32
p radiolabel to itself, no label transfer was detected in mutants
mSIRT6-S56A and mSIRT6-H133Y (Fig. 4c). Presence of mutant proteins on the
membrane was verified by Western blotting using affinity-purified antibody to mSIRT6
(Fig. 4b).
Based on this requirement for two catalytic core residues, we conclude that
mSIRT6 catalyzes the transfer of radiolabel from 32 P-NADby an enzymatic mechanism.
Labeling of proteins with
32 P-NAD+can
also occur nonenzymatically by the
covalent binding of NAD. Such labeling, as observed in the case of GAPDH (Zhang and
Snyder, 1992), can be misinterpreted as ADP-ribosylation of specific amino acid
acceptors (Itoga et al., 1997; Zhang and Snyder, 1992). We have observed low levels of
nonspecific radiolabeling of proteins incubated in the presence of 32 P-NAD+. Under our
reaction conditions, such modification occurs in core histones and enzymatically-inactive
Sir2 point mutants, generally not labeling more than 0.001% of total protein after 1-hour
incubation at 30° C (Fig. 5), as determined by scintillation counting of protein bands. In
contrast, in the case of mSIRT6 we observed incorporation of a molar quantity of ADPribose equivalent to 15% of total moles of mSIRT6 present in the reaction (Fig 5). For
this reason, and because of the difference in labeling efficiency between wild type and
point-mutant varieties of mSIRT6, we conclude that the transfer of
via a robust enzymatic mechanism.
121
32 P-radiolabeloccurs
Auto-ADP-ribosylation of mSIRT6
To test the hypothesis that mSIRT6 catalyzed the mono-ADP-ribosylation of
itself, we probed the reaction products from the above label-transfer reactions with an
antibody specific to mono-ADP-ribose (Meyer and Hilz, 1986).
This antibody
recognized a band corresponding to the radiolabeled mSIRT6 following incubation with
32 P--NAD
(Fig. 6a). No band was present at the corresponding position in preparations
from mutant mSIRT6 (Fig. 6a), demonstrating the specificity of the antibody for the
modified form of mSIRT6. This evidence strongly suggests that this modified form of
mSIRT6 is mono-ADP-ribosylated. While our results do not rule out the possibility that
the modification of wild type mSIRT6 occurs in E. coli before purification, the absence
of signal in point mutant SIRT6 indicates that mono-ADP ribosylation depends on the
catalytic activity of mSIRT6.
Having confirmed mono-ADP-ribosylation as the nature of the modification of
mSIRT6, we wished to ascertain whether this modification was catalyzed in an inter- or
intra-molecular fashion. mSIRT6 and two different mutants (H133Y and S56A) were
used in a molecular cis/trans test for enzymatic activity. GST-mSIRT6 was purified from
E. coli and incubated in combination with His-tagged mutant and wild-type mSIRT6 in
the presence of
32 P--NAD.
Reactions were purified as before and subjected to
autoradiography. Labeled GST-mSIRT6 migrated as an approximately 80 KDa band in
all reactions (Fig. 6b). Six histidine-tagged mSIRT6 migrated as a strongly labeled 39
KDa band (Fig. 6b). However, this band was absent from the corresponding reactions of
both His-tagged mutants, demonstrating that GST-mSIRT6 was unable to ADP-ribosylate
those proteins. Coomassie staining of the gel prior to film exposure revealed similar
122
amounts of protein in all three lanes (data not shown). We therefore conclude that the
auto-ADP-ribosylation reaction catalyzed by mSIRT6 is intra-molecular.
DISCUSSION
Here we provide the first characterization of a class IV sirtuin, mouse SIRT6.
This sirtuin shows a relatively weak sequence homology to the yeast Sir2 (25%),
suggesting a significant divergence in function and enzymatic activity. Consistent with
published findings, we failed to detect any NAD-dependent protein deacetylase activity
in preparations of mSIRT6 expressed in bacterial and mammalian cells. Surprisingly,
mSIRT6 did show a robust ADP-ribosyltransferase activity in vitro, indicating that
recombinant bacterial preparations indeed contained active protein.
We conclude that mSIRT6 is a mono-ADP-ribosyltransferase for the following
reasons. First, the purified protein can catalyze the transfer of radiolabel from 32 P--NAD,
a reaction also catalyzed by other Sir2 family members (Frye, 1999; Imai et al., 2000;
Tanny et al., 1999) and previously shown to be mono-ADP-ribosylation (Tanny et al.,
1999). Second, this activity requires the catalytic function of mSIRT6, as two different
point mutations in phylogenetically invariant residues predicted to abolish enzymatic
activity eliminated the transfer of label from NAD to mSIRT6.
Third, only the
enzymatically-modified form of mSIRT6 is recognized by an anti-ADP ribose antibody
specific to mono-ADP-ribosylated proteins. Finally, the transfer of label from
32 P--NAD
to mSIRT6 is accomplished in by an intra-molecular mechanism, indicating that SIRT6
may use ADP-ribosylation as a way to auto-regulate its activity.
123
Recombinant mSIRT6 expressed in E. coli and incubated with NAD was able to
incorporate a quantity of ADP-ribose equivalent to 15% of the moles mSIRT6 present in
the reaction.
This level of ADP-ribosylation is impressive considering the intra-
molecular nature of the reaction, by which a molecule of SIRT6 is only active on a single
substrate molecule. We failed to observe a band shift resulting from ADP-riboyslation,
suggesting that the number of amino acid residues ADP-ribosylated on mSIRT6 is very
small. Assuming a single ADP-ribosylation per molecule of SIRT6, our results indicate a
strong 15% activity in our recombinant protein preparations.
Mouse SIRT6 is broadly expressed at the RNA and protein levels throughout
development and during adulthood in at least eight different tissue types, indicating broad
expression throughout the organism. The SIRT6 protein is particularly abundant in brain
and liver. Interestingly, mSIRT6 protein expression is highest in muscle, even though
mRNA levels in this tissue are low relative to those of actin. This might indicate
increased SIRT6 protein stability in muscle compared to other tissue types.
Alternatively, the disproportionate amount of SIRT6 protein observed in muscle may
result from an increased rate of translation of SIRT6 mRNA in this tissue type.
Localization studies of mSIRT6 using N- and C-terminal GFP fusions as well as
antibodies to two different epitopes showed that expression of mSIRT6 was largely
nuclear, with only a diffuse presence in cytoplasm. Interestingly, endogenous levels of
SIRT6 do not permeate certain intra-nuclear regions, probably corresponding to the
nucleolus (Figure 3b). The only other mouse class IV sirtuin, mSIRT7, is localized to the
nucleolus (E. F. and L. G., unpublished data). We therefore speculate that mSIRT6 and
mSIRT7, despite extensive sequence homology (39%), have non-overlapping functions
124
within the cell. Like SIRT6, SIRT7 has not been shown to possess any in vitro protein
deacetylase activity (North et al., 2003).
Several ADP-ribosyltransferases are capable of reversible auto-modification
resulting in altered enzymatic activity. Pseudomonas ExoS, a bifunctional enzyme, is a
Rho GTPase-activating
protein (GAP) as well as an ADP-ribosyltransferase
(Riese et al.,
2002). Auto-ADP-ribosylation at arginine-146, observed in vitro and in vivo, reduces
GAP activity (Riese et al., 2002), suggesting a mechanism for intramolecular regulation.
In mammals, auto-modification of ADP-ribosyltransferase 5 (ART5) converts the protein
from NADase to transferase (Weng et al., 1999), again suggesting a mechanism for
regulation of enzyme activity. We speculate that SIRT6 might regulate its own activity
in vivo by ADP-ribosylation of specific residues required for activity. At this time, we
have not yet identified the physiological targets of SIRT6. Unlike class I sirtuins
including yeast Sir2 and SIRT1, SIRT6 appears to be highly specific in vitro, even failing
to catalyze ADP-ribosylation of SIRT6 molecules in trans. The discovery of auto-ADPribosyltransferase activity in preparations of recombinant mouse SIRT6 is the first report
of enzymatic activity for any class IV sirtuin. Future experiments will aim to identify
physiological substrates ADP-ribosylated by SIRT6.
125
FOOTNOTES
*We thank H. Hilz (Hamburg, Germany) for the ADPR antibody. We also thank Laura
Bordone (Guarente lab, MIT) for her kind contribution of mouse tissue protein samples.
Finally, we would like to thank Marcia Haigis and Gil Blander for scientific input and
critical discussions.
1Abbreviations used
in this study: mSIRT6, mouse SIRT6; GFP, Green Fluorescent
Protein; DAPI, 4',6-diamidino-2-phenyindole; ADPR, ADP-ribose.
REFERENCES
Armstrong, C. M., Kaeberlein, M., Imai, S. I., and Guarente, L. (2002). Mutations in
Saccharomyces cerevisiae gene SIR2 can have differential effects on in vivo silencing phenotypes
and in vitro histone deacetylation activity. Mol Biol Cell 13, 1427-1438.
Bitterman, K. J., Medvedik, O., and Sinclair, D. A. (2003). Longevity regulation in
Saccharomyces cerevisiae: linking metabolism, genome stability, and heterochromatin. Microbiol
Mol Biol Rev 67, 376-399, table of contents.
Blander, G., and Guarente, L. (2004). The Sir2 family of protein deacetylases. Annu Rev
Biochem 73,417-435.
Brunet, A., Sweeney, L. B., Sturgill, J. F., Chua, K. F., Greer, P. L., Lin, Y., Tran, H., Ross, S. E.,
Mostoslavsky, R., Cohen, H. Y., et al. (2004). Stress-dependent regulation of FOXO transcription
factors by the SIRT1 deacetylase. Science 303, 2011-2015.
Corda, D., and Di Girolamo, M. (2003). Functional aspects of protein mono-ADP-ribosylation.
Embo J 22, 1953-1958.
126
Finnin, M. S., Donigian, J. R., and Pavletich, N. P. (2001). Structure of the histone deacetylase
SIRT2. Nat Struct Biol 8, 621-625.
Frye, R. A. (1999). Characterization of five human cDNAs with homology to the yeast SIR2
gene: Sir2-like proteins (sirtuins) metabolize NAD and may have protein ADP-ribosyltransferase
activity. Biochem Biophys Res Commun 260, 273-279.
Frye, R. A. (2000). Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins.
Biochem Biophys Res Commun 273, 793-798.
Gasser, S. M., and Cockell, M. M. (2001). The molecular biology of the SIR proteins. Gene 279,
1-16.
Hekimi, S., and Guarente, L. (2003). Genetics and the specificity of the aging process. Science
299, 1351-1354.
Imai, S., Armstrong, C. M., Kaeberlein, M., and Guarente, L. (2000). Transcriptional silencing
and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403, 795-800.
Itoga, M., Tsuchiya, M., Ishino, H., and Shimoyama, M. (1997). Nitric oxide-induced
modification of glyceraldehyde-3-phosphate dehydrogenase with NAD+ is not ADP-ribosylation.
J Biochem (Tokyo) 121, 1041-1046.
Kaeberlein, M., McVey, M., and Guarente, L. (1999). The SIR2/3/4 complex and SIR2 alone
promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev 13,
2570-2580.
Kain, S. R., Mai, K., and Sinai, P. (1994). Human multiple tissue western blots: a new
immunological tool for the analysis of tissue-specific protein expression. Biotechniques 17, 982987.
Lin, S. J., Defossez, P. A., and Guarente, L. (2000). Requirement of NAD and SIR2 for life-span
extension by calorie restriction in Saccharomyces cerevisiae. Science 289, 2126-2128.
Lin, S. J., Ford, E., Haigis, M., Liszt, G., and Guarente, L. (2004). Calorie restriction extends
yeast life span by lowering the level of NADH. Genes Dev 18, 12-16.
Meyer, T., and Hilz, H. (1986). Production of anti-(ADP-ribose) antibodies with the aid of a
dinucleotide-pyrophosphatase-resistant
hapten and their application for the detection of
mono(ADP-ribosyl)atedpolypeptides. Eur J Biochem 155, 157-165.
Motta, M. C., Divecha, N., Lemieux, M., Kamel, C., Chen, D., Gu, W., Bultsma, Y., McBurney,
M., and Guarente, L. (2004). Mammalian SIRT1 represses forkhead transcription factors. Cell
116, 551-563.
127
North, B. J., Marshall, B. L., Borra, M. T., Denu, J. M., and Verdin, E. (2003). The human Sir2
ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Mol Cell 11, 437-444.
North, B. J., and Verdin, E. (2004). Sirtuins: Sir2-related NAD-dependent protein deacetylases.
Genome Biol 5, 224.
Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., Machado De Oliveira, R.,
Leid, M., McBurney, M. W., and Guarente, L. (2004). Sirtl promotes fat mobilization in white
adipocytes by repressing PPAR-gamma. Nature 429, 771-776.
Riese, M. J., Goehring, U. M., Ehrmantraut, M. E., Moss, J., Barbieri, J. T., Aktories, K., and
Schmidt, G. (2002). Auto-ADP-ribosylation of Pseudomonas aeruginosa ExoS. J Biol Chem 277,
12082-12088.
Rogina, B., and Helfand, S. L. (2004). Sir2 mediates longevity in the fly through a pathway
related to calorie restriction. Proc Natl Acad Sci U S A 101, 15998-16003.
Sauve, A. A., and Schramm, V. L. (2004). SIR2: the biochemical mechanism of NAD(+)dependent protein deacetylation and ADP-ribosyl enzyme intermediates. Curr Med Chem 11,
807-826.
Tanner, K. G., Landry, J., Sternglanz, R., and Denu, J. M. (2000). Silent information regulator 2
family of NAD- dependent histone/protein deacetylases generates a unique product, -O-acetylADP-ribose. Proc Natl Acad Sci U S A 97, 14178-14182.
Tanny, J. C., Dowd, G. J., Huang, J., Hilz, H., and Moazed, D. (1999). An enzymatic activity in
the yeast Sir2 protein that is essential for gene silencing. Cell 99, 735-745.
Tanny, J. C., and Moazed, D. (2001). Coupling of histone deacetylation to NAD breakdown by
the yeast silencing protein Sir2: Evidence for acetyl transfer from substrate to an NAD
breakdown product. Proc Natl Acad Sci U S A 98, 415-420.
Tissenbaum, H. A., and Guarente, L. (2001). Increased dosage of a sir-2 gene extends lifespan in
Caenorhabditis elegans. Nature 410, 227-230.
Weng, B., Thompson, W. C., Kim, H. J., Levine, R. L., and Moss, J. (1999). Modification of the
ADP-ribosyltransferase and NAD glycohydrolase activities of a mammalian transferase (ADPribosyltransferase 5) by auto-ADP-ribosylation. J Biol Chem 274, 31797-31803.
Wood, J. G., Rogina, B., Lavu, S., Howitz, K., Helfand, S. L., Tatar, M., and Sinclair, D. (2004).
Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature 430, 686-689.
Zhang, J., and Snyder, S. H. (1992). Nitric oxide stimulates auto-ADP-ribosylation of
glyceraldehyde-3-phosphate dehydrogenase. Proc Natl Acad Sci U S A 89, 9382-9385.
128
129
FIGURES
Figure 1. Sequence alignment of mouse sirtuin core domains. Conserved core domains
of mouse SIRT1, SIRT4, SIRT5, and SIRT6 were aligned with the yeast Sir2 core using
ClustalW. In the sirtuin phylogenetic tree, SIRT1 is class I, SIRT4 is class II, SIRT5 is
class III, and SIRT6 is class IV. At each position of the alignment, identical residues are
boxed and shaded in gray. Amino acids filled in black correspond to mSIRT6 residues
targeted for mutagenesis in this study.
130
1..
ySir2p
255
mSIRTl
mSIRT4
mSIRTS
mSIRT6
246
L
61
Ll~M
ySir2p
mSIRTl
mSIRT4
mSIRTS
mSIRT6
ySir2p
mSIRTl
mSIRT4
mSIRT5
mSIRT6
R
M
•'.'.'
.•..
•.•..
'.~
.•.
':•.
IlL
S1
4S
S S
v
a.~
..•...
L
A I I
V F H
- - I -KHLGIl,.'.?".DD
DVFNYNI
MHDPSVIlIYN
LAV-DFPDlpD
AMFDIEY
KDPRP~FK
TDRRPIQHID- - -I.VRSAPV~QRYWARNF
- -K
-
I
.
,
',:
.........•.
.•.
om I~P.-AUI
Q'A 'Q D
LAP
IANMVLPPEK'IYSPLFAKEIYPGQVGWPQFSSHQ~NPAI:nw
Y R REV
- -HSFIKM~QMK
- FQPSLC-HKFI~LSDKE
~SNWE-Rlin-
L.~•... N P G •..B L
A R ~:8 S K TiftM
M R S K E
- - D T T FEN
ySir2p
A •.
'.~
.•..
'
.A
•.R N P S - - - Q v W E ~ Y H
K fE - - - - - - - - - - - - - - -
A T
• V: .. T M E ERG
L R N Y
L R N Y
HWLV
*.;;e
.••i.'.'.
1;;;;:,MiW*
S TDK~VQCI~S
IWlSFLV
ySir2p
ATATIVTqHWNLPGERIFNKJRNLELI~L
mSIRTl
mSIRT4
mSIRTS
mSIRT6
-
S
ri
G - T - - - - -
- V A E N Y R S -
FVEEbpKIKTQYVRDT~VGTM-
N M
-'2
I
Ie. 'RI
-GLKATGR
II
Y K K R R E Y F l.Pjx"l G Y N N K V G ~ A A S Q G S M S I E;RI
Y
~A ~- LAG
~ ~ Q ~K G~ ~1Wl.h.'
.•.~.' ~'" ..~ ... ~
A lmI E 1;P,JE;1 T
~ ~ ~ ~ ~
L~T
-
ySir2p
P P Y I ~N
mSIRTl
mSIRT4
mSIRT5
mSIRT6
T L
R G D I F N Q V V ,
.E..•.
R .. ~'.
~.f
mSIRTl
mSIRT4
mSIRT5
mSIRT6
ySir2p
NIIiJIJ~.~11 ~.
~
ySir2p
mSIRTl
mSIRT4
mSIRTS
mSIRT6
'(; S F
GC M
P R D KIAILG
e'.'•'.'.
...•..
..
li T
F
F
- - Q R , L Q C
- S Q R '8' T iE L
- - T K
G
A T A S .• L I "
M
.G
.•~
.'
•
•.•...•..
'K
..•
...
Y K V DeE
A
HRVL.LNDG-EQTARRELQERFQALNisws
F K T R
U V Q - - - - '13 E R MG
N
T
A
E
mSIRTl
mSIRT4
mSIRTS
mSIRT6
R V V V I
--
'. A Q C E l!!]
~ R.~..$>'.C."
.. R D Q .G....•
R
....
M. ,00
V A K T R
-
-
-
-
-
-
AG
-
-
-
-
-
-
-
-
-
I C I
KIArimV
II.~.""I ,
K .:.'~'.R ~."'. V A LIP
L ,y; V
C L N: V
S V T l
ySirZp
mSIRTl
mSIRT4
mSIRTS
mSIRT6
ySir2p
DIAAMVAQKCrmW
526
mSIRTl
mSIRT4
mSIRTS
mSIRT6
V I
483
323
I N E L C H R LlQI
ElLPLIDPRRQH
KTLPEALAPHET
EVMCR
LMKHL@]L
-
-
-
-
-
-
A
'NKFHKS
N
EQFHRA
DTVNPDKVDF
EN
D P A I LEE
LDWEDS'
DRDLML
S Y
I,RED
I LllE.
,'.
C
MKYDKDEV
VHRRVKiA
VDRELALC
ADEASRTA
Q~~ V~ ~D ~K ~,~
~~..HIDE
~R
L IRe
- - Q D A RIP
J06
271
131
S E I V N M V
'QiYYSGYRF
VNcY~AAMFAPQV
Q I R
[!ijs
S S
I
LTA
I
G N L P L A T
Figure 2. Analysis of mouse SIRT6 and actin expression in adult tissues and developing
embryos. (A) RNA was isolated from the indicated tissues in wild-type adult mice,
resolved by electrophoresis, and subjected to Northern blotting. Blots were probed with
32 P-labeledcDNA specific to mSIRT6
(top panel) or actin (lower panel). Muscle actin
found in heart and skeletal muscle samples migrated as a distinct band. (B) RNA from 7day, 11-day, 15-day, and 17-day mouse embryos was analyzed by Northern blotting as in
A. (C) Protein extracts from the indicated wild-type mouse tissues were resolved by SDSPAGE, and analyzed by Western blotting using antibodies specific to mSIRT6 (top
panel) or actin (lower panel). For each tissue type, samples from four different mice
were included.
132
~
1j
Vj
=e
A.
... .-= ~~=
~
~
=: eu
eu
==
-
00
t)I)
==
~
-...
- :s
~;0..
eu
~
~
~
00
B.
~
~
"'Cl
.~
...
~
~
.-=
~
eu
Vj
"'Cl
I
I'
~
eu
"'Cl
I
'I""'C
'I""'C
.....
Liver
'I""'C
Actin
Actin
Pancreas
--_._--:--~
Kidney
eu
SIRT6
Heart
..
'••.•....
~•....
_
SIRT6
....
Spleen
'I""'C
~
"'Cl
I
I'
SIRT6
c.
Brain
~
~
"'Cl
I
tn
Muscle
'. I Actin
Testis
- ..' I SIRT6
I Actin
~~:~::-:b=---
1----- -
r
133
Figure 3. Subcellular localization of mSIRT6 by GFP and indirect immunofluorescence
microscopy.
(A) NIH 3T3 cells were transfected with GFP (top row), an N-terminal
eGFP-mSIRT6 fusion (middle row), or a C-terminal mSIRT6-eGFP fusion (bottom row).
Transfections were performed on glass coverslips in six-well plates. 48 hours posttransfection, cells were washed, fixed with paraformaldehyde, stained with DAPI, and
analyzed by fluorescence microscopy. The FITC channel (left column) shows GFP
fluorescence, and the DAPI channel (middle column) reveals nucleic acid localization.
Images from both channels are merged in the rightmost column. For each transfection, a
representative field of cells is pictured. (B) NIH 3T3 cells grown on coverslips were
stained with affinity-purified rabbit polyclonal antibodies to two different mSIRT6
epitopes (full-length mSIRT6, middle row; mSIRT6 amino acids 274-355, bottom row).
Samples were then stained with DAPI and Cy3-conjugated anti-rabbit IgG and visualized
by fluorescence microscopy. Cy3 fluorescence is shown in the left column, DAPIstained nucleic acids are shown in the middle column, and the merged image is shown in
the right column.
134
135
A.
GFP
DAPI
FITC
DAPI
GFP
GFP-
SIRT6
SIRT6GFP
B.
SIRT6
(full
length)
SIRT6
(274-
355)
136
Figure 4. NAD+-dependentmodification of mSIRT6. (A) Recombinant hSIRTl (left) and
mSIRT6 (right) were incubated in the presence of 32 P-NAD+with and without core
histones. Samples were purified by gel filtration chromatography, subjected to SDSPAGE, and exposed to film for 2 hrs. (B) Wild-type and two mutant forms of mSIRT6
(S56A; H133Y) were incubated with
32 P-NAD+, purified,
and resolved by SDS-PAGE.
Proteins were transferred to nitrocellulose membrane and developed by autoradiography
(right panel). Presence of wild type and mutant SIRT6 was confirmed by probing
membrane with affinity-purified anti-mSIRT6 rabbit polyclonal antibody (left panel).
137
A.
mSIRTl
mSIRT6
mSIRT6
. Histones
-
Histones:
+
+
32p,
c.
B.
<
\C
~
~
~
l/)
fIIII4
rJj
<
\C
~
\C
==
\C
\C
an
•
\C
~
~
~
~
~
~
~
~
~
~
I
00
00
I
00.
CI'J
CI'J
==
•
\C
~
~
r.rJ
1-
~
32p
anti-mSIRT6
138
~
~
~
~
00
Figure 5. Quantification of auto-ADP ribosylation by mSIRT6. (A) 0.5 [LLrecombinant
wild-type SIRT6 and two mutant forms (S56A, H133Y) were incubated with 3 2 p -NAD,
purified by gel filtration chromatography, and analyzed by SDS-PAGE. The gel was
stained with Coomassie and photographed. SIRT6 quantities were determined by
comparison to BSA standards run on the same gel. Wild type SIRT6 was estimated at
0.250
g, or 6.4 pmol. (B) The stained gel from (A) was analyzed by autoradiography to
confirm radiolabeling of SIRT6. (C) SIRT6 bands were excised from the gel and 3 2 p
radioactivity was quantitated by scintillation counting. Results are normalized to
measurements from the corresponding region excised from pET28a vector control lanes.
(D) An NAD standard curve was generated by scintillation counting of known quantities
of 32 p -NAD diluted to reflect the ratio of unlabeled NAD to
32
p -NAD
in the reaction.
(E) Ratio of incorporated ADP-ribose to SIRT6 was determined as follows.
Radioactivity measured in SIRT6 bands was converted to pmol NAD by comparison to
the standard curve. Pmol of NAD was divided by pmol of SIRT6 to attain the fraction of
labeled mSIRT6.
139
A.
B.
SlRT6
Coomassie
c.
32p
D.
200
200
CJSIRT6
lBS56A
_H133Y
CO)
0
~
)(
E
CO)
)(
100
E
0.
r2 =0.996
0
.......
100
0.
U
U
0
SIRT6
S56A
0
0.000
H133Y
0.275
0.550
0.825
NAD(pmol)
E.
.20
CJSIRT6
iiiJS56A
_H133Y
T
"0<0
Q)~
-0::
eou)
0.0
L..
..-
8
Q)
.Q
:g
.10
.5 ~
cod.
0::0
~
0
SIRT6
S56A
H133Y
140
1.00
Figure 6. Auto-ADP-ribosylation of mSIRT6. (A) Equal amounts of recombinant
mSIRT6 and mutant mSIRT6-H133Y protein were incubated with
32
-NAD*and blotted
to nitrocellulose as described in Fig. 4. The blot was probed with antibody specific to
mono-ADP-ribose, stripped, and reprobed with antibody specific to mSIRT6 as a control.
(B) GST-SIRT6 was incubated with
32 P-NAD* and
either mSIRT6 (lane 1), mSIRT6-
S56A (lane 2), or mSIRT6-H133Y (lane 3). Reactions were analyzed by autoradiography
as in Fig. 4b. Coomassie staining of the gel prior to film exposure revealed similar
amounts of recombinant protein in all three lanes (not shown).
141
A.
B.
rI)
::
<
\C
I
....
rI)
~
('t")
('t")
,....
,....
('t")
::
\C
==
\C
\C
~
I-ol
~
I-ol
~
a-c
I
00
I
~==
~
~
I-ol
00
+
00
~
00
~
00
~
~
CI:J
CI:J
I
\C
\C
CI:J
00
~
~
~
~
I-ol
lI)
00
I
I
~('t")
....
rI)
.,...
\C
~
~
a-c
+
I
::
~
('t")
('t")
,....
==
~
I
~
I-ol
00
+
~
00
~
I
\C
\C
00
00
~
~
I-ol
~
~
-+- SIRT6-GST
~
anti-mSIRT6
~
anti-ADPR
-+- SIRT6-His
32p
142
Chapter4
Conclusions
143
SSD1 and UTH1
Naturally occurring polymorphisms can account for significant effects on
longevity and the rate of aging, not only in yeast but in humans, where a locus linked to
extreme long life span has been mapped to chromosome 4 (Puca et al., 2001). Different
alleles of S. cerevisisae SSDI have been isolated from both laboratory and wild yeast
strains, indicating that this is a true polymorphic locus and suggesting that variation of
SSD1 positively impacts survival under certain environmental conditions (Sutton et al.,
1991; Wheeler et al., 2003). The observation that SSDI-V affects aging adds to an
already long list of cellular processes influenced by this gene. A summary of SSDI's
reported genetic interactions, included in Appendix A, Table 1, lists more than 50 genes
whose phenotypes are modified by SSD1.
It is therefore notable that we present the first mechanistic study of the action of
Ssdlp in cells, establishing this protein as a direct repressor of translation of at least one
key target mRNA. Ssdl, like Mpt5/Puf5/Uth4, is likely to have a conserved regulatory
role of some sort, probably in its capacity as an RNA binding protein and repressor of
translation. However, the key downstream target of Ssdlp, Uthlp, is a protein specific to
fungi. Interestingly, several genes associated with yeast longevity play a conserved role
in evolution, despite the fact that yeast aging is predominantly controlled by a mechanism
specific to yeast cells (discussed in Chapter 1). It is therefore possible that Ssdl proteins
play a role in maintaining life span and stress resistance in other organisms.
Exactly how Ssdlp and Uthlp affect life span is unclear, but genetic data clearly
indicate that the mechanism is distinct from the main yeast aging pathways discussed in
detail in Chapter 1. SSDJ-V extends the life span of sir2A and sir2AfoblA strains,
144
strongly suggesting that the longevity caused by Ssdlp is independent of Sir2p activity.
Indeed, Ssdlp does not reduce ERC accumulation or rDNA marker loss, strongly
supporting this conclusion. A recent report indicates that the Sir2p homolog Hst2p
promotes longevity during caloric restriction by a mechanism very similar to the one
already described for Sir2p (Lamming et al., 2005). This effect, while genetically
independent of SIR2, still occurs through a decrease in rDNA silencing and a reduction in
ERC formation and accumulation. For this reason, we believe that Hst2p is an unlikely
candidate to account for the Sir2p-independent extension of life span by Ssdlp.
Ssdlp exerts a profound effect on cell wall stability and cell integrity. Although
the bud scar hypothesis of aging has been widely discredited, it is nevertheless possible
that cell wall stability becomes a limiting factor for extremely old cells. Senescence is
typically accompanied by eventual cell lysis, and it is therefore possible that stabilizing
the cell wall might prevent this lysis and allow cell division to continue.
A small portion of the extension of life span observed in SSDI - V cells is
attributable to an increase in Nca3p, a mitochondrial homolog of Uthlp. NCA3 mRNA is
upregulated in both SSD1-V and UTHI cells, possibly as a means of compensating for a
reduction in Uthlp function in both cases. Overexpression of NCA3 slightly extends life
span, and deletion of this gene slightly shortens life span in an SSDI-V background.
Despite extensive homology to UTHI, NCA3 does not appear to associate with Ssdlp in
cells, and is regulated quite differently in response to SSD1-V. NCA3 has been reported
to affect mitochondrial biogenesis (Pelissier et al., 1995), and might exert its modest
effects on aging through an influence on metabolism.
145
Ssdlp is the second translational repressor found to strongly affect yeast aging.
The first, Mpt5/Uth4/Puf5, also plays a conserved role in germ line stem cell
development in C. elegans and Drosophila (Crittenden et al., 2002; Lin and Spradling,
1997). It will be interesting to see if Ssdl and Mpt5 homologs have co-evolved with
similar roles in these two organisms. In yeast, the similarities between Ssdlp and Mpt5
are striking. Both are large polymorphic repressors of RNA translation affecting cell wall
stability, stress resistance, and life span through the regulation of critical target
molecules. The discovery of these two genes as key polymorphic regulators suggests that
control of RNA translation and stability is a key mechanism controlling phenotypic
variation in the wild.
Very little is known of the homologs of SSDI in higher organisms, although SSD1
is a conserved gene. The finding, presented in Chapter 2, that Ssdlp can act as a
translational repressor should provide a starting point for studies of Ssdlp-related
proteins in other organisms. We believe the next major step in the research of Ssdlp will
be to systematically identify the RNA molecules associated with Ssdlp in vivo, as these
represent excellent targets for regulation by Ssdlp.
This approach has succeeded in
identifying targets of several RNA-binding proteins in yeast and worms (Gerber et al.,
2004; Lee and Schedl, 2001), and shows promise in other systems as well. It will be
interesting to see if the other targets of Ssdlp are connected by a common theme, such as
cell wall regulation or metabolism. It will also be interesting to see whether Ssdl
homologs regulate similar targets in different species.
146
SIR2 and CR
In Appendix B, we discuss the mechanism by which CR increases Sir2p activity
to promote rDNA stability and longevity. The results presented in this thesis support the
model wherein CR increases respiration, effectively increasing the NAD/NADH ratio
through a reduction in NADH levels. By this model, Sir2p activity is increased by relief
of competitive inhibition by NADH.
An opposing model posits that Pnclp, a
nicotinamidase involved in NAD synthesis, is increased by CR, thereby lowering the
levels of nicotinamide that normally limit Sir2p function (Anderson et al., 2003).
There is also a third possible model that has not been explicitly addressed by any
published studies. Although Sir2p is a nuclear protein, there is reason to believe that
NAD is freely diffusible between the nucleus and the cytoplasm. It is therefore possible
that the major NAD-utilizing glycolytic enzymes of the cytosol compete with Sir2p for
NAD binding, and it is the reduction of these enzymes during CR that activates Sir2p by
increasing available (but not total cellular) NAD. Consistent with this model, deletion of
glyceraldehyde 3-phosphate dehydrogenase (GAPDH), which converts glyceraldehydes3-phosphate to 1,3-diphosphoglycerate while reducing one molecule of NAD to NADH,
extends life span in a Sir2p-dependent manner (Lin et al., 2000). Overexpression of
GAPDH isoform TDH3 decreases Sir2p activity and rescues toxicity resulting from
extremely high SIR2 overexpression (Matecic et al., 2002). Future studies should
investigate whether reduction of major NAD-utilizing enzymes of glycolysis is sufficient
to activate Sir2p, and whether this activation might result from increased NAD
availability to Sir2p.
147
SIRT6 and SIRT7
In Chapter 3 and Appendix C, we present the first characterization of class IV
members of the Sir2 phylogenetic tree (Frye, 2000). Interestingly, despite extensive
conservation within the catalytic core, both SIRT6 and SIRT7 fail to demonstrate an in
vitro NAD-dependent deacetylase activity. Mouse SIRT6 does, however, catalyze a
robust auto-ADP-ribosyltransferase
reaction, the discovery of which counters the
assumption, widely held in the field, that Sir2 proteins are deacetylases first and
foremost, only weakly catalyzing ADP-ribosylation. It remains to be seen what is the
biological significance of this ADP-ribosylation reaction. In most known cases, ADPribosylation of arginine residues results in reversible inactivation of the substrate protein
(Riese et al., 2002), although this modification may enhance certain enzymatic functions
within the substrate (Weng et al., 1999). Future studies should identify ADP-ribosylated
targets of SIRT6.
SIRT7, is a broadly expressed nucleolar protein that strongly activates RNA
polymerase I transcription by an enzymatic mechanism. It remains to be seen what the
exact molecular target of SIRT7 is, but it is likely a member of the enormous Pol I
complex. SIRT7 displays neither deacetylase activity nor ADP-ribosyltransferase in
vitro, but this may result from substrate specificity issues rather than an inherent lack of
activity. SIRT1, orthologous to the yeast Sir2, has the broadest substrate specificity of
the mammalian sirtuins (North and Verdin, 2004) and is also the best characterized
(reviewed in Chapter 1). The discovery of SIRT7 as an activator of rDNA transcription
provides a potential link between energy metabolism, NAD availability, and ribosome
biogenesis, all of which one would expect to be tightly linked. It will therefore be
148
important and interesting to establish a model of SIRT7 regulation analogous to those
established for the yeast Sir2p.
149
REFERENCES
Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., and Sinclair, D. A.
(2003). Nicotinamide and PNC1 govern lifespan extension by calorie restriction in
Saccharomyces cerevisiae. Nature 423, 181-185.
Crittenden, S. L., Bernstein, D. S., Bachorik, J. L., Thompson, B. E., Gallegos, M.,
Petcherski, A. G., Moulder, G., Barstead, R., Wickens, M., and Kimble, J. (2002). A
conserved RNA-binding protein controls germline stem cells in Caenorhabditis elegans.
Nature 417, 660-663.
Frye, R. A. (2000). Phylogenetic classification of prokaryotic and eukaryotic Sir2-like
proteins. Biochem Biophys Res Commun 273, 793-798.
Gerber, A. P., Herschlag, D., and Brown, P. 0. (2004). Extensive association of
functionally and cytotopically related mRNAs with Puf family RNA-binding proteins in
yeast. PLoS Biol 2, E79.
Lamming, D. W., Latorre-Esteves, M., Medvedik, O., Wong, S. N., Tsang, F. A., Wang,
C., Lin, S. J., and Sinclair, D. A. (2005). HST2 mediates SIR2-independent life-span
extension by calorie restriction. Science 309, 1861-1864.
Lee, M. H., and Schedl, T. (2001). Identification of in vivo mRNA targets of GLD-1, a
maxi-KH motif containing protein required for C. elegans germ cell development. Genes
Dev 15, 2408-2420.
Lin, H., and Spradling, A. C. (1997). A novel group of pumilio mutations affects the
asymmetric division of germline stem cells in the Drosophila ovary. Development 124,
2463-2476.
Lin, S. J., Defossez, P. A., and Guarente, L. (2000). Requirement of NAD and SIR2 for
life-span extension by calorie restriction in Saccharomyces cerevisiae. Science 289,
2126-2128.
Matecic, M., Stuart, S., and Holmes, S. G. (2002). SIR2-induced inviability is suppressed
by histone H4 overexpression. Genetics 162, 973-976.
North, B. J., and Verdin, E. (2004). Sirtuins: Sir2-related NAD-dependent protein
deacetylases. Genome Biol 5, 224.
Pelissier, P., Camougrand, N., Velours, G., and Guerin, M. (1995). NCA3, a nuclear gene
involved in the mitochondrial expression of subunits 6 and 8 of the Fo-FI ATP synthase
of S. cerevisiae. Curr Genet 27, 409-416.
Puca, A. A., Daly, M. J., Brewster, S. J., Matise, T. C., Barrett, J., Shea-Drinkwater, M.,
Kang, S., Joyce, E., Nicoli, J., Benson, E., et al. (2001). A genome-wide scan for linkage
to human exceptional longevity identifies a locus on chromosome 4. Proc Natl Acad Sci
U S A 98, 10505-10508.
Riese, M. J., Goehring, U. M., Ehrmantraut, M. E., Moss, J., Barbieri, J. T., Aktories, K.,
and Schmidt, G. (2002). Auto-ADP-ribosylation of Pseudomonas aeruginosa ExoS. J
Biol Chem 277, 12082-12088.
Sutton, A., Immanuel, D., and Arndt, K. T. (1991). The SIT4 protein phosphatase
functions in late G1 for progression into S phase. Mol Cell Biol 11, 2133-2148.
Weng, B., Thompson, W. C., Kim, H. J., Levine, R. L., and Moss, J. (1999).
Modification of the ADP-ribosyltransferase and NAD glycohydrolase activities of a
mammalian transferase (ADP-ribosyltransferase
Chem 274,31797-31803.
150
5) by auto-ADP-ribosylation.
J Biol
Wheeler, R. T., Kupiec, M., Magnelli, P., Abeijon, C., and Fink, G. R. (2003). A
Saccharomyces cerevisiae mutant with increased virulence. Proc Natl Acad Sci U S A
100, 2766-2770.
151
152
Appendix A
Saccharomyces cerevisiae SSDJ-V Promotes
Longevity by a Sir2p-Independent
Mechanism
This chapter was published in Genetics Volume 166 Issue 4 pages 1661-1672. The
authors were Matt Kaeberlein, Alex Andalis, Gregory Liszt, Gerald Fink and Leonard
Guarente. I contributed Table 3, Figure 3, and Figure 4.
153
SUMMARY
TheSSDI gene of Saccharomyces cerevisiae affects diverse cellular processes including
cell integrity, cell cycle progression, and growth at high temperature. We show here that
the SSDI-V allele is necessary for cells to achieve extremely long life span. Furthermore,
we demonstrate that addition of SSDI - V to cells can increase longevity independently of
SIR2 or calorie restriction. Microarray analysis differentiates SSDI1-Vfrom four other
long-lived cell types and suggests that the presence of SSDI -V results in altered transcript
levels for genes involved in many cellular processes including cell wall biosynthesis,
DNA repair and stress response, and RNA processing. We propose that SSD1-V defines
a previously undescribed pathway affecting cellular longevity and aging.
154
INTRODUCTION
Aging in Saccharomyces cerevisiae can be studied by mutations that extend the
replicative life span of mother cells, defined as the number of daughters produced by a
given mother cell prior to senescence. We report here a new longevity-promoting factor,
SSD1-V, that extends mean life span up to 85% and promotes longevity in the absence of
Sir2p.
One cause of aging in yeast is the accumulation of extrachromosomal ribosomal DNA
circles (ERCs) (SINCLAIR and GUARENTE 1997). The yeast ribosomal DNA (rDNA)
is organized into a tandem array of 100-200 copies of a 9.1 kb repeat (PETES and
BOTSTEIN 1977; PHILIPPSEN et al. 1978; RUSTCHENKO and SHERMAN 1994).
Homologous recombination between adjacent repeats can result in excision of an ERC.
ERCs are self-replicating and asymmetrically segregated to the mother cell nucleus
during S-phase, resulting in an exponential increase in ERC copy number with age (
SINCLAIR and GUARENTE 1997). Once a threshold level of ERCs is achieved, it is
thought that a cell senescence pathway is activated that culminates in cell death.
A central regulator of life span in yeast is the Sir2 protein (KAEBERLEIN et al. 1999).
Sir2p is an NAD-dependent histone deacetylase (IMAI et al. 2000; LANDRY et al. 2000;
SMITH et al. 2000) required for transcriptional silencing at telomeres (GOTTSCHLING
et al. 1990), silent mating (HMA)loci (IVY et al. 1986; RINE and HERSKOWITZ 1987),
and the rDNA (BRYK et al. 1997; SMITH and BOEKE 1997). Mutation of SIR2 results
in increased rDNA recombination (GOTTLIEB and ESPOSITO 1989), increased ERC
formation (KAEBERLEIN et al. 1999), and decreased life span (KENNEDY et al. 1995),
wheras overexpression extends life span by 30-40% (KAEBERLEIN et al. 1999). Sir2p
is also required for life span extension by calorie restriction (CR), demonstrating the
importance of this protein as a central regulator of longevity (LIN et al. 2000).
Intriguingly, overexpression of a Sir2p homolog, Sir-2.1, was found to extend life span in
the nematode C. elegans, suggesting that Sir2 proteins also regulate aging in higher
eukaryotes (TISSENBAUM and GUARENTE 2001).
155
Genetic interaction between MPT5 and SSDI: SSDI is a polymorphic locus that
affects diverse cellular processes. Two allele classes have been identified for SSD1,
designated SSDI1-V and ssdl-d. SSDI-V alleles confer viability in the absence of the Sit4
protein phosphatase and code for functional Ssdl protein. In contrast, strains carrying
ssdl-d alleles are inviable in the absence of Sit4p (SUTTON et al. 1991), and d-type
alleles are likely null for Ssdlp function. Both V and d type alleles have been found in
natural isolates as well as laboratory strains of S. cerevisiae. A recent report (WHEELER
et al. 2003) suggests that SSDI allele type affects pathogenicity of yeasts, suggesting that
the SSD1 locus is susceptible to strong selective pressure under certain einvironmental
conditions.
A potential role for SSD 1-V as a regulator of cell life span was suggested by the
observation that SSD1-V suppresses many phenotypes associated with mutation of the
MPT5IUTH4 gene (KAEBERLEIN and GUARENTE 2002). MPT5 is a post-
transcriptional regulator (TADAUCHI et al. 2001) involved in regulating pheromone
response (CHEN and KURJAN 1997), cell wall stability (KAEBERLEIN and
GUARENTE 2002), telomere silencing (COCKELL et al. 1998), and longevity
(KENNEDY et al. 1995). Like SIR2, MPT5 is a limiting factor for longevity:
overexpression of MPT5 extends life span, while deletion has the opposite effect
(KENNEDY et al. 1997).
SSDI1-Vsuppresses the temperature sensitive growth defect caused by mutation of Mpt5p
as well as the sensitivity to calcofluor white (CFW) and sodium dodecyl sulfate
(SDS)(KAEBERLEIN
and GUARENTE 2002). Furthermore, in strains lacking SSDI-V,
deletion of MPT5 is synthetically lethal in combination with loss of function in either
SBF or CCR4 transcriptional complexes (KAEBERLEIN and GUARENTE 2002), both
of which function downstream of protein kinase C (Pkclp) to promote cell wall
biosynthesis (CHANG et al. 1999; IGUAL et al. 1996; MADDEN et al. 1997). These
156
results were interpreted to suggest that Mpt5p, Ssdlp, and Pkclp define three parallel
pathways that function to ensure cell integrity (KAEBERLEIN and GUARENTE 2002).
In addition to suppressing the cell integrity defects, SSD1-V suppresses the shortened life
span caused by deletion of MPT5 (KAEBERLEIN and GUARENTE 2002). We were
therefore interested in examining the possibility that SSDI-V might also promote
longevity in wild type cells. Here we show that addition of a single copy of SSDI-V to
ssdl-d wild type cells extends life span in at least two different strain backgrounds.
Furthermore, life span extension by SSDI-V does not require the Sir2 protein, although
the presence of both SSDI-V and SIR2 is necessary for maximal longevity.
MATERIALS AND METHODS
Strains and genetic techniques: The strains used in this study are listed in Table 2. All
strains were derived from W303R (described in MILLS et al. 1999), PSY316 (described
in PARK et al. 1999), or BKY5 (described in KENNEDY et al. 1995).Genetic crosses,
sporulation, and tetrad analysis were carried out as described (SHERMAN and HICKS
1991). The genotype of inviable spore clones was inferred when possible based on
marker segregation in viable spore clones from the same tetrad. Unless otherwise noted,
cells were cultured in YPD or synthetic media prepared using conventional methods
(GUTHRIE and FINK 1991). Yeast transformation was accomplished by the lithium
acetate method (GIETZ et al. 1992). The sir2 fob] strain was constructed as described
(LIN et al. 2000). All other gene deletions were generated by transforming cells with
PCR amplified disruption cassettes as described (KAEBERLEIN et al. 1999). In each
case, the entire open reading frame was removed. All disruptions were verified
phenotypically or by PCR. The SSDI1-Vintegrating plasmids p406SSD1 and p405SSDl1
were previously described (KAEBERLEIN and GUARENTE 2002). Unless otherwise
indicated, all SSDI- V strains contain SSDI- V integrated at the marker locus and still carry
the ssdl-d allele at the SSD1 locus. Deletion of ssdl-d does not affect any of the
phenotypes tested, including life span, growth at 30 ° , 37° , or 40 ° , or sensitivity to
calcofluor white.
157
Determination of SSD1 allele: In order to determine which SSDI allele was present in
PSY316, we deleted one copy of the SIT4 gene in diploid cells. Sporulation of these cells
revealed that deletion of SIT4 always resulted in lethality (n>20 sit4A spore clones). This
lethality was suppressed by integration of a single copy of SSD1-V at the URA3 locus.
Therefore, we conclude that in PSY316, the SSDI allele is a ssdl-d allele.
Life span, recombination and ERC analysis: Life spans were performed as described
(KAEBERLEIN and GUARENTE 2002). Statistical significance was determined by a
Wilcoxon rank sum test. Average life span is stated to be different for p<0.05. Each
figure represents data derived from a single experiment, unless otherwise stated. ERC
levels were determined as described (KAEBERLEIN et al. 1999; DEFOSSEZ et al.
1999). ERCs were separated on a 0.6% agarose gel without addition of ethidium bromide
at 1 Volt/cm for 48 hr. rDNA recombination rate was determined as described
(KAEBERLEIN et al. 1999).
Microarray analysis: RNA isolation and microarray analysis was performed essentially
as described (LIN et al. 2002). Candidate genes with altered transcript levels in SSD1-V
cells relative to wild type were defined as such if the ratio of SSD1-V (Cy5) to ssdl-d
(Cy3) was greater than 1.5 or less than 0.667 (1.5-fold decrease) in 2/2 independent
experiments. All such genes are listed in the supplemental data (Supplemental Table 1).
As a control, microarray analysis was performed on ssdlA (Cy5) cells relative to ssdl-d
(Cy3) cells. The 124 genes defined as regulated by CR represent the subset of genes
found to show significant changes in mRNA expression both in cells lacking HXK2 and
in cells grown on 0.5% glucose (LIN et al. 2002). Cluster analysis was performed using
Cluster and visualized with TreeView (EISEN et al. 1998). Statistical significance of the
overlap between regulated genes in different experiments shown in Figure 4 was
calculated using a hypergeometric distribution. P-values were obtained from the online
hypergeometric distribution calculator at http://www.alewand.de/stattab/tabdiske.htm.
Supplemental Table 1 as well as the entire microarray data sets for all experiments
presented in this paper are available on the World Wide Web at
158
http://web.mit.edu/biology/guarente/microarray/kaeberlein. Files may be downloaded as
Microsoft Excel spreadsheets.
RESULTS
SSDI-V extends life span and improves growth at high temperature: Mpt5p is a
limiting factor for longevity and functions in a pathway parallel to SSDI -V for cell
integrity (KAEBERLEIN and GUARENTE 2002). Based on this genetic interaction, we
hypothesized that SSD1-V might also regulate longevity. We first determined that our
wild type strain PSY316 carries the ssdl-d allele at the SSDI locus, based on inviability
caused by deletion of SIT4 in this background (see Materials and Methods). A single
copy of SSD1-V integrated at the URA3 locus results in an approximately 50% increase in
mean life span (Figure 1A). Integration of SSD1-V at the SSDI locus has a similar effect
on life span (not shown). Deletion of the chromosomal ssdl-d allele of PSY316 has no
effect on life span and does not affect life span extension by SSD1-V (Figure 1A).
Therefore ssdl-d is a null allele with respect to life span. All subsequent experiments
were carried out in the parental ssdl-d background.
PSY316 is a moderately long-lived yeast strain, however many yeast aging studies have
been carried out in short lived strain backgrounds having mean life spans of 10-15
generations.
In order to determine whether the life span extension by SSD1-V was strain
specific, we integrated SSD1-V into the short-lived strain BKY5. We verified that BKY5
carries an ssdl-d allele (see Materials and Methods) as well as a previously identified C-
terminal truncated allele of MPT5 (KENNEDY et al. 1997). Addition of SSD- V to
BKY5 results in an 85% increase in mean life span (Figure
B). Thus, SSD1-Vpromotes
long life span in at least two different ssdl-d strain backgrounds.
We had previously observed that cells from strain PSY316 grow normally at 37 ° , but are
incapable of sustained growth at 40 ° . Cells grown at 40 ° generally arrest as large budded
cells with a significant fraction undergoing lysis (data not shown), consistent with a loss
159
of cell wall integrity at the restrictive temperature. Addition of SSDI-V fully suppresses
these phenotypes and allows growth of PSY316 at 40° (Figure 1C). Addition of SSD1-V
to PSY316 also improves growth in the presence of the cell wall perturbing agents CFW
and SDS (data not shown), as previously reported for strain W303R (KAEBERLEIN and
GUARENTE 2002).
SSDI-V extends life span in the absence of SIR2: The Sir2 protein is a central regulator
of yeast longevity, necessary for life span extension in response to environmental signals
such as reduced nutrient availability (LIN et al. 2000) and osmotic stress (KAEBERLEIN
et al. 2002). In order to place SSD1-V into a genetic pathway relative to Sir2p, we
integrated the SSDI1-Vallele into a sir2 fob] double mutant. The sir2fob] double mutant
was utilized because it has a nearly wild-type life span, rather than the extremely short
life span observed for sir2 FOB] cells (KAEBERLEIN et al. 1999). As predicted by our
model previously proposed model (LIN et al. 2000; LIN et al. 2002), calorie restriction
(CR) by growth on low glucose fails to extend life span in the absence of SIR2 (Figure
2A). In contrast, sir2 fob] SSD1-V cells grown on 2% glucose have a life span that is
significantly longer than sir2 fob] ssdl -d cells. However, sir2 fob] SSD1-V cells do not
live as long as SIR2 FOB] SSD1-V cells (Figure 2B). Therefore, SSDI-V acts in a novel,
SIR2-independent pathway for longevity, although Sir2p is required for maximum
longevity in SSD1-V cells.
160
The Sir2-dependent life span extension caused by CR is the result of a metabolic shift
from fermentation to respiration (LIN et al. 2002). It is possible that a portion of the
longevity conferred by SSD1-V is achieved by causing the cell to undergo a similar
metabolic shift. To address this possibility, the effect of SSD1-V on life span was
examined in a respiration deficient strain lacking the CYT1 gene encoding cytochrome
cl. Mutation of CYT1 prevents life span extension by CR or by overexpression of the
Hap4p transcription factor (LIN et al. 2002). In contrast, SSD 1-V extends the life span of
cells lacking CYT1 to the same extent as wild type cells (Figure 2C), suggesting that the
mechanism of life span extension by SSD 1-V is independent of mitochondrial function
and respiration.
SSDI-V acts independently of ERC formation or accumulation: Sir2p and calorie
restriction promote longevity by decreasing the formation and accumulation of ERCs in
mother cells (KAEBERLEIN et al. 1999; LIN et al. 2000). In order to determine whether
the long life span of SSD1-V cells is also due to fewer ERCs, we measured the rate of
ERC formation and the amount of ERCs present in ssdl-d and SSD1-V cells. ERC
formation was estimated by determining the frequency at which an ADE2 marker
integrated into the rDNA is lost, as demonstrated by the presence of half-sectored
colonies (KAEBERLEIN et al. 1999). No difference was observed between SSD1-V and
ssdl-d cells by this assay (Figure 3A). Upon direct quantitation of ERCs from unsorted
cells, we observed that SSD1-V cells often had higher levels of ERCs than ssdl-d cells
(Figure 3B), indicating that the life span extension caused by SSD 1-V is unlikely to be the
result of decreased ERC formation or accumulation. This is consistent with the
observation that SSD1-V does not require Sir2p to extend life span.
Transcriptional analysis of SSDI-V: In order to further understand the effect of SSD1-V
on cell physiology and longevity, we used microarray analysis to examine the
transcriptional profile of SSD1-V cells relative to wild type ssdl-d cells. In 2/2
independent experiments, 83 genes were down-regulated and 217 genes were up-
regulated at least 1.5-fold by SSDI-V (see Supplemental Table 1).
161
The most common phenotype associated with Ssdlp is the ability to suppress temperature
sensitivity caused by mutations that affect the cell wall (Table 1). Recently, SSDI -Vhas
been found to increase resistance to the cell wall perturbing agents CFW and SDS
(KAEBERLEIN and GUARENTE 2002) and to alter the amount of chitin, 3-1,6-glucan,
-1,3-glucan, and mannan present in the cell wall (WHEELER et al. 2003). Microarray
analysis suggests that these observations can be at least partially explained by altered
expression of cell wall genes in SSDI-V cells. Messenger RNA levels for several cell
wall proteins, including the Chs5p chitin synthase and Kre5p, a protein required for 1,6-glucan biosynthesis, are elevated by SSDI-V. Interestingly, we also observe
increased transcript levels for several proteins involved in sporulation and spore wall
formation. In particular, SWM1 and TEP1, two genes involved in assembly of the spore
cell wall are up-regulated 2.2-fold and 2.1-fold respectively, perhaps suggesting a
fundamental alteration in the cell wall structure of vegetatively growing SSD1-V cells.
We have previously demonstrated a correlation between cell wall stability and longevity
(KAEBERLEIN and GUARENTE 2002), suggesting that enhanced cell wall integrity
may be necessary for cells to attain extreme longevity.
SSD1-V has also recently been reported to promote resistance to the plant antifungal
osmotin (IBEAS et al. 2000; IBEAS et al. 2001). It has been suggested that this
increased resistance is due to an altered composition of cell wall mannoproteins in SSDIVcells. Indeed, we find that mRNA coding for the cell wall mannoprotien, Cwplp, is
decreased 2.4-fold in SSD1-V cells. Cwpl is known to directly bind osmotin (IBEAS et
al. 2000), suggesting that reduction of Cwplp might promote the osmotin resistance
observed in SSD1-V cells.
SSD1-Vhas also been found to suppress the temperature sensitivity of several splicing
defective mutations (LUUKKONEN and SERAPHIN 1999). Consistent with these
observations, we find that several genes involved in RNA processing are differentially
transcribed in SSD1-V cells relative to ssdl-d cells, perhaps accounting for this
phenotype. In addition to these changes, SSD1-V cells also show altered levels of mRNA
coding for proteins involved in DNA repair, stress response, mating, and mitochondrial
162
function. Reasonable hypotheses could be made as to why each of these functional
categories might be important for the effect of SSD1-V on life span. Therefore, further
experimental analysis of specific candidate genes will be required in order to determine
which are important for longevity.
One particularly interesting candidate gene that shows altered mRNA levels in SSDI1-V
cells is NCA3. Nca3p is a member of the SUN family of proteins (Siml, Uthl, Nca3, and
Sun4) and functions to promote maturation of the mitochondrially encoded ATP8-ATP6
co-transcript (PELISSIER et al. 1995). Up-regulation (3.4-fold) of NCA3 by SSD -V is
striking because Nca3p shares extensive homology (60%) with the aging protein Uthlp.
Interestingly, we find that NCA3 mRNA is increased 4-fold in long-lived cells lacking
Uthlp (data not shown). Overexpression of NCA3 from the ADHI promoter results in a
slight, but reproducible increase in life span (Figure 4A), suggesting that Nca3p dosage
can affect longevity. However, NCA3 is not required for the majority of the life-span
extension seen in SSDI-V cells, as demonstrated by the finding that nca3 SSDI-V cells
have a life span comparable to NCA3 SSD1-V cells (Figure 4B). Therefore, we conclude
that increased transcription of NCA3 accounts for, at most, a minor fraction of the
longevity promoting activity of SSD1-V.
Gene expression analysis of long-lived cell types: We have previously shown that
calorie restriction by growth in 0.5% glucose, which promotes long life span, causes
characteristic changes in gene expression that are reproduced in two genetic models of
CR, namely overexpression of HAP4 and deletion of HXK2 (LIN et al. 2002). More
recently, we demonstrated that growth in the presence of high external osmolarity (HEO)
also extends life span in a SIR2-dependent manner and results in a gene expression
profile with significant similarity to calorically restricted cells (KAEBERLEIN et al.
2002). We were therefore interested in determining how closely the changes in gene
expression caused by addition of SSD1-V would match those caused by CR and HEO.
Two dimensional cluster analysis (EISEN et al. 1998) of the SSD1-V gene expression
data and previously published data sets for 0.5% glucose, HAP4-overexpression, HXK2
163
deletion (LIN et al. 2002), and 20% glucose (KAEBERLEIN et al. 2002) was performed
over the set of genes previously identified as being regulated by CR (see Materials and
Methods; LIN et al. 2002). Two independently derived data sets were included for each
condition, except for cells lacking HXK2, for which only one microarray experiment was
performed. In each case, the two data sets corresponding to a particular condition cluster
together (Figure 5A).
As expected, cells grown in 0.5% glucose cluster most closely with cells lacking HXK2
and define the CR group (Figure 5B). Cells overexpressing HAP4 also cluster with this
group, although on a separate branch. Cells exposed to HEO cluster with the HAP4/CR
group on the next level of the tree, and together these four cell types comprise the SIR2dependent longevity group. Strikingly, SSDI-V cells cluster separately from all the other
data sets at the highest level of the tree.
This analysis is further supported by a comparison of genes co-regulated by each of the
longevity promoting conditions above. Of the 124 genes regulated by CR, 55 are
similarly regulated by HAP4-overexpression and 48 are similarly regulated by growth in
20% glucose (Figure 5C).
In contrast, only 8/290 genes differentially transcribed by
addition of SSD1-V overlap with the CR-regulated genes (Figure 5C). Thus, the gene
expression changes observed by microarray analysis strongly support the genetic data and
suggest that SSD1-V promotes longevity by a novel mechanism unrelated to CR.
MPT5 and SIR2 affect longevity in a pathway parallel to SSDI-V: We have
previously demonstrated that MPT5 and SSD1-V act in parallel pathways to promote cell
integrity and that SSD1-V suppresses the short life span caused by deletion of MPT5 in
the W303R strain background (KAEBERLEIN AND GUARENTE 2002). As expected,
addition of SSD1-V also suppresses the short life span of the mpt5 deletion in PSY316
(Figure 6A). It is interesting to note, however, that mpt5 SSD1-V cells have a life span
intermediate between cells lacking both MPT5 and SSD1-V and cells with functional
copies of both genes. In fact, mpt5 SSD1-V cells have a life span not significantly
different than the wild type MPT5 ssdl-d strain, suggesting that MPT5 and SSDJ- V have
164
additive effects on longevity, as would be expected for genes functioning in parallel
pathways.
Like SSDI-V, overexpression of MPT5 increases mother cell life span (KENNEDY et al.
1997). Since SSDI-V is capable of extending the life span of cells lacking SIR2, we
wished to determine whether overexpression of MPT5 would have a similar effect. In
contrast to SSD1-V, MPT5-overexpression fails to extend the life span of sir2 fobl cells
(Figure 6B), suggesting that MPT5 and SIR2 act in the same pathway to promote
longevity.
It had been previously observed that cells with altered dosage of MPT5 display changes
in telomeric and rDNA silencing (KENNEDY 1996), suggesting a further link between
MPT5 and SIR2. Overexpression of MPT5 increases rDNA silencing and decreases
telomeric silencing, while deletion has an opposite effect (Table 3). Integration of SSD1V, in contrast, has no detectable effect on silencing at either locus. Consistent with the
inability of MPT5 overexpression to extend life span in the absence of SIR2, the
enhanced rDNA silencing observed in cells overexpressing MPT5 is fully suppressed by
deletion of SIR2 (Table 3). Based on these results, we propose that overexpression of
MPT5 increases life span by relocalizing Sir2p from telomeres to the rDNA (see
Discussion), thus enhancing ability of Sir2p to inhibit ERC accumulation in aging mother
cells.
DISCUSSION
One cause of aging in yeast is the accumulation of ERCs (SINCLAIR and GUARENTE
1997). A central regulator of ERC formation and longevity is the Sir2p histone
deacetylase (KAEBERLEIN et al. 1999). Several genes that regulate yeast life span act
by altering Sir2p activity or dosage (KAEBERLEIN et al. 1999; LIN et al. 2000; LIN et
al. 2002; KAEBERLEIN et al. 2002). Here we present evidence that SSD1-V defines a
novel Sir2p-independent pathway necessary for cells to achieve extreme longevity.
165
Two pathways promoting longevity: We initially began studying SSDI-Vbased on its
ability to suppress the temperature sensitivity caused by mutation of the UTH4/MPT5
gene. Like Sir2p, Mpt5p is limiting for life span in wild type cells (KENNEDY et al.
1997). Overexpression of Mpt5p increases life span and rDNA silencing in a Sir2p-
dependent manner (Figure 6B, Table 3), suggesting that Mpt5p promotes longevity by
increasing Sir2p activity at the rDNA.
In contrast to overexpression of MPT5, addition of a single copy of SSD1-V extends life
span in both SIR2 wild type and sir2 fob] double mutant cells (Figure 2C). However, the
sir2fob] SSD1-V strain has a life span that is shorter than the SIR2 FOB1 SSDI-V strain,
demonstrating that Sir2p is required for maximum longevity in SSDI1-Vcells. This is
consistent with the observation that MPT5 SSDI -V cells have a longer life span than mpt5
SSDI-V cells (Figure 6A), and suggests a model whereby Mpt5p and Sir2p function in
one pathway to increase life span while Ssdlp functions in a parallel pathway (Figure 7).
Mechanism of life span extension by SSDI-V: How is SSD -V acting to extend life
span? The effect of Sir2p on life span is, at least partially, due to its ability to deacetylate
rDNA histones and inhibit ERC formation (KAEBERLEIN et al. 1999). We have
observed no evidence to suggest that SSDI-V affects the rate of ERC formation or
accumulation. Addition of SSD1-Vhad no effect on rDNA recombination (Figure 3A) or
on rDNA silencing (Table 3) in PSY316, and we failed to detect a decrease in ERC levels
in SSDI-V cells relative to ssdl-d cells (Figure 3B). While it is still possible that SSDI-V
affects ERC replication or segregation specifically in aged cells, we feel that this is
unlikely to be the case. An alternative possibility is that SSDI -V makes cells more
resistant to ERCs, rather than reducing ERC levels. In support of this hypothesis, we
often observed that steady-state ERC levels were increased in unsorted SSDI-V cells
relative to wild-type ssdl-d cells (Figure 3B), although this was not always the case. The
mechanism by which ERCs induce senescence is currently unknown. One hypothesis is
that ERCs bind to and titrate key cellular replication or transcription factors away from
166
their normal targets. Alternatively, the rapid amplification of rDNA sequence could alter
rRNA transcription and/or processing, resulting in ribosome dysregulation. Ssdlp has
been shown to bind RNA and is predicted to have RNase activity (UESONO et al. 1997).
Perhaps, SSDI -V somehow alters rRNA or ribosome biogenesis in a manner that makes
cells more resistant to ERCs.
One attractive hypothesis is that SSDI-Vpromotes longevity by increasing cell wall
stability and cell integrity. SSDI-V suppresses several temperature sensitive mutations
that weaken the cell wall (Table 1) and has been found to directly affect cell wall
composition (WHEELER et al. 2003). Furthermore, microarray analysis suggests that
mRNA transcripts coding for cell wall regulatory and biosynthetic proteins are
differentially expressed in SSD1-V cells (Supplemental Table 1). SSD1-V also improves
resistance to the cell wall perturbing agents CFW and SDS (KAEBERLEIN and
GUARENTE 2002), and increases the maximum temperature at which PSY316 is
capable of growth (Figure 1C). Perhaps, the cell wall becomes limiting in very old cells
and SSDI-V extends life span by stabilizing it. How might cell wall stability limit
replicative life span? The terminal phenotype of yeast cells in the life span assay is cell
cycle arrest often accompanied by cell lysis (MCVEY et al. 2002). Enhanced cell wall
stability may prevent cell lysis late in life and allow additional cell divisions to occur.
167
Genetic diversity and the study of aging: The data presented here identify a genetic
polymorphism
that has a profound effect on mother cell life span. Genetic
polymorphisms have also been proposed to affect the likelihood of achieving extreme
longevity in human populations (PUCA et al. 2001), as well as other model systems.
Since both ssdl-d and SSD1-V allele types have been isolated from natural yeast
populations, the SSD1 locus represents a true polymorphic locus affecting longevity. In
the past, researchers studying aging in yeast have tended to avoid using long-lived wild
type backgrounds. We speculate that the majority (if not all) of these shorter lived yeast
strains carry ssdl-d alleles. A comprehensive reevaluation of previously identified
mutations affecting life span in a long-lived SSD1-V background would be of value to the
field.
SSD1-V is a polymorphic locus that confers extreme longevity on yeast mother cells by a
pathway independent of Sir2p. Sir2p has been found to extend life span in animals and,
like SIR2, SSDI homologs are present in yeast, worms, flies, and mammals. Might SSD1
family members also promote longevity outside of yeast? The mechanism by which
SSDI1-V cells achieve up to 85% longer life span is still unknown. Further work should
be devoted to testing candidate longevity genes regulated by SSD1-V and to defining the
molecular function of Ssdlp in cells.
168
REFERENCES
Bryk, M., M. Banerjee, M. Murphy, K. E. Knudsen, D. J. Garfinkel et al., 1997 Transcriptional
silencing of Tyl elements in the RDN1 locus of yeast. Genes Dev 11: 255-269.
Chang, M., D. French-Cornay, H. Y. Fan, H. Klein, C. L. Denis et al., 1999A complex containing
RNA polymerase II, Paflp, Cdc73p, Hprlp, and Ccr4p plays a role in protein kinase C signaling.
Mol Cell Biol 19: 1056-1067.
Chen, T., and J. Kurjan, 1997
Saccharomyces cerevisiae Mpt5p interacts with Sst2p and plays
roles in pheromone sensitivity and recovery from pheromone arrest. Mol Cell Biol 17: 34293439.
Cockell, M., H. Renauld, P. Watt and S. M. Gasser, 1998
Sif2p interacts with Sir4p
amino-terminal domain and antagonizes telomeric silencing in yeast. Curr Biol 8: 787-790.
Costigan, C., S. Gehrung and M. Snyder, 1992 A synthetic lethal screen identifies SLK1, a
novel protein kinase homolog implicated in yeast cell morphogenesis and cell growth. Mol Cell
Biol 12: 1162-1178.
Cvrckova, F., and K. Nasmyth, 1993
Yeast G1 cyclins CLN1 and CLN2 and a GAP-like
protein have a role in bud formation. Embo J 12: 5277-5286.
Defossez, P. A., R. Prusty, M. Kaeberlein, S. J. Lin, P. Ferrigno et al., 1999 Elimination of
replication block protein Fobl extends the life span of yeast mother cells. Mol Cell 3: 447-455.
Doseff, A. I., and K. T. Arndt, 1995
LAS 1 is an essential nuclear protein involved in cell
morphogenesis and cell surface growth. Genetics 141: 857-871.
Du, L. L., and P. Novick, 2002 Paglp, a novel protein associated with protein kinase Cbklp, is
required for cell morphogenesis and proliferation in Saccharomyces cerevisiae. Mol Biol Cell 13:
503-514.
Eisen, M. B., P. T. Spellman, P. 0. Brown and D. Botstein, 1998 Cluster analysis and display of
genome-wide expression patterns. Proc Natl Acad Sci U S A 95: 14863-14868.
Evans, D. R., and M. J. Stark, 1997 Mutations in the Saccharomyces cerevisiae type 2A protein
phosphatase catalytic subunit reveal roles in cell wall integrity, actin cytoskeleton organization
and mitosis. Genetics 145: 227-241.
Fernandez-Sarabia, M. J., A. Sutton, T. Zhong and K. T. Arndt, 1992 SIT4 protein phosphatase is
required for the normal accumulation of SWI4, CLN1, CLN2, and HCS26 RNAs during late G1.
Genes Dev 6: 2417-2428.
Fortes, P., J. Kufel, M. Fornerod, M. Polycarpou-Schwarz, D. Lafontaine et al., 1999 Genetic and
physical interactions involving the yeast nuclear cap- binding complex. Mol Cell Biol 19: 65436553.
169
Gietz, D., A. St Jean, R. A. Woods and R. H. Schiestl, 1992
Improved method for high
efficiency transformation of intact yeast cells. Nucleic Acids Res 20: 1425.
Gottlieb, S., and R. E. Esposito, 1989 A new role for a yeast transcriptional silencer gene, SIR2,
in regulation of recombination in ribosomal DNA. Cell 56: 771-776.
Gottschling, D. E., O. M. Aparicio, B. L. Billington and V. A. Zakian, 1990 Position effect at S.
cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63: 751-762.
Guthrie, C., and G. R. Fink, 1991 Guide to yeast genetics and molecular biology. Methods
Enzymol 194.
Ibeas, J. I., H. Lee, B. Damsz, D. T. Prasad, J. M. Pardo et al., 2000 Fungal cell wall
phosphomannans facilitate the toxic activity of a plant PR-5 protein. Plant J 23: 375-383.
Ibeas, J. I., D. J. Yun, B. Damsz, M. L. Narasimhan, Y. Uesono et al., 2001 Resistance to the
plant PR-5 protein osmotin in the model fungus Saccharomyces cerevisiae is mediated by the
regulatory effects of SSD1 on cell wall composition. Plant J 25: 271-280.
Igual, J. C., A. L. Johnson and L. H. Johnston, 1996
Coordinated regulation of gene
expression by the cell cycle transcription factor Swi4 and the protein kinase C MAP kinase
pathway for yeast cell integrity. Embo J 15: 5001-5013.
Imai, S., C. M. Armstrong, M. Kaeberlein and L. Guarente, 2000 Transcriptional silencing and
longevity protein Sir2 is an NAD- dependent histone deacetylase. Nature 403: 795-800.
Ivy, J. M., A. J. Klar and J. B. Hicks, 1986 Cloning and characterization of four SIR genes of
Saccharomyces cerevisiae. Mol Cell Biol 6: 688-702.
Jacoby, J. J., S. M. Nilius and J. J. Heinisch, 1998 A screen for upstream components of the yeast
protein kinase C signal transduction pathway identifies the product of the SLG1 gene. Mol Gen
Genet 258: 148-155.
Kaeberlein, M., A. A. Andalis, G. R. Fink and L. Guarente, 2002 High osmolarity extends life
span in Saccharomyces cerevisiae by a mechanism related to calorie restriction. Mol Cell Biol 22:
8056-8066.
Kaeberlein, M., and L. Guarente, 2002 Saccharomyces cerevisiae MPT5 and SSD1 function in
parallel pathways to promote cell wall integrity. Genetics 160: 83-95.
Kaeberlein, M., M. McVey and L. Guarente, 1999
The SIR2/3/4 complex and SIR2 alone
promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev 13:
2570-2580.
Kennedy, B. K., 1996 Genetic and Molecular Analysis of Aging in Yeast, pp. 233 in Biology.
Massachusetts Institute of Technology, Boston.
Kennedy, B. K., N. R. Austriaco, Jr., J. Zhang and L. Guarente, 1995 Mutation in the silencing
gene SIR4 can delay aging in S. cerevisiae. Cell 80: 485-496.
170
Kennedy, B. K., M. Gotta, D. A. Sinclair, K. Mills, D. S. McNabb et al., 1997 Redistribution of
silencing proteins from telomeres to the nucleolus is associated with extension of life span in S.
cerevisiae. Cell 89: 381-391.
Kikuchi, Y., Y. Oka, M. Kobayashi, Y. Uesono, A. Toh-e et al., 1994 A new yeast gene, HTR1,
required for growth at high temperature, is needed for recovery from mating pheromone-induced
G1 arrest. Mol Gen Genet 245: 107-116.
Kim, Y. J., L. Francisco, G. C. Chen, E. Marcotte and C. S. Chan, 1994 Control of cellular
morphogenesis by the Ipl 2/Bem2 GTPase-activating protein: possible role of protein
phosphorylation. J Cell Biol 127: 1381-1394.
Kosodo, Y., K. Imai, A. Hirata, Y. Noda, A. Takatsuki et al., 2001
Multicopy suppressors
of the sly 1 temperature-sensitive mutation in the ER-Golgi vesicular transport in Saccharomyces
cerevisiae. Yeast 18: 1003-1014.
Landry, J., A. Sutton, S. T. Tafrov, R. C. Heller, J. Stebbins et al., 2000 The silencing protein
SIR2 and its homologs are NAD-dependent protein deacetylases. Proc Natl Acad Sci U S A 97:
5807-5811.
Li, B., and J. R. Warner, 1998 Genetic interaction between YPT6 and YPT1 in Saccharomyces
cerevisiae. Yeast 14: 915-922.
Lin, S. J., P. A. Defossez and L. Guarente, 2000 Requirement of NAD and SIR2 for life-span
extension by calorie restriction in Saccharomyces cerevisiae. Science 289: 2126-2128.
Lin, S. J., M. Kaeberlein, A. A. Andalis, L. A. Sturtz, P. A. Defossez et al., 2002 Calorie
restriction extends Saccharomyces cerevisiae lifespan by increasing respiration. Nature 418: 344348.
Lorenz, M. C., and J. Heitman, 1998
Regulators of pseudohyphal differentiation in
Saccharomyces cerevisiae identified through multicopy suppressor analysis in ammonium
permease mutant strains. Genetics 150: 1443-1457.
Luukkonen, B. G., and B. Seraphin, 1999 A conditional U5 snRNA mutation affecting premRNA splicing and nuclear pre-mRNA retention identifies SSD1/SRK1 as a general splicing
mutant suppressor. Nucleic Acids Res 27: 3455-3465.
Madden, K., Y. J. Sheu, K. Baetz, B. Andrews and M. Snyder, 1997 SBF cell cycle regulator as a
target of the yeast PKC-MAP kinase pathway. Science 275: 1781-1784.
Martin, H., M. C. Castellanos, R. Cenamor, M. Sanchez, M. Molina et al., 1996 Molecular and
functional characterization of a mutant allele of the mitogen-activated protein-kinase gene
SLT2(MPK1) rescued from yeast autolytic mutants. Curr Genet 29: 516-522.
McDonald, H. B., A. H. Helfant, E. M. Mahony, S. K. Khosla and L. Goetsch, 2002 Mutational
analysis reveals a role for the C terminus of the proteasome subunit Rpt4p in spindle pole body
duplication in Saccharomyces cerevisiae. Genetics 162: 705-720.
171
McVey, M., M. Kaeberlein, H. A. Tissenbaum and L. Guarente, 2001 The short life span of
Saccharomyces cerevisiae sgs 1 and srs2 mutants is a composite of normal aging processes and
mitotic arrest due to defective recombination. Genetics 157: 1531-1542.
Mills, K. D., D. A. Sinclair and L. Guarente, 1999 MEC 1-dependent redistribution of the Sir3
silencing protein from telomeres to DNA double-strand breaks. Cell 97: 609-620.
Moriya, H., and K. Isono, 1999 Analysis of genetic interactions between DHH1, SSD1 and
ELM indicates their involvement in cellular morphology determination in Saccharomyces
cerevisiae. Yeast 15: 481-496.
Park, P. U., P. A. Defossez and L. Guarente, 1999 Effects of mutations in DNA repair genes on
formation of ribosomal DNA circles and life span in Saccharomyces cerevisiae. Mol Cell Biol
19: 3848-3856.
Pelissier, P., N. Camougrand, G. Velours and M. Guerin, 1995 NCA3, a nuclear gene involved in
the mitochondrial expression of subunits 6 and 8 of the Fo-F1 ATP synthase of S. cerevisiae. Curr
Genet 27: 409-416.
Petes, T. D., and D. Botstein, 1977 Simple Mendelian inheritance of the reiterated ribosomal
DNA of yeast. Proc Natl Acad Sci U S A 74: 5091-5095.
Philippsen, P., M. Thomas, R. A. Kramer and R. W. Davis, 1978 Unique arrangement of coding
sequences for 5 S, 5.8 S, 18 S and 25 S ribosomal RNA in Saccharomyces cerevisiae as
determined by R-loop and hybridization analysis. J Mol Biol 123: 387-404.
Puca, A. A., M. J. Daly, S. J. Brewster, T. C. Matise, J. Barrett et al., 2001A genome-wide scan
for linkage to human exceptional longevity identifies a locus on chromosome 4. Proc Natl Acad
Sci U S A 98: 10505-10508.
Rempola, B., A. Kaniak, A. Migdalski, J. Rytka, P. P. Slonimski et al., 2000 Functional analysis
of RRD1 (YIL153w) and RRD2 (YPL152w), which encode two putative activators of the
phosphotyrosyl phosphatase activity of PP2A in Saccharomyces cerevisiae. Mol Gen Genet 262:
1081-1092.
Rine, J., and I. Herskowitz, 1987 Four genes responsible for a position effect on expression from
HML and HMR in Saccharomyces cerevisiae. Genetics 116: 9-22.
Rosenwald, A. G., M. A. Rhodes, H. Van Valkenburgh, V. Palanivel, G. Chapman et al., 2002
ARL1 and membrane traffic in Saccharomyces cerevisiae. Yeast 19: 1039-1056.
Rustchenko, E. P., and F. Sherman, 1994 Physical constitution of ribosomal genes in common
strains of Saccharomyces cerevisiae. Yeast 10: 1157-1171.
Sherman, F., and J. Hicks, 1991 Micromanipulation and dissection of asci. Methods Enzymol
194: 21-37.
Sinclair, D. A., and L. Guarente, 1997 Extrachromosomal rDNA circles--a cause of aging in
yeast. Cell 91: 1033-1042.
172
Smith, A. M., J. E. Archer and F. Solomon, 1998 Regulation of tubulin polypeptides and
microtubule function: Luvlp [correction of Rkilp] interacts with the beta-tubulin binding protein
Rbl2p. Chromosoma 107: 471-478.
Smith, J. S., and J. D. Boeke, 1997
An unusual form of transcriptional silencing in yeast
ribosomal DNA. Genes Dev 11: 241-254.
Smith, J. S., C. B. Brachmann, I. Celic, M. A. Kenna, S. Muhammad et al., 2000 A
phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein
family. Proc Natl Acad Sci U S A 97: 6658-6663.
Stettler, S., N. Chiannilkulchai, S. Hermann-Le Denmat, D. Lalo, F. Lacroute et al., 1993 A
general suppressor of RNA polymerase I, II and III mutations in Saccharomyces cerevisiae. Mol
Gen Genet 239: 169-176.
Strunnikov, A. V., L. Aravind and E. V. Koonin, 2001 Saccharomyces cerevisiae SMT4 encodes
an evolutionarily conserved protease with a role in chromosome condensation regulation.
Genetics 158: 95-107.
Sutton, A., D. Immanuel and K. T. Arndt, 1991 The SIT4 protein phosphatase functions in late
G1 for progression into S phase. Mol Cell Biol 11: 2133-2148.
Tadauchi, T., K. Matsumoto, I. Herskowitz and K. Irie, 2001 Post-transcriptional regulation
through the HO 3'-UTR by Mpt5, a yeast homolog of Pumilio and FBF. Embo J 20: 552-561.
Tissenbaum, H. A., and L. Guarente, 2001 Increased dosage of a sir-2 gene extends lifespan in
Caenorhabditis elegans. Nature 410: 227-230.
Uesono, Y., A. Toh-e and Y. Kikuchi, 1997
with RNA. J Biol Chem 272: 16103-16109.
Ssdlp of Saccharomyces cerevisiae associates
Vannier, D., P. Damay and D. Shore, 2001 A role for Sds3p, a component of the Rpd3p/Sin3p
deacetylase complex, in maintaining cellular integrity in Saccharomyces cerevisiae. Mol Genet
Genomics 265: 560-568.
Watanabe, Y., K. Irie and K. Matsumoto, 1995 Yeast RLM1 encodes a serum response factor-like
protein that may function downstream of the Mpkl (Slt2) mitogen-activated protein kinase
pathway. Mol Cell Biol 15: 5740-5749.
Wheeler, R. T., M. Kupiec, P. Magnelli, C. Abeijon and G. R. Fink, 2003 A Saccharomyces
cerevisiae mutant with increased virulence. Proc Natl Acad Sci U S A 100: 2766-2770.
Wilson, R. B., A. A. Brenner, T. B. White, M. J. Engler, J. P. Gaughran et al., 1991 The
Saccharomyces cerevisiae SRK1 gene, a suppressor of bcyl and ins 1, may be involved in protein
phosphatase function. Mol Cell Biol 11: 3369-3373.
Yashiroda, H., T. Oguchi, Y. Yasuda, E. A. Toh and Y. Kikuchi, 1996 Bull , a new protein that
binds to the Rsp5 ubiquitin ligase in Saccharomyces cerevisiae. Mol Cell Biol 16: 3255-3263.
173
TABLES AND FIGURES
TABLE 1.
Reported genetic interactions with SSDI-V.
Gene
Function
Genetic
Reference
Interaction
ARL1
Membrane trafficking
ts
BCK1
Protein kinase involved in cell wall integrity
ts, other
ROSENWALD et al.
2002
COSTIGAN et al. 1992
BEM2
GTPase activating protein required for
polarized cell growth
Protein that binds ubiquitin ligase.
ts
KIM etal. 1994
ts
YASHIRODA et al.
BULl
CBK1
CCR4
CBC2
Protein kinase involved in cell morphogenesis
Transcriptional regulator of glucose-repressed
and cell wall genes.
Component of cap binding complex.
CDC28
CYR1
sl(mpt5), ts
1996
DU and NOVICK 2002
KAEBERLEIN and
GUARENTE 2002
sl (stol)
FORTES et al. 1999
Cyclin-dependent protein kinase
Adenylate cyclase
ts
ts
SUTTON et al. 1991
CLN1,
CLN2
DHH1
G1 cyclins.
G
ATP-dependent RNA helicase
sl1 (elml)
ELM1
Serine/threonine protein kinase that regulates
sl (dhhl)
pseudohyphal growth
Component of DNA end-joining repair pathway ts
HDF1
JNM1
LAS 1
LUV 1
Protein required for proper nuclear migration
during mitosis.
Essential gene required for bud formation and
morphogenesis.
Protein involved in protein sorting in the late
Golgi
M. Kaeberlein and L.
Guarente, unpublished
CVRCKOVA and
NASMYTH 1993
MORIYA and ISONO
1999
MORIYA and ISONO
1999
M. Kaeberlein and L.
Guarente, unpublished
ts
WILSON et al. 1991
ts
DOSEFF and ARNDT
1995
sl((rbl2)
SMITH et al. 1998
MEP1,
MEP2
Ammonium permeases involved in regulating
pseudohyphal growth
G
LORENZ and
HEITMAN 1998
MPT5
Protein required for high temperature growth
and normal life span
ts, sl(ccr4,
swi4, swi6)
KAEBERLEIN and
GUARENTE 2002
174
Gene
- --
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~------Function
Genetic
Reference
Interaction
PAG1
Protein that functions with Cbklp to regulate
cell morphogenesis
D
DU and NOVICK 2002
PDE2
3',5'-Cyclic-nucleotide phosphodiesterase
misc
WILSON et al. 1991
PPH21,
Catalytic subunits of protein phosphatase 2A.
ts, other
PRP18
U5 snRNA-associated protein
ts
RBL2
Putative tubulin cofactor A
sl(luvl)
EVANS and STARK
1997
LUUKKONEN and
SERAPHIN 1999
SMITH etal. 1998
RLMI1
Transcription factor downstream of MPK
ts
WATANABE et al.
RPC31
RPC53
RPD3
RNA polymerase III
RNA polymerase III
Histone deacetylase component of the Rpd3pSin3p complex
ts
1995
STETTLER etal. 1993
sl(swi6)
STETTLER et al. 1993
VANNIER et al. 2001
PRT4
Proteosome ATPase
ts
MCDONALD et al.
PPH22
2002
RRD 1
RRD2
SDS3
Phosphotyrosyl phosphatase activator
Protein involved in rapamycin sensitivity
Component of the Rpd3p-Sin3p histone
deacetylase complex
sl(rrd2)
sl(swi6)
REMPOLA et al. 2000
REMPOLA et al. 2000
VANNIER et al. 2001
SIN3
Component of the Rpd3p-Sin3p histone
deacetylase complex
sl(swi6)
VANNIER et al. 2001
SIT4
Phosphatase required for GI -S transition.
L
SUTTON et al. 1991
SLG 1
Protein required for maintenance of cell wall
integrity
ts
JACOBY et al. 1998
SLT2
ts
MARTIN etal. 1996
SLY 1
MAP kinase that functions downstream of
BCK1/SLK1
Protein involved in vesicle trafficking
ts
KOSODO et al. 2001
SMC2
Subunit of condensin protein complex
ts
sl(rrdl)
STRUNNIKOV et al.
2001
SMC4
Subunit of condensin protein complex
ts
STRUNNIKOV et al.
SNP1
U1 snRNA-associated protein
ts
2001
LUUKKONEN and
SERAPHIN 1999
STO 1
Component of cap binding complex.
sl(cbc2)
FORTES et al. 1999
SWI4
Cell cycle specific transcription factor.
ts, sl(mpt5)
KAEBERLEIN and
GUARENTE 2002
175
Gene
Function
Genetic
Reference
Interaction
SWI6
Cell cycle specific transcription factor.
ts, sl(mpt5)
U5AI
U5 snRNA
ts
YPT1
GTP-binding protein involved in the secretory
pathway
GTP-binding protein involved in the secretory
pathway
ts
KAEBERLEIN and
GUARENTE 2002
LUUKKONEN and
SERAPHIN 1999
LI and WARNER 1998
ts
LI and WARNER 1998
YPT6
Abbreviations for genetic interactions are as follows: ts = suppresses temperature sensitivity, sl(x)
= suppresses synthetic lethality between given gene and gene x, G = improves growth, L =
suppresses lethality, D = causes death.
176
TABLE 2.
Yeast strains used in this study
Strain
Relevant Genotype
PSY316AR
MATa ADE2::rDNI ade2-101 his3-A200 leu2-3,112 lys2-801
MKY2018
MKY2012
MK2017
MKY2076
MKY2077
MKY2085
MKY2086
MKY2147
MKY2153
MKY2020
MKY2021
MKY2152
MKY2149
MKY2152
MKD202
BKY5
PSY316AR pRS406/URA3
PSY316AR SSDI-V/URA3
PSY316AR SSDI-V/LEU2
PSY316AR ssdl-dA::HIS3
PSY316AR ssdl-dA::HIS3 SSD1-V/LEU2
PSY316AR sir2A::TRP1fobl A::LEU2pRS406/URA3
PSY316AR sir2A::TRP1fob A::LEU2 SSD1-V/URA3
PSY316AR cytlA::kanMX
PSY316AR cytlA::kanMX SSD-V/URA3
PSY316AR mpt5A::LEU2
PSY316AR mpt5A::LEU2 SSD1-V/URA3
PSY316pADH_NCA3
PSY316AR nca3::HIS3
PSY316AR nca3::HIS3 SSD1-V/URA3
PSY316AR a/a sit4::HIS3/SIT4 SSD1-V/URA3
MATa adel-100 his4-519 leu2-3,112 lys2-801 ura3-52 uth4-14c
ura3-52ssdl-d
ssdl-d
MKY3021
BKY5 SSD1-V/URA3
W303R
MKY1324
MATa ADE2::rDNJ his3 leu2 trpl ura3 ssdl-d2 RAD5
W303R mpt5::LEU2
MKY 1332
W303R mpt5::LEU2 SSD1 -V/URA3
MKY183
MKY596
MKY606
MKY580
MKY574
MKY590
W303R sir2::TRPJ
W303RpADH_MPT5
W303R sir2::TRPJ pADHMPT5
W303R rpd3::LEU2
W303R sir2::TRPJ rpd3::URA3
W303R mpt5::LEU2 rpd3::URA3
177
TABLE 3.
Effects of MPT5, SIR2, and SSDI-V on silencing
Genptype
Telomere
Silencing
rDNA
Silencing
4
4
4
1
mpt5A
sir2A
pADHMPT5
pADHMPT5 sir2A
4
4
4
ssdlA
SSDI-V
>
>
>
Stated effects on silencing are relative to silencing in the wild type ssdl-d background. Telomere
and rDNA silencing were measured by color formation using an ADE2 marker integrated into
subtelomeric or ribosomal DNA. In order to detect decreased rDNA silencing relative to wild
type in the sir2A strain, an rpd3A mutation was introduced into the wild type background.
178
Figure 1 - SSD1-V extends life span and improves cell integrity. (A) Life spans were
determined for PSY316 (*), PSY316 SSDI-V (), PSY316 ssdlA::HIS3 (X), and
PSY316 ssdlA::HIS3 SSD1-V (A). Mean life spans and number of cells analyzed were:
PSY316 22.2 (n=40), PSY316 SSDI-V 36.2 (n=40), PSY316 ssdlA::HIS3 21.9 (n=40),
and PSY316 ssdlA::HIS3 SSD1-V 38.0 (40). (B) Life spans were determined for BKY5
(*) and BKY5 SSD1-V (A). Mean life spans and number of cells analyzed were: BKY5
13.0 (n=40) and BKY5 SSDI-V 24.3 (n=40). (C) PSY316 cells are unable to grow at
temperatures greater than 39° unless SSD1-V is present. 10-fold serial dilutions of a log
phase culture plated onto YPD and incubated at either 30 ° or 40° for 48 hours are shown.
179
B.
A.
Generation
Generation
c. ~
180
Figure 2. - SSDI -V and Sir2p act in different pathways to promote longevity. (A) Life
spans were determined for PSY316 (*), PSY316 sir2fob (),
PSY316 0.5% glucose
(A), and PSY316 sir2fobl 0.5% glucose (X). Mean life spans and number of cells
analyzed were: PSY316 22.8 (n=40), PSY316 sir2fobl 21.2 (n=39), PSY316 0.5%
glucose 27.0 (n=40), and PSY316 sir2fobl 0.5% glucose 21.4 (40). (B) Life spans were
determined for PSY316 (*), PSY316 sir2fob
(), PSY316 SSDI-V (A), and PSY316
sir2fobl SSDI-V (X). Mean life spans and number of cells analyzed were: PSY316 22.8
(n=40), PSY316 sir2fobl 21.2 (n=39), PSY316 SSDI-V 37.3 (n=40), and PSY316 sir2
fobl SSDI-V 30.0 (40). (C) Life spans were determined for PSY316 (*), PSY316
SSDI-V (),
PSY316 cyt (),
and PSY316 SSDI-Vcytl (X). Mean life spans and
number of cells analyzed were: PSY316 21.7 (n=40), PSY316 SSDI-V39.3 (n=40),
PSY316 cytl 22.2 (n=40), and PSY316 SSDI-Vcytl
181
37.9 (40).
B.
A.
0.
jII0.
25
III
-
iIs
io0.
0.
50
40
30
20
10
0
Generation
C"
0.8
3 0.6
E 0.4
0.2
0
10
20
30
40
Generation
50
60
70
80
182
0
10
20
40
30
Generation
50
60
70
Figure 3. - SSD1-V does not extend life span by decreasing ERC levels. (A) SSD1-Vhas
no detectable effect on rDNA recombination. rDNA recombination was measured by the
frequency at which an ADE2 marker integrated into the rDNA is lost. A total of 33,000
colonies from 3 independent derived isolates was examined for each strain. (B) DNA
from unsorted cells was isolated and electrophoresed as described (Kaeberlein et al.
1999). The gel was transferred and probed with sequence homologous to the rDNA.
Extrachromosomal rDNA circles (ERCs) are denoted by arrowheads. The dark band
present in both lanes corresponds to genomic rDNA. In this isolate, the long-lived SSDIVcells have a greater steady-state amount of ERCs than ssdl-d cells, as quantitated by
the ratio of ERC DNA to genomic rDNA. However, in one independently derived SSDIV transformant we were unable to detect a significant difference in ERC levels relative to
wild type cells. In no case, did we detect fewer ERCs in SSDI-V cells.
183
A.
B.
2.5
--..
0
0
0
x
.........
>.
u
c:
2
1.5
Q)
:J
rr
Q)
~
u.
(f)
(f)
0
.....J
~
~~
ro 0.5
~
Q)
a
ssdl -d
SSOl -v
"'0
......
I
"'0
en
en
184
>
......
Cl
en
en
I
Figure 4. - Effect of NCA3 cell life span. (A) Life spans were determined for PSY316
(*)
and PSY316 pADH_NCA3 (U). Mean life spans and number of cells analyzed were:
PSY316 23.4 (n=80) and PSY316pADH_NCA3 27.6 (n=120). This figure represents
data pooled from two different experiments. (B) Life spans were determined for PSY316
(*),
PSY316 nca3 (U), PSY316 SSDI-V (A) and PSY316 nca3 SSDI-V(X). Mean life
spans and number of cells analyzed were: PSY316 23.3 (n=40), PSY316 nca3 22.3
(n=40), PSY316 SSD1-V 37.5 (n=40) and PSY316 nca3 SSDI-V 32.8 (n=40).
185
B.
A.
0.8
z
0.6
>
i
.2
2 0.4
0.2
0
0
10
30
20
50
40
Generation
186
10
20
30
Generation
40
50
60
70
Figure 5. - Microarray Analysis of long-lived cells. (A) Gene expression profiles for
long-lived cells were clustered over the 55 most highly expressed genes previously
identified as being regulated by CR (Lin et al. 2002). (B) Identical clustering as in A,
except over all 124 genes regulated by CR. The CR group clusters most closely together
and consists of cells grown on 0.5% glucose or deleted for HXK2. Life span extension by
CR, HAP4-overexpression or 20% glucose is SIR2 -dependent, and these data sets cluster
together on one of the two primary branches. Cells containing a single copy of SSDI -V
cluster separately from the other long-lived cell types. (C) Comparison of the overlap in
co-regulated genes between long-lived cell types. 55/124 genes transcriptionally altered
by CR are similarly altered by overexpression of HAP4. This overlap is statistically
significant (p < 10-4°). 48/124 genes transcriptionally altered by CR are similarly altered
by growth in 20% glucose. This overlap is statistically significant (p < 10-50). 8/124
genes transcriptionally altered by CR are similarly altered by introduction of SSD1-V.
This overlap is not statistically significant (p = 0.1).
187
B.
A.
nR412W
YBR012W-B
SRL3
mH1
E0l23
ERG4
0IS5
Yn089W
YOL003C
SDS3
nR45411
PHO'O
HGG1
YI!L00311
S1iR1
c.
DR525W
DR2.2C
DR290W
YEROO2W
nR44fiW
YUR306C
YHL311C
DL094C
SHU23
HAP4
CR
20% GLU
CR
SSDI-V
CR
CTF4
SOF1
J.lET13
RPL318
KAP122
JmPL28
DR314C
DR543C
YU.062C
SIT 1
YUR3.2W
nR321C
T1511
HXK1
YPLOO5W
YUR3I3C
JRH1
YPLO.IV
DR534C
»!R103C
YGL133V
TFB3
!'US 1
Y.:JL213W
LIF1
}IF t 1LPHJl) 2
SAG1
~1
YER028C
DtR095V
..J HXTl
188
Figure 6. - MPT5 and SIR2 determine longevity in a pathway parallel to SSD1-V. (A)
Life spans were determined for PSY316 (*), PSY316 SSDI-V (U), PSY316 mpt5 (),
and PSY316 mpt5 SSD1-V (X). Mean life spans and number of cells analyzed were:
PSY316 24.3 (n=40), PSY316 SSDI-V35.5
(n=40), PSY316 mpt5 15.3 (n=40), and
PSY316 mpt5 SSDI-V 22.9 (40).
(B) Life spans were determined for W303R (),
W303R pADH_MPT5 (),
W303R
sir2 (A), W303R sir2 pADHMPT5 (X), W303R SIR2/URA3 (*), and W303R
SIR21URA3 pADHMPT5
(0).
This experiment was performed in the W303R strain
background because overexpression of MPT5 from the pADH_MPT5 plasmid causes
slow growth and decreased viability in strain PSY316. Mean life spans and number of
cells analyzed were: W303R 20.9 (n=41), W303RpADHMPT5
25.8 (n=70), W303R
sir2 11.2 (n=41), W303R sir2 pADH_MPT5 10.1 (n=70), W303R SIR2/URA3 27.4
(n=40), and W303R SIR2/URA3 pADH_MPT5 25.8 (n=40).
189
LA
.Z.
3~.
R.
1
0.8
1
0.8
c)
7 0.6
.Lg
- 0.6
S
E! 0.4
i 0.4
O.Z
0.Z
0
N
0
10
20
30
40
Generation
50
60
70
10
30
20
Generation
190
40
50
Figure 7. - Genetic model for Ssdlp as a regulator of longevity.
Ssdlp acts parallel to Sir2p to extend life span. This could involve increasing the cell's
resistance to ERCs or could represent an ERC-independent longevity promoting function.
One likely possibility is that SSDI-Vresults
in an altered cell wall structure that allows
mother cells to achieve extreme old age.
191
Caloric
Restriction
Mpt5p
Sir2p
Ssd p
Cell wall?
ERC
0
Longevity
192
APPENDIX B
Caloric Restriction Extends Yeast Life Span
By Lowering the Level of NADH
This chapter was published in Genes and Development, Volume 18, Issue 1, pages 12-16.
The authors were Su-Ju Lin, Ethan Ford, Marcia Haigis, Gregory Liszt, and Leonard
Guarente. I contributed to the generation of the data presented in Figure 4.
193
SUMMARY
Calorie restriction extends life span in a wide variety of species. Previously, we
showed that calorie restriction increases the replicative life span in yeast by activating
Sir2, a highly conserved NAD-dependent deacetylase. Here we test whether CR
activates Sir2 by increasing the NAD/NADH ratio or by regulating the level of
nicotinamide, a known inhibitor of Sir2. We show that CR decreases NADH levels,
and that NADH is a competitive inhibitor of Sir2. A genetic intervention that
specifically decreases NADH levels increases life span, validating the model that
NADH regulates yeast longevity in response to CR.
194
INTRODUCTION
Calorie restriction (CR) extends life span in a wide spectrum of organisms and for
decades was the only regimen known to promote longevity in mammals (Weindruch and
Walford 1998; Roth et al. 2001). CR has also been shown to delay the onset or reduce the
incidence of many age-related diseases including cancer and diabetes (Weindruch and
Walford 1998; Roth et al. 2001). Although it has been suggested that CR may work by
reducing the levels of reactive oxygen species due to a slowing in metabolism
(Weindruch and Walford 1998), the mechanism by which CR extends life span is still
uncertain. To study the mechanism by which CR extends life span, we established a
model of CR in the budding yeast Saccharomyces cerevisiae. In this system, life span
can be extended by limiting glucose content in the media from 2% to 0.5% or by
reducing the activity of the glucose-sensing cAMP-dependent kinase (PKA) (Lin et al.
2000).
The benefit of CR requires NAD (nicotinamide adenine dinucleotide, oxidized
form) and Sir2 (Lin et al. 2000; Lin et al. 2002), a key regulator of life span in both yeast
and animals (Kaeberlein et al. 1999; Tissenbaum and Guarente 2001). Sir2 is an NAD-
dependent histone deacetylase and is required for chromatin silencing and life span
extension (Imai et al. 2000; Landry et al. 2000; Smith et al. 2000). The requirement of
NAD for Sir2 decaetylase activity suggested CR may activate Sir2 by increasing the
available pool of NAD for Sir2 (Guarente 2000).
Our previous studies suggested that there was a second mechanism to activate
195
Sir2 and extend the life span in yeast - osmotic stress (Kaeberlein and Guarente 2002).
This stress mechanism was genetically distinguishable from CR. Mutations knocking out
electron transport prevented CR from extending life span, but had no effect on the
longevity conferred by osmotic stress (Lin et al. 2002; Kaeberlein and Guarente 2002).
This requirement for electron transport during CR is because of a shunting of carbon
metabolism from fermentation to the mitochondrial TCA cycle. The concomitant increase
in respiration is necessary and sufficient for the activation of Sir2-mediating silencing
and extension in life span (Lin et al. 2002). The fact that respiration produces NAD from
NADH (Bakker et al. 2001), reinforces the idea that changes in the NAD/NADH ratio
regulates Sir2 during CR.
A recent report, however, challenged this model by claiming that both stress and
CR activated Sir2 by a different mechanism, namely by decreasing intracellular levels of
nicotinamide (Anderson et al., 2003), a non-competitive inhibitor of Sir2 (Bitterman et al.
2002). This change in nicotinamide levels was triggered by activation of the PNC1 gene,
encoding a nicotinamidase in the NAD salvage pathway (Ghislain et al. 2002). This gene
was strongly activated by osmotic stress, but to a lesser degree by CR. Also consistent
with this model, PNCI was shown to be required for the extension in life span by CR
(Anderson et al. 2003). The authors conclude that CR reduces nicotinamide levels by upregulating PNC1, and this reduction activates Sir2 and extends the life span.
In this report we attempt to determine whether changes in nicotinamide, the
NAD/NADH ratio, or both up-regulate Sir2 during CR. We show that NADH is a
196
competitive inhibitor of Sir2, and that CR reduces the level of NADH in cells. These
findings provide a simple model for activation of Sir2 and extension of the life span by
CR, which we further support by genetic experiments.
RESULTS AND DISCUSSION
To study whether CR activates Sir2 by increasing the NAD/NADH ratio, we first
measured the NAD and NADH levels in cells grown in 2% and 0.5% glucose (CR).
Surprisingly, the NAD levels in cells under CR were not changed (Fig. 1A), whereas the
NADH levels were decreased to 50% of non-CR cells, (Fig. B). To validate the efficacy
and sensitivity of our assay, we measured the NAD levels of the nptlA mutant. It has
been shown that cells lacking the NPT1 gene (encoding nicotinic acid phosphoribosyl
transferase in the NAD salvage pathway) exhibit a 40% to 60% decrease in NAD levels
(Smith et al. 2000; Anderson et al. 2002). Consistent with previous reports (Smith et al.
2000; Anderson et al. 2002), we detected a similar decrease in the NAD levels in nptlA
mutants. As a further test, we measured NAD and NADH levels in cells that overexpress the transcription factor Hap4, which activates nuclear genes encoding
mitochondrial proteins (Forsburg and Guarente 1989; de Winde and Grivell 1993). This
manipulation was shown to extend life span in a Sir2 dependent manner (Lin et al. 2002).
Similar to CR, Hap4 over-expression causes a switch of metabolism from fermentation
toward respiration (Blom et al. 2000) and, as shown in Fig. B, triggered a 50% decrease
in NADH levels without altering NAD concentration (Fig. A). Since respiration is
required for life span extension in CR, we tested whether a functional electron transport
chain is required for the decrease in NADH levels. As shown in Fig. D, deleting the
197
CYTI gene, which encodes the cytochrome c , abolished the decrease in NADH levels
induced by CR. All these studies suggest that CR increases the intracellular NAD/NADH
ratio by up-regulating respiration thereby decreasing NADH levels. We also measured
NAD and NADH levels in a sir2A mutant grown in 2% and 0.5% glucose. The sir2A
mutant exhibited the normal reduction in NADH levels in response to CR (shown in Fig.
1C, D), indicating that it functions downstream of the metabolic changes.
Since NADH levels responded to CR but NAD levels did not, it seemed possible
that NADH, and not NAD, regulated Sir2, perhaps by inhibiting its activity. To test this
hypothesis, we measured activity of Sir2 in the presence of various concentrations of
NADH using purified recombinant GST-tagged Sir2 proteins. Sir2 activity was
determined by quantitating the NAD-dependent deacetylation of histone H4 peptides
labeled with [3 H]-acetyl coenzyme A (Armstrong et al. 2002). If NADH is indeed a
competitive inhibitor of Sir2 activity, the presence of NADH should increase the apparent
KM(the Michaelis-Menten binding constant) of Sir2 for NAD without affecting the Vmax
(maximum velocity) (Stryer 1995). Kinetic analysis with a wide range of substrate
(NAD) concentrations is shown as a Lineweaver-Burk double reciprocal plot (Fig. 2A).
This analysis estimates the KM(Fig. 2A, X intercept) of Sir2 to be 30 yM, consistent with
previous report (Imai et al. 2000; Tanner et al. 2000). As NADH concentrations were
stepped up, the apparent KMfor NAD was increased, reaching an increase of 3 fold at 250
FM NADH.
The Vmax(Fig. 2A, Y intercept) of Sir2 activity was not significantly
changed in the presence of NADH. These data suggest NADH functions as a competitive
198
inhibitor of Sir2. As shown in Fig. 2B, NADH also competitively inhibited the human
SIRT1. In the presence of 300 FM NADH, the KMof SIRT1 increased 3 fold.
Intracellular concentrations of total NAD plus NADH of about 1mM have been
reported (de Koning and van Dam 1992; Richard et al. 1993). We have calculated values
for NAD and NADH from the data in Fig 1, assuming a yeast cell size of 70 mm3
(Guthrie and Fink 2002). Table 1 shows our values and those of other recent reports.
The data are in reasonable agreement with the previous reports and with each other, and
small differences may by partly due to different estimates of cell size. The concentration
of free NADH in cells must be less than the values in Table 1, and appears to be in a
sensitive range to regulate Sir2 activity.
We sought genetic data to support the idea that the increase in the NAD/NADH
ratio is what extends life span in CR. During respiratory growth, both cytosolic and
mitochondrial NADH are re-oxidized, in part by the NADH dehydrogenases in the
respiratory chain (Bakker et al. 2001). To determine whether yeast life span could be
extended by simply activating NADH dehydrogenase, we over-expressed two related
mitochondrial NADH dehydrogenases, Ndel and Nde2 (Luttik et al. 1998). Similar to
CR, over-expressing Ndel and Nde2 significantly decreased the NADH levels without
changing the NAD levels (Fig. 3A). Moreover, cells over-expressing Ndel and Nde2
exhibited a longer life span on 2% glucose to a degree similar to cells grown on 0.5%
glucose (Fig. 3B). Further, 0.5% glucose did not extend the life span of cells overexpressing the NADH dehydrogenases (Fig. 3B), suggesting that CR and the NADH
199
dehydrogenases function in the same pathway, i.e. to decrease NADH levels and extend
the life span.
Our findings appear to challenge the claim that the Pncl nicotinamidase triggers
the life span extension in CR (Anderson et al. 2003). To address this paradox, we first
repeated life span analysis of the pnclA mutants on 2% and 0.5% glucose. Consistent
with the previous report, the pnclA mutation largely prevented the life span extension by
0.5% glucose (at best a 10-15% increase) (Fig. 4A) when compared with wild type cells
(~30% increase) (Fig. 4B). Since the above data indicated that CR functions by
decreasing NADH, we surmised that hyper-accumulation of nicotinamide in the pnclA
mutants might mask regulation by NADH. Nntl, a putative nicotinamide methyl
transferase, appears to modify nicotinamide in yeast (Anderson et al. 2003). Thus, we
over expressed Nntl to reduce nicotinamide levels in the pnclA mutant. Strikingly, overexpressing Nntl restored the ability of CR to extend life span (30%) in pnclA mutants
(Fig. 4B). These data show that the reduction in NADH can activate Sir2 and give a full
extension of the life span in a pnclA mutant, as long as the excess nicotinamide is
depleted. This result shows that PNCI, the NAD salvage pathway, and glucosedependent changes in nicotinamide levels are not required for the extension of life span
by CR.
Our studies show that a switch to oxidative metabolism during CR increases the
NAD/NADH ratio by decreasing NADH levels. NADH is a competitive inhibitor of
Sir2, implying that a reduction in this dinucleotide activates Sir2 to extend the life span in
200
CR. Indeed, over-expression of the NADH dehydrogenase specifically lowers NADH
levels and extends the life span, providing strong support for this hypothesis. Regulation
of the life span by NADH is also consistent with the earlier finding that electron transport
is required for longevity during CR (Lin et al., 2002). The NAD/NADH ratio reflects
the intracellular redox state and is a read out of metabolic activity. Our findings suggest
that this ratio can serve a critical regulatory function, namely the determination of the life
span of yeast mother cells. It remains to be seen whether this ratio will serve related
regulatory functions in higher organisms.
MATERIALS AND METHODS
Yeast strain PSY316 MATa ura3-52 leu2-3, 112 his3-A200 ade2-101 lys2-801
RDN1.::ADE2has been previously described (Park et al. 1999). Rich media YPD and
synthetic media were made as described (Sherman et al. 1978). The ADHI -driven
integrating ppp35 (URA3) vector is a derivative of ppp81 (LEU2) vector (Lin et al. 2002)
made by Peter Park. Over-expression constructs of Ndel1, Nde2 and Nntl were made as
described previously (Lin et al. 2002) using ppp81 (Ndel) or ppp35 (Nde2 and Nntl). All
constructs made for this study were verified by sequencing. The yeast Sir2 expression
construct pGEX-SIR2 was a gift from J. Tanny and D. Moazed at Harvard Medical School
(Tanny et al. 1999). The human SIRT1 expression construct pGEX-GST-hSIRTl was a gift
from F. Ishikawa at Tokyo Institute of Technology, Japan (Takata and Ishikawa 2003). All
gene deletions in this study were done by replacing the wild type genes with the Kanr marker
as described in (Guldener et al. 1996) and verified by Polymerase Chain Reaction (PCR)
using oligonucleotides flanking the genes of interest.
201
Life span analyses were carried out as previously described (Lin et al. 2000). All life
span analyses in this study were carried out on YPD plates at least twice independently with
more than 45 cells per strain per experiment. Results from a single experiment are shown.
Yeast GST-Sir2 and human GST-SIRT1 fusion proteins were made using the T7
expression system as previously described (Ford and Hernandez 1997) with the following
modifications. pGEX-SIR2 and pGEX-GST-hSIRTl were transformed into the E. coli
strain BL21(DE3) Codon-Plus-RIL (Stratagene) and BL21(DE3) respectively. In
addition, the procedure for yeast GST-Sir2 was scaled up to a 10 liter culture and 5 ml of
glutathione-agarose resin. The purified protein was concentrated on a Centriprep-30
(Amacon) column.
The deacetylation assay was carried out as described previously (Armstrong et al.
2002). In brief, histone deacetylase activity was measured using a peptide corresponding to
the N-terminal tail of the histone H4 (Upstate Biotechnology) labeled with tritiated Acetyl
Coenzyme A (PerkinElmer). Reactions were carried out in 50 yl buffer containing 50 mM
Tris-HCl, pH 8, 4 mM MgCl 2, 0.2 mM DTT and a variable concentration of NAD and
NADH at 30°C for 2.5 hours (yeast Sir2) or 37°C for 2 hours (human SIRT1).
Measurement of the NAD and NADH nucleotides were performed as described
previously (Lin et al. 2001) with a few modifications. In brief, cells were grown to an
OD6 00 of 0.5 then 107 cells were harvested in duplicates by centrifugation in 2 x 1.5 ml
tubes. Acid extraction was performed in one tube to obtain NAD and alkali extraction
was performed in the other to obtain NADH. 2 l of neutralized cell extract (105 cells)
was used for enzymatic cycling reaction as previously described (Lin et al. 2001). The
concentration of nucleotides was measured fluorometrically with excitation at 365 nm
202
and emission monitored at 460 nm. Standard curves for determining NAD and NADH
concentrations were obtained as follows: NAD and NADH were added into the acid and
alkali buffer to a final concentration of 0 pM, 2.5 pM, 5 pM, 7.5 yM which were then
treated with the same procedure along with other samples. The fluorometer was
calibrated each time before use with 0 FM, 5 FM, 10 uM, 20 pM, 30 pM and 40 pM
NADH to ensure the detection was within a linear range.
Acknowledgment
We thank members of the Guarente laboratory for discussions; J. Gordon for
advice with the NAD nucleotide measurements; J. Tanny and D. Moazed for the
yeast Sir2 expression construct and discussions; F. Ishikawa for the human SIRT1
expression construct. Supported by NIH, the Ellison Medical Foundation, the
Seaver Institute, and the Howard and Linda Stern Fund (LG); Individual National
Research Service Award (S.-J. L., E. F., M. H.).
203
REFERENCES
Anderson, R.M., K.J. Bitterman, J.G. Wood, O. Medvedik, H. Cohen, S.S. Lin, J.K. Manchester,
J.I. Gordon, and D.A. Sinclair. 2002. Manipulation of a nuclear NAD+ salvage pathway
delays aging without altering steady-state NAD+ levels. J Biol Chem 277: 18881-90.
Anderson, R.M., K.J. Bitterman, J.G. Wood, O. Medvedik, and D.A. Sinclair. 2003.
Nicotinamide and PNC1 govern lifespan extension by calorie restriction in
Saccharomyces cerevisiae. Nature 423: 181-5.
Armstrong, C.M., M. Kaeberlein, S.I. Imai, and L. Guarente. 2002. Mutations in Saccharomyces
cerevisiae gene SIR2 can have differential effects on in vivo silencing phenotypes and in
vitro histone deacetylation activity. Mol Biol Cell 13: 1427-38.
Bakker, B.M., K.M. Overkamp, A.J. van Maris, P. Kotter, M.A. Luttik, J.P. van Dijken, and J.T.
Pronk. 2001. Stoichiometry and compartmentation of NADH metabolism in
Saccharomyces cerevisiae. FEMS Microbiol Rev 25: 15-37.
Bitterman, K.J., R.M. Anderson, H.Y. Cohen, M. Latorre-Esteves, and D.A. Sinclair. 2002.
Inhibition of silencing and accelerated aging by nicotinamide, a putative negative
regulator of yeast Sir2 and human SIRT1. J Biol Chem 23: 23.
Blom, J., M.J. De Mattos, and L.A. Grivell. 2000. Redirection of the respiro-fermentative flux
distribution in Saccharomyces cerevisiae by overexpression of the transcription factor
Hap4p. Appl Environ Microbiol 66: 1970-3.
de Koning and K. van Dam. 1992. A method for the determination of changes of glycolytic
metabolites in yeast on a subsecond time scale using extraction at neutral pH. Anal
Biochem 204:118-23
de Winde, J.H. and L.A. Grivell. 1993. Global regulation of mitochondrial biogenesis in
Saccharomyces cerevisiae. Prog Nucleic Acid Res Mol Biol 46: 51-91.
Ford, E. and N. Hernandez. 1997. Characterization of a trimeric complex containing Oct-1,
SNAPc, and DNA. JBiol Chem 272: 16048-55.
Forsburg, S.L. and L. Guarente. 1989. Identification and characterization of HAP4: a third
component of the CCAAT-bound HAP2/HAP3 heteromer. Genes Dev 3:1166-78.
Fulco, M., R.L. Schiltz, S. ezzi, M.T. King, P. Zhao, Y. Kashiwaya, E. Hoffman, R.L. Veech,
and V. Sartorelli. 2003. Sir2 regulates skeletal muscle differentiation as a potential sensor
of the redox state. Mol Cell 12: 51-62.
204
Ghislain, M., E. Talla, and J.M. Francois. 2002. Identification and functional analysis of the
Saccharomyces cerevisiae nicotinamidase gene, PNC1. Yeast 19: 215-24.
Guarente, L. 2000. Sir2 links chromatin silencing, metabolism, and aging. Genes Dev 14: 1021-6.
Guldener, U., S. Heck, T. Fielder, J. Beinhauer, and J.H. Hegemann. 1996. A new efficient gene
disruption cassette for repeated use in budding yeast. Nucleic Acids Res 24: 2519-24.
Guthrie, C. and G.R. Fink. 2002. Guide to Yeast Genetics and Molecular and Cellular Biology. In
Methods in Enzymology. Academic Press.
Imai, S., C.M. Armstrong, M. Kaeberlein, and L. Guarente. 2000. Transcriptional silencing and
longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403: 795-800.
Kaeberlein, M., M. McVey, and L. Guarente. 1999. The SIR2/3/4 complex and SIR2 alone
promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev
13: 2570-80.
Kaeberlein, M., A.A. Andalis, G.R. Fink, and L. Guarente. 2002. High osmolarity extends life
span in Saccharomyces cerevisiae by a mechanism related to calorie restriction. Mol Cell
Biol 22: 8056-66.
Landry, J., A. Sutton, S.T. Tafrov, R.C. Heller, J. Stebbins, L. Pillus, and R. Sternglanz. 2000.
The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases.
Proc Natl Acad Sci U S A 97: 5807-11.
Lin, S.-J., M. Kaeberlein, A.A. Andalis, L.A. Sturtz, P.-A. Defossez, V.C. Culotta, G.R. Fink, and
L. Guarente. 2002. Calorie restriction extends life span by shifting carbon toward
respiration. Nature 418: 344-8.
Lin, S.J., P.A. Defossez, and L. Guarente. 2000. Requirement of NAD and SIR2 for life-span
extension by calorie restriction in Saccharomyces cerevisiae. Science 289: 2126-8.
Lin, S.J. and L. Guarente. 2003. Nicotinamide adenine dinucleotide, a metabolic regulator of
transcription, longevity and disease. Curr Opin Cell Biol 15: 241-6.
Lin, S.S., J.K. Manchester, and J.I. Gordon. 2001. Enhanced gluconeogenesis and increased
energy storage as hallmarks of aging in Saccharomyces cerevisiae. J Biol Chem 276:
36000-7.
Luttik, M.A., K.M. Overkamp, P. Kotter, S. de Vries, J.P. van Dijken, and J.T. Pronk. 1998. The
Saccharomyces cerevisiae NDE1 and NDE2 genes encode separate mitochondrial NADH
dehydrogenases catalyzing the oxidation of cytosolic NADH. J Biol Chem 273: 2452934.
205
Park, P.U., P.A. Defossez, and L. Guarente. 1999. Effects of mutations in DNA repair genes on
formation of ribosomal DNA circles and life span in Saccharomyces cerevisiae. Mol Cell
Biol 19: 3848-56.
Richard, P., B. Teusink, H.V. Westerhoff, and K. van Dam. 1993. Around the growth phase
transition S. cerevisiae's make-up favours sustained oscillations of intracellular
metabolites. FEBS Lett 318: 80-2
Roth, G.S., D.K. Ingram, and M.A. Lane. 2001. Caloric restriction in primates and relevance to
humans. Ann N YAcad Sci 928: 305-15.
Rutter, J., M. Reick, L.C. Wu, and S.L. McKnight. 2001. Regulation of clock and NPAS2 DNA
binding by the redox state of NAD cofactors. Science 293: 510-4.
Sherman, F., G.R. Fink, and C.W. Lawrence. 1978. Methods in Yeast Genetics. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
Smith, J.S., C.B. Brachmann, I. Celic, M.A. Kenna, S. Muhammad, V.J. Starai, J.L. Avalos, J.C.
Escalante-Semerena, C. Grubmeyer, C. Wolberger, and J.D. Boeke. 2000. A
phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2
protein family. Proc Natl Acad Sci U S A 97: 6658-63.
Stryer, L. 1995. Biochemistry. W. H. Freeman and Company, New York.
Takata, T. and F. Ishikawa. 2003. Human Sir2-related protein SIRT1 associates with the bHLH
repressors HES 1 and HEY2 and is involved in HES 1- and HEY2-mediated
transcriptional repression. Biochem Biophys Res Commun 301: 250-7.
Tanner, K.G., J. Landry, R. Sternglanz, and J.M. Denu. 2000. Silent information regulator 2
family of NAD- dependent histone/protein deacetylases generates a unique product, 1-Oacetyl-ADP-ribose. Proc Natl Acad Sci U S A 97: 14178-82.
Tanny, J.C., G.J. Dowd, J. Huang, H. Hilz, and D. Moazed. 1999. An enzymatic activity in the
yeast Sir2 protein that is essential for gene silencing. Cell 99: 735-45.
Tissenbaum, H.A. and L. Guarente. 2001. Increased dosage of a sir-2 gene extends lifespan in
Caenorhabditis elegans. Nature 410: 227-30.
Weindruch, W. and R.L. Walford. 1998. The retardation of aging and diseases by dietary
restriction. Charles C. Thomas, Springfield, Illinois, USA.
Zhang, Q., D.W. Piston, and R.H. Goodman. 2002. Regulation of corepressor function by nuclear
NADH. Science 295: 1895-7.
206
TABLES AND FIGURES
Table 1: Intracellular concentrations of NAD and NADH.
Normal condition (mM)
NAD
NADH
Calorie restriction (mM)
NAD/NADH
ratio
NAD
NADH
NAD/NADH
ratio
2.14 a*
1.14
-
2-3
-
2C
0.78
1.26 0.0 6 d
0.85 0.13
a Reported unit was
b
1.14~~~~~~~~~~~~~~~~~~~b*
~Ashrafi
-
2-3
Smith et al
2000
etal
2000
Lin et al
2001
-
2.56
1.48
References
-
1.19 0.08
0.39 0.11
-
Anderson et
al 2002
3.05
This study
1.5x10-4 pmole/cell.
Reported unit was about 80 amole/cell.
c Reported units were 23.7 amole/pg protein and 9.3 amole/pg protein for NAD and NADH
respectively.
*We converted reported units (a to c) into mM (per cell) assuming a yeast cell size of 70 femtoliter
(70 jum3) and the total protein of 6 pg/cell (Guthrie and Fink 2002).
d Numbers show mean ±+standard deviations derived from data shown in Fig 1.
207
Figure 1. Calorie restriction decreases intracellular NADH levels. Measurements of intracellular
levels of NAD (A and C) and NADH (B and D) in various yeast strains grown in 2% or 0.5%
glucose. Results show average of 3 independent experiments each conducted in duplicates. Error
bars denote standard deviations. NAD and NADH levels are shown as (pM/p,g): levels of NAD or
NADH (PM) normalized to the concentrations of proteins from the extracts (pg) present in the
reaction. Reactions contain cell extracts from 105 cells. WT, wild type yeast strain PSY316;
+Hap4-oe: wild type cells over-expressing Hap4; 2%: cells grown in 2% glucose; 0.5%: cells
grown in 0.5% glucose. nptl~, cytl ~ and sir2~hmr 1~ are isogenic derivatives of PSY316.
B
A
0.75
i
0.5
C)
:::L
..-.
T
..-.
J.
0
'#
1
9
c.
~
co
:c
D
T
T
T
T
T T
T
T
T
T
It)
..-.
i
0.5 .
~
CD
9
Xca
:c
+
1
C)
C)
:::L
"'-'
0.75
T
0.5
::J:
C
«
Z
,.
0
~
.
0.75 . 1
0.25
'#
C'l
+
T
-
:::L
"'-'
0.5
CD
~
i
~
:::L
"'-'
«
Z
C'l
..-.
0.75
C
C 0.25
C
C)
::J:
"'-'
«
Z
Lin_Figure 1
1
1
0.25
-
0
-
C
«
Z
T
T
T
""'I'"
.
'#
C'l
~
#It)
0
~
. '#.
#C'l
It)
0
#C'l
.
'#
1I?~C'l
#-
.'#
II?
<f~o
~ o
... <f
... & <f~-~<f
-OJe~& .c: .c:e
~
~
~
208
0.25
0
#-
iP-
It)~C'l
II?
. <f~o
~.-. <f
_OJe'O)~
.c:
e
u
.c:
Figure 2. NADH inhibits Sir2 NAD-dependent histone deacetylase activity. (A) Kinetic analysis
of the Sir2 NAD-dependent histone deacetylase activities in the presence of 0 /M (),
50 AM
(2), 100 pM () or 250 pM (O) NADH. 150 ng of recombinant GST-tagged yeast Sir2 protein
was assayed with various concentrations of NAD and NADH at 30°C for 2.5 hrs. Data are shown
as a Lineweaver-Burk double reciprocal plot of 1/V (CPM/hr) versus 1/[NAD] (M). Results
show average of three independent experiments each measured in duplicates. (B) Kinetic analysis
of the human SIRT1 NAD-dependent histone deacetylase activities in the presence of 0 PM (U),
50 pM (01), 150 FM ()
or 300 pM (O) NADH. Experiments were carried out as in (A), except
that 50 ng of recombinant GST-tagged human SIRT1 protein (Takata and Ishikawa 2003) was
used and reaction was carried out at 37°C for 2 hrs.
B
A
LinFigure 2
C
O
D
:I
0
1/[NAD] (M)
1/[NAD] (M)
209
Figure 3. Over-expressing NADH dehydrogenase increases the intracellular NAD/NADH ratio
and life span. (A) Measurements of NADH (closed bars, left panel) and NAD (open bars, right
panel) levels in cells over-expressing Ndel and Nde2. Results show average of 4 independent
experiments each conducted in duplicates. Error bars denote standard deviations. (B) Life span
analysis of cells over expressing Ndel and Nde2 grown in 2% and 0.5% glucose. Average life
spans on 2% glucose: +vectors, 19.4; +Ndel-oe, +Nde2-oe: 27.2. Average life spans on 0.5%
glucose: +vectors, 25.8; +Ndel-oe, +Nde2-oe: 27.1. + vectors: cells carrying control vectors
ppp35 and ppp81; +Ndel-oe, +Nde2-oe: cells over-expressing Ndel and Nde2.
A
Lin_Figure 3
1
1
.-.
.-.
~
~
en 0.7
~
en
1
1
0.7
:L
0.5
"'-'
:t:
C
c(
Z
C
c(
Z 0.2
0.2
0
+vectors +Ndel-oe
+Nde2-oe
+vectors +Nde1-oe
+Nde2-oe
B
___
.!l.
+vectors, .2%
-0- +vectors, 0.5%
-e-- +Ndel-oe,
Nde2-oe,2%
--cr- +Ndel-oe,
Nde2-oe, 0.5%
1
Gi
()
.!0.7
.a
.!
>
....o
c
o
;:
g 0.2
a-
U.
.,..
Generations
210
Figure 4. Calorie restriction in pnclA mutants. (A) Calorie restriction slightly extends life span
in a pnclA mutant. (B) Over-expressing Nntl restores the full life span extension by calorie
restriction in a pnclA mutant. Average life spans on 2% glucose: pnclA + vector, 20.9; WT +
vector, 20.16; Apncl+Nntl-oe,
21.6. Average life spans on 0.5% glucose: pnclA + vector 23.9;
WT + vector, 27.3; pnclA +Nntl-oe, 28. WT: wild type PSY316 cells; + vector: cells carrying a
control vector ppp35; + Nntl -oe: cells over-expressing Nntl. pnclA was derived from PSY316.
LinFigure 4
~~~~~A
A0
0
3
ao
a-
.1
0
a-
U.
0
10
20
30
40
50
Generations
B
0
', 2%
0
e,0.5%
0
0
eAs
a
c
U
W
i)
IL
0
10
20
30
40
Generations
211
50
APPENDIX
C
The Mammalian Sir2 Protein SIRT7 is an
Activator of RNA Polymerase I
Transcription
This chapter has been submitted for publication. The authors are Ethan Ford, Renate
Voit, Gregory Liszt and Leonard Guarente. My contributions include Figure 1 and
Supplemental Figure S 1, as well as contributing to the writing of the paper.
212
SUMMARY
The yeast silent information regulator Sir2 is a highly conserved NAD*dependent protein deacetylase. Here, we show that one mammalian homolog, SIRT7, is
preferentially localized in nucleoli, where it is associated with the coding regions of the
rRNA genes (rDNA). SIRT7 interacts with RNA polymerase I (Pol I) as well as with
histones. Overexpression of SIRT7 upregulates Pol I transcription, whereas knock-down
of SIRT7 via siRNAs decreases Pol I transcription. SIRT7 increases the amount of Pol I
at the coding region of the rDNA. Our results establish SIRT7 as a novel activating
component of the mammalian Pol I transcription apparatus.
213
RESULTS AND DISCUSSION
RNA polymerase I (Pol I) is the most efficient of the mammalian RNA polymerases,
accounting for up to 65% of total transcription in metabolically active mammalian cells
(Grummt, 2003). To attain this high level of ribosomal RNA (rRNA) synthesis, the
ribosomal DNA (rDNA) comprises approximately 200 tandemly repeated rRNA genes.
Each of the 43 kb gene repeats encodes a single rRNA precursor transcript that is later
cleaved and processed into the mature 18S, 28S, and 5.8S rRNAs. Intergenic spacer
regions (IGS) separate adjacent transcribed rDNA sequences. In all eukaryotes Pol I
transcription is highly coordinated with cellular metabolism and cell proliferation
(Grummt, 1999). Nutrient starvation, aging, growth factor deprivation, DNA damage,
and other conditions that slow down cellular division cause a dramatic decrease in prerRNA synthesis (Grummt, 2003). Along these lines, the tumor suppressors pRb and p53
downregulate Pol I transcription (Budde and Grummt, 1999; Cavanaugh et al., 1995; Voit
et al., 1997; Zhai and Comai, 2000). Likewise, conditions that stimulate cellular division
increase pre-rRNA synthesis (Zhao et al., 2003).
The Sir2 family of enzymes, termed sirtuins, is conserved from bacteria to
humans and regulates a wide range of processes including gene silencing, aging, cellular
differentiation, and metabolism (Blander and Guarente, 2004).
Sirtuins contain a
conserved catalytic core domain flanked by divergent amino- and carboxy-terminal
regions (Frye, 2000). The catalytic domain confers NAD*-dependentprotein deacetylase
as well as ADP-ribosyltransferase activity. The mammalian genome encodes seven
homologs of the yeast SIR2 gene, termed SIRT1-7 (Frye, 2000).
214
While several
physiologically significant SIRT1 substrates have been identified including p53 (Luo et
al., 2001; Vaziri et al., 2001), MyoD (Fulco et al., 2003), FOXO3 (Brunet et al., 2004;
Motta et al., 2004), PPARy (Picard et al., 2004), and NF-kB (Yeung et al., 2004), little is
known about the biological functions of the other mammalian sirtuins. SIRT2 is a
cytoplasmic protein and catalyzes together with HDAC6 the deacetylation of tubulin
(North et al., 2003), whereas so far no target has been identified for SIRT3, which is
located in mitochondria (Onyango et al., 2002).
To begin to address the function of SIRT7, the expression pattern of SIRT7 was
investigated by Northern and Western blot analysis using mRNA and cell extracts
derived from eight different adult mouse tissues. Antibodies were raised against the Nterminus of mSIRT7, which is not conserved in SIRT1-6. These antibodies recognized
one single polypeptide of 45 kD in nuclear extracts, but not in cytoplasmic fractions of
mouse and human cells (Fig. A). SIRT7 mRNA was detected in each sample except
skeletal muscle, and showed highest levels in the liver (Fig. B). In addition, SIRT7
mRNAs were readily detectable in samples taken from different mouse embryonic stages
between day E7 and day E17. SIRT7 protein was also broadly expressed except in heart
and muscle (Fig. 1C).
Next, we investigated the subcellular localization of human SIRT7 using GFPtagged proteins and indirect immunofluorescence.
SIRT7-GFP was located almost
exclusively in nucleoli (Fig. D). Moreover, the SIRT7-specific antibodies detected
endogenous SIRT7 within distinct nuclear foci, which were co-stained with antibodies
against Pol I and therefore represent nucleoli (Fig. E). Nucleolar localization was
observed throughout interphase. During M-phase, when nucleoli dissolve, SIRT7 was
215
not retained at the Nucleolus Organizer Region (NOR), but distributed over the entire
condensed chromatin (Fig. F).
The nucleolar localization raised the possibility that SIRT7 is associated with
rDNA. We investigated this by chromatin immunoprecipitation (ChIP). Crosslinked
chromatin from 293T cells was immunoprecipitated with anti-SIRT7 antibodies, and
precipitated DNA was analyzed by PCR using four primer sets that amplify specific
regions of the 43 kb human rDNA repeat except for primer set H23/H27 which
recognizes a repeat in the intergenic spacer (IGS) region. (Fig. 2A). ChIP-PCR revealed
that anti-SIRT7 antibodies specifically precipitated rDNA when tested with primer sets
that amplify two parts of the transcribed region (HI and H13) and the promoter sequence
(H0) (Fig. 2B top). No signal above the IgG control was observed with the H23/H27
primer set that amplifies sequences in the IGS, demonstrating the specificity of the
interaction of SIRT7 with the transcribed region of the rDNA. The distribution of SIRT7
on rDNA was almost identical to that of Pol I, viewed by precipitation with anti-RPA 16
antibodies, which recognize the second largest subunit of Pol I (Fig. 2B middle). As
expected, acetylated histone H4 was present across the entire rDNA repeat including the
IGS (Fig. 2B bottom).
Since SIRT7 and Pol I were detected at the same rDNA regions, we next tested
whether the two proteins interact. Lysates from 293T cells overexpressing FLAG-tagged
SIRT7 or mock-transfected 293T cells were immunoprecipitated with anti-FLAG (M2)
antibodies, and co-precipitation of Pol I was analyzed by Western blot with RPA1 16
antibodies. While equal amounts of RPA1 16 were present in both cell lysates, it was
only detected in immunoprecipitates from cells expressing FLAG-tagged SIRT7 (Fig.
216
2C).
Simmalarly, RNA polymerase I remains associated with SIRT7 after tandem
affinity purification (TAP)(Fig. 2D). We next tested whether SIRT7 and Pol I interact in
vivo at their endogenous levels. Antibodies against Pol I, but not control antibodies, coimmunoprecipitated endogenous SIRT7 along with Pol I from a partially purified mouse
nuclear extract (Fig. 2E). Thus, SIRT7 and Pol I associate in vivo at the rDNA.
Interestingly, like the yeast SIR protein complex, SIRT7 fused to GST also interacts with
histones isolated from HeLa cells in vitro (Fig. 2F).
To test whether SIRT7 modulates Pol I transcription, a human rDNA minigene
reporter (Voit et al., 1999) and an expression plasmid for FLAG-tagged SIRT7 were cotransfected into human 293T cells. Transcripts derived from the rDNA reporter gene
were analyzed by Northern blot. Overexpression of SIRT7 stimulated transcription of the
reporter gene up to six-fold over basal levels in a dose-dependent manner (Fig. 3A). A
comparable activation of Pol I transcription was also observed in human U2OS cells and
mouse 3T3 fibroblasts that were overexpressing SIRT7 (data not shown).
This
stimulation was Pol I-specific, since overexpression of SIRT7 did not activate
transcription of a Pol II-driven luciferase reporter gene (data not shown). These results
demonstrate that SIRT7 specifically increases transcription by Pol I in vivo.
To gain further evidence that SIRT7 functions in transcriptional activation, cells
were depleted of SIRT7 by RNA interference (RNAi).
Western blots from cells
transfected with anti-SIRT7 small inhibitory RNAs (siRNAs) showed that SIRT7, but not
actin protein levels were efficiently decreased by anti-SIRT7 siRNAs (Fig. 3B left). PrerRNA levels were measured using RT-PCR and pairs of primers that amplify part of the
5' external transcribed spacer of the pre-rRNA. Downregulation of SIRT7 by specific
217
siRNAs resulted in significant reduction of pre-rRNA synthesis, whereas expression of
GAPDH was not affected (Fig. 3B right). These results indicate that depletion of SIRT7
reduces cellular rRNA synthesis and substantiate the claim that SIRT7 is a positive
regulator of Pol I transcription.
To determine whether activation of Pol I transcription by SIRT7 is functionally
linked to the enzymatic activities of sirtuins, we generated point mutants, replacing serine
112 with alanine and histidine 188 with tyrosine (fig. S1). These residues within the
catalytic domain are invariant among sirtuins. Moreover, the homologous mutations
have been shown to be required for enzymatic activity in SIRT1 and yeast Sir2 (Frye,
1999; Liszt et al., 2005; Vaziri et al., 2001).
Wild-type and mutant proteins were
transiently expressed in human 293T cells, and 45S pre-rRNA levels were analyzed on
Northern blots. Notably, a two- to three-fold increase of the level of pre-rRNA was
observed in cells expressing wild-type FLAG-SIRT7, but not in cells overexpressing
88 Y (Fig. 3C). Both mutant proteins were correctly localized to the
SIRT7Sll2A or SIRT7Hl
nucleolus (Fig 3D). These findings indicate that an NAD+-dependent enzymatic activity
of SIRT7 is required for transcriptional activation but not for nucleolar localization.
In addition, pre-rRNA levels were determined in cells treated with nicotinamide,
which is a potent inhibitor of sirtuins. As expected, treatment of NIH3T3 cells with 5
mM nicotinamide strongly inhibited pre-rRNA synthesis (Fig. 3E). In contrast, TSA, an
inhibitor of class I and II HDACs, did not affect the level of pre-rRNA synthesis,
suggesting that SIRT7, but not the class I and II HDACs, supports Pol I transcription in
vivo. Inhibition by nicotinamide is not due to cellular redistribution of SIRT7, since the
localizatioin of GFP-SIRT7 is not altered in the presence or absence of nicotinamide (Fig.
218
3F). In contrast, addition of actinomycin D at a concentration that selectively inhibits Pol
I transcription released GFP-SIRT7 from the nucleoli resulting in redistribution
throughout the nucleus. These results suggest that nucleolar localization of SIRT7 is
tightly linked to ongoing Pol I transcription.
Based on the observation that SIRT7 is (i) bound to rDNA, (ii) interacts with Pol
I, and (iii) stimulates Pol I transcription, we asked whether SIRT7 changes the occupancy
of Pol I at the rDNA. To investigate this, we performed ChIP using anti-RPA 16
antibodies and cell lines stably expressing FLAG-SIRT7 wild-type or mutant proteins.
Western blot analysis demonstrated equivalent overexpression of SIRT7Wt,SIRT7s t2 A,
88 Y (Fig. 4A). Both input chromatin and chromatin precipitated with antiand SIRT7Hl
RPA116 antibodies were used as template for PCR with primers corresponding to the
rDNA promoter (HO), coding region (H1 and H13), and IGS (H23/H27). Notably, the
amount of rDNA precipitated with Pol I-specific antibodies was significantly higher in
SIRT7-overexpressing cells when compared to control cells that had been transfected
with the empty vector (Fig. 4B). However, when cell lines overexpressing the SIRT7
point mutants S 112Aand H188Y were analyzed, the levels of precipitated rDNA was
similar to that of the empty vector (Fig. 4B). When a primer pair to the IGS was used, a
region in which Pol I is not bound, the background ChIP signal was identical in all four
cell lines, demonstrating that the differences between the cell lines seen with primer pairs
HO, H1, and H13 is not due to variations in the preparation of the chromatin. These data
demonstrate that overexpression of SIRT7 increases the amount of Pol I at the rDNA. In
addition, enhancement of association of Pol I with the rDNA requires conserved residues
within the catalytic domain of SIRT7.
219
In a converse experiment, we analyzed the association of Pol I with rDNA in cells
transfected with nonspecific or SIRT7-specific siRNAs.
Western blot analysis
demonstrated significant reduction of SIRT7 protein levels by SIRT7-specific siRNA,
whereas the levels of actin were the unaffected (Fig. 4C). Crosslinked chromatin was
precipitated from cells treated with nonspecific and SIRT7-specific siRNAs using antiRPA116 antibodies, and quantified by PCR with the rDNA-specific primer sets H0, H1,
H13, and H23/H27. Anti-RPA1 16 antibodies precipitated significantly less rDNA from
cells treated with anti-SIRT7 siRNAs compared to cells treated with nonspecific siRNAs
(Fig. 4D). This demonstrates that reduction of cellular SIRT7 protein levels by RNAi
concomitantly reduced the amount of Pol I associated with rDNA. These results are in
agreement with our observation that SIRT7 is critical for activation of Pol I transcription.
Here, we establish that SIRT7 is an activating component of the RNA polymerase
I transcriptional machinery. SIRT7 strongly stimulates Pol I transcription in vivo by an
enzymatic mechanism. Importantly, these data suggest a novel mechanism by which
mammalian cells may regulate rRNA transcription.
In yeast, a change in the
NAD+/NADH ratio translates the metabolic shift of calorie restriction into lifespan
extension via Sir2p (Lin et al., 2004). Such a model is also believed to explain the
regulation of SIRT1 in liver and muscle cells, where changes in the NAD+/NADHratio
can arise from diet or exercise and influence SIRT1 activity (Fulco et al., 2003; Rodgers
et al., 2005). This paradigm suggests that diet-induced changes in the NAD+/NADH
ratio may regulate SIRT7 to couple changing energy status with levels of rRNA
transcription and ribosome production.
220
Sir2 homologs positively regulate longevity in yeast, worms, and flies despite
extraordinary phylogenetic distance between these organisms (Hekimi and Guarente,
2003). In yeast, Sir2p promotes longevity predominantly through its silencing role at the
rDNA (Kaeberlein et al., 1999; Sinclair and Guarente, 1997). It is interesting that the
effect of sirtuins at the rDNA has been inverted in mammals. SIRT7 activates RNA
polymerase I transcription, which is typically proportional to the requirement for cell
growth. We suspect that a link between SIRT7 and growth may be part of a larger set of
physiological changes involving all seven sirtuins that is induced by diet.
221
MATERIALS AND METHODS
Plasmid constructs, antibodies and antibody production
The human SIRT7 cDNA was purchased from ATCC (IMAGE 222518), amplified by PCR, and
cloned into pCMV-Tag4a (Stratagene) cut with EcoRI and XhoI to make the plasmid pCMVFLAG-SIRT7.
The plasmid pCMV-FLAG-SIRT7 served as template for site directed
mutagenesis using the Stratagene Quick Change mutagenesis kit to produce the plasmids pCMVFLAG-SIRT7sl 12A and pCMV-FLAG-SIRT7Hl 88Y. pEGFP-SIRT7 was constructed by amplifying
the SIRT7 coding sequence by PCR and cloning it into the EcoRI and BamHI sites of pEGFP-N1
(Clontech).
pET-GST-SIRT7 was created by cloning the SIRT7 coding sequence into the NheI
and BamHI sites of the vector pET-GST (kind gift from R. Marciniak, University of Texas, San
Antonio). To generate TAP-tagged SIRT7, the stop codon of the SIRT7 cDNA was removed by
site directed mutagenesis and substituted by a BglII site, and the coding sequence was cloned into
the Bam HI site of the vector pZome-lC (Cellzome).
The N-terminal 81 amino acids of mouse SIRT7 were expressed in E. coli as a
glutathione S-transferase (GST)-fusion and purified over a glutathione-Sepharose column. The
purified protein was injected into NZW rabbits by Covance Bioproducts to create SIRT7
antiserum.
Full-length SIRT7 and SIRT7(1-81) proteins were bound to NHS-Sepharose
according to manufacturer instructions (Amersham).
The crude serum was first passed over the
SIRT7(1-81)-NHS-Sepharose resin. The resin was washed extensively. The purified antibody
was eluted with 0.1 M glycine, pH 2.5, and the pH was neutralized by the addition of 1/104
volume of 1 M Hepes, pH 7.9. The process was repeated a second time using the full-length
SIRT7-NHS-Sepharose resin.
Other antibodies used were anti-actin C4 (ICN), anti-Flag M2 (Sigma), anti-acetylated
histone H4 (Upstate), and anti-histone H4 (Upstate), a purified rabbit polyclonal antibody against
RPA-116, and human autoimmune serum against the largest subunit of Pol I (provided by U.
Scheer, University of Wuerzburg).
Multiple tissue Northern and Western blots
A hybridization probe containing the SIRT7 open reading frame was created using the Prime-It
Random Primer Labeling kit (Stratagene) and was used to probe Multiple Tissue Northern Blots
(Stratagene) according to the manufacturer's instructions. The blots were then stripped and
reprobed with the actin probe included in the kit.
222
Homogenized mouse tissues from two mice of the FVB genetic background were obtained as a
generous gift from L. Bordone, MIT. From these samples, SDS-solubilized proteins were
prepared, separated by SDS-PAGE, and analyzed by Western blotting.
Cell culture, transfections and RNA analysis
293T, U2OS and NIH3T3 cells were cultured in DMEM supplemented with 10% FCS. Where
indicated cells were treated with 0.050 yg/ml actinomycin D, 5 mM nicotinamide, or 40 nM TSA.
For transient expression, 293T or U2OS cells were transfected in 60 mm dishes with the calcium
phosphate precipitation technique using different amounts of pCMV-SIRT7 plasmids and 2 ug
rDNA reporter plasmid pHr-P-BH, which contains a fragment from -401 to +378 (+1,
transcription start site) of the human rDNA repeat fused to a BamHI-Hinfl
fragment
encompassing the transcription termination sites T1 and T2. Reporter transcripts were analyzed
on Northern blots as described (Voit et al., 1999). To analyze pre-rRNA synthesis, cellular RNA
was isolated and subjected to Northern blot analysis using a
32 P-labeled antisense
RNA
encompassing the 5'-terminal rDNA sequences from -57 to +183. To normalize for gel loading,
the blots were reprobed with radiolabeled riboprobes against cytochrome c oxidase 1 (cox 1).
For stable expression of TAP-tagged SIRT7, U2OS cells were transfected with
pZome-SIRT7 or pZome alone followed by selection with 2 g/ml of puromycin. Similarly, for
stable expression of FLAG-tagged SIRT7 cell lines, 293T cells were transfected with pCMVTAG-4a (Stratagene), pCMV-FLAG-SIRT7, pCMV-FLAG-SIRT7sl 2A, or pCMV-FLAG88 Y in combination with pBABE-PURO at a 10:1 ratio and selected with 2 mg/ml
SIRT7Hl
puromycin.
Immunofluorescence
U2OS cells were fixed with paraformaldehyde
as described before (Zatsepina et al., 1993) and
stained with purified anti-SIRT7 antibodies, anti-Pol I antibodies, anti-rabbit Alexa-488
antibodies (MoBiTec), anti-human Cy3 antibodies (Dianova), and Hoechst 33342. Images were
visualized using a Zeiss Axiophot microscope.
Localization of GFP-tagged proteins was visualized with a Nikon miscroscope in live cells that
had been treated with the dye Hoechst 33342.
Immunoprecipitations
One 10 cm plate of 293T cells stably transfected with pCMV-Tag4a and pCMV-FLAG-SIRT7
was resuspended in 1 ml NP-40 lysis buffer (50 mM Tris-HC1, pH 8.0, 150 mM NaC1, 1% NP-
223
40) and transferred to a 1.5 ml tube. The lysis reaction was allowed to proceed for 30 min on ice
and centrifuged for 15 min at 14,000 rpm. 10 ul of FLAG(M2)-protein A-Sepharose beads were
added to the lysates and incubated for 1 hr. After extensive washing the beads were boiled in SDS
loading buffer and the eluted proteins were analyzed by SDS-PAGE and Western blotting.
Chromatin immunoprecipitations
Chromatin immunoprecipitation (ChIP) experiments were performed essentially as described
(Weinmann et al., 2001) with a few modifications.
For each ChIP, one 15 cm plate of 293T cells
was grown to 75% confluency.
was added directly to the media to a final
Formaldehyde
concentration of 1% and incubated for 10 min at room temperature.
The reaction was stopped by
adding glycine to a final concentration of 0.125 M for 5 min. Cells were washed twice with cold
PBS, incubated with 2 ml of 2.5% trypsin at 37 ° C for 10 min, harvested with 10 ml of PBS plus
Complete Protease Inhibitors (Roche), and washed twice with PBS plus protease inhibitors. The
final cell pellet was resuspended in cell lysis buffer (5 mM HEPES pH 8.0, 85 mM KCl, 0.5%
NP-40, and protease inhibitors), incubated on ice for 5 min, and centrifuged at 5,000 rpm in a
microfuge for 10 min. The pellet was resuspended in nuclei lysis buffer (50 mM Tris-Cl pH 8.1,
10 mM EDTA, 1% SDS, and protease inhibitors) and incubated on ice for 10 min. The chromatin
was sonicated to an average length of approximately 500 bp as visualized by ethidium bromide
agarose gel electrophoresis. The resulting chromatin was cleared of insoluble material by
spinning at 14,000 rpm for 15 min in a microfuge and diluted 5-fold in IP dilution buffer (0.01%
SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-Cl pH 8.1, 167 mM NaCl). Chromatin
was pre-cleared by adding 80 ,pulof salmon sperm DNA/BSA/protein-A
slurry (0.4 mg/ml salmon
sperm DNA, 1 mg/ml BSA, 10 mM Tris-Cl pH 8.0, 1 mM EDTA, 50% protein A sepharose
beads).
In separate 1.5 ml tubes, antibody beads were prepared by incubating 10 1 of specific
antibodies with protein-A Sephaorse in 500 ml IP dilution buffer plus 50 mg/ml BSA and 0.4
mg/ml ssDNA.
After 1 hour the supernatant was removed from the antibody beads. The pre-
cleared chromatin was added and incubated for 3 hours at 4° C. The beads were washed two
times with each of the following buffers: low salt wash buffer (0.1% SDS, 1% Triton X-100, 2
mM EDTA, 20 mM Tris-Cl pH 8.1, 150 mM NaCl), high salt wash buffer (0.1% SDS, 1% Triton
X-100, 2 mM EDTA, 20 mM Tris-Cl pH 8.1, 500 mM NaCl), LiCl wash buffer (1% deoxycholic
acid, 1% NP-40, 1 mM EDTA, 10 mM Tris-Cl pH 8.0, 250 mM LiCl), and TE. After the last
wash the chromatin was eluted from the beads by incubating twice for 15 minutes with 150 p IP
elution buffer (100 mM NaHCO3, 1% SDS). Formaldehyde crosslinking was reversed by
incubating at 65 ° C for 4 hours in the presence of 0.3 M NaCl and 0.1 mg/ml RNase A. DNA was
224
ethanol precipitated and resuspended in 100 pl of H 20. 2
6.5, and 1.5
l 0.5 M EDTA, 4
l 1 M Tris-Cl pH
l of 20 mg/ml Proteinase K were added and incubated for 2 hours at 45 ° C.
Samples were extracted with phenol/chloroform/isoamyl
alcohol and ethanol precipitated.
were washed with 70% ethanol, dried and resuspended in 30
0.1 mM EDTA).
Pellets
l TE/10 (10 mM Tris-Cl pH 7.5,
Increasing amounts of precipitated chromatin was used as template in
quantitative PCR reactions as previously described (O'Sullivan et al., 2002).
Purification of proteins and protein-protein interactions
GST and recombinant GST-tagged SIRT7 were expressed in E. coli Codon Plus-RP cells
(Stratagene) and affinity purified over glutathione-Sepharose according to standard protocols.
Acetylated core histones were purified from butyric acid treated HeLa cells by hydroxylapatite
chromatography essentially as described (Ausubel et al., 1997). To assay for interaction of
SIRT7 and histones, GST and GST-SIRT7 were immobilized on glutathione-Sepharose and
incubated with 2 pg of purified core histones for 2 h at 4° C in buffer AM-400 (400 mM KCl, 20
mM Tris-Cl pH 7.9, 5 mM MgCl 2 , 0.1 mM EDTA, 10% glycerol, 0.5 mM EDTA) supplemented
with 0.2% NP-40 and protease inhibitors. After five washes in incubation buffer, bound proteins
were eluted with SDS-loading buffer, separated on 15% polyacrylamide gels by SDS-PAGE, and
visualized by staining with Coomassie.
U2OS cells stably transfected with pZome or pZome-SIRT7 were grown on ten
150 mm dishes to 80% confluency.
Cells were harvested in buffer A (10 mM Hepes pH 7.9, 1.5
mM MgCl 2, 10 mM KCl, 0.5 mM DTT, protease inhibitors), incubated for 15 min at 4 ° C, and
the nuclei pelleted by centrifugation.
The nuclei were resuspended in buffer C (20 mM Hepes pH
7.9, 420 mM NaCl, 1.5 mM MgCl2, 25% glycerol, 0.2 mM EDTA, protease inhibitors),
homogenized, and incubated at 4° C for 30 min.
The lysate was cleared by centrifugation at
13000 rpm for 30 min at 4 ° C, and the extract was dialysed against buffer AM-100 (100 mM
KCl, 20 mM Tris-Cl pH 7.9, 5 mM MgCl 2, 0.1 mM EDTA, 10% glycerol, 0.5 mM EDTA, 0.5
mM PMSF). Batch purification of the IgG binding domain-tagged proteins was performed using
300 l of IgG-Sepharose 6 Fast Low resin (Amersham Biosciences). The protein was eluted
from the beads by washing three times in TEV-cleavage buffer (25 mM Tris-Cl pH 8.0, 150 mM
NaCl, 0.1% NP-40, 0.5 mM EDTA, 1 mM DTT) and rotating over night at 4° C in TEV-cleavage
buffer containing 50 units AcTEV protease (Invitrogen). Supernatants from the TEV-cleavage
reaction containing SIRT7 and interacting proteins were collected and substituted with CaCl2
(final concentration 2 mM) and 3 volumes of calmodulin binding buffer (25 mM Tris-Cl pH 8.0,
150 mM NaCl,
1 mM magnesium
acetate,
1 mM imidazol,
225
2 mM CaCl 2, 10 mM B-
mercaptoethanol, 0.1% NP-40). The proteins were batch-purified with 200 Pl of calmodulin
beads (Stratagene) under rotation for 2 h at 4 C. The beads were washed three times in
calmodulin binding buffer, transferred into a column and bound proteins eluted with calmodulin
elution buffer (25 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM magnesium acetate, 1 mM imidazol,
20 mM EGTA, 10 mM B-mercaptoethanol, 0.02% NP-40).
RNAi experiments
To knock-down cellular SIRT7 by RNAi, dsRNAs were synthesized as a custom "Smart Pool"
against SIRT7 and "non-specific control duplexes - XIII" (Dharmacon).
To determine the effect
of these siRNAs on pre-rRNA levels, the duplexes were transfected into U2OS cells using
RNAifect (Qiagen). After incubation for 48 h, cells were harvested and lysed with SDS loading
buffer for Western blot analysis or with GITC for isolation of cellular RNA. Cellular RNA was
reverse transcribed
with random primers.
The amount of pre-rRNA determined by
32
semiquantitative PCR in the presence of a- P-dCTP with primer 1 (forward) 5'-GCT GTC CTC
TGG C-3' and primer 2 (reverse) 5'-CGG CAG GCG GCT CAA G-3' that amplify a fragment
from +9 to +120 of the external transcribed spacer of the human rDNA repeat. Radiolabeled PCR
fragments were analyzed on 8% polyacrylamide gels and quantified using a Phosphorimager.
GAPDH-cDNA was amplified by PCR using the primers 5'-CCA TCA CCA TCT TCC AGG
AG-3' and 5'-CCT GCT TCA CCA CCT TCT TG-3'.
293T cells for ChIP assays were transfected with the above siRNAs using Oligofectamine
(Invitrogen) according to the manufacturer's instructions. 48 hours post-transfection the cells
were transfected a second time and 48 hours after the second transfection the cells were harvested
for ChIP experiments as described above.
226
REFERENCES
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl,
K. (1997). Current Protocols in Molecular Biology (New York: John Wiley and Sons).
Blander, G., and Guarente, L. (2004). The Sir2 family of protein deacetylases. Annu Rev
Biochem 73,417-435.
Brunet, A., Sweeney, L. B., Sturgill, J. F., Chua, K. F., Greer, P. L., Lin, Y., Tran, H., Ross, S. E.,
Mostoslavsky, R., Cohen, H. Y., et al. (2004). Stress-dependent regulation of FOXO transcription
factors by the SIRT1 deacetylase. Science 303, 2011-2015.
Budde, A., and Grummt, I. (1999). p53 represses ribosomal gene transcription. Oncogene 18,
1119-1124.
Cavanaugh, A. H., Hempel, W. M., Taylor, L. J., Rogalsky, V., Todorov, G., and Rothblum, L. I.
(1995). Activity of RNA polymerase I transcription factor UBF blocked by Rb gene product.
Nature 374, 177-180.
Frye, R. A. (1999). Characterization of five human cDNAs with homology to the yeast SIR2
gene: Sir2-like proteins (sirtuins) metabolize NAD and may have protein ADP-ribosyltransferase
activity. Biochem Biophys Res Commun 260, 273-279.
Frye, R. A. (2000). Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins.
Biochem Biophys Res Commun 273, 793-798.
Fulco, M., Schiltz, R. L., Iezzi, S., King, M. T., Zhao, P., Kashiwaya, Y., Hoffman, E., Veech, R.
L., and Sartorelli, V. (2003). Sir2 regulates skeletal muscle differentiation as a potential sensor of
the redox state. Mol Cell 12, 51-62.
Grummt, I. (1999). Regulation of mammalian ribosomal gene transcription by RNA polymerase
I. Prog Nucleic Acid Res Mol Biol 62, 109-154.
Grummt, I. (2003). Life on a planet of its own: regulation of RNA polymerase I transcription in
the nucleolus. Genes Dev 17, 1691-1702.
Hekimi, S., and Guarente, L. (2003). Genetics and the specificity of the aging process. Science
299, 1351-1354.
Kaeberlein, M., McVey, M., and Guarente, L. (1999). The SIR2/3/4 complex and SIR2 alone
promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev 13,
2570-2580.
Lin, S. J., Ford, E., Haigis, M., Liszt, G., and Guarente, L. (2004). Calorie restriction extends
yeast life span by lowering the level of NADH. Genes Dev 18, 12-16.
227
Liszt, G., Ford, E., Kurtev, M., and Guarente, L. (2005). Mouse Sir2 homolog SIRT6 is a nuclear
ADP-ribosyltransferase. J Biol Chem.
Luo, J., Nikolaev, A. Y., Imai, S., Chen, D., Su, F., Shiloh, A., Guarente, L., and Gu, W. (2001).
Negative control of p53 by Sir2alpha promotes cell survival under stress. Cell 107, 137-148.
Motta, M. C., Divecha, N., Lemieux, M., Kamel, C., Chen, D., Gu, W., Bultsma, Y., McBurney,
M., and Guarente, L. (2004). Mammalian SIRT1 represses forkhead transcription factors. Cell
116, 551-563.
North, B. J., Marshall, B. L., Borra, M. T., Denu, J. M., and Verdin, E. (2003). The human Sir2
ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Mol Cell 11,437-444.
O'Sullivan, A. C., Sullivan, G. J., and McStay, B. (2002). UBF binding in vivo is not restricted to
regulatory sequences within the vertebrate ribosomal DNA repeat. Mol Cell Biol 22, 657-668.
Onyango, P., Celic, I., McCaffery, J. M., Boeke, J. D., and Feinberg, A. P. (2002). SIRT3, a
human SIR2 homologue, is an NAD-dependent deacetylase localized to mitochondria. Proc Natl
Acad Sci U S A 99, 13653-13658.
Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., Machado De Oliveira, R.,
Leid, M., McBurney, M. W., and Guarente, L. (2004). Sirtl promotes fat mobilization in white
adipocytes by repressing PPAR-gamma. Nature 429, 771-776.
Rodgers, J. T., Lerin, C., Haas, W., Gygi, S. P., Spiegelman, B. M., and Puigserver, P. (2005).
Nutrient control of glucose homeostasis through a complex of PGC- lalpha and SIRT . Nature
434, 113-118.
Sinclair, D. A., and Guarente, L. (1997). Extrachromosomal rDNA circles--a cause of aging in
yeast. Cell 91, 1033-1042.
Vaziri, H., Dessain, S. K., Ng Eaton, E., Imai, S. I., Frye, R. A., Pandita, T. K., Guarente, L., and
Weinberg, R. A. (2001). hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell
107, 149-159.
Voit, R., Hoffmann, M., and Grummt, I. (1999). Phosphorylation by GI-specific cdk-cyclin
complexes activates the nucleolar transcription factor UBF. Embo J 18, 1891-1899.
Voit, R., Schafer, K., and Grummt, I. (1997). Mechanism of repression of RNA polymerase I
transcription by the retinoblastoma protein. Mol Cell Biol 17, 4230-4237.
Weinmann, A. S., Bartley, S. M., Zhang,T., Zhang, M. Q., and Farnham, P. J. (2001). Use of
chromatin immunoprecipitation to clone novel E2F target promoters. Mol Cell Biol 21, 68206832.
228
Yeung, F., Hoberg, J. E., Ramsey, C. S., Keller, M. D., Jones, D. R., Frye, R. A., and Mayo, M.
W. (2004). Modulation of NF-kappaB-dependent transcription and cell survival by the SIRTI1
deacetylase. Embo J 23, 2369-2380.
Zatsepina, O. V., Voit, R., Grummt, I., Spring, H., Semenov, M. V., and Trendelenburg, M. F.
(1993). The RNA polymerase I-specific transcription initiation factor UBF is associated with
transcriptionally active and inactive ribosomal genes. Chromosoma 102, 599-611.
Zhai, W., and Comai, L. (2000). Repression of RNA polymerase I transcription by the tumor
suppressor p53. Mol Cell Biol 20, 5930-5938.
Zhao, J., Yuan, X., Frodin, M., and Grummt, I. (2003). ERK-dependent phosphorylation of the
transcription initiation factor TIF-IA is required for RNA polymerase I transcription and cell
growth. Mol Cell 11, 405-413.
Acknowledgements
The authors thank Marcia Haigis, and Gil Blander for thoughtful discussion and careful
reading of the manuscript. LG and EF are supported by NIH grants.
229
FIGURES
Fig. 1. SIRT7 is a nucleolar protein. (A) SIRT7 is a nuclear component of mammalian
cells. 20 mg cytoplasmic and nuclear extracts from NIH-3T3 and U2OS cells were
subjected to Western blot analysis with anti-SIRT7 antibodies. (B) RNA was isolated
from the indicated tissues (left panels) and embryos (right panels) in wild-type adult
mice, resolved by electrophoresis, and subjected to Northern blotting. Blots were probed
with
32
-labeled cDNA specific to SIRT7 (top panels) or actin (lower panels). Muscle
actin found in heart and skeletal muscle samples migrated as a distinct band. (C) Protein
extracts from the indicated wild-type mouse tissues were resolved by SDS-PAGE, and
analyzed by Western blotting using antibodies specific to SIRT7 (top panel) or actin
(lower panel). For each tissue type, samples from two different mice were included. (D)
Nucleolar localization of GFP-SIRT7 in live human U2OS cells. (E) Endogenous SIRT7
and Pol I were visualized by immunofluorescence
microscopy in U2OS cells using anti-
SIRT7 (green) and anti-Pol I antibodies (red). The DNA was counter-stained with
Hoechst 33342. (F) During mitosis SIRT7 is associated with condensed chromatin.
SIRT7-GFP was visualized in live U2OS cells stained with Hoechst 33342.
230
A
Celllysates
NIH 3T3
w
z
()
HeLa
w
()
mSIAT?
z
actin
- ...
-.-
2
3
4
6
GFP-SIAT?
•
8
9
10
11
13
SIAT7
C
.... ----
actin
1-1
D
7
2
---,-
3
4
R
5
6
__
V
~
7
8
9
.-...
_
"!",...I
IIJ" _I
mS IAT?
actin
10 11 13 14 15 16 17
phase
F
me~~hase
anaphase
._
1111
Figure 1
Fig. 2. SIRT7 is associated with the rDNA and RNA polymerase I.
(A) Diagram depicting the location of the primer pairs used: (H0) promoter, (H1) 5'
external transcribed spacer, (H13) end of 28S rRNA, and (H23/H27) intergenic region of
the human rDNA gene. (B) Results of ChIP analysis showing the localization of SIRT7
and RNA pol I within transcribed region of the rDNA gene repeats. Chromatin from
293T cells was precipitated by the indicated antibodies and analyzed by PCR with the
indicated primer pairs. (C) Coimmunoprecipitation of SIRT7 and RNA polymerase I
(RPA116). Anti-FLAG immunoprecipitations were performed from whole cell extracts
prepared from 293T cells harbouring empty vector (pCMV) or a plasmid expressing
FLAG-tagged SIRT7 (pCMV-SIRT7-FLAG). Immunoprecipitates were analyzed by
Western blot as indicated. (D) Pol I is a component of the SIRT7-TAP complex. U2OS
cell lines harboring the empty vector or SIRT7-TAP were established. TAP-tagged
complexes were purified on IgG and Calmodulin resins, and the eluted protein complexes
tested for copurifying proteins by Western blot analysis. Lane 1, 50 /g of cell extract;
lane 2, eluate from mock transfected cells; lane 3, eluate from a cell line expressing
SIRT7-TAP. The Western blot was probed with an antibody specific for RPA116. (E)
Endogenous SIRT7 interacts with RNA polymerase I. Partially purified human nuclear
extract was immunoprecipitated with control non-specific human antibodies (lane 2) and
anti-RNA polymerase I antibodies (lane 3). The precipitated proteins were analyzed by
western blotting with anti-SIRT7 and anti-RPA-1 16 antibodies as indicated. (F) SIRT7
interacts with histones. Histones were isolated from butyric acid treated HeLa cells by
ion exchange chromatography incubated with GST-SIRT7-Sepharose
and GST-
Sepharose beads. The proteins were eluted and separated by SDS-PAGE and visualized
by staining with Coomassie.
232
A
18S
POETS
28S
5.8S
•
3'ETS
IGS
/;--
I
H23/H27
H13
HOH1
H23/H27
B
HO
a-SIRT711
5 II I
5I
IgG
I
I
HI
IgG
I
I
H13
a-SIRT711
IgG
a-SIRT71
5 II I
5 I I I
5 II I
5
~JW
I
II
'
~3'1"l~'1[1<s;F'
.... ~
H23/H27
Oligo Pair
IgG
a-SIRT71 I.P.
I
5 II I
5 I ~I Input
,~'~'~Y"":~
'!it~~k*~~",,, <._
~*\m:~~~~ J'L~'.<=i~~N«~
""il/"
>
"<
HO
IgG
5
I I
II
HI
a-Poll I I
IgG
I
5I I 1
5
II
J
..'.~'"
~~~~
~;.
""'$
f::.._:aYIi;o.;~
+\,~~
SIRTl
H13
H23/H27
Oligo Pair
a-Poll II
IgG
a-Pol II I IgG
a-Poll I I.P.
'
1
5 I I 1
5 II 1 5 II 1
5 II 1
5 I ~I Input
Poll
HO
IgG
5
I I
II
HI
a-H4 II
IgG
1
5I I I
5
II
Hl3
H23/H27
Oligo Pair
a-H4
II
IgG
a-H4 I I IgG
a-H4 I I.P.
1
5 I I 1
5 II I
5 II I
5 II I
5 I ~I Input
Histone H4
2
4
3
C
5% Input
I
(!)II
a.
10
2Q)
0
13
!!;
~0
en
c:i.
E
~
0
()
:>
:E
a.
a.
-
..
1
U
_
-
16
17
<5
a..
6
(!)
S?
- .-
en
~
15
'5
a.
E
!!;
U
14
E
~
Q)
Cti
11
~
>
a.
D
(/)
:>
:E
9
8
~~
LL
a:
U5
U
7
(!)I
~
:E
6
aFLAG
I.P.
~~
U.
>
5
-
RPA116
_
...
2
a-RPA-116
a-SIRT7
3
RPA116~,k
.....
en
-SIRT7
2
3
(!)
/H3
-H2A1B
4
-H4
2
3
2
3
Figure 2
Fig. 3. SIRT7 is an activator of Pol I transcription. (A) Overexpression of SIRT7
stimulates Pol I transcription from an rDNA minigene reporter. 293T cells were cotransfected with a Pol I reporter plasmid and increasing amounts of an expression
plasmid encoding SIRT7-Flag. RNA was isolated from transfected cells. The amount of
reporter transcripts was determined by Northern blot analysis and quantified using a
PhosphorImager. Bottom panel: Western blot of the transfected cells probed with antiFlag antibody. (B) Knock-down of SIRT7 by RNAi impairs rRNA synthesis. Left panel:
Western blot of extracts from U2OS cells transfected with control-dsRNA (lane 1) or
SIRT7-specific dsRNA (lane 2). Right panel: Pol I transcription was analyzed by RTPCR. RNA was isolated from cells treated with the respective dsRNAs. Increasing
amounts of cDNA were used for PCR with primers that amplify a region of the 5'
external transcribed spacer of the human pre-rRNA. Results from two independent
experiments (lanes 1,2,5,6 and 3,4,7,8, respectively) are shown. As a control, RT-PCR
was performed to analyze expression of GAPDH. (C) Stimulation of cellular Pol I
transcription by SIRT7 requires reisdues H188 and S112. Northern blot analysis of prerRNA transcripts from 293T cells transfected with different amounts of plasmids
expressing wild-type SIRT7 or the point mutants H188Y and S112A (top panel).
Expression levels of SIRT7-Flag, SIRT7/H188Y-Flag, and SIRT7/Sl12A-Flag were
monitored on Western blots using anti-Flag antibodies (bottom panel). (D) The SIRT7
mutants H188Y and S1 12A were expressed as GFP-tagged proteins in U2OS cells and
their cellular localization was examined in live cells. (E) Nicotinamide represses rRNA
synthesis. NIH3T3 cells were cultured for 6h in medium containing 40 nM TSA or 5 mM
nicotinamide, and pre-rRNA levels were measured by Northern blot analysis. The blot
was subsequently reprobed for cytochrome c oxidase (coxl) mRNA. (F) Treatment with
actinomycin D, but not with nicotinamide releases SIRT7-GFP from nucleoli. U2OS
cells expressing SIRT7-GFP were cultured in the presence of either 50 mg/ml of
actinomycin D for 2h to inhibit Pol I activity or 5 mM nicotinamide for 6h to inhibit
NAD+-dependent deacetylase activity. Localization of SIRT7-GFP was examined in live
cells.
234
A
B
- 0.5
Northern blot:
-
1
2
••
reporter transcript
2 5.9 6.5
EtBr: _ ..~.... :.....
' .'..' ..".•
"
WB a-Flag:
_
.,
c
WB:
28S rRNA
a-SIRT7
•
a-actin
••
Flag-Sirt?
3
4
.1
- 0.5 1 0.5 1 0.5
......
_
......
______
1
-
>'tII
"-"
.......
"'.
GAPDH
-
...... -
....
--
--
~ ~~
-2
2
pre-rRNA
28S rRNA
'"
pre-rRNA
I1g pCMV-Flag-Sirt?
lilIIIlW
EtBr:
"""
,"''''
-
- ..
3
4
5
6
?
8
D
WT H188Y S112A
Northern blot:
RT-PCR:
fold stimulation
18S rRNA
••
1 2
SIRT7-siRNA
control-siRNA
I1g pCMV-Flag-Sirt?
18S rRNA
~
••
Q)
en
cu
...
WB a-Flag:
2
3
4
Flag-Sirt?
.t:
C.
56?
E
Northern blot:
••
2
pre-rRNA
cox1
3
Figure 3
Fig. 4. SIRT7 stimulates the association of RNA Polymerase I with the rDNA
(A) Western blot showing overexpression levels of SIRT7. (B) Enrichment of RNA pol I
at the transcribed region of the rDNA genes in the presence of ectopic SIRT7. Chromatin
was prepared from cells harbouring empty vector (pCMV) or plasmids expressing wildtype SIRT7 (SIRT7-wt) and mutant SIRT7 (SIRT7-S112A and SIRT7 H188Y). The
chromatin was precipitated with anti-RPA1 16 antibodies and analyzed by PCR with the
primer pairs indicated on the right side of the figure. (C) Following siRNA transfections,
whole-cell lysates were analyzed by immunoblot for SIRT7 and B-actin. (D) ChIP
analysis of Pol I levels in cells transfected with siRNAs. Chromatin was prepared from
cells transfected with non-specific (ns) or anti-SIRT7 siRNA. The chromatin was
precipitated with anti-RPA1 16 antibodies and analyzed by PCR with the primer pairs
indicated on the right side of the figure
236
A
B
(\J
><Xl
U;
I
<{
.....
==
>
Input
SIRT7- SIRT7SI~T7- S112A H188Y
<Xl
.....
pCMV
----
~ ~ ~
a: a: c:
~
0
0..
U5 U5
5
1
5
5
1
1
5
anti-Poll
IgG
SIRT7- SIRT7pCMV
SI~T7-
---1
5
5
1
S112A
1
5
H188Y
1
5
SIRT7- SIRT7- SIRT7pCMV ~
S112A H188Y
5 1 5 1 5
5 JlI
Input
U5
HO
-SIRT7
2
3
4
H1
H13
H23/H27
4
2
c
D
<{
z
<{
z
5
6
7
8
9
10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
anti-Poll
Input
a:
"(jj
a:
"(jj
Jllinput
(/)
c
~:~ ..w'
-~
-
HO
SIRT7
-actin
H1
2
H13
H23/H27
2
3
4
5
6
7
8
9
10
11 12
Figure 4
SUPPORTING FIGURE
Fig. S1. Sequence alignment of mouse sirtuin core domains. Conserved core domains of
mouse SIRT1, SIRT4, SIRT5, and SIRT7 were aligned with the yeast Sir2 core using
ClustalW.
In the sirtuin phylogenetic tree, SIRT1 is class I, SIRT4 is class II, SIRT5 is
class III, and SIRT7 is class IV. At each position of the alignment, identical residues are
boxed and shaded in gray. Amino acids filled in black correspond to SIRT7 residues
targeted for mutagenesis in this study.
238
-I..
ySir2p
hSIRTI
hSIRT4
hSIRT5
hSIRTI
ySir2p
hSIRTI
hSIRT4
hSIRT5
hSIRTI
ySir2p
hSIRTI
hSIRT4
hSIRT5
hSIRT7
ySir2p
hSIRTI
hSIRT4
hSIRT5
hSIRTI
ySir2p
hSIRTI
hSIRT4
hSIRT5
hSIRTI
K V."
L
-
A.
G
N G V
-
-
-
1 K H L
GID
R L A V D F P D
P
R T D R R P 1 Q H G
-WRKWQAQDIIAT
- - - -WTLLQKGR
S
~~I~~~~
~~~11~~~~~~~~~~~1~~~
I -I'.. Fl'.
wi
R AS
-
-
-
--IIQ.M
-
- S
-FQ
1 Y S
Q F S S H Q
S KEN
- ,- L S EAE
P ,I R Q R Y WAR
N F V G
HN~SRVWEFYHYRREVMG
D - - - - - - -
SLC
L N PAW
A G
TLT
QV
- - S G'LYW---LV K L L R N Y
-K
A
T K
G
QtlJR
R V V V 1
HEQKLVQHVV
E
G
R K
T K N - -ilL.
L R
L P R TAl
; L I ....•K Y
:..........•....
.•
""'.:.::.
V TI ..••.....•.....
H W
\'. L D.
G E
.~. T S
.G I;'. T S '.. ' - -
K
N
Q
-
V D C E AI." . R
LII..........................•
G E R 1 F
T_
- R G .. L
- - - - -. '.' V
V
N R E Y
Ii-
G
N
Q
A
V
OliN
Q
K 1 .R. N L
E R . Q E N Y K R V
D -
II
S Y
-
-
-
-
-
IIR
R G
V A EFT
RRPKLYIV
RE DIK
IG
ETA
LQW
L
L
-
-
TWSAEAHBL_DVF
ALSGKGE R TAL
H R H Q TIII-
-
-
-
V
1
:I~
- T Q
-
-
-
- Y
-
-
-
PGT
- -
-
-
-
-
-
-
-
-
-
~I::::
DTV-
--N
~'--~
- A P V S EIV
N M V P
RPVAL
PSSIP
SGYRF
LTAWE
PAAMFAPQVAA
P R L W C M T K P P S
H A E -IDIISILIY
HLHDVE
RSDDLAC_K
T N RtliR
KDDWAA_K_H
1
S
Y C Y K K R R E Y F_
R C
I
V'L
QILI
IAIL
FATAT
FAT
A S
M D R V L
LFKTR
NMYI
EV
Q.. ~
,..•.
.•...N K F H K SIR
E OIL
C
.. EQFHRAMKYDKDV
DKVD-FVHKRVK
A
A I L E - E V D R E L A H C
I LNWE-AATEAASRA
S HIQ
HE
KKL
AL-K M - -.
A L S T Wi
RAilA
E C
MS
----
Q C
1 S T 0 KItIV
L
R
- L
1
V
E
-
KF
S
~
~
~
~
~.~I
..
DI Ell....•.
N
T
Kim. K L L R N Y
ySir2p
hSIRTI
hSIRT4
hSIRT5
hSIRTI
ySir2p
hSIRTI
hSIRT4
hSTRT5
hSIRTI
K -
D - . I
E
G.....•.•.
F
L
0
NSR
F H F Qlp
K
I A A M V A Q K C
I I N E L C H R L
L L P LID
P C
GTTLPEALACHEN
DVM
R L L MAE
L
I
W 526
G 495
314
III L
306
328
Figure 81
240
MITLibraries
Document Services
Room 14-0551
77 Massachusetts Avenue
Cambridge, MA 02139
Ph: 617.253.5668 Fax: 617.253.1690
Email: docs@mit.edu
http://libraries.mit.edu/docs
DISCLAIMER OF QUALITY
Due to the condition of the original material, there are unavoidable
flaws in this reproduction. We have made every effort possible to
provide you with the best copy available. If you are dissatisfied with
this product and find it unusable, please contact Document Services as
soon as possible.
Thank you.
Some pages in the original document contain
pictures or graphics that will not scan or reproduce well.